Original Article
Epidemics of Diarrhea Caused by a Clindamycin-Resistant Strain of Clostridium difficile in Four Hospitals
N Engl J Med 1999; 341:1645-1651November 25, 1999
- Abstract
Background
Large outbreaks of diarrhea caused by a newly recognized strain of Clostridium difficile occurred in four hospitals located in different parts of the United States between 1989 and 1992. Since frequent use of clindamycin was associated with the outbreak in one of the hospitals, we examined the resistance genes of the epidemic-strain isolates and studied the role of clindamycin use in these outbreaks.
Methods
Case–control studies were performed at three of the four hospitals to assess the relation of the use of clindamycin to C. difficile–associated diarrhea. All isolates of the epidemic strain and representative isolates of other strains identified during each outbreak were tested for susceptibility to clindamycin. Chromosomal DNA from these representative isolates was also analyzed by dot blot hybridization and amplification with the polymerase chain reaction (PCR) with the use of probes and primers from a previously described determinant of erythromycin resistance — the erythromycin ribosomal methylase B (ermB ) gene — found in C. perfringens and C. difficile.
Results
In a stratified analysis of the case–control studies with pooling of the results according to the Mantel–Haenszel method, we found that the use of clindamycin was significantly increased among patients with diarrhea due to the epidemic strain of C. difficile, as compared with patients whose diarrhea was due to nonepidemic strains (pooled odds ratio, 4.35; 95 percent confidence interval, 2.02 to 9.38; P<0.001). Exposure to other types of antibiotics or hospitalization in a surgical ward was not significantly associated with the risk of C. difficile–associated diarrhea due to the epidemic strain. All epidemic-strain isolates were highly resistant to clindamycin (minimal inhibitory concentration, >256 μg per milliliter). DNA hybridization and PCR analysis showed that all these isolates had an ermB gene, which encodes a 23S ribosomal RNA methylase that mediates resistance to macrolide, lincosamide, and streptogramin antibiotics. Only 15 percent of the nonepidemic strains were resistant to clindamycin.
Conclusions
A strain of C. difficile that is highly resistant to clindamycin was responsible for large outbreaks of diarrhea in four hospitals in different states. The use of clindamycin is a specific risk factor for diarrhea due to this strain. Resistance to clindamycin further increases the risk of C. difficile–associated diarrhea, an established complication of antimicrobial use.
Media in This Article
Figure 2
DNA Dot Blot Analysis of Strains of Clostridium difficile.Figure 1
Odds Ratio for the Use of Clindamycin before Becoming Ill among Patients with Diarrhea Due to the Epidemic Strain of Clostridium difficile as Compared with Patients with Diarrhea Due to Nonepidemic Strains.Article Activity
- Article
Since its etiologic role in pseudomembranous colitis was discovered 21 years ago,1 Clostridium difficile has been recognized as a major nosocomial pathogen throughout the world.2 A wide variety of strains are capable of causing disease,3,4 and outbreaks or epidemics of C. difficile–associated diarrhea are often linked to a single strain, but the relatedness of these strains among different institutions and geographic regions is not clear. A recent collaborative typing study demonstrated that a newly recognized strain of C. difficile was responsible for outbreaks of diarrhea in four hospitals in different parts of the United States that occurred between 1989 and 1992.5 We evaluated the association of diarrhea from this strain with the use of clindamycin, the resistance of this strain to clindamycin, and the genetic basis for resistance to clindamycin. Three of these outbreaks were reported previously as unrelated events,6-8 but we now know that the outbreaks were caused by one strain with an apparent propensity to cause epidemics.
Methods
Outbreaks of Diarrhea Associated with C. difficile Infection
The clinical aspects of the previously reported outbreaks in New York, Arizona, and Massachusetts6-8 and the outbreak in Florida are summarized in Table 1Table 1
Outbreaks of Diarrhea Associated with Clostridium difficile Infection in Four Hospitals.. Criteria for case definitions varied between investigations but were based on clinical symptoms of diarrhea and the detection of C. difficile cytotoxin in the stool of affected patients in each instance. In the Arizona outbreak diarrhea was defined as four or more loose or unformed stools in a period of 24 to 36 hours, but it was not defined on the basis of frequency or a specific period in the other outbreaks.New York
In 1989 there was an abrupt increase in cases of C. difficile–associated diarrhea in a 460-bed Veterans Affairs facility in upstate New York.6 The incidence of C. difficile–associated diarrhea during this period (20 per 1000 admissions) was 10 times as high as in the previous two years. The reason for the marked increase in the number of cases was not reported, but two case–control studies conducted early in the outbreak (from December 1988 to May 1989) identified antimicrobial therapy, particularly with second- and third-generation cephalosporins, as the chief risk factor. Criteria for the use of antimicrobial therapy were adopted by the hospital, but the epidemic continued at least through the spring of 1993.
Arizona
In July 1990 a Veterans Affairs facility in Arizona noted an abrupt increase in cases of C. difficile–associated diarrhea.7 The incidence of disease during this outbreak (15.8 per 1000 discharges) was five times as high as in the previous 21 months. However, three months after clindamycin was removed from the hospital formulary, the incidence decreased to rates documented before the outbreak.
Florida
A 786-bed community hospital in southwest Florida documented 106 cases of C. difficile–associated diarrhea between November 12, 1990, and January 28, 1991. The incidence during the outbreak was 19 per 1000 discharges, and it had decreased to 7 per 1000 discharges by March 1991. At the time, this decrease was attributed to a change in housekeeping procedures.
Massachusetts
A 431-bed tertiary-care teaching hospital in a large city in eastern Massachusetts documented 98 cases of C. difficile–associated diarrhea between June and December 1992.8 The overall incidence during this period (16 per 1000 discharges) was unchanged from the previous year, but focal outbreaks were recognized on two hospital wards over a two-month period. These focal outbreaks resolved without specific intervention.
Identification of Strains Associated with the Outbreaks
Isolates from all four outbreaks were systematically compared by three methods5: restriction-endonuclease analysis of whole-cell DNA with the use of HindIII,7,8 a polymerase-chain-reaction (PCR) assay with the use of arbitrary primers,9 and pulsed-field gel electrophoresis with SmaI restriction-enzyme analysis.8 The predominant, epidemic-associated strain at each hospital was either a single strain (on the basis of PCR analysis) or two highly related types (J7 and J9) that were only distinguished by one HindIII-derived genomic fragment on the basis of restriction-endonuclease analysis.5 Type J7 isolates were recovered only from the Arizona outbreak. Since this difference between J7 and J9 was most likely the result of a single genetic event,10 these strains were determined to be part of a single genetic lineage,5 which we refer to as the epidemic strain.
The epidemic strain accounted for 66 percent of isolates (27 of 41) typed at the New York hospital,9 52 percent of isolates (33 of 63) at the Arizona hospital,7 33 percent of isolates (6 of 18) at the Florida hospital (unpublished data), and 33 percent of isolates (30 of 90) at the Massachusetts hospital.8 During the two-month outbreak in the medical and surgical wards at the Massachusetts hospital, the epidemic strain accounted for 62 percent of the isolates (16 of 26).
Patients
Investigators at three of the hospitals reviewed data bases and patients' charts for clindamycin use in the patients with C. difficile–associated diarrhea. Data linking patients to the C. difficile typing results were not available from the Florida hospital. For patients who had more than one episode of C. difficile–associated diarrhea, only the first episode was analyzed. The records of all patients for whom the recovered C. difficile isolate was typed were analyzed to determine whether clindamycin had been given at any time during the two months before the illness. Patients were classified as having C. difficile–associated diarrhea due to the epidemic strain or due to nonepidemic strains. In the New York outbreak there were 29 episodes of C. difficile–associated diarrhea for which antibiotic histories and typing data were available; the epidemic strain was recovered from 20 patients and other strains were recovered from 9. These data were available for 63 episodes of C. difficile–associated diarrhea in the Arizona hospital (33 related to the epidemic strain and 30 related to other strains) and for 90 episodes in the Massachusetts hospital (30 related to the epidemic strain and 60 to other strains). Data on exposure to antibiotics other than clindamycin and the type of ward (surgical or other) the patient was in at the time of the episode were available for 160 of the 183 episodes: 28 episodes in New York (21 related to the epidemic strain and 7 related to other strains), 42 episodes in Arizona (25 related to the epidemic strain and 17 to other strains), and 90 episodes in Massachusetts (30 related to the epidemic strain and 60 to other strains). Odds ratios and confidence intervals for three variables (clindamycin use, use of other antibiotics, and hospitalization in a surgical ward) were calculated for individual institutions and combined according to the Mantel–Haenszel method.11 All P values are two-sided.
Susceptibility Testing of C. difficile Isolates
We used the E test (AB Biodisk, Solna, Sweden) to assess all 85 epidemic-strain isolates for susceptibility to clindamycin, including 16 isolates from New York, 33 from Arizona, 6 from Florida, and 30 from Massachusetts. Two representative isolates of the epidemic strain from each of the four outbreaks were identified by restriction-endonuclease analysis and selected for additional testing for susceptibility to erythromycin, ciprofloxacin, ampicillin, and tetracycline and were identified as follows: type J9 (isolates 5602 and 5610) from New York, type J7 (isolates 4224 and 4290) from Arizona, type J9p2 (isolates 5644 and 5650) from Florida, and type J9 (isolates 4478 and 5627) from Massachusetts.
Three toxigenic isolates, identified by restriction-endonuclease analysis, served as controls; two strains were susceptible to clindamycin (type K12p [isolate 5672], an endemic strain from Cook County Hospital, Chicago,12 and type Y4 [isolate 1323], an endemic strain from the Minneapolis Veterans Affairs Medical Center13), and one strain was resistant to clindamycin (type B1 [isolate 832], an epidemic-associated strain from the Minneapolis Veterans Affairs Medical Center14).
In addition, representative C. difficile isolates of the nonepidemic strains from each of the four outbreaks were also tested for susceptibility to clindamycin. One isolate of each nonepidemic strain was chosen from each outbreak for analysis. In New York, 3 of the 9 types identified on PCR (from 9 nonepidemic cases of C. difficile–associated diarrhea) were available for susceptibility testing, whereas 1 isolate of each of the 17 identified by restriction-endonuclease analysis (from 30 nonepidemic cases) was available from Arizona, 1 isolate of 6 of the 7 types identified by PCR (from 12 nonepidemic cases) was available from Florida, and 1 isolate of each of the 20 strains identified by pulsed-field gel electrophoresis (from 60 nonepidemic cases) was available from Massachusetts. In brief, we performed the E test as directed by the manufacturer, using reduced brucella agar plates supplemented with 5 percent defibrinated sheep's blood, 1 mg of vitamin K per liter, and 5 mg of hemin per liter (Remel, Lenexa, Kans.).15 The isolates were incubated overnight in reduced tryptic soy broth, the amount of the inoculum of C. difficile was standardized, and the bacteria were inoculated onto plates and grown to confluency. Antibiotic-impregnated strips were then placed on the inoculated plates, and the plates were incubated anaerobically at 37°C for 48 hours. The minimal inhibitory concentration was measured at the intercept of the inhibition ellipse.
Genetic Analysis of Strains' Resistance to Clindamycin
For the following analyses C. difficile strains were grown in brain–heart infusion medium with iron sulfate16 in an anaerobic glove chamber in an atmosphere of 80 percent nitrogen, 10 percent hydrogen, and 10 percent carbon dioxide at 37°C. When appropriate, the medium was supplemented with erythromycin (50 μg per milliliter).
DNA was extracted from 100-ml broth cultures of C. difficile that had been grown to the late log phase. The cells were harvested and lysed according to the sarkosyl lysis procedure,17 and chromosomal DNA purified by dye buoyant density–gradient ultracentrifugation at 260,000×g for 20 hours at 20°C. The chromosomal DNA was extracted from the gradient, dialyzed against TRIS–EDTA buffer (0.01 mM EDTA and 0.1 mM TRIS, pH 7.5), and concentrated by evaporation.
PCR assays were conducted with a GenAmp2400 thermal cycler (Perkin–Elmer Cetus, Norwalk, Conn.) in volumes of 100 μl that contained approximately 100 ng of template DNA. Two oligonucleotide primers specific for the erythromycin ribosomal methylase B (ermB) gene of C. difficile strain 63018 — 2980 (5'AATAAGTAAACAGGTAACGTT3') and 2981 (5'GCTCCTTGGAAGCTGTCAGTAG3') — were included at a concentration of approximately 0.7 μM per reaction. The PCR assay consisted of 30 cycles of amplification at 95°C for one minute, two minutes of annealing at 55°C, and three minutes of extension at 72°C. The products were separated by electrophoresis on 0.8 percent agarose gels.
Samples of chromosomal DNA (10 μg) from each strain were blotted onto nylon membranes (Hybond N+, Amersham, Arlington Heights, Ill.), and cross-linked to the membrane by exposure to ultraviolet light for five minutes at 312 nm. A 688-bp ermB-specific probe labeled with digoxigenin-11-deoxyuridine triphosphate was prepared by PCR with use of the primers 2980 and 2981 and allowed to hybridize to DNA immobilized on the membrane at 65°C overnight. The membrane was washed twice at room temperature in 2× sodium citrate buffer (SSC) (300 mM sodium chloride and 30 mM sodium citrate), pH 7.5, containing 0.1 percent sodium dodecyl sulfate, and twice at 65°C in 0.2× SSC, containing 0.1 percent sodium dodecyl sulfate. Bound probe was detected with use of an anti-digoxigenin–specific, chemiluminescent substrate (CDP-Star, Roche Diagnostics Australia, Castle Hill, Australia) according to the manufacturer's specifications.
Results
Association of the Epidemic Strain of C. difficile with Clindamycin Use
Case–control studies were performed at the New York, Arizona, and Massachusetts hospitals to evaluate the relation between exposure to clindamycin and diarrhea due to the epidemic strain of C. difficile (Figure 1Figure 1
Odds Ratio for the Use of Clindamycin before Becoming Ill among Patients with Diarrhea Due to the Epidemic Strain of Clostridium difficile as Compared with Patients with Diarrhea Due to Nonepidemic Strains.). The frequency of exposure to clindamycin among patients with diarrhea due to nonepidemic strains ranged from 7 percent in Massachusetts to 23 percent in Arizona, which is indicative of variation in the overall frequency of the use of clindamycin among the institutions. Yet, within each institution, clindamycin use was a more frequent cause of diarrhea due to the epidemic strain than of diarrhea due to nonepidemic strains. In the New York hospital, 11 of 20 cases of diarrhea due to the epidemic strain were associated with clindamycin use (55 percent), as compared with 1 of 9 cases of diarrhea due to nonepidemic strains (11 percent); the respective values for the Arizona hospital were 15 of 33 (45 percent) and 7 of 30 (23 percent), and the respective values for the Massachusetts hospital were 9 of 30 (30 percent) and 4 of 60 (7 percent). Overall, 35 of the 83 cases of diarrhea due to the epidemic strain were associated with clindamycin use (42 percent), as compared with 12 of 99 cases due to nonepidemic strains (12 percent, P<0.001). The odds ratio for the use of clindamycin ranged from 2.74 to 9.78 (Figure 1). The pooled odds ratio for the association between clindamycin use and diarrhea due to the epidemic strain was 4.35 (95 percent confidence interval, 2.02 to 9.38; P<0.001) (Figure 1).In contrast, the use of other antibiotics was not associated with diarrhea due to the epidemic strain. The pooled odds ratio was 1.13 (95 percent confidence interval, 0.53 to 2.41; P=0.74) for cefazolin, 1.02 (95 percent confidence interval, 0.45 to 2.32; P=0.95) for third-generation cephalosporins (ceftazidime, ceftriaxone, and cefotaxime), 0.43 (95 percent confidence interval, 0.16 to 1.20; P=0.10) for ampicillin, 1.09 (95 percent confidence interval, 0.49 to 2.45; P=0.83) for vancomycin, and 1.10 (95 percent confidence interval, 0.45 to 2.71; P=0.83) for aminoglycosides (gentamicin and tobramycin). Similarly, hospitalization in a surgical ward was not a risk factor for diarrhea due to the epidemic strain (pooled odds ratio, 0.75; 95 percent confidence interval, 0.38 to 1.49; P=0.42).
Susceptibility of Epidemic and Nonepidemic Strains of C. difficile to Clindamycin
All 85 isolates of the epidemic strain of C. difficile were highly resistant to clindamycin (minimal inhibitory concentration of clindamycin, >256 μg per milliliter). The representative isolates of epidemic strains (type J9, J7, or J9p2) from each hospital outbreak were also highly resistant to erythromycin, as was the clindamycin-resistant strain (type B1) that was used as a control (Table 2Table 2
Antimicrobial-Resistance Profiles of Representative Isolates of the Epidemic Strain of Clostridium difficile at Each Hospital and Control Strains.). Both clindamycin-susceptible control strains (types K12p and Y4) were susceptible to clindamycin and erythromycin. The majority of nonepidemic strains from each outbreak were susceptible to clindamycin. High-level resistance to clindamycin (minimal inhibitory concentration, >256 μg per milliliter) was present in only 15 percent of the nonepidemic strains (7 of 46 strains; 1 of 3 in New York, 3 of 17 in Arizona, 0 of 6 in Florida, and 3 of 20 in Massachusetts). The minimal inhibitory concentration of clindamycin for the remaining isolates of nonepidemic strains was 4 μg per milliliter or less in the case of 34 strains and 6 μg per milliliter in the case of the other 5 strains.Genetic Basis of Clindamycin Resistance in the Epidemic Strain
Resistance to macrolide–lincosamide–streptogramin (MLS) antimicrobial agents such as erythromycin and clindamycin is often mediated by a 23S ribosomal RNA methylase encoded by one of a group of highly related erm genes that have been found in gram-positive and gram-negative organisms. Two of these genes, one from C. perfringens and one from C. difficile, belong to the ErmB–ErmAM hybridization class and have been referred to as the ermBP and ermZ genes, respectively.18,19 However, in accordance with a newly proposed nomenclature for the erm genes (unpublished data), these genes are both referred to here as ermB genes. DNA dot blot hybridizations were carried out on chromosomal DNA prepared from the epidemic strain of C. difficile and control strains under highly stringent conditions, with use of an ermB-specific probe derived from C. difficile strain 630. DNA from all the representative isolates of the clindamycin-resistant epidemic strain at each hospital showed strong hybridization with the probe, indicating that the isolates contained an ermB gene (Figure 2Figure 2
DNA Dot Blot Analysis of Strains of Clostridium difficile.). The control strains K12p and Y4, which are susceptible to MLS antibiotics, did not hybridize to the probe.Next, we conducted PCR assays with primers 2980 and 2981 and each of the isolates analyzed by dot blot hybridization to confirm that the gene present in the epidemic strains was closely related to that of strain 630. Analysis of each of the MLS-resistant epidemic strains revealed PCR products of the expected size (688 bp), indicating that the gene present in the epidemic strains was an ermB-like gene (data not shown). No PCR products were obtained from the MLS-susceptible control strains. In addition, Southern blots carried out on DNA from each of the resistant strains indicated that there may have been more than one copy of the ermB gene in each of those strains (data not shown).
Discussion
This study demonstrates that large outbreaks of diarrhea in four hospitals in separate regions of the United States were all caused by a specific, highly clindamycin-resistant strain of C. difficile and that the use of clindamycin was a specific risk factor. The relation between clindamycin use and infection with the epidemic strain was consistent among the institutions, which justifies our pooled analysis and strengthens our findings. Although other virulence factors associated with this particular strain may affect its epidemic potential, resistance of specific C. difficile strains to clindamycin may partially explain the well-known propensity of this agent to precipitate outbreaks and epidemics of diarrhea.
These results cast new light on the relation between antibiotic use and C. difficile–associated diarrhea. The role of the antimicrobial agent has been assumed to be to disrupt the normal intestinal flora, particularly anaerobes, of the host, which is an important resistance factor with respect to infection with C. difficile. The antimicrobial agent precipitating a particular episode of C. difficile–associated diarrhea has been thought to have no direct association with the pattern of resistance of the infecting strain.2 For example, most strains of C. difficile are susceptible to ampicillin, yet historically, this agent has commonly been implicated in episodes of diarrhea. Although C. difficile isolates are routinely resistant to cephalosporins such as cefoxitin, resistance to clindamycin is less common. High-level resistance to clindamycin was present in only 15 percent of the nonepidemic strains in our study. Our results indicate that the relatively high likelihood of C. difficile–associated diarrhea after exposure to clindamycin is not just a consequence of effects on the resident flora; it may also be linked to the susceptibility profile of the organism.
Hospital-wide use of clindamycin has been identified as the chief factor responsible for the outbreak of C. difficile–associated diarrhea at the Arizona hospital,7 but this association was not apparent or was not assessed in the initial investigations of the other outbreaks.6,8 The outbreak in Arizona was abruptly terminated by the removal of clindamycin from the hospital formulary.7 The use of cephalosporins was identified as the chief risk factor for C. difficile–associated diarrhea early in the New York outbreak, on the basis of multivariate analyses of two case–control studies in which ward controls and diarrhea controls, respectively, were used.6 The use of clindamycin, however, was also a risk factor in the ward study and showed a trend in the diarrhea study.6 Stool culture, with typing of the recovered C. difficile isolates, was not performed in New York until one year after the original case–control studies.9 We used the later cohort of cases (identified between March and October 1990) and found that clindamycin use was a specific risk factor for diarrhea due to the epidemic strain of C. difficile. A subsequent comparative typing study of C. difficile isolates from this same hospital documented persistence of the epidemic strain two years later (January to November 1992).20 The risk of C. difficile–associated diarrhea associated with the use of specific antibiotics had not been reported previously for the outbreak at the Massachusetts hospital,8 and data on antibiotic use were not available from the Florida outbreak.
There is evidence that this strain or genetically related strains may have an even broader geographic distribution than is suggested by the distribution of these four outbreaks. Preliminary results obtained with use of PCR ribotyping indicate that the epidemic strain from the Massachusetts hospital designated as type J9 on the basis of restriction-endonuclease analysis or type D1 on the basis of pulsed-field gel electrophoresis is PCR ribotype 1.21 PCR ribotype 1 was the most common strain among hospitalized patients in England and Wales, accounting for 57 percent of all isolates in one survey,21 and was responsible for a large outbreak in northwest England involving 175 patients and 17 deaths at one hospital.22 A formal comparison of restriction-endonuclease analysis and PCR ribotyping methods should clarify whether these European epidemic strains are related to the epidemic strains we studied. We have also used restriction-endonuclease analysis to analyze two C. difficile isolates of the clonal strain associated with another clindamycin-related epidemic of diarrhea that was recently reported in Virginia.23 Neither of these isolates (kindly provided by Michael Climo and Edward Wong) was type J9 or J7.
Each of the epidemic-strain isolates contained an erm gene19 which, on the basis of its ability to hybridize under highly stringent conditions with an ermB-specific probe, belongs to the ErmB class of erythromycin-resistance determinants. This conclusion was supported by PCR analysis, which showed that a product of the same size as the ermB determinant from C. difficile strain 630 was amplified from each of the epidemic isolates with use of ermB-specific primers. These data provide evidence that the resistance to MLS antibiotics of each of the epidemic-strain isolates results from the presence of an ermB gene.
MLS-resistance genes from the ErmB hybridization class have been detected in both C. perfringens and C. difficile. 24-26 The ermB gene from C. perfringens is located on a large nonconjugative but mobilizable plasmid, pIP402.27 By contrast, the ermB gene from C. difficile strain 630, which is 99 percent homologous to the C. perfringens gene (unpublished data), appears to be located on the chromosome.
In strain 630, transfer of erythromycin resistance occurs in the absence of detectable plasmids. The ermB gene has been postulated to reside on the as yet uncharacterized conjugative transposon Tn5398. 28 It is possible that the ermB gene detected in the epidemic strain that we studied is also associated with Tn5398, or with a related mobile genetic element located on the chromosome. Such elements are likely to represent an important method for the dissemination of resistance to MLS antibiotics among clinical isolates of C. difficile, especially in hospitals. It is also possible that the ermB gene in the epidemic strain is located on the chromosome but is not associated with a transposable element or that ermB is located on a plasmid. However, no antibiotic-resistance plasmids have ever been reported in C. difficile.
Taken together, these observations suggest that a single erythromycin–clindamycin resistance gene, present in specific strains of C. difficile, is associated with a significantly increased risk of C. difficile–associated diarrhea in widely dispersed U.S. hospitals, especially in association with clindamycin use. C. difficile–associated diarrhea is virtually unknown in the absence of use of antimicrobial agents, and the risk of this illness among hospitalized patients increases with the use of clindamycin and the presence of clindamycin-resistant strains of C. difficile. C. difficile–associated diarrhea is yet another example of the increasing number of nosocomial infections caused by organisms resistant to antimicrobial agents. It is encouraging that in two well-described outbreaks caused by clindamycin-resistant C. difficile, there was rapid resolution of the epidemic with restriction of the use of clindamycin.7,23
Supported by a grant from the Department of Veterans Affairs Research Service (to Drs. Johnson and Gerding) and by a grant from the Australian National Health and Medical Research Council (to Dr. Rood).
We are indebted to Lata Venkataraman, John Galgiani, Tom Minnick, Melanie Hall, Jeffery Stall, Janet K. Shim, and Susan P. Sambol for their contributions to this investigation.
Source Information
From the Infectious Disease Section, Department of Medicine, Veterans Affairs Chicago Health Care System, Lakeside Division, and Northwestern University Medical School, Chicago (S.J., D.N.G.); the Infectious Disease Section, Department of Medicine, Beth Israel Deaconess Medical Center and Harvard Medical School, Boston (M.H.S., P.D.); the Department of Microbiology, Monash University, Clayton, Victoria, Australia (K.A.F., D.L., J.I.R.); the Centers for Disease Control and Prevention, Atlanta (G.E.K., F.C.T.); the Stratton Veterans Affairs Medical Center and Albany Medical College, Albany, N.Y. (A.L.B., M.E.R.); and the Veterans Affairs Medical Center, Tucson, Ariz. (S.M.P.).
Address reprint requests to Dr. Johnson at the Veterans Affairs Chicago Health Care System, Lakeside Division, Medicine Service, 333 East Huron, Chicago, IL 60611, or at stu-johnson@nwu.edu.
- References
References
1
Bartlett JG ,Chang TW ,Gurwith M ,Gorbach SL ,Onderdonk AB . Antibiotic-associated pseudomembranous colitis due to toxin-producing clostridia. N Engl J Med 1978;298:531-534
Full Text | Web of Science | Medline2
Gerding DN ,Johnson S ,Peterson LR ,Mulligan ME ,Silva J Jr . Clostridium difficile-associated diarrhea and colitis. Infect Control Hosp Epidemiol 1995;16:459-477
CrossRef | Web of Science | Medline3
Clabots CR ,Johnson S ,Olson MM ,Peterson LR ,Gerding DN . Acquisition of Clostridium difficile by hospitalized patients: evidence for colonized new admissions as a source of infection. J Infect Dis 1992;166:561-567
CrossRef | Web of Science | Medline4
Samore MH ,Bettin KM ,DeGirolami PC ,Clabots CR ,Gerding DN ,Karchmer AW . Wide diversity of Clostridium difficile types at a tertiary referral hospital. J Infect Dis 1994;170:615-621
CrossRef | Web of Science | Medline5
Samore MH ,Killgore G ,Johnson S , et al. Multicenter typing comparison of sporadic and outbreak Clostridium difficile isolates from geographically diverse hospitals. J Infect Dis 1997;176:1233-1238
CrossRef | Web of Science | Medline6
Nelson DE ,Auerbach SB ,Baltch AL , et al. Epidemic Clostridium difficile-associated diarrhea: role of second- and third-generation cephalosporins. Infect Control Hosp Epidemiol 1994;15:88-94[Erratum, Infect Control Hosp Epidemiol 1994;15:366.]
CrossRef | Web of Science | Medline7
Pear SM ,Williamson TH ,Bettin KM ,Gerding DN ,Galgiani JN . Decrease in nosocomial Clostridium difficile-associated diarrhea by restricting clindamycin use. Ann Intern Med 1994;120:272-277
Web of Science | Medline8
Samore MH ,Venkataraman L ,DeGirolami PC ,Arbeit RD ,Karchmer AW . Clinical and molecular epidemiology of sporadic and clustered cases of nosocomial Clostridium difficile diarrhea. Am J Med 1996;100:32-40
CrossRef | Web of Science | Medline9
Killgore GE ,Kato H . Use of arbitrary primer PCR to type Clostridium difficile and comparison of results with those by immunoblot typing. J Clin Microbiol 1994;32:1591-1593
Web of Science | Medline10
Tenover FC ,Arbeit RD ,Goering RV . How to select and interpret molecular strain typing methods for epidemiological studies of bacterial infections: a review for healthcare epidemiologists. Infect Control Hosp Epidemiol 1997;18:426-439
CrossRef | Web of Science | Medline11
Rothman KJ, Greenland S. Modern epidemiology. 2nd ed. Philadelphia: Lippincott-Raven, 1998:270-2.
12
Mekonen E ,Johnson S ,Pottinger J ,Kocka F ,Pulvirenti J ,Gerding D . Predominance of a single restriction endonuclease analysis (REA) group of Clostridium difficile (CD) at two Chicago hospitals. Infect Control Hosp Epidemiol 1996;17:Suppl:P32-P32 abstract.13
Clabots CR, Pearson AC, Bettin K, et al. Typing of Clostridium difficile (CD) strains responsible for epidemics in a hospital with a high endemic incidence of CD-associated diarrhea. In: Program and abstracts of the 31st Interscience Conference on Antimicrobial Agents and Chemotherapy, Chicago, September 29–October 2, 1991. Washington, D.C.: American Society for Microbiology, 1991:352. abstract.
14
Johnson S ,Clabots CR ,Linn FV ,Olson MM ,Peterson LR ,Gerding DN . Nosocomial Clostridium difficile colonisation and disease. Lancet 1990;336:97-100
CrossRef | Web of Science | Medline15
Methods for antimicrobial susceptibility testing of anaerobic bacteria: approved standard. 4th ed. NCCLS document M11-A4. Wayne, Pa.: National Committee for Clinical Laboratory Standards, 1997.
16
Smith CJ ,Markowitz SM ,Macrina FL . Transferable tetracycline resistance in Clostridium difficile. Antimicrob Agents Chemother 1981;19:997-1003
Web of Science | Medline17
Abraham LJ ,Rood JI . Molecular analysis of transferable tetracycline resistance plasmids from Clostridium perfringens. J Bacteriol 1985;161:636-640
Web of Science | Medline18
Wust J ,Hardegger U . Transferable resistance to clindamycin, erythromycin, and tetracycline in Clostridium difficile. Antimicrob Agents Chemother 1983;23:784-786
Web of Science | Medline19
Arthur M ,Brisson-Noel A ,Courvalin P . Origin and evolution of genes specifying resistance to macrolide, lincosamide and streptogramin antibiotics: data and hypotheses. J Antimicrob Chemother 1987;20:783-802
CrossRef | Web of Science | Medline20
Rafferty ME ,Baltch AL ,Smith RP , et al. Comparison of restriction enzyme analysis, arbitrarily primed PCR, and protein profile analysis for epidemiologic investigation of an ongoing Clostridium difficile outbreak. J Clin Microbiol 1998;36:2957-2963
Web of Science | Medline21
Brazier JS . The epidemiology and typing of Clostridium difficile. J Antimicrob Chemother 1998;41:Suppl C:47-57
CrossRef | Web of Science | Medline22
Cartmill TDI ,Panigrahi H ,Worsley MA ,McCann DC ,Nice CN ,Keith E . Management and control of a large outbreak of diarrhoea due to Clostridium difficile. J Hosp Infect 1994;27:1-15
CrossRef | Web of Science | Medline23
Climo MW ,Israel DS ,Wong ES ,Williams D ,Coudron P ,Markowitz SM . Hospital-wide restriction of clindamycin: effect on the incidence of Clostridium difficile-associated diarrhea and cost. Ann Intern Med 1998;128:989-995
Web of Science | Medline24
Berryman DI ,Lyristis M ,Rood JI . Cloning and sequence analysis of ermQ, the predominant macrolide-lincosamide-streptogramin B resistance gene in Clostridium perfringens. Antimicrob Agents Chemother 1994;38:1041-1046
Web of Science | Medline25
Berryman DI ,Rood JI . The closely related ermB-ermAM genes from Clostridium perfringens, Enterococcus faecalis (pAM beta1), and Streptococcus agalactiae (pIP501) are flanked by variants of a directly repeated sequence. Antimicrob Agents Chemother 1995;39:1830-1834
Web of Science | Medline26
Lyras D, Rood JI. Transposable genetic elements and antibiotic resistance determinants from Clostridium perfringens and Clostridium difficile. In: Rood JI, McClane BA, Songer JG, Titball RW, eds. The clostridia: molecular biology and pathogenesis. San Diego, Calif.: Academic Press, 1997:73-92.
27
Brefort G ,Magot M ,Ionesco H ,Sebald M . Characterization and transferability of Clostridium perfringens plasmids. Plasmid 1977;1:52-66
CrossRef | Web of Science | Medline28
Mullany P ,Wilks M ,Tabaqchali S . Transfer of macrolide-lincosamide-streptogramin B (MLS) resistance in Clostridium difficile is linked to a gene homologous with toxin A and is mediated by a conjugative transposon, Tn5398. J Antimicrob Chemother 1995;35:305-315
CrossRef | Web of Science | Medline
- Citing Articles (98)
Citing Articles
1
Katharine A. Germansky, Ciarán P. Kelly. (2012) Clostridium difficile Infection. Hospital Medicine Clinics
CrossRef2
Eleni Apostolopoulou, Vasilios Raftopoulos, Konstantinos Terzis, Ioannis Elefsiniotis. (2011) Infection Probability Score: A predictor of Clostridium difficile–associated disease onset in patients with haematological malignancy. European Journal of Oncology Nursing 15:5, 404-409
CrossRef3
Fred C. Tenover, Ellen Jo Baron, Lance R. Peterson, David H. Persing. (2011) Laboratory Diagnosis of Clostridium difficile Infection. The Journal of Molecular Diagnostics 13:6, 573-582
CrossRef4
L. Ratnayake, J. McEwen, N. Henderson, D. Nathwani, G. Phillips, D. Brown, J. Coia. (2011) Control of an outbreak of diarrhoea in a vascular surgery unit caused by a high-level clindamycin-resistant Clostridium difficile PCR ribotype 106. Journal of Hospital Infection 79:3, 242-247
CrossRef5
P. Spigaglia, F. Barbanti, P. Mastrantonio, , G. Ackermann, C. Balmelli, F. Barbut, E. Bouza, J. Brazier, M. Delmee, D. Drudy, E. Kuijper, H. Ladas, P. Mastrantonio, E. Nagy, H. Pituch, I. Poxton, M. Rupnik, M. Wullt, M. Yucesoy. (2011) Multidrug resistance in European Clostridium difficile clinical isolates. Journal of Antimicrobial Chemotherapy 66:10, 2227-2234
CrossRef6
Khalid A Osman, Mohamed H Ahmed, Mahir A Hamad, Dilip Mathur. (2011) Emergency colectomy for fulminant Clostridium difficile colitis: Striking the right balance. Scandinavian Journal of Gastroenterology 46:10, 1222-1227
CrossRef7
K. Solomon, S. Fanning, S. McDermott, S. Murray, L. Scott, A. Martin, M. Skally, K. Burns, E. Kuijper, F. Fitzpatrick, L. Fenelon, L. Kyne. (2011) PCR ribotype prevalence and molecular basis of macrolide-lincosamide-streptogramin B (MLSB) and fluoroquinolone resistance in Irish clinical Clostridium difficile isolates. Journal of Antimicrobial Chemotherapy 66:9, 1976-1982
CrossRef8
H. Pituch, P. Obuch-Woszczatynski, D. Wultanska, G. Nurzynska, C. Harmanus, A. Banaszkiewicz, A. Radzikowski, M. Luczak, A. van Belkum, E. Kuijper. (2011) Characterization and antimicrobial susceptibility of Clostridium difficile strains isolated from adult patients with diarrhoea hospitalized in two university hospitals in Poland, 2004-2006. Journal of Medical Microbiology 60:8, 1200-1205
CrossRef9
K. Solomon, S. Murray, L. Scott, S. McDermott, D. Drudy, A. Martin, C. O'Donoghue, M. Skally, K. Burns, L. Fenelon, F. Fitzpatrick, L. Kyne, S. Fanning. (2011) An investigation of the subtype diversity of clinical isolates of Irish Clostridium difficile ribotypes 027 and 078 by repetitive-extragenic palindromic PCR. Journal of Medical Microbiology 60:8, 1080-1087
CrossRef10
Camilla Wiuff, Derek J. Brown, Henry Mather, A-Lan Banks, Anne Eastaway, John E. Coia. (2011) The epidemiology of Clostridium difficile in Scotland. Journal of Infection 62:4, 271-279
CrossRef11
Emily K. Shuman, Preeti N. Malani. (2011) Prevention and Management of Prosthetic Joint Infection in Older Adults. Drugs & Aging 28:1, 13-26
CrossRef12
William Cheadle, James T. Lee, Lena M. Napolitano, Ronald Lee Nichols. (2010) Clinical Update on the Use of Moxifloxacin in the Treatment of Community-Acquired Complicated Intraabdominal Infections. Surgical Infections 11:5, 487-494
CrossRef13
Latisha Heinlen, Jimmy D. Ballard. (2010) Clostridium difficile Infection. The American Journal of the Medical Sciences 340:3, 247-252
CrossRef14
Renee Huang, Edward C. Lee. (2010) Deep Venous Thrombosis Prophylaxis and Antibiotics in the National Surgical Quality Improvement Program Era. Seminars in Colon and Rectal Surgery 21:3, 148-152
CrossRef15
Gracia Fellmeth, Sucharita Yarlagadda, Shabnam Iyer. (2010) Epidemiology of community-onset Clostridium difficile infection in a community in the South of England. Journal of Infection and Public Health 3:3, 118-123
CrossRef16
T. Norén, I. Alriksson, T. Åkerlund, L. G. Burman, M. Unemo. (2010) In vitro susceptibility to 17 antimicrobials of clinical Clostridium difficile isolates collected in 1993-2007 in Sweden. Clinical Microbiology and Infection 16:8, 1104-1110
CrossRef17
M. He, M. Sebaihia, T. D. Lawley, R. A. Stabler, L. F. Dawson, M. J. Martin, K. E. Holt, H. M. B. Seth-Smith, M. A. Quail, R. Rance, K. Brooks, C. Churcher, D. Harris, S. D. Bentley, C. Burrows, L. Clark, C. Corton, V. Murray, G. Rose, S. Thurston, A. van Tonder, D. Walker, B. W. Wren, G. Dougan, J. Parkhill. (2010) Evolutionary dynamics of Clostridium difficile over short and long time scales. Proceedings of the National Academy of Sciences 107:16, 7527-7532
CrossRef18
J. Glenn Songer. 2010. Enteric Clostridia. , 211-229.
CrossRef19
J. Glenn Songer. (2010) Clostridia as agents of zoonotic disease. Veterinary Microbiology 140:3-4, 399-404
CrossRef20
Lisa F. Dawson, Esmeralda Valiente, Brendan W. Wren. (2009) Clostridium difficile—A continually evolving and problematic pathogen. Infection, Genetics and Evolution 9:6, 1410-1417
CrossRef21
Karin I. Hjalmarson, Sherwood L. Gorbach. 2009. Clostridium difficile Infection in Critical Care. , 271-287.
CrossRef22
O. M. Williams, R. C. Spencer. (2009) The management of Clostridium difficile infection. British Medical Bulletin 91:1, 87-110
CrossRef23
Maja Rupnik, Mark H. Wilcox, Dale N. Gerding. (2009) Clostridium difficile infection: new developments in epidemiology and pathogenesis. Nature Reviews Microbiology 7:7, 526-536
CrossRef24
Amer A. Alkhatib, Christopher C. Tietze, Kathryn A. Peterson, Mae F. Go. (2009) Cytomegalovirus Clostridium Colitis Disease in an Immunocompetent Patient. Southern Medical Journal 102:7, 775-776
CrossRef25
Jennifer R. O'Connor, Stuart Johnson, Dale N. Gerding. (2009) Clostridium difficile Infection Caused by the Epidemic BI/NAP1/027 Strain. Gastroenterology 136:6, 1913-1924
CrossRef26
Michelle M. Merrigan, Susan P. Sambol, Stuart Johnson, Dale N. Gerding. (2009) New approach to the management of Clostridium difficile infection: colonisation with non-toxigenic C. difficile during daily ampicillin or ceftriaxone administration. International Journal of Antimicrobial Agents 33, S46-S50
CrossRef27
Dale N. Gerding. (2009) Clostridium difficile 30 years on: what has, or has not, changed and why?. International Journal of Antimicrobial Agents 33, S2-S8
CrossRef28
S. Persson, M. Torpdahl, K. E. P. Olsen. (2008) New multiplex PCR method for the detection of Clostridium difficile toxin A ( tcdA ) and toxin B ( tcdB ) and the binary toxin ( cdtA / cdtB ) genes applied to a Danish strain collection. Clinical Microbiology and Infection 14:11, 1057-1064
CrossRef29
Iris Velazquez-Gomez, Rene Rocha-Rodriguez, Doris H. Toro, Jose J. Gutierrez-Nuñez, Glenda Gonzalez, Sonia Saavedra. (2008) A Severity Score Index for Clostridium difficile Infection. Infectious Diseases in Clinical Practice 16:6, 376-378
CrossRef30
Mark F. Kurd, Luis Pulido, Ashish Joshi, James J. Purtill, Javad Parvizi. (2008) Clostridium Difficile Infection After Total Joint Arthroplasty: Who is at Risk?. The Journal of Arthroplasty 23:6, 839-842
CrossRef31
A. R. F. Barreto, I. C. Cavalcante, M. V. Castro, A. F. T. A. Junqueira, M. R. Vale, R. A. Ribeiro, M. H. L. P. Souza, G. A. C. Brito. (2008) Fucoidin Prevents Clostridium difficile Toxin-A-Induced Ileal Enteritis in Mice. Digestive Diseases and Sciences 53:4, 990-996
CrossRef32
Leanne B. Gasink, Ebbing Lautenbach. (2008) Prevention and Treatment of Health Care–Acquired Infections. Medical Clinics of North America 92:2, 295-313
CrossRef33
Michael J. Wood, Neil Hyman, James C. Hebert, Hagen Blaszyk. (2008) Catastrophic Clostridium difficile Enteritis in a Pelvic Pouch Patient: Report of a Case. Journal of Gastrointestinal Surgery 12:2, 350-352
CrossRef34
Robert C. Owens, Jr., Curtis J. Donskey, Robert P. Gaynes, Vivian G. Loo, Carlene A. Muto. (2008) Antimicrobial‐Associated Risk Factors for Clostridium difficile Infection. Clinical Infectious Diseases 46:s1, S19-S31
CrossRef35
Roger Baxter, G. Thomas Ray, Bruce H. Fireman. (2008) Case‐Control Study of Antibiotic Use and Subsequent Clostridium difficile –Associated Diarrhea in Hospitalized Patients • . Infection Control and Hospital Epidemiology 29:1, 44-50
CrossRef36
Dennis G Maki, Nasia Safdar, Steven C Ebert. (2007) Prevalence, Consequences, and Solutions. Pharmacotherapy 27:10 Part 2, 121S-125S
CrossRef37
Christos Gougoulias, Kieran M. Tuohy, Glenn R. Gibson. (2007) Dietary-based gut flora modulation against Clostridium difficile onset. Food Science & Technology Bulletin: Functional Foods 4:4, 31-41
CrossRef38
M. H. Wilcox. (2007) Evidence for low risk of Clostridium difficile infection associated with tigecycline. Clinical Microbiology and Infection 13:10, 949-952
CrossRef39
E. Sawabe, H. Kato, K. Osawa, T. Chida, N. Tojo, Y. Arakawa, N. Okamura. (2007) Molecular analysis of Clostridium difficile at a university teaching hospital in Japan: a shift in the predominant type over a five-year period. European Journal of Clinical Microbiology & Infectious Diseases 26:10, 695-703
CrossRef40
Christoph Schmidt, Birgit Löffler, Grit Ackermann. (2007) Antimicrobial phenotypes and molecular basis in clinical strains of Clostridium difficile. Diagnostic Microbiology and Infectious Disease 59:1, 1-5
CrossRef41
B. Elliott, B. J. Chang, C. L. Golledge, T. V. Riley. (2007) Clostridium difficile-associated diarrhoea. Internal Medicine Journal 37:8, 561-568
CrossRef42
Denise Drudy, Norma Harnedy, Seamus Fanning, Margaret Hannan, Lorraine Kyne. (2007) Emergence and Control of Fluoroquinolone‐Resistant, Toxin A–Negative, Toxin B–Positive Clostridium difficile • . Infection Control and Hospital Epidemiology 28:8, 932-940
CrossRef43
Warren N. Fawley, Sarah Underwood, Jane Freeman, Simon D. Baines, Katie Saxton, Keith Stephenson, Robert C. Owens, Jr., Mark H. Wilcox. (2007) Efficacy of Hospital Cleaning Agents and Germicides Against Epidemic Clostridium difficile Strains • . Infection Control and Hospital Epidemiology 28:8, 920-925
CrossRef44
D. B. Blossom, L. C. McDonald. (2007) The Challenges Posed by Reemerging Clostridium difficile Infection. Clinical Infectious Diseases 45:2, 222-227
CrossRef45
Sawsan Taha, Orjan Johansson, Stephan Rivera Jonsson, Daniel Heimer, Karel Krovacek. (2007) Toxin production by and adhesive properties of Clostridium difficile isolated from humans and horses with antibiotic-associated diarrhea. Comparative Immunology, Microbiology and Infectious Diseases 30:3, 163-174
CrossRef46
Lynne V. McFarland, Henry W. Beneda, Jill E. Clarridge, Gregory J. Raugi. (2007) Implications of the changing face of Clostridium difficile disease for health care practitioners. American Journal of Infection Control 35:4, 237-253
CrossRef47
Steven J Martin. (2007) Antimicrobial stewardship: the aspirin of the 21st Century. Expert Review of Anti-infective Therapy 5:2, 159-161
CrossRef48
Perry Hookman, Jamie S. Barkin. (2007) Review: Clostridium difficile-Associated Disorders/Diarrhea and Clostridium difficile Colitis: The Emergence of a More Virulent Era. Digestive Diseases and Sciences 52:4, 1071-1075
CrossRef49
Frederic Barbut, Beatrice Gariazzo, Laetitia Bonne, Valerie Lalande, Beatrice Burghoffer, Ralucca Luiuz, Jean‐Claude Petit. (2007) Clinical Features of Clostridium difficile –Associated Infections and Molecular Characterization of Strains: Results of a Retrospective Study, 2000‐2004 • . Infection Control and Hospital Epidemiology 28:2, 131-139
CrossRef50
L. Clifford McDonald, Bruno Coignard, Erik Dubberke, Xiaoyan Song, Teresa Horan, Preeta K. Kutty, . (2007) Recommendations for Surveillance of Clostridium difficile –Associated Disease • . Infection Control and Hospital Epidemiology 28:2, 140-145
CrossRef51
B. Hubert, V. G. Loo, A.-M. Bourgault, L. Poirier, A. Dascal, E. Fortin, M. Dionne, M. Lorange. (2007) A Portrait of the Geographic Dissemination of the Clostridium difficile North American Pulsed-Field Type 1 Strain and the Epidemiology of C. difficile-Associated Disease in Quebec. Clinical Infectious Diseases 44:2, 238-244
CrossRef52
S. Cherifi, M. Delmee, J. Van Broeck, I. Beyer, B. Byl, G. Mascart. (2006) Management of an Outbreak of Clostridium difficile –Associated Disease Among Geriatric Patients • . Infection Control and Hospital Epidemiology 27:11, 1200-1205
CrossRef53
Emilio Bouza, Almudena Burillo, Patricia Muñoz. (2006) Antimicrobial Therapy of Clostridium difficile-Associated Diarrhea. Medical Clinics of North America 90:6, 1141-1163
CrossRef54
(2006) Epidemic Clostridium difficile. New England Journal of Medicine 354:11, 1199-1203
Full Text55
Matthew H. Samore, Lata Venkataraman, Paola C. Degirolami, Michelle M. Merrigan, Stuart Johnson, Dale N. Gerding, Yehuda Carmeli, Stephan Harbarth. (2006) Genotypic and Phenotypic Analysis of Clostridium difficile Correlated with Previous Antibiotic Exposure. Microbial Drug Resistance 12:1, 23-28
CrossRef56
L. Clifford McDonald, Maria Owings, Daniel B. Jernigan. (2006) Clostridium difficile Infection in Patients Discharged from US Short-stay Hospitals, 1996–20031. Emerging Infectious Diseases 12:3, 409-415
CrossRef57
2006. Lincosamides. , 2063-2069.
CrossRef58
Loo, Vivian G., Poirier, Louise, Miller, Mark A., Oughton, Matthew, Libman, Michael D., Michaud, Sophie, Bourgault, Anne-Marie, Nguyen, Tuyen, Frenette, Charles, Kelly, Mirabelle, Vibien, Anne, Brassard, Paul, Fenn, Susan, Dewar, Ken, Hudson, Thomas J., Horn, Ruth, René, Pierre, Monczak, Yury, Dascal, André, . (2005) A Predominantly Clonal Multi-Institutional Outbreak of Clostridium difficile–Associated Diarrhea with High Morbidity and Mortality. New England Journal of Medicine 353:23, 2442-2449
Full Text59
McDonald, L. Clifford, Killgore, George E., Thompson, Angela, Owens, Robert C. Jr., Kazakova, Sophia V., Sambol, Susan P., Johnson, Stuart, Gerding, Dale N., . (2005) An Epidemic, Toxin Gene–Variant Strain of Clostridium difficile. New England Journal of Medicine 353:23, 2433-2441
Full Text60
J. Pepin, N. Saheb, M.-A. Coulombe, M.-E. Alary, M.-P. Corriveau, S. Authier, M. Leblanc, G. Rivard, M. Bettez, V. Primeau, M. Nguyen, C.-E. Jacob, L. Lanthier. (2005) Emergence of Fluoroquinolones as the Predominant Risk Factor for Clostridium difficile-Associated Diarrhea: A Cohort Study during an Epidemic in Quebec. Clinical Infectious Diseases 41:9, 1254-1260
CrossRef61
Cassandra D. Salgado, Naomi O??Grady, Barry M. Farr. (2005) Prevention and control of antimicrobial-resistant infections in intensive care patients*. Critical Care Medicine 33:10, 2373-2382
CrossRef62
R. John, J.S. Brazier. (2005) Antimicrobial susceptibility of polymerase chain reaction ribotypes of Clostridium difficile commonly isolated from symptomatic hospital patients in the UK. Journal of Hospital Infection 61:1, 11-14
CrossRef63
L. Clifford McDonald. (2005) Clostridium difficile : Responding to a New Threat From an Old Enemy • . Infection Control and Hospital Epidemiology 26:8, 672-675
CrossRef64
E. Bouza, P. Munoz, R. Alonso. (2005) Clinical manifestations, treatment and control of infections caused by Clostridium difficile. Clinical Microbiology and Infection 11:s4, 57-64
CrossRef65
Y. J. Tang-Feldman, J. P. Henderson, G. Ackermann, S. S. Feldman, M. Bedley, J. Silva, S. H. Cohen. (2005) Prevalence of the ermB Gene in Clostridium difficile Strains Isolated at a University Teaching Hospital from 1987 through 1998. Clinical Infectious Diseases 40:10, 1537-1540
CrossRef66
Carlene A. Muto, Marian Pokrywka, Kathleen Shutt, Aaron B. Mendelsohn, Kathy Nouri, Kathy Posey, Terri Roberts, Karen Croyle, Sharon Krystofiak, Sujata Patel‐Brown, A. William Pasculle, David L. Paterson, Melissa Saul, Lee H. Harrison. (2005) A Large Outbreak of Clostridium difficile ‐Associated Disease With an Unexpected Proportion of Deaths and Colectomies at a Teaching Hospital Following Increased Fluoroquinolone Use • . Infection Control and Hospital Epidemiology 26:3, 273-280
CrossRef67
M. C. McEllistrem, R. J. Carman, D. N. Gerding, C. W. Genheimer, L. Zheng. (2005) A Hospital Outbreak of Clostridium difficile Disease Associated with Isolates Carrying Binary Toxin Genes. Clinical Infectious Diseases 40:2, 265-272
CrossRef68
Julian S. Bendle, Peter A. James, Peter M. Bennett, Matthew B. Avison, Alasdair P. MacGowan, Khalid M. Al-Shafi. (2004) Resistance determinants in strains of Clostridium difficile from two geographically distinct populations. International Journal of Antimicrobial Agents 24:6, 619-621
CrossRef69
J. Glenn Songer. (2004) The emergence of Clostridium difficile as a pathogen of food animals. Animal Health Research Reviews 5:02, 321-326
CrossRef70
Ursula Changela, Joan P. Cannon, Chinyere Aneziokoro, Palak S. Shah, Lizy Thottapurathu, Joseph Lentino. (2004) Risk factors and mortality associated with Clostridium difficile-associated diarrhoea at a VA hospital. International Journal of Antimicrobial Agents 24:6, 562-566
CrossRef71
Usha Stiefel, Curtis J. Donskey. (2004) The role of the intestinal tract as a source for transmission of nosocomial pathogens. Current Infectious Disease Reports 6:6, 420-425
CrossRef72
M. Iizuka, H. Itou, S. Konno, J. Chihara, M. Tobita, H. Oyamada, I. Toyoshima, K. Sasaki, A. Sato, Y. Horie, S. Watanabe. (2004) Elemental diet modulates the growth of Clostridium difficile in the gut flora. Alimentary Pharmacology and Therapeutics 20:s1, 151-157
CrossRef73
Robert Gaynes, David Rimland, Edna Killum, H. Ken Lowery, Theodore M. Johnson II, George Killgore, Fred C. Tenover. (2004) Outbreak of Clostridium difficile Infection in a Long‐Term Care Facility: Association with Gatifloxacin Use. Clinical Infectious Diseases 38:5, 640-645
CrossRef74
Dale N. Gerding. (2004) Clindamycin, Cephalosporins, Fluoroquinolones, and Clostridium difficile –Associated Diarrhea: This Is an Antimicrobial Resistance Problem. Clinical Infectious Diseases 38:5, 646-648
CrossRef75
(2004) National Clostridium difficile Standards Group: Report to the Department of Health. Journal of Hospital Infection 56, 1-38
CrossRef76
H. Pituch, A. van Belkum, N. van den Braak, P. Obuch-Woszczatynski, A. Sawicka-Grzelak, H. Verbrugh, F. Meisel-Mikolajczyk, . (2003) Clindamycin-resistant, toxin A-negative, toxin B-positive Clostridium difficile strains cause antibiotic-associated diarrhea among children hospitalized in a hematology unit. Clinical Microbiology and Infection 9:8, 903-904
CrossRef77
Mark H Wilcox. (2003) Clostridium difficile infection and pseudomembranous colitis. Best Practice & Research Clinical Gastroenterology 17:3, 475-493
CrossRef78
M.H Wilcox, W.N Fawley, N Wigglesworth, P Parnell, P Verity, J Freeman. (2003) Comparison of the effect of detergent versus hypochlorite cleaning on environmental contamination and incidence of Clostridium difficile infection. Journal of Hospital Infection 54:2, 109-114
CrossRef79
W.N. Fawley, J. Freeman, M.H. Wilcox. (2003) Evidence to support the existence of subgroups within the UK epidemic Clostridium difficile strain (PCR ribotype 1). Journal of Hospital Infection 54:1, 74-77
CrossRef80
Claudia Thomas, Mark Stevenson, D. James Williamson, Thomas V. Riley. (2002) Clostridium difficile –Associated Diarrhea: Epidemiological Data from Western Australia Associated with a Modified Antibiotic Policy. Clinical Infectious Diseases 35:12, 1457-1462
CrossRef81
John G. Bartlett. (2002) Clostridium difficile-associated enteric disease. Current Infectious Disease Reports 4:6, 477-483
CrossRef82
Giovanni Bonfiglio, Jacques Simporè, Salvatore Pignatelli, Salvatore Musumeci, Maria Letizia Solinas. (2002) Epidemiology of bacterial resistance in gastro-intestinal pathogens in a tropical area. International Journal of Antimicrobial Agents 20:5, 387-389
CrossRef83
Endale T. Mekonen, Dale N. Gerding, Susan P. Sambol, Jean M. Pottinger, Joseph J. Pulvirenti, Dayle Marsh, Frank E. Kocka, Stuart Johnson. (2002) Predominance of a Single Restriction Endonuclease Analysis Group With Intrahospital Subgroup Diversity Among Clostridium difficile Isolates at Two Chicago Hospitals • . Infection Control and Hospital Epidemiology 23:11, 648-652
CrossRef84
Lynne V. McFarland. (2002) What’s Lurking Under the Bed? Persistence and Predominance of Particular Clostridium difficile Strains in a Hospital and the Potential Role of Environmental Contamination • . Infection Control and Hospital Epidemiology 23:11, 639-640
CrossRef85
Joseph J. Pulvirenti, Dale N. Gerding, Catherine Nathan, Irfan Hafiz, Tarun Mehra, Dayle Marsh, Frank Kocka, Thomas Rice, Staci A. Fischer, John Segreti, Robert A. Weinstein. (2002) Difference in the Incidence of Clostridium difficile Among Patients Infected With Human Immunodeficiency Virus Admitted to a Public Hospital and a Private Hospital • . Infection Control and Hospital Epidemiology 23:11, 641-647
CrossRef86
Wafaa Y Jamal, Eiman M Mokaddas, Tina L Verghese, V.O Rotimi. (2002) In vitro activity of 15 antimicrobial agents against clinical isolates of Clostridium difficile in Kuwait. International Journal of Antimicrobial Agents 20:4, 270-274
CrossRef87
Munshi Moyenuddin, John C. Williamson, Cristopher A. Ohl. (2002) Clostridium difficile — associated diarrhea: Current strategies for diagnosis and therapy. Current Gastroenterology Reports 4:4, 279-286
CrossRef88
T KALB, S LORIN. (2002) Infection in the chronically critically ill: unique risk profile in a newly defined population. Critical Care Clinics 18:3, 529-552
CrossRef89
Patrizia Spigaglia, Paola Mastrantonio. (2002) Analysis of Macrolide-Lincosamide-Streptogramin B (MLS B ) Resistance Determinant in Strains of Clostridium difficile. Microbial Drug Resistance 8:1, 45-53
CrossRef90
Torbjorn Norén, Yajarayma J Tang-Feldman, Stuart H Cohen, Joseph Silva, Per Olcén. (2002) Clindamycin resistant strains of Clostridium difficile isolated from cases of C. difficile associated diarrhea (CDAD) in a hospital in Sweden. Diagnostic Microbiology and Infectious Disease 42:2, 149-151
CrossRef91
Bartlett, John G., . (2002) Antibiotic-Associated Diarrhea. New England Journal of Medicine 346:5, 334-339
Full Text92
V. Båverud. (2002) Clostridium difficile infections in animals with special reference to the horse. A review. Veterinary Quarterly 24:4, 203-219
CrossRef93
Lorraine Kyne, Richard J. Farrell, Ciarán P. Kelly. (2001) Clostridium difficile. Gastroenterology Clinics of North America 30:3, 753-777
CrossRef94
S. Harbarth, M.H. Samore, Y. Carmeli. (2001) Antibiotic prophylaxis and the risk of C lostridium difficile -associated diarrhoea. Journal of Hospital Infection 48:2, 93-97
CrossRef95
William P. Ciesla, David A. Bobak. (2001) Management and prevention of Clostridium difficile-associated diarrhea. Current Infectious Disease Reports 3:2, 109-115
CrossRef96
Cirle S. Alcantara, Richard L. Guerrant. (2000) Update on Clostridium difficile infection. Current Gastroenterology Reports 2:4, 310-314
CrossRef97
Dale N. Gerding. (2000) Good Antimicrobial Stewardship in the Hospital: Fitting, but Flagrantly Flagging • . Infection Control and Hospital Epidemiology 21:4, 253-255
CrossRef98
Gorbach, Sherwood L., . (1999) Antibiotics and Clostridium difficile. New England Journal of Medicine 341:22, 1690-1691
Full Text
