Original Article
An Outbreak of Multidrug-Resistant, Quinolone-Resistant Salmonella enterica Serotype Typhimurium DT104
N Engl J Med 1999; 341:1420-1425November 4, 1999
- Abstract
Background
Food-borne salmonella infections have become a major problem in industrialized countries. The strain of Salmonella enterica serotype typhimurium known as definitive phage type 104 (DT104) is usually resistant to five drugs: ampicillin, chloramphenicol, streptomycin, sulfonamides, and tetracycline. An increasing proportion of DT104 isolates also have reduced susceptibility to fluoroquinolones.
Methods
The Danish salmonella surveillance program determines the phage types of all typhimurium strains from the food chain, and in the case of suspected outbreaks, five-drug–resistant strains are characterized by molecular methods. All patients infected with five-drug–resistant typhimurium are interviewed to obtain clinical and epidemiologic data. In 1998, an outbreak of salmonella occurred, in which the strain of typhimurium DT104 was new to Denmark. We investigated this outbreak and report our findings here.
Results
Until 1997, DT104 infections made up less than 1 percent of all human salmonella infections. The strain isolated from patients in the first community outbreak of DT104 in Denmark, in 1998, was resistant to nalidixic acid and had reduced susceptibility to fluoroquinolones. The outbreak included 25 culture-confirmed cases. Eleven patients were hospitalized, and two died. The molecular epidemiology and data from patients indicated that the primary source was a Danish swine herd. Furthermore, the investigation suggested reduced clinical effectiveness of treatment with fluoroquinolones.
Conclusions
Our investigation of an outbreak of DT104 documented the spread of quinolone-resistant bacteria from food animals to humans; this spread was associated with infections that were difficult to treat. Because of the increase in quinolone resistance in salmonella, the use of fluoroquinolones in food animals should be restricted.
Media in This Article
Figure 1
Number of Cases of Quinolone-Resistant, Multidrug-Resistant Salmonella enterica Serotype Typhimurium DT104 in Denmark, According to Week of Onset, May through August 1998.Table 1
Patients Infected with Quinolone-Resistant, Multidrug-Resistant Salmonella enterica Serotype Typhimurium DT104 in Denmark, February through August 1998.Article Activity
- Article
The incidence of zoonotic food-borne salmonella infections has increased in most industrialized countries. Of particular concern is the spread of multidrug-resistant Salmonella enterica serotype typhimurium, known as definitive phage type 104 (DT104).1,2 In Denmark, efforts have been made to control salmonella in chickens (layers and broilers) and pigs.3 Intensive surveillance for salmonella in live animals and in food products is conducted during processing and distribution to wholesalers and retailers. These data, together with the data from surveillance of diseases in humans, are collated and analyzed at the Danish Zoonosis Center, a network including the Danish Veterinary Laboratory, the Food and Veterinary Administration, and the Statens Serum Institut. In this report we describe how this surveillance system identified and controlled an outbreak of multidrug-resistant DT104. The investigation provided a unique opportunity to document the spread of an infectious agent through the food chain. Furthermore, the results indicate the reduced effectiveness of treatment of human disease with the spread of a quinolone-resistant strain of DT104.
Methods
Surveillance
In Denmark the diagnosis of human salmonella infections is carried out at the Statens Serum Institut and at eight clinical microbiology laboratories. The Statens Serum Institut receives notification of positive findings as well as isolates from the microbiology laboratories. Surveillance for multidrug-resistant typhimurium DT104 is carried out by monitoring the antibiotic susceptibility of all strains of typhimurium and by phage typing of the isolates at the Danish Veterinary Laboratory.4-7 Telephone interviews are conducted prospectively with patients who are infected with typhimurium strains that are resistant to ampicillin, chloramphenicol, streptomycin, sulfonamides, and tetracycline — that is, strains indicative of five-drug–resistant typhimurium DT104. The aim is to obtain standardized clinical and epidemiologic information, and the interview includes data on food consumption and place of purchase of consumed food. In the present investigation, information on the place of purchase was compared with the distribution list from a slaughterhouse suspected as the source of the DT104 strain.
The surveillance of food animals and food of animal origin is described in the annual report of the Danish Zoonosis Center.3 Every commercial flock of layers and broilers and every herd producing more than 100 pigs for slaughter per year is regularly tested for salmonella by a combination of serologic and bacteriologic methods. Cattle herds are tested only when there is suspicion of infection. All slaughterhouses take part in salmonella monitoring. Every flock of broilers is tested after slaughter, and approximately 30,000 end-product samples of pork and 3000 end-product samples of beef are tested yearly. The number of samples tested from each slaughterhouse is proportional to the number of animals slaughtered. Approximately 12,000 to 15,000 samples from retail outlets are tested by municipal food-control units. A total of more than 2 million samples from living animals and food of animal origin are tested for salmonella annually in Denmark. All isolates of salmonella are submitted to the Danish Veterinary Laboratory for serotyping and additional characterization.
The 1998 Outbreak
In June 1998, an unusual strain of typhimurium was identified in specimens or cultures from five patients and from samples of pork obtained from a slaughterhouse. We used epidemiologic and microbiologic methods to investigate the source of this outbreak, to search for additional cases, and to determine the mode of transmission of infection.
Microbiologic Examination
Antibiotic-susceptibility testing of isolates from humans was performed by tablet diffusion on Danish Blood Agar (SSI Diagnostica, Hillerød, Denmark) with the use of Rosco Neosensitabs (Rosco, Roskilde, Denmark). Nalidixic acid–resistant strains were tested for susceptibility to ciprofloxacin with the E test (Biodisk, Solna, Sweden). The antibiotic susceptibility of isolates from animals and food was examined as previously described.8
Strains of DT104 from animals, food, and humans were analyzed by pulsed-field gel electrophoresis (PFGE), carried out in a contour-clamped homogeneous electric-field system (Pulsaphor Plus, Pharmacia LKB, Uppsala, Sweden). The preparation of DNA blocks and digestion with restriction enzymes were carried out as previously described.9 All strains were analyzed with the use of the restriction enzymes XbaI and BlnI. The electrophoretic running conditions for analysis with both enzymes were 12 V per centimeter at 14°C for 23 hours. Pulse times were increased in steps, as follows: 10 seconds for 22 hours, 15 seconds for 52 hours, 20 seconds for 6 hours, 40 seconds for 5 hours, and 60 seconds for 4 hours. Polymerized phage lambda DNA (Pharmacia LKB) was used as a molecular-size marker.
After electrophoresis, gels were stained in aqueous bromide (Sigma, St. Louis) at 2 μg per milliliter for 15 minutes and photographed under ultraviolet light (300 nm). Each fragment pattern that differed from the others in one or more fragments of more than 100 kilobases was assigned a type number.
A 342-base-pair fragment of the gyrA gene was amplified with the primers P1 (5'TACCGTCATAGTTATCCACGA) and P2 (5'GTACTTTACGCCATGAACGT). The amplification products were sequenced on an ABI 373A automatic sequencer with the AmpliTaq FS dye terminator kit (Applied Biosystems, Foster City, Calif.). The sequences were compared and analyzed by DNAsis software (Hitachi Software Engineering, Yokohama, Japan).
Results
Identification of the Outbreak
The outbreak came to light on June 18, 1998, when an unusual resistance pattern appeared in typhimurium found in specimens or cultures from five patients received between June 9 and June 16, 1998 (Patients 5, 6, 9, 10, and 13) (Table 1Table 1
Patients Infected with Quinolone-Resistant, Multidrug-Resistant Salmonella enterica Serotype Typhimurium DT104 in Denmark, February through August 1998.). On the same day, a sample of pork collected on May 26 at a slaughterhouse on the island of Zealand was recognized to be positive for typhimurium with the same resistance profile as that seen in the isolates from the five patients. This resistance profile was also found in typhimurium strains from two pork samples routinely collected by municipal food inspectors. In both cases, the wholesalers had received pork from the slaughterhouse on Zealand. Besides being resistant to five drugs, the strains were resistant to nalidixic acid. This resistance profile had not previously been detected in salmonella from Danish animals or animal-derived foods, and it had been detected only twice in salmonella from humans (Table 1, Patients 1 and 2). Because of the unusual resistance pattern, we hypothesized that the five cases of disease in humans were caused by multidrug-resistant typhimurium in pork from the slaughterhouse.Tracing the Source
Investigation at the slaughterhouse revealed that the pork sample positive for multidrug-resistant typhimurium probably came from pigs that had been delivered to the slaughterhouse on May 20, 22, or 25. During these three days, animals from a total of 37 herds had been delivered, and samples from each pen of animals were screened bacteriologically. One herd, a fattening swine herd, was found to be infected with the strain identified in the outbreak. On subsequent investigation of contacts of the infected herd, the outbreak strain was found in another swine herd that had delivered piglets and shared machinery with the fattening herd. Nearly 90 herds were examined in connection with this investigation, and only these 2 herds tested positive. The veterinarian responsible for the implicated herds gave a written statement that fluoroquinolones had not been used in the herds in 1998.
During the period of approximately four months when the outbreak was under investigation, the outbreak strain was not detected in any of 3296 follow-up fecal samples collected from 313 herds in which pigs were seropositive for salmonella or in any of approximately 5000 samples of pork products collected at all slaughterhouses in the country. Furthermore, it was not detected in any other animal herds or samples from slaughterhouses.
Microbiologic Investigations
The unusual resistance pattern was found in isolates from all the patients, the slaughterhouse, the two pork samples from the food-inspection agencies, and the two swine herds. It was also found in one isolate obtained later during the outbreak from a sample of smoked tenderloin and in an isolate from pork from the kitchen of Patient 19. All these isolates were of DT104, with the same resistance phenotype. The strains were susceptible to ciprofloxacin, as judged by tablet diffusion. The minimal inhibitory concentration of ciprofloxacin in the isolates from the outbreak ranged from 0.064 to 0.124 mg per liter. These isolates were 1/10 as susceptible to ciprofloxacin as the isolates that were susceptible to nalidixic acid.
PFGE patterns for the majority of strains investigated, including the isolates from animals and food of animal origin, were indistinguishable. Two strains from humans varied in either the XbaI profile (Patient 8) or the BlnI profile (Patient 19).
Sequence analysis of the polymerase-chain-reaction–amplified region of the gyrA gene identified a base substitution at codon 87 (according to Escherichia coli numbering10) in all isolates from humans. The substitution (GAC→AAC) causes an amino acid change from aspartate to asparagine. All isolates from food related to the outbreak contained the same substitution, as did isolates from two swine herds related to the outbreak. Nalidixic acid–resistant DT104 isolates from food originating in Germany and the United Kingdom and from a Danish swine herd, found at a later stage and not epidemiologically related to the Danish outbreak, contained a base-pair substitution at codon 83. The isolates from food from the United Kingdom and from the Danish swine herd contained a TCC→TTC substitution (serine to phenylalanine), and the isolate from food from Germany contained a TCC→TAC substitution (serine to tyrosine).
Epidemiologic Investigations
Table 1 summarizes the characteristics of 27 registered cases of quinolone-resistant, multidrug-resistant typhimurium DT104 infection in Denmark through August 1998, and Figure 1Figure 1
Number of Cases of Quinolone-Resistant, Multidrug-Resistant Salmonella enterica Serotype Typhimurium DT104 in Denmark, According to Week of Onset, May through August 1998. shows the course of the epidemic. Two patients probably acquired infection by occupational transmission. Patient 18 was a worker at the incriminated slaughterhouse, and Patient 23 was a nurse who cared for Patient 21. The nurse was exposed in the hospital ward where the patient was admitted. She had malaise and low-grade fever during the week after exposure and diarrhea seven days after exposure. Patient 25 acquired salmonella infection at the hospital, where she shared a room with Patient 21. Among the remaining 23 patients, data on food exposure were available for 19; 18 of these had consumed pork products, including meatballs, tenderloin, and roast pork. Patient 19 had tasted a raw meatball before cooking it. She became ill with diarrhea and vomiting 4.5 hours after exposure. The outbreak strain was later found in the patient's kitchen in leftover frozen pork.An association with the consumption of pork originating from the slaughterhouse was established for cases with disease onset after May 26, the day multidrug-resistant typhimurium was found in the slaughterhouse (Figure 1). All patients had acquired gastroenteritis in Denmark, and 9 of 18 patients had eaten pork originating from the slaughterhouse concerned. In the same period, 13 patients with quinolone-sensitive DT104 were interviewed. Four had travel-associated infections (P=0.02 for the comparison with patients with quinolone-resistant DT104 infection, by Fisher's exact test), and none of the nine patients with domestically acquired infections had consumed pork from these retailers (P=0.01 for the comparison with patients with quinolone-resistant DT104 infection, by Fisher's exact test).
The median age of the patients listed in Table 1 was 45 years, and they were ill for a median of 14 days (interquartile range, 10 to 21). At least seven had a history of antibiotic use before the onset of disease. Eleven patients were admitted to the hospital with gastroenteritis or septicemia. Fluoroquinolone treatment was reported to lack clinical effect in at least four cases. Patients 10, 12, and 19 had persistent diarrhea despite treatment with ciprofloxacin or fleroxacin; they recovered after treatment with mecillinam (Patient 19) or discontinuation of treatment (Patients 10 and 12). From Patient 19, three strains isolated after treatment were tested for susceptibility to ciprofloxacin, and the minimal inhibitory concentration for all isolates remained 0.09 mg per liter.
Patient 14 was a 62-year-old woman without chronic or malignant disease. She was admitted to the hospital after nine days with gastrointestinal symptoms. During five days of treatment with ciprofloxacin (250 mg twice daily), intestinal perforation developed, and laparotomy was performed. The patient was treated before and after the operation with ceftriaxone and gentamicin, and again with ciprofloxacin for four days, but she died of multiorgan failure. Salmonella was not cultured from samples taken at the time of operation. Autopsy revealed peritonitis and a perforation of the colon.
Patient 25 was an 82-year-old woman with diabetes mellitus and enteropathy after radiotherapy for uterine cancer, who was admitted to the hospital after eight days with malabsorptive symptoms. In the hospital she became infected with DT104 and intestinal perforation developed. She died more than two months after the onset of gastroenteritis. Diagnoses at autopsy included perforations of both the ileum and the urinary bladder and peritonitis. Salmonella was cultured from the peritoneal fluid at autopsy. Patient 3, who had fecal, urinary, and blood cultures positive for salmonella, was treated with ciprofloxacin eight days after the onset of gastroenteritis. The patient recovered after 10 days of treatment with intravenous ciprofloxacin (400 mg twice daily). Salmonella was isolated from blood cultures taken two days after the initiation of treatment. Patient 27 had a dual infection with campylobacter species and underwent an appendectomy. Antimicrobial treatment was initiated after the operation.
Discussion
Since the beginning of the 1990s, infections with the zoonotic salmonella typhimurium DT104 have been recognized in several countries.1,2 It has a broad host spectrum and the potential of spreading to large numbers of domestic as well as to wild animals. Because of its extensive reservoir, DT104 is difficult to control in animal husbandry. It is often resistant to five antibacterial agents and can also be resistant to others, including the fluoroquinolones. Since fluoroquinolones are the drugs of first choice for extraintestinal and serious intestinal complications of human salmonellosis, fluoroquinolone resistance has the potential of causing problems with therapy. There is, however, little documented evidence of the effect of quinolone-resistant salmonella on human health.11
Denmark has active surveillance of salmonella at farms, including nearly all commercial food-animal producers, and all slaughterhouses. Isolates generated through the surveillance system are collected, characterized, and stored centrally. This system yields detailed information on the prevalence of and trends in the distribution of different salmonella types in national food production, and the emergence of new types of salmonella can quickly be detected. Until 1997, DT104 infections accounted for less than 1 percent of the total number of human salmonella infections, and apart from a small hospital outbreak in 1996, only sporadic cases had been recorded.3 The present emergence of a quinolone-resistant strain is the first community outbreak in Denmark.
Our investigation suggested that the source of the outbreak was pork from a slaughterhouse. The peak of the epidemic curve (during weeks 22 and 23 of 1998) coincided with the demonstration of the outbreak strain in the slaughterhouse, and the data on food exposure were corroborated by the results of PFGE typing and sequence analysis of a fragment of the gyrA gene. All isolates from the outbreak contained the same mutation, whereas isolates from another pig herd and from pork from Germany and the United Kingdom did not. A number of different base-pair substitutions in the gyrA gene of salmonella have been found to result in resistance to nalidixic acid. The GAC→AAC substitution (aspartate to asparagine) at codon 87 that was found in this outbreak has been infrequently detected in salmonella isolates.12-15 However, Ridley and Threlfall16 found that 11 of 15 nalidixic acid–resistant DT104 isolates contained this substitution.
It is likely that the reservoir of the outbreak clone was the two identified swine herds. Surveillance for salmonella identified no other isolates of the outbreak strain in Danish food animals, end products from slaughterhouses, or other meat products.
The outbreak strain was resistant to nalidixic acid but would be considered susceptible to fluoroquinolones according to standard cutoff points for the drugs' minimal inhibitory concentrations.17 The outbreak strain had one mutation in the gyrase gene, and no strains with two or more mutations were recovered during treatment. Nevertheless, an impaired response to fluoroquinolone treatment was reported. Fluoroquinolones frequently fail to change the natural course of diarrhea due to salmonella, especially if the diarrhea has lasted for more than a week before treatment is instituted.18 However, in the present study, diarrhea resolved promptly when the treatment was changed from ciprofloxacin to mecillinam in one patient, and an intestinal perforation developed in another patient during treatment with ciprofloxacin. It is important to emphasize that it would have been impossible to predict the clinical course of these patients even if they had been infected by a quinolone-sensitive strain.
Careful epidemiologic studies are warranted to determine the effect of reduced fluoroquinolone susceptibility on human health and its implications for treatment options. Despite this note of caution, our data suggest that salmonella strains with one mutation in the gyrase gene may respond poorly to fluoroquinolones, as suggested by others.19,20 Because reduced susceptibility cannot be detected by disk or tablet diffusion with newer fluoroquinolones, susceptibility to nalidixic acid may be used as a surrogate marker.19 Minimal inhibitory concentrations of ciprofloxacin should be determined for nalidixic acid–resistant strains.
Fluoroquinolones were licensed for veterinary use in Denmark in 1993. In 1998 fluoroquinolones accounted for 400 kg of a total of 57,300 kg of antimicrobial agents consumed by all food-producing animals, and there was no indication of fluoroquinolone use in 1998 in the implicated herds. These observations suggest that selection pressures were not extensive in this outbreak. It is impossible to determine whether the gyrA mutant was introduced by pigs from outside Denmark, was introduced by environmental spread (e.g., from wild animals or equipment), or was related to the use of fluoroquinolones at the suspected farms before 1998.
The incubation period ranged from 4.5 hours to 7 days, although the incubation period of salmonella is said to be usually 16 to 72 hours.21 Although most patients were infected by food products, we also demonstrated occupational and nosocomial transmission. Several of the patients had taken antimicrobial drugs before the onset of disease; this observation is in line with studies suggesting that antibiotic treatment is an important risk factor for antimicrobial-resistant infections.22
In conclusion, our investigation documented how quinolone-resistant, multidrug-resistant S. enterica serotype typhimurium DT104 spread from food animals to humans. Through an integrated surveillance system, it was possible to detect the outbreak and mitigate the spread of this strain of salmonella. Furthermore, in vitro resistance to nalidixic acid in isolates was associated with reduced efficacy of fluoroquinolones in vivo. Because fluoroquinolones remain a standard empirical treatment for suspected extraintestinal salmonella infections and serious gastroenteritis, particularly in patients with underlying health problems, the occurrence of quinolone-resistant salmonella in animals is of great concern. To avoid the selection of quinolone-resistant strains, with a potential for clonal spread, fluoroquinolones should not be used in food animals unless other therapeutic options have been ruled out.
Source Information
From Statens Serum Institut (K.M., J.E., P.G.-S., A.M.P.), the Danish Veterinary Laboratory (D.L.B., F.M.A., K.F.), the Danish Food and Veterinary Administration (J.M.E.), and the Danish Zoonosis Center (H.C.W.) — all in Copenhagen, Denmark.
Address reprint requests to Dr. Mølbak at Statens Serum Institut, Artillerivej 5, DK-2300 Copenhagen S, Denmark.
- References
References
1
Threlfall EJ ,Frost JA ,Ward LR ,Rowe B . Increasing spectrum of resistance in multiresistant Salmonella typhimurium. Lancet 1996;347:1053-1054
CrossRef | Web of Science | Medline2
Glynn MK ,Bopp C ,Dewitt W ,Dabney P ,Mokhtar M ,Angulo FJ . Emergence of multidrug-resistant Salmonella enterica serotype typhimurium DT104 infections in the United States. N Engl J Med 1998;338:1333-1338
Full Text | Web of Science | Medline3
Hald T, Wegener HC, Jørgensen BB, eds. Annual report on zoonoses in Denmark 1997. Copenhagen, Denmark: Danish Zoonosis Centre, 1998.
4
Callow BR . A new phage-typing scheme for Salmonella typhimurium. J Hyg (Lond) 1959;57:346-359
CrossRef | Medline5
Anderson ES ,Ward LR ,Saxe MJ ,de Sa JD . Bacteriophage-typing designations of Salmonella typhimurium. J Hyg (Lond) 1977;78:297-300
CrossRef | Web of Science | Medline6
Wegener HC ,Baggesen DL ,Gaarslev K . Salmonella typhimurium phage types from human salmonellosis in Denmark 1988-1993. APMIS 1994;102:521-525
CrossRef | Web of Science | Medline7
Baggesen DL ,Wegener HC . Phage types of Salmonella enterica ssp. enterica serovar typhimurium isolated from production animals and humans in Denmark. Acta Vet Scand 1994;35:349-354
Web of Science | Medline8
Seyfarth AM ,Wegener HC ,Frimodt-Moller N . Antimicrobial resistance in Salmonella enterica subsp. enterica serovar typhimurium from humans and production animals. J Antimicrob Chemother 1997;40:67-75
CrossRef | Web of Science | Medline9
Olsen JE ,Skov MN ,Threlfall EJ ,Brown DJ . Clonal lines of Salmonella enterica serotype Enteritidis documented by IS200-, ribo-, pulsed-field gel electrophoresis and RFLP typing. J Med Microbiol 1994;40:15-22
CrossRef | Web of Science | Medline10
Yoshida H ,Bogaki M ,Nakamura M ,Nakamura S . Quinolone resistance-determining region in the DNA gyrase gyrA gene of Escherichia coli. Antimicrob Agents Chemother 1990;34:1271-1272
Web of Science | Medline11
Division of Emerging and Other Communicable Disease Surveillance and Control. The medical impact of the use of antimicrobials in food animals: report and proceedings of a WHO meeting: Berlin, Germany, 13-17 October 1997. Geneva: World Health Organization, 1997. (Document no. WHO/EMC/ZOO/97.4.)
12
Griggs DJ ,Gensberg K ,Piddock LJV . Mutations in gyrA gene of quinolone-resistant Salmonella serotypes isolated from humans and animals. Antimicrob Agents Chemother 1996;40:1009-1013
Web of Science | Medline13
Ouabdesselam S ,Tankovic J ,Soussy CJ . Quinolone resistance mutations in the gyrA gene of clinical isolates of Salmonella. Microb Drug Resist 1996;2:299-302
CrossRef | Web of Science | Medline14
Piddock LJV ,Ricci V ,McLaren I ,Griggs DJ . Role of mutation in the gyrA and parC genes of nalidixic-acid-resistant salmonella serotypes isolated from animals in the United Kingdom. J Antimicrob Chemother 1998;41:635-641
CrossRef | Web of Science | Medline15
Ruiz J ,Castro D ,Goni P ,Santamaria JA ,Borrego JJ ,Vila J . Analysis of the mechanism of quinolone resistance in nalidixic acid-resistant clinical isolates of Salmonella serotype Typhimurium. J Med Microbiol 1997;46:623-628
CrossRef | Web of Science | Medline16
Ridley A ,Threlfall EJ . Molecular epidemiology of antibiotic resistance genes in multiresistant epidemic Salmonella typhimurium DT 104. Microb Drug Resist 1998;4:113-118
CrossRef | Web of Science | Medline17
Performance standards for antimicrobial susceptibility testing: ninth informational supplement. Vol. 19. No. 1. Wayne, Pa.: National Committee for Clinical Laboratory Standards, 1999. (NCCLS document no. M-100-S9.)
18
Wistrom J ,Norrby SR . Fluoroquinolones and bacterial enteritis, when and for whom? J Antimicrob Chemother 1995;36:23-39
CrossRef | Web of Science | Medline19
Vasallo FJ ,Martin-Rabadan P ,Alcala L ,Garcia-Lechuz JM ,Rodriguez-Creixems M ,Bouza E . Failure of ciprofloxacin therapy for invasive non-typhoidal salmonellosis. Clin Infect Dis 1998;26:535-536
CrossRef | Web of Science | Medline20
Wain J ,Hoa NT ,Chinh NT , et al. Quinolone-resistant Salmonella typhi in Viet Nam: molecular basis of resistance and clinical response to treatment. Clin Infect Dis 1997;25:1404-1410
CrossRef | Web of Science | Medline21
Anglim AM, Schaffner W, Farr BM. Prevention and control of nosocomial enteric infections. In: Blaser MJ, Smith PD, Ravdin JI, Greenberg HB, Guerrant RL, eds. Infections of the gastrointestinal tract. New York: Raven Press, 1995:1525-45.
22
Holmberg SD ,Osterholm MT ,Senger KA ,Cohen ML . Drug-resistant Salmonella from animals fed antimicrobials. N Engl J Med 1984;311:617-622
Full Text | Web of Science | Medline
- Citing Articles (124)
Citing Articles
1
R. COX, T. SU, H. CLOUGH, M. J. WOODWARD, C. SHERLOCK. (2012) Spatial and temporal patterns in antimicrobial resistance of Salmonella Typhimurium in cattle in England and Wales. Epidemiology and Infection1-12
CrossRef2
V. Ricci, N. Loman, M. Pallen, A. Ivens, M. Fookes, G. C. Langridge, J. Wain, L. J. V. Piddock. (2011) The TCA cycle is not required for selection or survival of multidrug-resistant Salmonella. Journal of Antimicrobial Chemotherapy
CrossRef3
Jianxian Sun, Jianying Hu, Hui Peng, Jiachen Shi, Zhaomin Dong. (2011) Molecular and physiological characterization of fluoroquinolone resistance in relation to uropathogenicity among Escherichia coli isolates isolated from Wenyu River, China. Chemosphere
CrossRef4
A. E. Mather, L. Matthews, D. J. Mellor, R. Reeve, M. J. Denwood, P. Boerlin, R. J. Reid-Smith, D. J. Brown, J. E. Coia, L. M. Browning, D. T. Haydon, S. W. J. Reid. (2011) An ecological approach to assessing the epidemiology of antimicrobial resistance in animal and human populations. Proceedings of the Royal Society B: Biological Sciences
CrossRef5
Migma Dorji Tamang, Hyang-Mi Nam, Aeran Kim, Hee-Soo Lee, Tae-Sun Kim, Min-Ji Kim, Geum-Chan Jang, Suk-Chan Jung, Suk-Kyung Lim. (2011) Prevalence and Mechanisms of Quinolone Resistance Among Selected Nontyphoid Salmonella Isolated from Food Animals and Humans in Korea. Foodborne Pathogens and Disease 8:11, 1199-1206
CrossRef6
Sepideh Pakpour, Suha Jabaji, Martin R. Chénier. (2011) Frequency of Antibiotic Resistance in a Swine Facility 2.5 Years After a Ban on Antibiotics. Microbial Ecology
CrossRef7
S. Van Boxstael, K. Dierick, X. Van Huffel, M. Uyttendaele, D. Berkvens, L. Herman, S. Bertrand, C. Wildemauwe, B. Catry, P. Butaye, H. Imberechts. (2011) Comparison of antimicrobial resistance patterns and phage types of Salmonella Typhimurium isolated from pigs, pork and humans in Belgium between 2001 and 2006. Food Research International
CrossRef8
Seiji Yamasaki, Saya Nagasawa, Mitsuko Hayashi-Nishino, Akihito Yamaguchi, Kunihiko Nishino. (2011) AcrA dependency of the AcrD efflux pump in Salmonella enterica serovar Typhimurium. The Journal of Antibiotics 64:6, 433-437
CrossRef9
Ross C. Beier, Phelue N. Anderson, Michael E. Hume, Toni L. Poole, Sara E. Duke, Tawni L. Crippen, Cynthia L. Sheffield, David J. Caldwell, James A. Byrd, Robin C. Anderson, David J. Nisbet. (2011) Characterization of Salmonella enterica Isolates from Turkeys in Commercial Processing Plants for Resistance to Antibiotics, Disinfectants, and a Growth Promoter. Foodborne Pathogens and Disease 8:5, 593-600
CrossRef10
I. RUDDAT, S. SCHWARZ, E. TIETZE, D. ZIEHM, L. KREIENBROCK. (2011) A quantitative approach to analyse linkages between antimicrobial resistance properties in Salmonella Typhimurium isolates. Epidemiology and Infection1-11
CrossRef11
Leonard Amaral, Seamus Fanning, Jean-Marie Pagès. 2011. Efflux Pumps of Gram-Negative Bacteria: Genetic Responses to Stress and the Modulation of their Activity by pH, Inhibitors, and Phenothiazines. , 61-108.
CrossRef12
T. Horiyama, E. Nikaido, A. Yamaguchi, K. Nishino. (2011) Roles of Salmonella multidrug efflux pumps in tigecycline resistance. Journal of Antimicrobial Chemotherapy 66:1, 105-110
CrossRef13
Karin Hoelzer, Andrea Moreno Switt, Martin Wiedmann. (2011) Animal contact as a source of human non-typhoidal salmonellosis. Veterinary Research 42:1, 34
CrossRef14
Panagiota Gousia, Vagelis Economou, Hercules Sakkas, Stamatina Leveidiotou, Chrissanthy Papadopoulou. (2011) Antimicrobial Resistance of Major Foodborne Pathogens from Major Meat Products. Foodborne Pathogens and Disease 8:1, 27-38
CrossRef15
Yun Xu, William Cheung, Catherine L. Winder, Warwick B. Dunn, Royston Goodacre. (2011) Metabolic profiling of meat: assessment of pork hygiene and contamination with Salmonella typhimurium. The Analyst 136:3, 508
CrossRef16
H. Scott Hurd, Michael B. Vaughn, Derald Holtkamp, James Dickson, Lorin Warnick. (2010) Quantitative Risk from Fluoroquinolone-Resistant Salmonella and Campylobacter Due to Treatment of Dairy Heifers with Enrofloxacin for Bovine Respiratory Disease. Foodborne Pathogens and Disease 7:11, 1305-1322
CrossRef17
E. John Threlfall. 2010. Salmonella. .
CrossRef18
In Sook Hwang, Joon Young Song, Woo Joo Kim, Hye Won Jeong, Moo Sang Kim, Hee Jin Cheong. (2010) Prevalence and Mechanisms of Low Level Quinolone Resistance among Non-Typhoidal Salmonella Isolates from Human and poultry/Livestock in Korea: Usefulness of Nalidixic Acid Resistance Test. Infection and Chemotherapy 42:4, 230
CrossRef19
Jian-Xiang Wu, Shao-en Zhang, Xue-ping Zhou. (2010) Monoclonal antibody-based ELISA and colloidal gold-based immunochromatographic assay for streptomycin residue detection in milk and swine urine. Journal of Zhejiang University SCIENCE B 11:1, 52-60
CrossRef20
Si-Yang Huang, Lei Dai, Li-Ning Xia, Xiang-Dang Du, Yong-Hua Qi, He-Bing Liu, Cong-Ming Wu, Jian-Zhong Shen. (2009) Increased Prevalence of Plasmid-Mediated Quinolone Resistance Determinants in Chicken Escherichia coli Isolates from 2001 to 2007. Foodborne Pathogens and Disease 6:10, 1203-1209
CrossRef21
Martin R. Chénier, Pierre Juteau. (2009) Impact of an Aerobic Thermophilic Sequencing Batch Reactor on Antibiotic-Resistant Anaerobic Bacteria in Swine Waste. Microbial Ecology 58:4, 773-785
CrossRef22
YANPING LUO, JINGYUN LI, YUE MA, CHANGQIN HU, SHAOHONG JIN, SHENGHUI CUI. (2009) ISOLATION AND CHARACTERIZATION OF NONTYPHOID SALMONELLA FROM HOSPITAL FOOD HANDLERS IN BEIJING, CHINA. Journal of Food Safety 29:3, 414-423
CrossRef23
Martin R. Chénier, Pierre Juteau. (2009) Fate of Chlortetracycline- and Tylosin-Resistant Bacteria in an Aerobic Thermophilic Sequencing Batch Reactor Treating Swine Waste. Microbial Ecology 58:1, 86-97
CrossRef24
H. KORSGAARD, M. MADSEN, N. C. FELD, J. MYGIND, T. HALD. (2009) The effects, costs and benefits of Salmonella control in the Danish table-egg sector. Epidemiology and Infection 137:06, 828
CrossRef25
Muhammad Azeem Saeed, Abdul Haque, Aamir Ali, Mashkoor Mohsin, Saira Bashir, Ayesha Tariq, Amna Afzal, Tayyaba Iftikhar, Yasra Sarwar. (2009) A profile of drug resistance genes and integrons in E. coli causing surgical wound infections in the Faisalabad region of Pakistan. The Journal of Antibiotics 62:6, 319-323
CrossRef26
Franz M. Geiger. (2009) Second Harmonic Generation, Sum Frequency Generation, and χ (3) : Dissecting Environmental Interfaces with a Nonlinear Optical Swiss Army Knife. Annual Review of Physical Chemistry 60:1, 61-83
CrossRef27
Endrias Zewdu, Poppe Cornelius. (2009) Antimicrobial resistance pattern of Salmonella serotypes isolated from food items and personnel in Addis Ababa, Ethiopia. Tropical Animal Health and Production 41:2, 241-249
CrossRef28
L’ubica Majtánová, Viktor Majtán. (2009) Molecular characterization of the multidrug-resistant phage types Salmonella enterica serovar Typhimurium DT104, DT20A and DT120 strains in the Slovakia. Microbiological Research 164:2, 157-162
CrossRef29
Lee Learn-Han, Cheah Yoke-Kqueen, Noorzaleha Awang Salleh, Sabrina Sukardi, Sim Jiun-Horng, Khoo Chai-Hoon, Son Radu. (2008) Analysis of Salmonella Agona and Salmonella Weltevreden in Malaysia by PCR fingerprinting and antibiotic resistance profiling. Antonie van Leeuwenhoek 94:3, 377-387
CrossRef30
M. E. RELLER, R. V. TAUXE, L. A. KALISH, K. MØLBAK. (2008) Excess salmonellosis in women in the United States: 1968–2000. Epidemiology and Infection 136:08,
CrossRef31
F. Boyen, F. Haesebrouck, D. Maes, F. Van Immerseel, R. Ducatelle, F. Pasmans. (2008) Non-typhoidal Salmonella infections in pigs: A closer look at epidemiology, pathogenesis and control. Veterinary Microbiology 130:1-2, 1-19
CrossRef32
C. García-Feliz, J. A. Collazos, A. Carvajal, S. Herrera, M. A. Echeita, P. Rubio. (2008) Antimicrobial Resistance of Salmonella enterica Isolates from Apparently Healthy and Clinically Ill Finishing Pigs in Spain. Zoonoses and Public Health 55:4, 195-205
CrossRef33
Jessica I. Lundin, David A. Dargatz, Bruce A. Wagner, Jason E. Lombard, Ashley E. Hill, Scott R. Ladely, Paula J. Fedorka-Cray. (2008) Antimicrobial Drug Resistance of Fecal Escherichia coli and Salmonella spp. Isolates from United States Dairy Cows. Foodborne Pathogens and Disease 5:1, 7-19
CrossRef34
Vincent O. Rotimi, Wafaa Jamal, Tibor Pal, Agnes Sonnevend, Tsonyo S. Dimitrov, M. John Albert. (2008) Emergence of multidrug-resistant Salmonella spp. and isolates with reduced susceptibility to ciprofloxacin in Kuwait and the United Arab Emirates. Diagnostic Microbiology and Infectious Disease 60:1, 71-77
CrossRef35
E. Mateu, M. Martin. (2008) Why is Anti-Microbial Resistance a Veterinary Problem As Well?. Journal of Veterinary Medicine, Series B 48:8, 569
CrossRef36
Leigh B. Rosengren, Cheryl L. Waldner, Richard J. Reid-Smith, Patricia M. Dowling, John C.S. Harding. (2007) Associations Between Feed and Water Antimicrobial Use in Farrow-to-Finish Swine Herds and Antimicrobial Resistance of Fecal Escherichia coli from Grow-Finish Pigs. Microbial Drug Resistance 13:4, 261-270
CrossRef37
M. KIVI, A. HOFHUIS, D. W. NOTERMANS, W. J. B. WANNET, M. E. O. C. HECK, A. W. VAN DE GIESSEN, Y. T. H. P. VAN DUYNHOVEN, O. F. J. STENVERS, A. BOSMAN, W. VAN PELT. (2007) A beef-associated outbreak of Salmonella Typhimurium DT104 in The Netherlands with implications for national and international policy. Epidemiology and Infection 135:06, 890
CrossRef38
Robyn S. Kay, Alexander G. Vandevelde, Paul D. Fiorella, Rebecca Crouse, Carina Blackmore, Roger Sanderson, Christina L. Bailey, Michael L. Sands. (2007) Outbreak of Healthcare‐Associated Infection and Colonization With Multidrug‐Resistant Salmonella enterica Serovar Senftenberg in Florida • . Infection Control and Hospital Epidemiology 28:7, 805-811
CrossRef39
Christine A. Bunner, Bo Norby, Paul C. Bartlett, Ronald J. Erskine, Frances P. Downes, John B. Kaneene. (2007) Prevalence and pattern of antimicrobial susceptibility in Escherichia coli isolated from pigs reared under antimicrobial-free and conventional production methods. Journal of the American Veterinary Medical Association 231:2, 275-283
CrossRef40
Swanson, Stephen J., Snider, Cynthia, Braden, Christopher R., Boxrud, David, Wünschmann, Arno, Rudroff, Jo AnnLockett, JanaSmith, Kirk E., . (2007) Multidrug-Resistant Salmonella enterica Serotype Typhimurium Associated with Pet Rodents. New England Journal of Medicine 356:1, 21-28
Full Text41
Hee Jin Cheong, Yeon Joo Lee, In Sook Hwang, Sae Yoon Kee, Hye Won Cheong, Joon Young Song, Jun Man Kim, Yong Ho Park, Ji-Hun Jung, Woo Joo Kim. (2007) Characteristics of Non-typhoidal Salmonella Isolates from Human and Broiler-chickens in Southwestern Seoul, Korea. Journal of Korean Medical Science 22:5, 773
CrossRef42
Xiuping Jiang, Hua Yang, Brittany Dettman, Michael P. Doyle. (2006) Analysis of Fecal Microbial Flora for Antibiotic Resistance in Ceftiofur-Treated Calves. Foodborne Pathogens and Disease 3:4, 355-365
CrossRef43
W. Si, J. Gong, C. Chanas, S. Cui, H. Yu, C. Caballero, R.M. Friendship. (2006) In vitro assessment of antimicrobial activity of carvacrol, thymol and cinnamaldehyde towards Salmonella serotype Typhimurium DT104: effects of pig diets and emulsification in hydrocolloids. Journal of Applied Microbiology 101:6, 1282-1291
CrossRef44
Mary J. Gilchrist, Christina Greko, David B. Wallinga, George W. Beran, David G. Riley, Peter S. Thorne. (2006) The Potential Role of Concentrated Animal Feeding Operations in Infectious Disease Epidemics and Antibiotic Resistance. Environmental Health Perspectives 115:2, 313-316
CrossRef45
J. L. Lusk, F. B. Norwood, J. R. Pruitt. (2006) Consumer Demand for a Ban on Antibiotic Drug Use in Pork Production. American Journal of Agricultural Economics 88:4, 1015-1033
CrossRef46
B. Langvad, M.N. Skov, E. Rattenborg, J.E. Olsen, D.L. Baggesen. (2006) Transmission routes of Salmonella Typhimurium DT 104 between 14 cattle and pig herds in Denmark demonstrated by molecular fingerprinting. Journal of Applied Microbiology 101:4, 883-890
CrossRef47
Laura J. V. Piddock. (2006) Multidrug-resistance efflux pumps — not just for resistance. Nature Reviews Microbiology 4:8, 629-636
CrossRef48
Hsun-Chin Chao, Chien-Chang Chen, Shih-Yen Chen, Cheng-Hsun Chiu. (2006) Bacterial enteric infections in children: etiology, clinical manifestations and antimicrobial therapy. Expert Review of Anti-infective Therapy 4:4, 629-638
CrossRef49
(2006) Antimicrobial Resistance: Implications for the Food System.. Comprehensive Reviews in Food Science and Food Safety 5:3, 71-137
CrossRef50
Qijing Zhang, Orhan Sahin, Patrick F. McDermott, Sophie Payot. (2006) Fitness of antimicrobial-resistant Campylobacter and Salmonella. Microbes and Infection 8:7, 1972-1978
CrossRef51
A. M. Dechet, E. Scallan, K. Gensheimer, R. Hoekstra, J. Gunderman-King, J. Lockett, D. Wrigley, W. Chege, J. Sobel, . (2006) Outbreak of Multidrug-Resistant Salmonella enterica Serotype Typhimurium Definitive Type 104 Infection Linked to Commercial Ground Beef, Northeastern United States, 2003-2004. Clinical Infectious Diseases 42:6, 747-752
CrossRef52
Caroline S. Zeind, R. Rebecca Couris. (2006) Prevention of Food and Waterborne Diseases While Traveling. Nutrition Today 41:2, 78-87
CrossRef53
Timothy J. Barrett, Peter Gerner-Smidt, Bala Swaminathan. (2006) Interpretation of Pulsed-Field Gel Electrophoresis Patterns in Foodborne Disease Investigations and Surveillance. Foodborne Pathogens and Disease 3:1, 20-31
CrossRef54
W. Si, J. Gong, R. Tsao, T. Zhou, H. Yu, C. Poppe, R. Johnson, Z. Du. (2006) Antimicrobial activity of essential oils and structurally related synthetic food additives towards selected pathogenic and beneficial gut bacteria. Journal of Applied Microbiology 100:2, 296-305
CrossRef55
2006. Sulfonamides. , 3216-3230.
CrossRef56
2006. Chloramphenicol. , 706-713.
CrossRef57
2006. Fluoroquinolones. , 1396-1407.
CrossRef58
Kunihiko Nishino, Tammy Latifi, Eduardo A. Groisman. (2006) Virulence and drug resistance roles of multidrug efflux systems of Salmonella enterica serovar Typhimurium. Molecular Microbiology 59:1, 126-141
CrossRef59
D. N. Taylor. (2005) Poorly Absorbed Antibiotics for the Treatment of Traveler' Diarrhea. Clinical Infectious Diseases 41:Supplement 8, S564-S570
CrossRef60
Miriam Weinberger, Nathan Keller. (2005) Recent trends in the epidemiology of non-typhoid Salmonella and antimicrobial resistance: the Israeli experience and worldwide review. Current Opinion in Infectious Diseases 18:6, 513-521
CrossRef61
F. J. Angulo, K. Molbak. (2005) Human Health Consequences of Antimicrobial Drug--Resistant Salmonella and Other Foodborne Pathogens. Clinical Infectious Diseases 41:11, 1613-1620
CrossRef62
Stephanie D. Wedel, Jeffrey B. Bender, Fe T. Leano, David J. Boxrud, Craig Hedberg, Kirk E. Smith. (2005) Antimicrobial-drug Susceptibility of Human and Animal Salmonella Typhimurium, Minnesota, 1997–2003. Emerging Infectious Diseases 11:12, 1899-1906
CrossRef63
B. Erdem, S. Ercis, G. Hascelik, D. Gur, A.D. Aysev. (2005) Antimicrobial resistance of Salmonella enterica group C strains isolated from humans in Turkey, 2000–2002. International Journal of Antimicrobial Agents 26:1, 33-37
CrossRef64
C. Seminati, W. Mejia, E. Mateu, M. Martin. (2005) Mutations in the quinolone-resistance determining region (QRDR) of Salmonella strains isolated from pigs in Spain. Veterinary Microbiology 106:3-4, 297-301
CrossRef65
B. Erdem, S. Ercis, G. Hascelik, D. Gur, S. Gedikoglu, A. D. Aysev, B. Sumerkan, M. Tatman-Otkun, I. Tuncer. (2005) Antimicrobial resistance patterns and serotype distribution among Salmonella enterica strains in Turkey, 2000?2002. European Journal of Clinical Microbiology & Infectious Diseases 24:3, 220-225
CrossRef66
U. Roesler, A. von Altrock, P. Heller, S. Bremerich, T. Arnold, J. Lehmann, K.-H. Waldmann, U. Truyen, A. Hensel. (2005) Effects of Fluorequinolone Treatment Acidified Feed, and Improved Hygiene Measures on the Occurrence of Salmonella Typhimurium DT104 in an Integrated Pig Breeding Herd. Journal of Veterinary Medicine Series B 52:2, 69-74
CrossRef67
Kenji Sato, Paul C. Bartlett, Mahdi A. Saeed. (2005) Antimicrobial susceptibility of Escherichia coli isolates from dairy farms using organic versus conventional production methods. Journal of the American Veterinary Medical Association 226:4, 589-594
CrossRef68
Trudy M. Wassenaar. (2005) Use of Antimicrobial Agents in Veterinary Medicine and Implications for Human Health. Critical Reviews in Microbiology 31:3, 155-169
CrossRef69
Uwe Roesler, Heike Marg, Ilka Schröder, Stephanie Mauer, Thorsten Arnold, Jörg Lehmann, Uwe Truyen, Andreas Hensel. (2004) Oral vaccination of pigs with an invasive gyrA-cpxA-rpoB Salmonella Typhimurium mutant. Vaccine 23:5, 595-603
CrossRef70
L. Tollefson. (2004) Developing New Regulatory Approaches to Antimicrobial Safety. Journal of Veterinary Medicine Series B 51:8-9, 415-418
CrossRef71
F. J. Angulo, V. N. Nargund, T. C. Chiller. (2004) Evidence of an Association Between Use of Anti-microbial Agents in Food Animals and Anti-microbial Resistance Among Bacteria Isolated from Humans and the Human Health Consequences of Such Resistance. Journal of Veterinary Medicine Series B 51:8-9, 374-379
CrossRef72
K. Molbak. (2004) Spread of Resistant Bacteria and Resistance Genes from Animals to Humans - The Public Health Consequences. Journal of Veterinary Medicine Series B 51:8-9, 364-369
CrossRef73
David G. White, Shaohua Zhao, Ruby Singh, Patrick F. McDermott. (2004) Antimicrobial Resistance Among Gram-Negative Foodborne Bacterial Pathogens Associated with Foods of Animal Origin. Foodborne Pathogens and Disease 1:3, 137-152
CrossRef74
Isabel Escribano, Juan C. Rodrı́guez, Gloria Royo. (2004) Mutations in the gyrA gene in Salmonella enterica clinical isolates with decreased ciprofloxacin susceptibility. International Journal of Antimicrobial Agents 24:3, 300-303
CrossRef75
L.-H. Su, C.-H. Chiu, C. Chu, J. T. Ou. (2004) Antimicrobial Resistance in Nontyphoid Salmonella Serotypes: A Global Challenge. Clinical Infectious Diseases 39:4, 546-551
CrossRef76
P.-A Belœil, P Fravalo, C Fablet, J.-P Jolly, E Eveno, Y Hascoet, C Chauvin, G Salvat, F Madec. (2004) Risk factors for Salmonella enterica subsp. enterica shedding by market-age pigs in French farrow-to-finish herds. Preventive Veterinary Medicine 63:1-2, 103-120
CrossRef77
Manuel L. Fern??ndez Guerrero, Jos?? Maria Aguado, Ana Arribas, Carlos Lumbreras, Miguel de Gorgolas. (2004) The Spectrum of Cardiovascular Infections due to Salmonella enterica. Medicine 83:2, 123-138
CrossRef78
Emanuel Goldman. (2004) Antibiotic Abuse in Animal Agriculture: Exacerbating Drug Resistance in Human Pathogens. Human and Ecological Risk Assessment: An International Journal 10:1, 121-134
CrossRef79
Alicia D. Anderson, Jennifer M. Nelson, Shannon Rossiter, Frederick J. Angulo. (2003) Public Health Consequences of Use of Antimicrobial Agents in Food Animals in the United States. Microbial Drug Resistance 9:4, 373-379
CrossRef80
Jennifer M. Stephen, Mark A. Toleman, Timothy R. Walsh, Ronald N. Jones. (2003) Salmonella bloodstream infections: report from the SENTRY Antimicrobial Surveillance Program (1997–2001). International Journal of Antimicrobial Agents 22:4, 395-405
CrossRef81
Dominique Gendrel, Martin Chalumeau, Florence Moulin, Josette Raymond. (2003) Fluoroquinolones in paediatrics: a risk for the patient or for the community?. The Lancet Infectious Diseases 3:9, 537-546
CrossRef82
N. Fisker, K. Vinding, K. Molbak, M. K. Hornstrup. (2003) Clinical Review of Nontyphoid Salmonella Infections from 1991 to 1999 in a Danish Country. Clinical Infectious Diseases 37:4, e47-e52
CrossRef83
S.M.L. Stevenson, T.A. McAllister, L.B. Selinger, L.J. Yanke, M.E. Olson, D.W. Morck, R.R. Read. (2003) Transfer of a rifampicin-resistant Escherichia coli strain among feedlot cattle. Journal of Applied Microbiology 95:2, 398-410
CrossRef84
P. D. Crook, J. F. Aguilera, E. J. Threlfall, S. J. O'Brien, G. Sigmundsdottir, D. Wilson, I. S. T. Fisher, A. Ammon, H. Briem, J. M. Cowden, M. E. Locking, H. Tschape, W. van Pelt, L. R. Ward, M. A. Widdowson. (2003) A European outbreak of Salmonella enterica serotype Typhimurium definitive phage type 204b in 2000. Clinical Microbiology and Infection 9:8, 839-845
CrossRef85
John A. Crump, Timothy J. Barrett, Jennifer T. Nelson, Frederick J. Angulo. (2003) Reevaluating Fluoroquinolone Breakpoints for Salmonella enterica Serotype Typhi and for Non‐Typhi Salmonellae. Clinical Infectious Diseases 37:1, 75-81
CrossRef86
E.J. Threlfall, C.J. Teale, R.H. Davies, L.R. Ward, J.A. Skinner, A. Graham, C. Cassar, K. Speed. (2003) A Comparison of Antimicrobial Susceptibilities in Nontyphoidal Salmonellas from Humans and Food Animals in England and Wales in 2000. Microbial Drug Resistance 9:2, 183-189
CrossRef87
Abdelmejid Bahloul, Abdelfatah Sebban, Zainaba Dardari, Mohammed Boudouma, Said Kitane, Touria Belghiti, Jean-Pierre Joly. (2003) New heterocycles from 8-hydroxyquinoline via dipolar 1,3-cycloadditions: Synthesis & biological evaluation. Journal of Heterocyclic Chemistry 40:2, 243-248
CrossRef88
Ziad A Memish, S Venkatesh, Atef M Shibl. (2003) Impact of travel on international spread of antimicrobial resistance. International Journal of Antimicrobial Agents 21:2, 135-142
CrossRef89
Paul S. Berger, Robin K. Oshiro. 2003. Source Water Protection: Microbiology of Source Water. .
CrossRef90
Sylvie Baucheron, Hein Imberechts, Elisabeth Chaslus-Dancla, Axel Cloeckaert. (2002) The AcrB Multidrug Transporter Plays a Major Role in High-Level Fluoroquinolone Resistance in Salmonella enterica Serovar Typhimurium Phage Type DT204. Microbial Drug Resistance 8:4, 281-289
CrossRef91
Celso José Bruno Oliveira, Luiz Fernando Oliveira Silva Carvalho, Sueli Aparecida Fernandes, Ana Terezinha Tavechio, Claudio Camacho Pereira Menezes, Francisco José Domingues. (2002) Antimicrobial Resistance of Salmonella Serotypes Isolated from Slaughter-Age Pigs and Environmental Samples. Microbial Drug Resistance 8:4, 407-411
CrossRef92
Wang-Huei Sheng, Yee-Chun Chen, Jann-Tay Wang, Shan-Chwen Chang, Kwen-Tay Luh, Wei-Chuan Hsieh. (2002) Emerging fluoroquinolone-resistance for common clinically important gram-negative bacteria in Taiwan. Diagnostic Microbiology and Infectious Disease 43:2, 141-147
CrossRef93
Brenda A Wilson, Abigail A Salyers. (2002) Ecology and physiology of infectious bacteria — implications for biotechnology. Current Opinion in Biotechnology 13:3, 267-274
CrossRef94
C. Poppe, K. Ziebell, L. Martin, K. Allen. (2002) Diversity in Antimicrobial Resistance and Other Characteristics Among Salmonella Typhimurium DT104 Isolates. Microbial Drug Resistance 8:2, 107-122
CrossRef95
E.John Threlfall. (2002) Antimicrobial drug resistance in Salmonella: problems and perspectives in food- and water-borne infections. FEMS Microbiology Reviews 26:2, 141-148
CrossRef96
Edward E. Eaton, Joanna Dobrozycski, Rosa Loas, Dimitri Laddis, Glenn J. Fennelly. (2002) Nontyphoidal Salmonella Bacteremia and Pneumonia as the Initial Manifestation of Human Immunodeficiency Virus Infection in a Four-Year-Old Child. AIDS Patient Care and STDs 16:6, 247-250
CrossRef97
C.J. Teale. (2002) Antimicrobial resistance and the food chain. Journal of Applied Microbiology 92:s1, 85S-89S
CrossRef98
Laura J.V. Piddock. (2002) Fluoroquinolone resistance in Salmonella serovars isolated from humans and food animals. FEMS Microbiology Reviews 26:1, 3-16
CrossRef99
(2002) Urinary Tract Infections and a Multidrug-Resistant Escherichia coli Clonal Group. New England Journal of Medicine 346:7, 535-536
Full Text100
Chiu, Cheng-Hsun, Wu, Tsu-Lan, Su, Lin-Hui, Chu, Chishih, Chia, Ju-Hsin, Kuo, An-Jing, Chien, Maw-Sheng, Lin, Tzou-Yien, . (2002) The Emergence in Taiwan of Fluoroquinolone Resistance in Salmonella enterica Serotype Choleraesuis. New England Journal of Medicine 346:6, 413-419
Full Text101
Lis Alban, Anne-Mette Olsen, Bent Nielsen, Rie Sørensen, Birthe Jessen. (2002) Qualitative and quantitative risk assessment for human salmonellosis due to multi-resistant Salmonella Typhimurium DT104 from consumption of Danish dry-cured pork sausages. Preventive Veterinary Medicine 52:3-4, 251-265
CrossRef102
Francesco Castelli, Chiara Pezzoli, Lina Tomasoni. (2001) Epidemiology of Travelers'Diarrhea. Journal of Travel Medicine 8:s2, s26-s30
CrossRef103
Herbert L. DuPont, Zhi‐Dong Jiang, Charles D. Ericsson, Javier A. Adachi, John J. Mathewson, Margaret W. DuPont, Ernesto Palazzini, Lise M. Riopel, David Ashley, Francisco Martinez‐Sandoval. (2001) Rifaximin versus Ciprofloxacin for the Treatment of Traveler's Diarrhea: A Randomized, Double‐Blind Clinical Trial. Clinical Infectious Diseases 33:11, 1807-1815
CrossRef104
E. Mateu, M. Martin. (2001) Why is Anti-Microbial Resistance a Veterinary Problem As Well?. Journal of Veterinary Medicine Series B 48:8, 569-581
CrossRef105
Stuart B. Levy. (2001) Antibiotic Resistance: Consequences of Inaction. Clinical Infectious Diseases 33:s3, S124-S129
CrossRef106
Edward C. Oldfield, Mark R. Wallace. (2001) THE ROLE OF ANTIBIOTICS IN THE TREATMENT OF INFECTIOUS DIARRHEA. Gastroenterology Clinics of North America 30:3, 817-835
CrossRef107
A. Sundsfjord, G. Skov Simonsen, P. Courvalin. (2001) Human infections caused by glycopeptide-resistant Enterococcus spp: are they a zoonosis?. Clinical Microbiology and Infection 7:4, 16-33
CrossRef108
S. Schwarz, C. Kehrenberg, T.R. Walsh. (2001) Use of antimicrobial agents in veterinary medicine and food animal production. International Journal of Antimicrobial Agents 17:6, 431-437
CrossRef109
David A. Barber. (2001) New perspectives on transmission of foodborne pathogens and antimicrobial resistance. Journal of the American Veterinary Medical Association 218:10, 1559-1561
CrossRef110
Pramil Singh. 2001. Does Low Meat Consumption Contribute to Greater Longevity?. , 135-170.
CrossRef111
Rachel A. Walker, Elizabeth Lindsay, Martin J. Woodward, Linda R. Ward, E. John Threlfall. (2001) Variation in Clonality and Antibiotic-Resistance Genes Among Multiresistant Salmonella enterica Serotype typhimurium Phage-Type U302 (MR U302) from Humans, Animals, and Foods. Microbial Drug Resistance 7:1, 13-21
CrossRef112
Bender, Jeffrey B., Hedberg, Craig W., Boxrud, David J., Besser, John M., Wicklund, Julie H., Smith, Kirk E., Osterholm, Michael T., . (2001) Use of Molecular Subtyping in Surveillance for Salmonella enterica Serotype Typhimurium. New England Journal of Medicine 344:3, 189-195
Full Text113
D. Acheson, E. L. Hohmann. (2001) Nontyphoidal Salmonellosis. Clinical Infectious Diseases 32:2, 263-269
CrossRef114
Dominique Gendrel, Florence Moulin. (2001) Fluoroquinolones in Paediatrics. Paediatric Drugs 3:5, 365-377
CrossRef115
Helen C. Davison, Mark E.J. Woolhouse, J.Chris Low. (2000) What is antibiotic resistance and how can we measure it?. Trends in Microbiology 8:12, 554-559
CrossRef116
Nicholas J. Beeching, C. Anthony Hart. (2000) Gastrointestinal infections: you can hide but you still have to run. Current Opinion in Infectious Diseases 13:5, 477-479
CrossRef117
STUART B. LEVY. (2000) Antibiotic and antiseptic resistance: impact on public health. The Pediatric Infectious Disease Journal 19:Supplement, S120-S122
CrossRef118
D. Acheson. (2000) Introduction. Clinical Infectious Diseases 31:1, 127-127
CrossRef119
R. Carnevale, K. Molbak, F. Bager, F. M. Aarestrup. (2000) Fluoroquinolone Resistance in Salmonella: A Web Discussion. Clinical Infectious Diseases 31:1, 128-130
CrossRef120
Judith A. O'Donnell, Steven P. Gelone. (2000) FLUOROQUINOLONES. Infectious Disease Clinics of North America 14:2, 489-513
CrossRef121
Fey, Paul D., Safranek, Thomas J., Rupp, Mark E., Dunne, Eileen F., Ribot, Efrain, Iwen, Peter C., Bradford, Patricia A., Angulo, Frederick J., Hinrichs, Steven H., . (2000) Ceftriaxone-Resistant Salmonella Infection Acquired by a Child from Cattle. New England Journal of Medicine 342:17, 1242-1249
Full Text122
(2000) Multidrug-Resistant Salmonella enterica Serotype Typhimurium DT104. New England Journal of Medicine 342:9, 661-661
Full Text123
E. JOHN THRELFALL, LINDA R. WARD, JEREMY A. SKINNER, ANDREW GRAHAM. (2000) Antimicrobial Drug Resistance in Non-Typhoidal Salmonellas from Humans in England and Wales in 1999: Decrease in Multiple Resistance in Salmonella enterica Serotypes Typhimurium, Virchow, and Hadar. Microbial Drug Resistance 6:4, 319-325
CrossRef124
CAMILLA WIUFF, MOGENS MADSEN, DORTHE LAU BAGGESEN, FRANK MØLLER AARESTRUP. (2000) Quinolone Resistance among Salmonella enterica from Cattle, Broilers, and Swine in Denmark. Microbial Drug Resistance 6:1, 11-17
CrossRef
- Letters
