Original Article
A Preliminary Study of Long-Term Treatment with Interferon Gamma-1b and Low-Dose Prednisolone in Patients with Idiopathic Pulmonary Fibrosis
N Engl J Med 1999; 341:1264-1269October 21, 1999
- Abstract
Background
Patients with idiopathic pulmonary fibrosis have progressive scarring of the lung and usually die within four to five years after symptoms develop. Treatment with oral glucocorticoids is often ineffective. We conducted an open, randomized trial of treatment with a combination of interferon gamma-1b, which has antifibrotic properties, and an oral glucocorticoid.
Methods
We studied 18 patients with idiopathic pulmonary fibrosis who had not had responses to glucocorticoids or other immunosuppressive agents. Nine patients were treated for 12 months with oral prednisolone alone (7.5 mg daily, which could be increased to 25 to 50 mg daily), and nine with a combination of 200 μg of interferon gamma-1b (given three times per week subcutaneously) and 7.5 mg of prednisolone (given once a day).
Results
All the patients completed the study. Lung function deteriorated in all nine patients in the group given prednisolone alone: total lung capacity decreased from a mean (±SD) of 66±8 percent of the predicted value at base line to 62±6 percent at 12 months. In contrast, in the group receiving interferon gamma-1b plus prednisolone, total lung capacity increased (from 70±6 percent of the predicted value at base line to 79±12 percent at 12 months, P<0.001 for the difference between the groups). In the group that received interferon gamma-1b plus prednisolone, the partial pressure of arterial oxygen at rest increased from 65±9 mm Hg at base line to 76±8 mm Hg at 12 months, whereas in the group that received prednisolone alone it decreased from 65±6 to 62±4 mm Hg (P<0.001 for the difference in the change from base-line values between the two groups); on maximal exertion, the value increased from 55±6 to 65±8 mm Hg in the group that received combined treatment and decreased from 55±6 mm Hg to 52±5 mm Hg in the group given prednisolone alone (P<0.001). The side effects of interferon gamma-1b, such as fever, chills, and muscle pain, subsided within the first 9 to 12 weeks.
Conclusions
In a preliminary study, 12 months of treatment with interferon gamma-1b plus prednisolone was associated with substantial improvements in the condition of patients with idiopathic pulmonary fibrosis who had had no response to glucocorticoids alone.
Media in This Article
Figure 3
Mean (±SD) Level of Transcription of the Genes for Transforming Growth Factor β1 (TGF-β1), Connective-Tissue Growth Factor (CTGF), and Interferon Gamma-1b (IFN-γ) before and after Six Months of Treatment.Figure 1
Total Lung Capacity and Partial Pressure of Oxygen before and after One Year of Treatment with Prednisolone Alone or in Combination with Interferon Gamma-1b.Article Activity
- Article
Idiopathic pulmonary fibrosis is characterized by a fibroproliferative response with only minor signs of inflammation, and it almost always causes rapid fibrotic destruction of the lung.1 Regardless of treatment, the median survival is four to five years after the onset of symptoms.2 The standard treatment for idiopathic pulmonary fibrosis is oral glucocorticoids. However, lung function improves in less than 30 percent of patients who receive this treatment.2
The proliferation of fibroblasts and the accumulation of interstitial collagens are the hallmarks of progressive organ fibrosis.3 In vitro studies have demonstrated that interferon-γ inhibits the proliferation of lung fibroblasts in a dose-dependent manner and reduces the synthesis of protein in fibroblasts.4,5 Moreover, in a bleomycin-induced model of lung fibrosis, exogenous interferon-γ down-regulated the transcription of the gene for transforming growth factor β1.6 This growth factor has been demonstrated to cause severe lung fibrosis in rats with adenovirus vector–mediated overexpression of the cytokine.7 It also has a major role in collagen synthesis as well as in the proliferation and activation of fibroblasts. In contrast to the immunomodulatory function of transforming growth factor β1, the effects of this growth factor on the regulation of wound healing and fibrosis are mediated by the action of connective-tissue growth factor.8 A study of various forms of pulmonary fibrosis, including idiopathic pulmonary fibrosis, has indicated that there may be a general impairment of the production of interferon-γ in patients with pulmonary fibrosis.9 In addition, another study reported that treatment of progressive pulmonary fibrosis with interferon gamma-1b was effective in patients who had idiopathic pulmonary fibrosis, scleroderma, or sarcoidosis that was resistant to three months of treatment with high doses of glucocorticoids.10
On the basis of these observations and the slow turnover rate of connective tissue, we hypothesized that 12 months of treatment with interferon gamma-1b, in combination with prednisolone at a dose that does not affect the clinical course of idiopathic pulmonary fibrosis when given alone, would slow or even stop the progression of disease.
Methods
Patients were eligible for the study if they had histologically verified idiopathic pulmonary fibrosis and if they had had a decrease in lung function of at least 10 percent during the 12 months before the study began, despite continuous or repeated treatment with glucocorticoids, other immunosuppressive agents, or both for at least 6 of the 12 months. The main histopathological feature used to identify idiopathic pulmonary fibrosis was the presence of subpleural and periacinar fibrotic lesions, with only minor cellular infiltration. The absence of bilateral patchy infiltrates on high-resolution computed tomography and the demonstration of a predominantly peripheral distribution of lesions were the radiologic criteria for identifying the disease. Patients with a history of exposure to organic or inorganic dust or drugs known to cause pulmonary fibrosis and those with connective-tissue diseases or other chronic lung diseases causing pulmonary fibrosis were excluded. Patients with end-stage idiopathic pulmonary fibrosis, as identified on the basis of a total lung capacity of less than 45 percent of the predicted normal value, were also excluded.
The study was conducted between May 1996 and February 1998. The protocol was approved by the ethics committee of the University of Vienna Medical School, and all the patients provided written informed consent. The patients were initially treated with 50 mg of oral prednisolone per day for 4 weeks, with subsequent tapering of the dose to 10 mg per day over a 14-day period, regardless of any previous treatment. Complete lung-function tests were performed after the initial four-week period in combination with high-resolution computed tomography. After obtaining additional written consent from the patients, we performed fiberoptic bronchoscopy and obtained specimens of the lung during peripheral transbronchial biopsy for the assessment of gene transcription.
If the additional glucocorticoid treatment was ineffective, the patients were randomly assigned to receive either 200 μg of interferon gamma-1b (Imukin, Boehringer Ingelheim, Vienna, Austria) subcutaneously three times per week plus 7.5 mg of oral prednisolone daily for 12 months or 7.5 mg of oral prednisolone per day alone for 12 months. In the group of patients who were assigned to receive prednisolone alone, the dose could be increased to 25 to 50 mg per day in patients who had deterioration of lung function or worsening symptoms. Lung function was measured at base line and after 3, 6, 9, and 12 months of treatment. Forced vital capacity, total lung capacity, and arterial-blood gases were measured in patients at rest and after maximal exertion to assess lung function, since these measurements correlate well with the extent of lung fibrosis.11 Predicted normal values were derived from the reference values of the Austrian Society of Pulmonary Medicine.12 Each value represents the best of at least two measurements. Spirometry and body plethysmography were performed with the Autobox DL 6200 (SensorMedics, Vienna, Austria), and blood gas pressure was measured with a gas analyzer (model ABL 510, Radiometer, Copenhagen, Denmark).
For the assessment of the transcription of the genes for transforming growth factor β1, connective-tissue growth factor, and interferon-γ, three transbronchial-biopsy specimens were obtained from the same lung segment before and after six months of therapy. Approximately 1 μg of complementary DNA was used for semiquantitative analysis by the reverse-transcription polymerase chain reaction (RT-PCR). The constitutive control was glyceraldehyde-3-phosphate dehydrogenase. We amplified the genes using the following primers: 5'GCCCTGGACACCAACTATTGC3' (sense) and 5'AGGCTCCAAATGTAGGGGCAG3' (antisense) for transforming growth factor β1, 5'CCGACTGGAAGACACGTTTGG3' (sense) and 5'TCATGCCATGTCTCCGTACATCTT3' (antisense) for connective-tissue growth factor, and 5'GCATCGTTTTGGGTTCTCTTGGCTGTTACTGC3' (sense) and 5'CTCCTTTTTCGCTTCCCTGTTTTAGCTGCTGG3' (antisense) for interferon-γ. The specificity of the RT-PCR products was controlled by Southern blot hybridization. The RT-PCR assay was carried out in a total volume of 50 μl. Thirty cycles of a hot-start PCR assay were performed on a Perkin–Elmer thermal cycler (model 480, Perkin–Elmer, Norwalk, Conn.). Aliquots were separated by electrophoresis on a NuSieve GTG agarose gel (FMC BioProducts, Rockland, Me.) and visualized with Vistagreen (Amersham International, Buckinghamshire, United Kingdom).
Analysis of variance was used to compare the mean changes in values from base line to 12 months in the two treatment groups. The data were analyzed descriptively with Report (version 6.0.08, IDV, Munich, Germany) and statistically with Testimate (version 5.2a, IDV).13 The model was interpreted only in the case of a nonsignificant result according to Bartlett's test for homogeneity of variance. We used the Wilcoxon rank-sum test of variance for the statistical evaluation of the results of the gene-transcription analysis. All reported P values are two-sided.
Results
We screened 22 patients for the study and excluded 4 because they had end-stage pulmonary fibrosis. All 18 patients initially received 50 mg of oral prednisolone daily for four weeks, and none had a response to this treatment.
Thus, we enrolled 18 patients (17 men and 1 woman, 9 patients in each group). The main symptom related to their lung disease at the time of enrollment was breathlessness on exertion or at rest. None of the patients had clinically significant heart disease. There were no significant differences between the groups at base line (Table 1Table 1
Base-Line Characteristics of the Patients.). All patients completed the study.During the 1-year study period, total lung capacity decreased, though not significantly, in all nine patients in the group given prednisolone alone, from a mean (±SD) of 66±8 percent of the predicted value at base line to 62±6 percent at 12 months (Figure 1AFigure 1
Total Lung Capacity and Partial Pressure of Oxygen before and after One Year of Treatment with Prednisolone Alone or in Combination with Interferon Gamma-1b.). In contrast, ventilation and gas exchange improved significantly in the patients receiving the combination of interferon gamma-1b and prednisolone. In this group, total lung capacity rose from a mean of 70±10 percent of the predicted value at base line to 79±12 percent at 12 months (Figure 1A). In other words, the patients receiving prednisolone alone had an absolute decrease in total lung capacity of 4 percent, whereas the group receiving interferon gamma-1b plus prednisolone had an absolute increase in total lung capacity of 9 percent (P<0.001). The results were similar for the changes in forced vital capacity (data not shown). The increase in forced vital capacity and total lung capacity usually started after three months of treatment and was most pronounced over the next three to six months (data not shown).In the group that received interferon gamma-1b plus prednisolone, the partial pressure of arterial oxygen at rest increased from 64±9 mm Hg at base line to 76±8 mm Hg at 12 months, whereas in the group that received prednisolone alone it decreased from 65±6 to 62±4 mm Hg (P<0.001 for the difference in the change from base-line values between the two groups) (Figure 1B). On maximal exertion, the partial pressure of arterial oxygen increased from 55±6 mm Hg at base line to 65±8 mm Hg at 12 months in the group that received interferon gamma-1b plus prednisolone and decreased from 55±6 mm Hg to 52±5 mm Hg in the group given prednisolone alone (P<0.001) (Figure 1C). There was a similar increase in the carbon monoxide diffusing capacity (data not shown) among the patients receiving interferon gamma-1b plus prednisolone.
As of July 1999, all patients in the study were alive. After 12 months of treatment with interferon gamma-1b and prednisolone, only one of the three patients who initially required supplemental oxygen was still receiving it. After 12 months of treatment with prednisolone alone, four patients needed supplemental oxygen, as compared with two at base line. After 12 months, all nine patients in the group given prednisolone alone were still breathless on exertion, as compared with only one patient in the group given interferon gamma-1b and prednisolone. All patients receiving interferon gamma-1b and prednisolone reported an improved ability to perform the activities of daily living. However, changes in the quality of life were not formally evaluated.
In an evaluation of the in vivo level of transcription of the genes for transforming growth factor β1, connective-tissue growth factor, and interferon-γ by RT-PCR, we found striking differences before and after six months of therapy with interferon gamma-1b plus prednisolone. Figure 2Figure 2
Semiquantitative Assessment of the Transcription of the Genes for Transforming Growth Factor β1 (TGF-β1) and Connective-Tissue Growth Factor (CTGF) by the Reverse-Transcriptase–Polymerase-Chain-Reaction (RT-PCR) Assay in Two Representative Patients before and after Six Months of Therapy with Interferon Gamma-1b plus Prednisolone. shows the results of semiquantitative RT-PCR analysis of the transcription of transforming growth factor β1 and connective-tissue growth factor in two patients before and after six months of therapy. Figure 3Figure 3Mean (±SD) Level of Transcription of the Genes for Transforming Growth Factor β1 (TGF-β1), Connective-Tissue Growth Factor (CTGF), and Interferon Gamma-1b (IFN-γ) before and after Six Months of Treatment. shows the PCR results obtained after the initial four-week period of treatment with prednisolone but before random assignment to subsequent treatment in all 18 patients, and after six months of treatment in the 9 patients in the group receiving interferon gamma-1b plus prednisolone, and in 4 patients in the group given prednisolone alone who underwent a second bronchoscopy. After the initial treatment with prednisolone, all the patients had levels of transcription of the genes for transforming growth factor β1 and connective-tissue growth factor that were approximately seven times and four times as high, respectively, as those in six normal subjects, and no transcription of the gene for interferon-γ could be detected. After six months of therapy, levels of transcription of the gene for transforming growth factor β1 and connective-tissue growth factor decreased significantly only in the group given interferon gamma-1b plus prednisolone (P=0.004 for both).During the first two to three weeks of treatment with interferon gamma-1b plus prednisolone, all nine patients had fever and chills of variable severity, and three had bone and muscle pain. Two patients reported brief, migraine-like headaches. All side effects subsided within the first 9 to 12 weeks of treatment. Fever and chills recurred after an interval of more than three months in two patients with respiratory tract infections. The symptoms resolved within 24 hours after treatment with interferon gamma-1b was discontinued. Treatment with interferon gamma-1b was resumed after two weeks, with no further adverse effects. Repeated laboratory tests showed mild lymphopenia in three patients (1400±500 cells per cubic millimeter; normal range, 1000 to 4000 cells per cubic millimeter). To rule out the possibility that interferon gamma-1b might induce autoimmune disorders, we performed tests for antinuclear antibodies and immune complexes and measured complement activity. However, no elevation of these markers was detected in any of the patients. The main side effects among those who received prednisolone alone were hyperglycemia in three patients, weight gain and skin changes in all patients, and aseptic necrosis of the femur in one patient.
Discussion
In a preliminary study, we found that one year of treatment with interferon gamma-1b plus low-dose prednisolone was associated with substantial improvement of pulmonary ventilation and gas exchange in patients with idiopathic pulmonary fibrosis who had not had a response to glucocorticoids. A larger study is now required to determine whether our results can be confirmed.
Molecular assessment of lung tissue from our patients showed a nearly complete lack of interferon-γ, with levels of transcription of the genes for transforming growth factor β1 and connective-tissue growth factor that far exceeded the levels in normal tissue. This finding confirms the observation of intense immunohistochemical staining for transforming growth factor β1 in lung tissue from patients with idiopathic pulmonary fibrosis.14 Our additional finding of a high level of in vivo expression of both genes supports the idea that connective-tissue growth factor is one of the main mediators of transforming growth factor β1 during the development of fibrotic lesions. In vitro studies have shown that interferon-γ decreased the synthesis of both collagen I and III15 and of transforming growth factor β1.6 Moreover, a reduced level of transcription of the gene for transforming growth factor β1 by adenovirus vector–mediated overexpression of the extracellular-matrix protein proteoglycan decorin resulted in a significant reduction of scarring in a rat model of glomerulosclerosis.16
The improvement of lung function resulting from treatment with interferon gamma-1b in patients with idiopathic pulmonary fibrosis, in combination with a significantly reduced level of transcription of the genes for transforming growth factor β1 and connective-tissue growth factor, provides important support for the hypothesis that mesenchymal activation in patients with lung fibrosis depends, at least in part, on the overexpression of the genes for transforming growth factor β1 and connective-tissue growth factor. Moreover, these data suggest that the mesenchymal activation in patients with idiopathic pulmonary fibrosis corresponds with a low level of transcription of interferon-γ. In view of the well-documented immunosuppressive efficacy of transforming growth factor β1,17-19 including the inhibition of the release of interferon-γ20 and the suppression of interferon-γ–dependent immune reactions,21 it is possible that mesenchymal activation during chronic inflammation could lead to an acquired deficiency of interferon-γ. This view is strongly supported by the reciprocal effects of interferon-γ and transforming growth factor β1 on mucosal inflammation of the intestine.22 Thus, interferon-γ may have a counterbalancing effect on transforming growth factor β1–dependent activation of mesenchymal tissues.
Supported by the Austrian Ministry of Health.
We are indebted to all the participating physicians and personnel of the Department of Pulmonary Medicine for their help in conducting this study.
Source Information
From the Department of Internal Medicine IV, Division of Pulmonary Medicine, University of Vienna Medical School, Vienna, Austria.
Address reprint requests to Dr. Block at the University of Vienna Medical School, Wahringer Gurtel 18-10, A-1090 Vienna, Austria, or at lutz-henning.block@akh-wein.ac.at.
- References
References
1
Ryu JH ,Colby TV ,Hartman TE . Idiopathic pulmonary fibrosis: current concepts. Mayo Clin Proc 1998;73:1085-1101
CrossRef | Web of Science | Medline2
Tukiainen P ,Taskinen E ,Holsti P ,Korhola O ,Valle M . Prognosis of cryptogenic fibrosing alveolitis. Thorax 1983;38:349-355
CrossRef | Web of Science | Medline3
Specks U ,Nerlich A ,Colby TV ,Wiest I ,Timpl R . Increased expression of type VI collagen in lung fibrosis. Am J Respir Crit Care Med 1995;15:1956-19644
Elias JA ,Freundlich B ,Kern JA ,Rosenbloom J . Cytokine networks in the regulation of inflammation and fibrosis in the lung. Chest 1990;97:1439-1445
CrossRef | Web of Science | Medline5
Bienkowski RS ,Gotkin MG . Control of collagen deposition in mammalian lung. Proc Soc Exp Biol Med 1995;209:118-140
Web of Science | Medline6
Gurujeyalakshmi G ,Giri SN . Molecular mechanisms of antifibrotic effect of interferon gamma in bleomycin-mouse model of lung fibrosis: downregulation of TGF-β and procollagen I and III gene expression. Exp Lung Res 1995;21:791-808
CrossRef | Web of Science | Medline7
Sime PJ ,Xing Z ,Graham FL ,Csaky KG ,Gauldie J . Adenovector-mediated gene transfer of active transforming growth factor β1 induces prolonged severe fibrosis in rat lung. J Clin Invest 1997;100:768-776
CrossRef | Web of Science | Medline8
Grotendorst GR . Connective tissue growth factor: a mediator of TGF-beta action on fibroblasts. Cytokine Growth Factor Rev 1997;8:171-179
CrossRef | Medline9
Prior C ,Haslam PL . In vivo levels and in vitro production of interferon-gamma in fibrosing interstitial lung diseases. Clin Exp Immunol 1992;88:280-287
CrossRef | Web of Science | Medline10
Ziesche R ,Kink E ,Herold C ,Podolsky A ,Block LH . Therapy of chronic interstitial lung disease with a combination of interferon-γ and low-dose prednisolone. Chest 1996;110:Suppl:25S-25S abstract.11
Watters LC ,King TE ,Schwarz MI ,Waldron JA ,Stanford RE ,Cherniack RM . A clinical, radiographic, and physiologic scoring system for the longitudinal assessment of patients with idiopathic pulmonary fibrosis. Am Rev Respir Dis 1986;133:97-103
Web of Science | Medline12
Harnoncourt K ,Feldner H ,Forche G , et al. Die Standardisierung der Lungenfunktionsdiagnostik. Osterreich Arzteztg 1982;37:1640-164213
IDV — data analysis and study planning: Testimate 5.2a. Report 6.0.08. Munich, Germany: Wessobrunner, 1998.
14
Broekelmann TJ ,Limper AH ,Colby TV ,McDonald JA . Transforming growth factor beta 1 is present at sites of extracellular matrix gene expression in human pulmonary fibrosis. Proc Natl Acad Sci U S A 1991;88:6642-6646
CrossRef | Web of Science | Medline15
Sempowski GD ,Derdak S ,Phipps RP . Interleukin-4 and interferon-gamma discordantly regulate collagen biosynthesis by functionally distinct lung fibroblast subsets. J Cell Physiol 1996;167:290-296
CrossRef | Web of Science | Medline16
Isaka Y ,Brees DK ,Ikegaya K , et al. Gene therapy by skeletal muscle expression of decorin prevents fibrotic disease in rat kidney. Nat Med 1996;2:418-423
CrossRef | Web of Science | Medline17
Qin L ,Ding Y ,Bromberg JS . Gene transfer of transforming growth factor-beta 1 prolongs murine cardiac allograft survival by inhibiting cell-mediated immunity. Hum Gene Ther 1996;7:1981-1988
CrossRef | Web of Science | Medline18
Gilbert KM ,Thoman M ,Bauche K ,Pham T ,Weigle WO . Transforming growth factor-beta 1 induces antigen-specific unresponsiveness in naive T cells. Immunol Invest 1997;26:459-472
CrossRef | Web of Science | Medline19
Lawrence DA . Transforming growth factor-beta: a general review. Eur Cytokine Netw 1996;7:363-374
Web of Science | Medline20
Naganuma H ,Sasaki A ,Satoh E , et al. Transforming growth factor-beta inhibits interferon-gamma secretion by lymphokine-activated killer cells stimulated with tumor cells. Neurol Med Chir (Tokyo) 1996;36:789-795
CrossRef | Medline21
Lee YJ ,Han Y ,Lu HT , et al. TGF-beta suppresses IFN-gamma induction of class II MHC gene expression by inhibiting class II transactivator messenger RNA expression. J Immunol 1997;158:2065-2075
Web of Science | Medline22
Strober W ,Kelsall B ,Fuss I , et al. Reciprocal IFN-gamma and TGF-beta responses regulate the occurrence of mucosal inflammation. Immunol Today 1997;18:61-64
CrossRef | Medline
- Citing Articles (162)
Citing Articles
1
Don C. Rockey, Scott L. Friedman. 2012. Hepatic Fibrosis and Cirrhosis. , 64-85.
CrossRef2
Eva Baroke, Shyam Maharaj, Martin Kolb. (2011) Clinical trials in idiopathic pulmonary fibrosis: update and perspectives. Clinical Investigation 1:12, 1669-1680
CrossRef3
Stefania Cerri, Paolo Spagnolo, Fabrizio Luppi, Luca Richeldi. (2011) Management of Idiopathic Pulmonary Fibrosis. Clinics in Chest Medicine
CrossRef4
Oisin J. O’Connell, Marcus P. Kennedy, Michael T. Henry. (2011) Idiopathic pulmonary fibrosis: Treatment update. Advances in Therapy 28:11, 986-999
CrossRef5
Shunji Hikino, Shouichi Ohga, Tadamune Kinjo, Takeshi Kusuda, Masayuki Ochiai, Hirosuke Inoue, Satoshi Honjo, Kenji Ihara, Koichi Ohshima, Toshiro Hara. (2011) Tracheal aspirate gene expression of preterm newborns developing bronchopulmonary dysplasia. Pediatrics Internationalno-no
CrossRef6
Jie Ding, Keijiro Hori, Rainny Zhang, Yvonne Marcoux, Dariush Honardoust, Heather A. Shankowsky, Edward E. Tredget. (2011) Stromal cell-derived factor 1 (SDF-1) and its receptor CXCR4 in the formation of postburn hypertrophic scar (HTS). Wound Repair and Regeneration 19:5, 568-578
CrossRef7
D. Montgomery Bissell. (2011) Therapy for hepatic fibrosis: Revisiting the preclinical models. Clinics and Research in Hepatology and Gastroenterology 35:8-9, 521-525
CrossRef8
Moisés Selman, Annie Pardo, Luca Richeldi, Stefania Cerri. (2011) Emerging drugs for idiopathic pulmonary fibrosis. Expert Opinion on Emerging Drugs 16:2, 341-362
CrossRef9
Arnab Datta, Chris J Scotton, Rachel C Chambers. (2011) Novel therapeutic approaches for pulmonary fibrosis. British Journal of Pharmacology 163:1, 141-172
CrossRef10
Eman Ali, Somaya Mansour. (2011) Boswellic acids extract attenuates pulmonary fibrosis induced by bleomycin and oxidative stress from gamma irradiation in rats. Chinese Medicine 6:1, 36
CrossRef11
Bryan Corrin, Andrew G. Nicholson. 2011. Diffuse parenchymal disease of the lung. , 263-326.
CrossRef12
Paolo Spagnolo, Cinzia Del Giovane, Fabrizio Luppi, Stefania Cerri, Sara Balduzzi, E. Haydn Walters, Roberto D'Amico, Luca Richeldi, Luca Richeldi. 2010. Non-steroid agents for idiopathic pulmonary fibrosis. .
CrossRef13
Arata Azuma. (2010) Pirfenidone: antifibrotic agent for idiopathic pulmonary fibrosis. Expert Review of Respiratory Medicine 4:3, 301-310
CrossRef14
Ziv Paz, Yehuda Shoenfeld. (2010) Antifibrosis: To Reverse the Irreversible. Clinical Reviews in Allergy & Immunology 38:2-3, 276-286
CrossRef15
Yasuhiro Yamauchi, Tadashi Kohyama, Hajime Takizawa, Sumiko Kamitani, Masashi Desaki, Kazutaka Takami, Shin Kawasaki, Jun Kato, Takahide Nagase. (2010) Tumor necrosis factor-αα enhances both epithelial-mesenchymal transition and cell contraction induced in A549 human alveolar epithelial cells by transforming growth factor-ββ1. Experimental Lung Research 36:1, 12-24
CrossRef16
R. M. du Bois. (2010) Strategies for treating idiopathic pulmonary fibrosis. Nature Reviews Drug Discovery 9:2, 129-140
CrossRef17
Ross C. KLINGSBERG, Steven E. MUTSAERS, Joseph A. LASKY. (2010) Current clinical trials for the treatment of idiopathic pulmonary fibrosis. Respirology 15:1, 19-31
CrossRef18
Jun Araya, Stephen L. Nishimura. (2010) Fibrogenic Reactions in Lung Disease. Annual Review of Pathology: Mechanisms of Disease 5:1, 77-98
CrossRef19
R.-M. Liu, K.A. Gaston Pravia. (2010) Oxidative stress and glutathione in TGF-β-mediated fibrogenesis. Free Radical Biology and Medicine 48:1, 1-15
CrossRef20
Luis M. Sarmiento Méndez, Diego Castillo Villegas. (2009) La clínica vista a través de archivos. Archivos de Bronconeumología 45:10, 516-520
CrossRef21
Robert Matthew KOTTMANN, Christopher M. HOGAN, Richard P. PHIPPS, Patricia J. SIME. (2009) Determinants of initiation and progression of idiopathic pulmonary fibrosis. Respirology 14:7, 917-933
CrossRef22
Paul J. Pockros. (2009) Antifibrotics for Chronic Hepatitis C. Clinics in Liver Disease 13:3, 365-373
CrossRef23
Demosthenes Bouros. (2009) Interferon gamma for idiopathic pulmonary fibrosis. The Lancet 374:9685, 180-182
CrossRef24
Talmadge E King, Carlo Albera, Williamson Z Bradford, Ulrich Costabel, Phil Hormel, Lisa Lancaster, Paul W Noble, Steven A Sahn, Javier Szwarcberg, Michiel Thomeer, Dominique Valeyre, Roland M du Bois. (2009) Effect of interferon gamma-1b on survival in patients with idiopathic pulmonary fibrosis (INSPIRE): a multicentre, randomised, placebo-controlled trial. The Lancet 374:9685, 222-228
CrossRef25
Tadao Kuruma, Toru Maruyama, Shin-ichi Hiramatsu, Yuichiro Yasuda, Shioto Yasuda, Keita Odashiro, Mine Harada. (2009) Relationship between amiodarone-induced subclinical lung toxicity and Th1/Th2 balance. International Journal of Cardiology 134:2, 224-230
CrossRef26
Adam S. Morgenthau, Maria L. Padilla. (2009) Spectrum of Fibrosing Diffuse Parenchymal Lung Disease. Mount Sinai Journal of Medicine: A Journal of Translational and Personalized Medicine 76:1, 2-23
CrossRef27
Tamera J Corte, Athol U Wells. (2009) Treatment of idiopathic interstitial pneumonias. Expert Review of Respiratory Medicine 3:1, 81-91
CrossRef28
Soo-Taek Uh. (2009) Idiopathic Pulmonary Fibrosis: New Concept of Pathogenesis and Treatment. Journal of the Korean Medical Association 52:1, 22
CrossRef29
Katerina M. Antoniou, Nikolaos Tzanakis, Eleni G. Tzortzaki, Katerina Malagari, Anastassios V. Koutsopoulos, Michael Alexandrakis, Athol U. Wells, Nikolaos M. Siafakas. (2008) Different angiogenic CXC chemokine levels in bronchoalveolar lavage fluid after interferon gamma-1b therapy in idiopathic pulmonary fibrosis patients. Pulmonary Pharmacology & Therapeutics 21:6, 840-844
CrossRef30
Kazuhiro Komura, Koichi Yanaba, Mayuka Horikawa, Fumihide Ogawa, Manabu Fujimoto, Thomas F. Tedder, Shinichi Sato. (2008) CD19 regulates the development of bleomycin-induced pulmonary fibrosis in a mouse model. Arthritis & Rheumatism 58:11, 3574-3584
CrossRef31
S Nagai, T Handa, DS Kim. (2008) Pharmacotherapy in patients with idiopathic pulmonary fibrosis. Expert Opinion on Pharmacotherapy 9:11, 1909-1925
CrossRef32
Hisashi Oku, Toshikatsu Shimizu, Tomoji Kawabata, Morio Nagira, Ichiro Hikita, Azumi Ueyama, Shuuichi Matsushima, Mikinori Torii, Akinori Arimura. (2008) Antifibrotic action of pirfenidone and prednisolone: Different effects on pulmonary cytokines and growth factors in bleomycin-induced murine pulmonary fibrosis. European Journal of Pharmacology 590:1-3, 400-408
CrossRef33
Jianfei Wang, Hong Chen, Heather A. Shankowsky, Paul G. Scott, Edward E. Tredget. (2008) Improved Scar in Postburn Patients Following Interferon-α2b Treatment Is Associated with Decreased Angiogenesis Mediated by Vascular Endothelial Cell Growth Factor. Journal of Interferon & Cytokine Research 28:7, 423-434
CrossRef34
A SUMIDA, Y HASEGAWA, M OKAMOTO, N HASHIMOTO, K IMAIZUMI, H YATSUYA, T YOKOI, K TAKAGI, K SHIMOKATA, T KAWABE. (2008) Th1/Th2 Immune Response in Lung Fibroblasts in Interstitial Lung Disease. Archives of Medical Research 39:5, 503-510
CrossRef35
Mehrnaz Gharaee-Kermani, Biao Hu, Sem H Phan, Margaret R Gyetko. (2008) The role of urokinase in idiopathic pulmonary fibrosis and implication for therapy. Expert Opinion on Investigational Drugs 17:6, 905-916
CrossRef36
Ritesh Agarwal, Surinder K. Jindal. (2008) Acute exacerbation of idiopathic pulmonary fibrosis: A systematic review. European Journal of Internal Medicine 19:4, 227-235
CrossRef37
Mehmet Polatli, Handan T. Tuna, Cigdem Yenisey, Mukadder Serter, Orhan Cildag. (2008) Lung Function and IFN- γ Levels in the Sera of Silica-Exposed Workers. Journal of Interferon & Cytokine Research 28:5, 311-316
CrossRef38
Hironobu Ihn. (2008) Autocrine TGF-β signaling in the pathogenesis of systemic sclerosis. Journal of Dermatological Science 49:2, 103-113
CrossRef39
Steven K Huang, Jeffrey L Myers, Kevin R Flaherty. (2008) The role of lung biopsy in the diagnosis and management of idiopathic interstitial pneumonia. Expert Opinion on Medical Diagnostics 2:2, 183-190
CrossRef40
Antje Moeller, Kjetil Ask, David Warburton, Jack Gauldie, Martin Kolb. (2008) The bleomycin animal model: A useful tool to investigate treatment options for idiopathic pulmonary fibrosis?. The International Journal of Biochemistry & Cell Biology 40:3, 362-382
CrossRef41
Jianfei Wang, Haiyan Jiao, Tara L. Stewart, Heather A. Shankowsky, Paul G. Scott, Edward E. Tredget. (2007) Improvement in Postburn Hypertrophic Scar After Treatment with IFN- α 2b Is Associated with Decreased Fibrocytes. Journal of Interferon & Cytokine Research 27:11, 921-930
CrossRef42
Mehrnaz Gharaee-Kermani, Biao Hu, Victor J Thannickal, Sem H Phan, Margaret R Gyetko. (2007) Current and emerging drugs for idiopathic pulmonary fibrosis. Expert Opinion on Emerging Drugs 12:4, 627-646
CrossRef43
Katerina M. Antoniou, Athanasia Pataka, Demosthenes Bouros, Nikolaos M. Siafakas. (2007) Pathogenetic pathways and novel pharmacotherapeutic targets in idiopathic pulmonary fibrosis. Pulmonary Pharmacology & Therapeutics 20:5, 453-461
CrossRef44
Yaron Rotman, Marc G. Ghany. (2007) INTERFERON-?? FOR HEPATIC FIBROSIS IN PATIENTS WITH CHRONIC HEPATITIS C. Evidence-Based Gastroenterology 8:3, 61-63
CrossRef45
Eleni G. Tzortzaki, Katerina M. Antoniou, Maria I. Zervou, Irini Lambiri, Anastassios Koutsopoulos, Nikolaos Tzanakis, Maria Plataki, George Maltezakis, Demosthenes Bouros, Nikolaos M. Siafakas. (2007) Effects of antifibrotic agents on TGF-β1, CTGF and IFN-γ expression in patients with idiopathic pulmonary fibrosis. Respiratory Medicine 101:8, 1821-1829
CrossRef46
Sonye K. Danoff, Peter B. Terry, Maureen R. Horton. (2007) A Clinicianʼs Guide to the Diagnosis and Treatment of Interstitial Lung Diseases. Southern Medical Journal 100:6, 579-587
CrossRef47
Anne Marie Sousa, Tiegang Liu, Oscar Guevara, JoAnne Stevens, Barry L. Fanburg, Matthias Gaestel, Deniz Toksoz, Usamah S. Kayyali. (2007) Smooth muscle α-actin expression and myofibroblast differentiation by TGFβ are dependent upon MK2. Journal of Cellular Biochemistry 100:6, 1581-1592
CrossRef48
Sylvie Delanian, Jean-Louis Lefaix. (2007) Current Management for Late Normal Tissue Injury: Radiation-Induced Fibrosis and Necrosis. Seminars in Radiation Oncology 17:2, 99-107
CrossRef49
M. Vasakova, I. Striz, A. Slavcev, S. Jandova, J. Dutka, M. Terl, L. Kolesar, J. Sulc. (2007) Correlation of IL-1alpha and IL-4 Gene Polymorphisms and Clinical Parameters in Idiopathic Pulmonary Fibrosis. Scandinavian Journal of Immunology 65:3, 265-270
CrossRef50
Paul J. Pockros, Lennox Jeffers, Nezam Afdhal, Zachary D. Goodman, David Nelson, Robert G. Gish, K. Rajender Reddy, Robert Reindollar, Maribel Rodriguez-Torres, Sarah Sullivan, Lawrence M. Blatt, Sima Faris-Young. (2007) Final results of a double-blind, placebo-controlled trial of the antifibrotic efficacy of interferon-γ1b in chronic hepatitis C patients with advanced fibrosis or cirrhosis. Hepatology 45:3, 569-578
CrossRef51
Hiroyasu Shoda, Akihito Yokoyama, Ryouhei Nishino, Taku Nakashima, Nobuhisa Ishikawa, Yoshinori Haruta, Noboru Hattori, Tetsuji Naka, Nobuoki Kohno. (2007) Overproduction of collagen and diminished SOCS1 expression are causally linked in fibroblasts from idiopathic pulmonary fibrosis. Biochemical and Biophysical Research Communications 353:4, 1004-1010
CrossRef52
Ali Emad, Yasaman Emad. (2007) Levels of Cytokine in Bronchoalveolar Lavage (BAL) Fluid in Patients with Pulmonary Fibrosis Due to Sulfur Mustard Gas Inhalation. Journal of Interferon & Cytokine Research 27:1, 38-43
CrossRef53
Owen J. Dempsey. (2006) Clinical review: Idiopathic pulmonary fibrosis—Past, present and future. Respiratory Medicine 100:11, 1871-1885
CrossRef54
Demosthenes Bouros, Katerina M Antoniou, Argyris Tzouvelekis, Nikolaos M Siafakas. (2006) Interferon-γ 1b for the treatment of idiopathic pulmonary fibrosis. Expert Opinion on Biological Therapy 6:10, 1051-1060
CrossRef55
Lorinda Chung, Jan Lin, Daniel E. Furst, David Fiorentino. (2006) Systemic and localized scleroderma. Clinics in Dermatology 24:5, 374-392
CrossRef56
Paulo José de Lima Mota. (2006) Pneumonias intersticiais idiopáticas – Uma revisão da literatura. Revista Portuguesa de Pneumologia (English Edition) 12:5, 581-601
CrossRef57
P. Markart, W. Seeger, A. Günther. (2006) Differenzielle Therapie bei Lungenfibrosen. Der Internist 47:S01, S26-S32
CrossRef58
Simona Inghilleri, Patrizia Morbini, Tiberio Oggionni, Sergio Barni, Carla Fenoglio. (2006) In situ assessment of oxidant and nitrogenic stress in bleomycin pulmonary fibrosis. Histochemistry and Cell Biology 125:6, 661-669
CrossRef59
Pelagia G. Tsoutsou, Konstantinos I. Gourgoulianis, Efthymia Petinaki, Anastassios Germenis, Anthousa G. Tsoutsou, Maria Mpaka, Smaragda Efremidou, Pashalis-Adam Molyvdas. (2006) Cytokine levels in the sera of patients with idiopathic pulmonary fibrosis. Respiratory Medicine 100:5, 938-945
CrossRef60
Christina Charles, Philip Clements, Daniel E Furst. (2006) Systemic sclerosis: hypothesis-driven treatment strategies. The Lancet 367:9523, 1683-1691
CrossRef61
Mostafa Ghanei, Yoones Panahi, Mojtaba Mojtahedzadeh, Ali reza Hosseini Khalili, Jafar Aslani. (2006) Effect of gamma interferon on lung function of mustard gas exposed patients, after 15 years. Pulmonary Pharmacology & Therapeutics 19:2, 148-153
CrossRef62
Paul W. Noble. (2006) Idiopathic Pulmonary Fibrosis: Natural History and Prognosis. Clinics in Chest Medicine 27:1, 11-16
CrossRef63
Steven D. Nathan. (2006) Therapeutic Management of Idiopathic Pulmonary Fibrosis: An Evidence-Based Approach. Clinics in Chest Medicine 27:1, 27-35
CrossRef64
Edward E. Tredget, Liju Yang, Megan Delehanty, Heather Shankowsky, Paul G. Scott. (2006) Polarized Th2 Cytokine Production in Patients with Hypertrophic Scar Following Thermal Injury. Journal of Interferon & Cytokine Research 26:3, 179-189
CrossRef65
C. Montero-Martínez. (2006) Nuevos tratamientos en la fibrosis pulmonar idiopática. Archivos de Bronconeumología 42:1, 1-2
CrossRef66
ARATA AZUMA. (2006) Nihon Naika Gakkai Zasshi 95:6, 1069-1075
CrossRef67
Arata Azuma. (2006) Recent Topics in Treatment for Idiopathic Pulmonary Fibrosis. Nihon Ika Daigaku Igakkai Zasshi 2:4, 192-201
CrossRef68
Yoshinori Itoh, Toshiaki Sendo, Ryozo Oishi. (2006) Folia Pharmacologica Japonica 127:6, 425-432
CrossRef69
R K. Hoyles, R M. du Bois. (2006) Treatment of Idiopathic Pulmonary Fibrosis. Clinical Pulmonary Medicine 13:1, 17-24
CrossRef70
Jeffrey C Horowitz, Victor J Thannickal. (2006) Idiopathic Pulmonary Fibrosis. Treatments in Respiratory Medicine 5:5, 325-342
CrossRef71
K LEWIS. (2006) Analyses of Efficacy End Points in a Controlled Trial of Interferon-γ1b for Idiopathic Pulmonary FibrosisKing TE Jr, Safrin S, Starko KM, et al (Univ of California, San Francisco; InterMune Inst, Brisbane, Calif; Natl Jewish Med and Research Ctr, Denver, Colo; et al) Chest 127:171-177, 2005§. Yearbook of Pulmonary Disease 2006, 141-143
CrossRef72
Demedts, Maurits, Behr, Juergen, Buhl, Roland, Costabel, Ulrich, Dekhuijzen, Richard, Jansen, Henk M., MacNee, William, Thomeer, Michiel, Wallaert, Benoit, Laurent, François, Nicholson, Andrew G., Verbeken, Eric K., Verschakelen, Johny, Flower, Christopher D.R., Capron, Frédérique, Petruzzelli, Stefano, De Vuyst, Paul, van den Bosch, Jules M.M., Rodriguez-Becerra, Eulogio, Corvasce, Giuseppina, Lankhorst, Ida, Sardina, Marco, Montanari, Mauro, . (2005) High-Dose Acetylcysteine in Idiopathic Pulmonary Fibrosis. New England Journal of Medicine 353:21, 2229-2242
Full Text73
Dianne M. Walters, Aurita Antao-Menezes, Jennifer L. Ingram, Annette B. Rice, Abraham Nyska, Yoshiro Tani, Steven R. Kleeberger, James C. Bonner. (2005) Susceptibility of Signal Transducer and Activator of Transcription-1-Deficient Mice to Pulmonary Fibrogenesis. The American Journal of Pathology 167:5, 1221-1229
CrossRef74
Victor J Thannickal, Kevin R Flaherty, Robert C Hyzy, Joseph P Lynch 3rd. (2005) Emerging drugs for idiopathic pulmonary fibrosis. Expert Opinion on Emerging Drugs 10:4, 707-727
CrossRef75
G??nseli Kln??, Elif Altu?? Kolsuk. (2005) The role of bronchoalveolar lavage in diffuse parenchymal lung diseases. Current Opinion in Pulmonary Medicine 11:5, 417-421
CrossRef76
Bruno Crestani, Sylvain Marchand-Adam, Sophie Schneider. (2005) Traitements médicamenteux de la fibrose pulmonaire idiopathique. Revue de Pneumologie Clinique 61:3, 221-231
CrossRef77
Michael E. Halkos, Anthony A. Gal, Faraz Kerendi, Daniel L. Miller, Joseph I. Miller. (2005) Role of Thoracic Surgeons in the Diagnosis of Idiopathic Interstitial Lung Disease. The Annals of Thoracic Surgery 79:6, 2172-2179
CrossRef78
Mehrnaz Gharaee-Kermani, Kazuo Hatano, Yasuhiro Nozaki, Sem H. Phan. (2005) Gender-Based Differences in Bleomycin-Induced Pulmonary Fibrosis. The American Journal of Pathology 166:6, 1593-1606
CrossRef79
Muntasir M. ABDELAZIZ, Yaseen S. SAMMAN, Siraj O. WALI, Mahir M. A. HAMAD. (2005) Treatment of idiopathic pulmonary fibrosis: Is there anything new?. Respirology 10:3, 284-289
CrossRef80
Brigham C. Willis, Janice M. Liebler, Katherine Luby-Phelps, Andrew G. Nicholson, Edward D. Crandall, Roland M. du Bois, Zea Borok. (2005) Induction of Epithelial-Mesenchymal Transition in Alveolar Epithelial Cells by Transforming Growth Factor-β1. The American Journal of Pathology 166:5, 1321-1332
CrossRef81
S. Harari, A. Caminati. (2005) Idiopathic pulmonary fibrosis. Allergy 60:4, 421-435
CrossRef82
R. Dale Brown, S. Kelly Ambler, M. Darren Mitchell, Carlin S. Long. (2005) THE CARDIAC FIBROBLAST: Therapeutic Target in Myocardial Remodeling and Failure. Annual Review of Pharmacology and Toxicology 45:1, 657-687
CrossRef83
M. Selman, C. Navarro, M. Gaxiola. (2005) Fibrosis pulmonar idiopática: en busca de un tratamiento eficaz. Archivos de Bronconeumología 41, 15-20
CrossRef84
Hiroshi Ishii, Hiroshi Mukae, Jun-ichi Kadota, Takeshi Fujii, Koh Abe, Jun-ichi Ashitani, Shigeru Kohno. (2005) Increased Levels of Interleukin-18 in Bronchoalveolar Lavage Fluid of Patients with Idiopathic Nonspecific Interstitial Pneumonia. Respiration 72:1, 39-45
CrossRef85
Ganesh Raghu, Jacqueline Chang. (2004) Idiopathic pulmonary fibrosis: current trends in management. Clinics in Chest Medicine 25:4, 621-636
CrossRef86
Kevin K. Brown, Ganesh Raghu. (2004) Medical treatment for pulmonary fibrosis: current trends, concepts, and prospects. Clinics in Chest Medicine 25:4, 759-772
CrossRef87
Paul W. Noble, Robert J. Homer. (2004) Idiopathic pulmonary fibrosis: new insights into pathogenesis. Clinics in Chest Medicine 25:4, 749-758
CrossRef88
S. Boniface, J.Y. Gaubert, B. Chetaille, A. Fraticelli, F. Retornaz, P. Astoul, D. Vervloet, A. Magnan, M. Reynaud-Gaubert. (2004) « Classification 2002 des pneumopathies interstitielles idiopathiques ». La Revue de Médecine Interne 25:12, 891-905
CrossRef89
A. Grassegger, R. Hopfl. (2004) Significance of the cytokine interferon gamma in clinical dermatology. Clinical and Experimental Dermatology 29:6, 584-588
CrossRef90
F. Luppi, S. Cerri, B. Beghè, L.M. Fabbri, L. Richeldi. (2004) Corticosteroid and immunomodulatory agents in idiopathic pulmonary fibrosis. Respiratory Medicine 98:11, 1035-1044
CrossRef91
Federica Meloni, Patrizio Vitulo, Alessandro Cascina, Tiberio Oggionni, Anna Bulgheroni, Enrica Paschetto, Catherine Klersy, Andrea M. D’Armini, Anna Fietta, Alessia Marone Bianco, Eloisa Arbustini, Mario Viganò. (2004) Bronchoalveolar lavage cytokine profile in a cohort of lung transplant recipients: A predictive role of interleukin-12 with respect to onset of bronchiolitis obliterans syndrome. The Journal of Heart and Lung Transplantation 23:9, 1053-1060
CrossRef92
Leah A. Cohn, Carol R. Norris, Eleanor C. Hawkins, Janice A. Dye, Cheri A. Johnson, Kurt J. Williams. (2004) Identification and Characterization of an Idiopathic Pulmonary Fibrosis-Like Condition in Cats. Journal of Veterinary Internal Medicine 18:5, 632-641
CrossRef93
Om P Sharma. (2004) Search for a cure for idiopathic pulmonary fibrosis: is stem cell therapy a light at the end of a long tunnel?. Current Opinion in Pulmonary Medicine 10:5, 376-377
CrossRef94
Victor J Thannickal, Kevin R Flaherty, Fernando J Martinez, Joseph P Lynch 3rd. (2004) Idiopathic pulmonary fibrosis: emerging concepts on pharmacotherapy. Expert Opinion on Pharmacotherapy 5:8, 1671-1686
CrossRef95
James C Bonner. (2004) Regulation of PDGF and its receptors in fibrotic diseases. Cytokine & Growth Factor Reviews 15:4, 255-273
CrossRef96
Robert M. Strieter, Michael P. Keane. (2004) Innate immunity dictates cytokine polarization relevant to the development of pulmonary fibrosis. Journal of Clinical Investigation 114:2, 165-168
CrossRef97
Dianhua Jiang, Jiurong Liang, Jennifer Hodge, Bao Lu, Zhou Zhu, Shuang Yu, Juan Fan, Yunfei Gao, Zhinan Yin, Robert Homer, Craig Gerard, Paul W. Noble. (2004) Regulation of pulmonary fibrosis by chemokine receptor CXCR3. Journal of Clinical Investigation 114:2, 291-299
CrossRef98
Sadik Sogut, Huseyin Ozyurt, Ferah Armutcu, Levent Kart, Mustafa Iraz, Omer Akyol, Suleyman Ozen, Suleyman Kaplan, Ismail Temel, Zeki Yildirim. (2004) Erdosteine prevents bleomycin-induced pulmonary fibrosis in rats. European Journal of Pharmacology 494:2-3, 213-220
CrossRef99
Lazaros I. Sakkas, Chris D. Platsoucas. (2004) Is systemic sclerosis an antigen-driven T cell disease?. Arthritis & Rheumatism 50:6, 1721-1733
CrossRef100
(2004) Interferon Gamma-1b for Pulmonary Fibrosis. New England Journal of Medicine 350:17, 1794-1797
Full Text101
Donato Rigante, Stefano Miceli Sopo, Gilda Federico, Achille Stabile. (2004) In Vivo and In Vitro Production of Interferon- γ in Pediatric Patients with Idiopathic Pulmonary Fibrosis. Pediatric Asthma, Allergy & Immunology 17:1, 87-92
CrossRef102
John G McHutchison, Anouk T Dev. (2004) Future trends in managing hepatitis C. Gastroenterology Clinics of North America 33:1, 51-61
CrossRef103
Paul J. Pockros. (2004) Current status of immunomodulatory therapies in HCV infection. Current Hepatitis Reports 3:1, 16-22
CrossRef104
Victor J. Thannickal, Galen B. Toews, Eric S. White, Joseph P. Lynch III, Fernando J. Martinez. (2004) Mechanisms of Pulmonary Fibrosis. Annual Review of Medicine 55:1, 395-417
CrossRef105
Harold A. Chapman. (2004) Disorders of lung matrix remodeling. Journal of Clinical Investigation 113:2, 148-157
CrossRef106
Raghu, Ganesh, Brown, Kevin K., Bradford, Williamson Z., Starko, Karen, Noble, Paul W., Schwartz, David A., King, Talmadge E. Jr., . (2004) A Placebo-Controlled Trial of Interferon Gamma-1b in Patients with Idiopathic Pulmonary Fibrosis. New England Journal of Medicine 350:2, 125-133
Full Text107
Teirstein, Alvin S., . (2004) The Elusive Goal of Therapy for Usual Interstitial Pneumonia. New England Journal of Medicine 350:2, 181-183
Full Text108
Anouk Dev, Keyur Patel, John G. McHutchison. (2004) New therapies for chronic hepatitis C virus infection. Current Gastroenterology Reports 6:1, 77-86
CrossRef109
Jeffrey T. Chapman, Carol F. Farver. (2004) Idiopathic Interstitial Lung Disease. Clinical Pulmonary Medicine 11:1, 17-24
CrossRef110
Hüseyin Özyurt, Sadık Söğüt, Zeki Yıldırım, Levent Kart, Mustafa Iraz, Ferah Armutçu, İsmail Temel, Süleyman Özen, Ahmet Uzun, Ömer Akyol. (2004) Inhibitory effect of caffeic acid phenethyl ester on bleomycine-induced lung fibrosis in rats. Clinica Chimica Acta 339:1-2, 65-75
CrossRef111
Thomas H
gle, Andreas Cerny. (2003) Current therapy and new molecular approaches to antiviral treatment and prevention of hepatitis C. Reviews in Medical Virology 13:6, 361-371
CrossRef112
Eric S White, Michael H Lazar, Victor J Thannickal. (2003) Pathogenetic mechanisms in usual interstitial pneumonia/idiopathic pulmonary fibrosis. The Journal of Pathology 201:3, 343-354
CrossRef113
Koji Kawai, Hideyuki Akaza. (2003) Bleomycin-induced pulmonary toxicity in chemotherapy for testicular cancer. Expert Opinion on Drug Safety 2:6, 587-596
CrossRef114
M MUERS. (2003) What's new in & Respiratory disorders. Medicine 31:11, 1-4
CrossRef115
Marjolein Drent, Roland M. du Bois, Venerino Poletti. (2003) Recent advances in the diagnosis and management of nonspecific interstitial pneumonia. Current Opinion in Pulmonary Medicine 9:5, 411-417
CrossRef116
Luca Richeldi, Huw Richard H R Davies, Paolo Spagnolo, Fabrizio Luppi, Luca Richeldi. 2003. Corticosteroids for idiopathic pulmonary fibrosis. .
CrossRef117
C. EDWARD ROSE, SUNG-SANG J. SUNG, SHU MAN FU. (2003) Significant Involvement of CCL2 (MCP-1) in Inflammatory Disorders of the Lung. Microcirculation 10:3-4, 273-288
CrossRef118
Antony T.H Lin, Philip J Clements, Daniel E Furst. (2003) Update on disease-modifying antirheumatic drugs in the treatment of systemic sclerosis. Rheumatic Disease Clinics of North America 29:2, 409-426
CrossRef119
Marco Chilosi, Venerino Poletti, Alberto Zamò, Maurizio Lestani, Licia Montagna, Paola Piccoli, Serena Pedron, Manuela Bertaso, Aldo Scarpa, Bruno Murer, Alessandra Cancellieri, Roberta Maestro, Gianpietro Semenzato, Claudio Doglioni. (2003) Aberrant Wnt/β-Catenin Pathway Activation in Idiopathic Pulmonary Fibrosis. The American Journal of Pathology 162:5, 1495-1502
CrossRef120
Barbara White. (2003) Interstitial lung disease in scleroderma. Rheumatic Disease Clinics of North America 29:2, 371-390
CrossRef121
Huw Richard H R Davies, Luca Richeldi, E. Haydn Walters, Huw Richard H R Davies. 2003. Immunomodulatory agents for idiopathic pulmonary fibrosis. .
CrossRef122
Shri N. Giri. (2003) N
OVEL PHARMACOLOGICAL APPROACHES TO MANAGE INTERSTITIAL LUNG FIBROSIS IN THE TWENTY -FIRST CENTURY . Annual Review of Pharmacology and Toxicology 43:1, 73-95
CrossRef123
Mohammed S. Razzaque, Takashi Taguchi. (2003) Pulmonary fibrosis: Cellular and molecular events. Pathology International 53:3, 133-145
CrossRef124
Masato Komai, Hiroyuki Tanaka, Taisei Masuda, Koichi Nagao, Masayuki Ishizaki, Masatsugu Sawada, Hiroichi Nagai. (2003) Role of Th2 responses in the development of allergen-induced airway remodelling in a murine model of allergic asthma. British Journal of Pharmacology 138:5, 912-920
CrossRef125
John G. McHutchison, Keyur Patel. (2002) Future therapy of hepatitis C. Hepatology 36:S1, S245-S252
CrossRef126
Hironobu Ihn. (2002) Pathogenesis of fibrosis: role of TGF-β and CTGF. Current Opinion in Rheumatology 14:6, 681-685
CrossRef127
Takahiro Tsuburai, Motoyoshi Suzuki, Yoji Nagashima, Shunsuke Suzuki, Satoshi Inoue, Tomonori Hashiba, Atsuhisa Ueda, Kunihiko Ikehara, Takeshi Matsuse, Yoshiaki Ishigatsubo. (2002) Adenovirus-Mediated Transfer and Overexpression of Heme Oxygenase 1 cDNA in Lung Prevents Bleomycin-Induced Pulmonary Fibrosis via a Fas–Fas Ligand-Independent Pathway. Human Gene Therapy 13:16, 1945-1960
CrossRef128
Vivian Lee, Manu Jain. (2002) Fibroproliferative Acute Respiratory Distress Syndrome: A Changing Paradigm. Clinical Pulmonary Medicine 9:6, 315-322
CrossRef129
O. Blétry, A. Somogyi. (2002) Les interférons ont-ils une action antifibrosante ?Le point de vue de l'interniste. La Revue de Médecine Interne 23, 511S-S15S
CrossRef130
Nam P. Nguyen, John E. Antoine, Suresh Dutta, Ulf Karlsson, Sabah Sallah. (2002) Current concepts in radiation enteritis and implications for future clinical trials. Cancer 95:5, 1151-1163
CrossRef131
C. GESSNER, H. WIRTZ, U. SACK, J. WINKLER, P. STIEHL, J. SCHAUER, G. WOLFF. (2002) BALF N -acetylglucosaminidase and β -galactosidase activities in idiopathic pulmonary fibrosis. Respiratory Medicine 96:9, 751-756
CrossRef132
K. Demopoulos, D. A. Arvanitis, D. A. Vassilakis, N. M. Siafakas, D. A. Spandidos. (2002) MYCL1, FHIT, SPARC, p16 INK4 and TP53 genes associated to lung cancer in idiopathic pulmonary fibrosis. Journal of Cellular and Molecular Medicine 6:2, 215-222
CrossRef133
Andrew Leask, Alan Holmes, David J. Abraham. (2002) Connective tissue growth factor: A new and important player in the pathogenesis of fibrosis. Current Rheumatology Reports 4:2, 136-142
CrossRef134
R.J. SHAW, R. DJUKANOVIC, D.P. TASHKIN, A.B. MILLAR, R.M. DU BOIS, P.A. CORRIS. (2002) The role of small airways in lung disease. Respiratory Medicine 96:2, 67-80
CrossRef135
G. H. Stummvoll. (2002) Current Treatment Options in Systemic Sclerosis (Scleroderma). Acta Medica Austriaca 29:1, 14-19
CrossRef136
S Delanian, J.L Lefaix. (2002) Réversibilité de la fibroatrophie radio-induite. La Revue de Médecine Interne 23:2, 164-174
CrossRef137
David C. Rishikof, Dennis A. Ricupero, Ping-Ping Kuang, Hanqiao Liu, Ronald H. Goldstein. (2002) Interleukin-4 regulates connective tissue growth factor expression in human lung fibroblasts. Journal of Cellular Biochemistry 85:3, 496-504
CrossRef138
Pinak S. Acharya, David A. Zisman. (2001) Antifibrotic Therapy for Idiopathic Pulmonary Fibrosis. Clinical Pulmonary Medicine 8:6, 327-334
CrossRef139
Christopher P. Denton, David J. Abraham. (2001) Transforming growth factor-β and connective tissue growth factor: key cytokines in scleroderma pathogenesis. Current Opinion in Rheumatology 13:6, 505-511
CrossRef140
Joseph A. Lasky, Luis A. Ortiz. (2001) Antifibrotic Therapy for the Treatment of Pulmonary Fibrosis. The American Journal of the Medical Sciences 322:4, 213-221
CrossRef141
Luc Mouthon, Christian Agard. (2001) Treating systemic sclerosis in 2001. Joint Bone Spine 68:5, 393-402
CrossRef142
C. G. Lee, R. J. Homer, Z. Zhu, S. Lanone, X. Wang, V. Koteliansky, J. M. Shipley, P. Gotwals, P. Noble, Q. Chen, R. M. Senior, J. A. Elias. (2001) Interleukin-13 Induces Tissue Fibrosis by Selectively Stimulating and Activating Transforming Growth Factor 1. Journal of Experimental Medicine 194:6, 809-822
CrossRef143
Joseph P. Lynch, Eric White, Kevin Flaherty. (2001) Corticosteroids in idiopathic pulmonary fibrosis. Current Opinion in Pulmonary Medicine 7:5, 298-308
CrossRef144
Robert P. Baughman, Fortune O. Alabi. (2001) Nonsteroidal therapy for idiopathic pulmonary fibrosis. Current Opinion in Pulmonary Medicine 7:5, 309-313
CrossRef145
Gross, Thomas J., Hunninghake, Gary W., . (2001) Idiopathic Pulmonary Fibrosis. New England Journal of Medicine 345:7, 517-525
Full Text146
John W. Wilson, Tiffany L. Bamford. (2001) Assessing the Evidence for Remodelling of the Airway in Asthma. Pulmonary Pharmacology & Therapeutics 14:3, 229-247
CrossRef147
Patricia J. Sime, Katherine M.A. O'Reilly. (2001) Fibrosis of the Lung and Other Tissues: New Concepts in Pathogenesis and Treatment. Clinical Immunology 99:3, 308-319
CrossRef148
Min-Jue Xie, Yoshiharu Motoo, Shi-Bing Su, Norio Sawabu. (2001) Expression of Tumor Necrosis Factor-α, Interleukin-6, and Interferon-γ in Spontaneous Chronic Pancreatitis in the WBN/Kob Rat. Pancreas 22:4, 400-408
CrossRef149
Ganesh Krishna, Kela Liu, Hidenobu Shigemitsu, Mingxing Gao, Thomas A. Raffin, Glenn D. Rosen. (2001) PG490-88, a Derivative of Triptolide, Blocks Bleomycin-Induced Lung Fibrosis. The American Journal of Pathology 158:3, 997-1004
CrossRef150
John Varga. (2000) Progress in systemic sclerosis: Novel therapeutic paradigms. Current Rheumatology Reports 2:6, 481-485
CrossRef151
Ashutosh N Aggarwal, Digamber Behera. (2000) Interferon-γ 1b: impact of new indications (idiopathic pulmonary fibrosis). Expert Opinion on Pharmacotherapy 1:7, 1423-1427
CrossRef152
Daniel E. Furst. (2000) Rational therapy in the treatment of systemic sclerosis. Current Opinion in Rheumatology 12:6, 540-544
CrossRef153
Sunil Gupta, Michael R. Clarkson, Joseph Duggan, Hugh R. Brady. (2000) Connective tissue growth factor: Potential role in glomerulosclerosis and tubulointerstitial fibrosis. Kidney International 58:4, 1389-1399
CrossRef154
Beverly Lange. (2000) The Management of Neoplastic Disorders of Haematopoeisis in Children with Down's Syndrome.. British Journal of Haematology 110:3, 512-524
CrossRef155
Om P. Sharma, Alison G. Wilcox. (2000) Interferons and interstitial lung disease. Current Opinion in Pulmonary Medicine 6:5, 397-398
CrossRef156
Carmen Fonseca, David Abraham, Carol M. Black. (2000) Lung fibrosis. Springer Seminars in Immunopathology 21:4, 453-474
CrossRef157
Epstein, Franklin H., , Blobe, Gerard C., Schiemann, William P., Lodish, Harvey F., . (2000) Role of Transforming Growth Factor β in Human Disease. New England Journal of Medicine 342:18, 1350-1358
Full Text158
Ernest C. Borden, Daniel Lindner, Robert Dreicer, Mohamad Hussein, David Peereboom. (2000) Second-generation interferons for cancer: clinical targets. Seminars in Cancer Biology 10:2, 125-144
CrossRef159
(2000) Interferon Gamma-1b for the Treatment of Idiopathic Pulmonary Fibrosis. New England Journal of Medicine 342:13, 974-975
Full Text160
Carmen Fonseca, David Abraham, Carol M. Black. (1999) Lung fibrosis. Springer Seminars in Immunopathology 21:4, 453-474
CrossRef161
Jim J Egan. (1999) New treatments for pulmonary fibrosis?. The Lancet 354:9193, 1839-1840
CrossRef162
Bois, R.M. du, . (1999) Interferon Gamma-1b for the Treatment of Idiopathic Pulmonary Fibrosis. New England Journal of Medicine 341:17, 1302-1304
Full Text
- Letters
