Original Article
The Prevalence of Hepatitis C Virus Infection in the United States, 1988 through 1994
N Engl J Med 1999; 341:556-562August 19, 1999
- Abstract
Background
Because many persons with chronic hepatitis C virus (HCV) infection are asymptomatic, population-based serologic studies are needed to estimate the prevalence of the infection and to develop and evaluate prevention efforts.
Methods
We performed tests for antibody to HCV (anti-HCV) on serum samples from 21,241 persons six years old or older who participated in the third National Health and Nutrition Examination Survey, conducted during 1988 through 1994. We determined the prevalence of HCV RNA by means of nucleic acid amplification and the genotype by means of sequencing.
Results
The overall prevalence of anti-HCV was 1.8 percent, corresponding to an estimated 3.9 million persons nationwide (95 percent confidence interval, 3.1 million to 4.8 million) with HCV infection. Sixty-five percent of the persons with HCV infection were 30 to 49 years old. Seventy-four percent were positive for HCV RNA, indicating that an estimated 2.7 million persons in the United States (95 percent confidence interval, 2.4 million to 3.0 million) were chronically infected, of whom 73.7 percent were infected with genotype 1 (56.7 percent with genotype 1a, and 17.0 percent with genotype 1b). Among subjects 17 to 59 years of age, the strongest factors independently associated with HCV infection were illegal drug use and high-risk sexual behavior. Other factors independently associated with infection included poverty, having had 12 or fewer years of education, and having been divorced or separated. Neither sex nor racial–ethnic group was independently associated with HCV infection.
Conclusions
In the United States, about 2.7 million persons are chronically infected with HCV. People who use illegal drugs or engage in high-risk sexual behavior account for most persons with HCV infection.
Media in This Article
Table 1
Prevalence of Antibody to HCV (Anti-HCV) According to Demographic Characteristics in NHANES III.Table 2
Prevalence of Antibody to HCV (Anti-HCV) According to Age and Race or Ethnic Group in NHANES III.Article Activity
- Article
Hepatitis C virus (HCV) infection is a leading cause of chronic liver disease in the United States. Before the characterization of HCV,1,2 the magnitude of infection could not be reliably determined because assessment of clinical disease (i.e., non-A, non-B hepatitis) underestimated the true extent of infection. After tests to detect antibody to HCV (anti-HCV) became available, studies to determine the prevalence of HCV infection in the general population were performed, mostly with volunteer blood donors as the subjects.3,4 However, the prevalence of HCV among blood donors does not reflect the prevalence in the general population, since even first-time donors are a highly selected group that has been screened for risk factors associated with various infectious diseases. To estimate the true prevalence of HCV infection in the United States, we tested serum samples from participants in the third National Health and Nutrition Examination Survey (NHANES III) for anti-HCV.
Methods
Survey Design and Collection of Data
The NHANES is conducted periodically by the National Center for Health Statistics, Centers for Disease Control and Prevention (CDC), to obtain national statistics on the health and nutritional status of the noninstitutionalized civilian population by means of household interviews, standardized physical examinations, and collection and testing of blood samples in special mobile examination centers.5 NHANES III, conducted during 1988 through 1994, included a sample of approximately 40,000 persons at least two months of age at 89 randomly selected locations throughout the United States. The study protocol was reviewed and approved by an institutional review board at the CDC. All participants (or their parents, in the case of children) provided written informed consent.
NHANES III was based on a complex, stratified, multistage, probability-sample design.5 Persons less than 5 years of age or 60 years of age or older, blacks, and Mexican Americans were sampled at higher frequencies than other persons. After weighting on the basis of age, sex, level of education, and race or ethnic group, the distribution of participants was similar to that of the U.S. population as a whole.
We collected information in interviews on demographic, occupational, and behavioral characteristics. Race or ethnic group was defined by the subjects' choices among the categories non-Hispanic white, non-Hispanic black, and Mexican American. Subjects who did not choose one of these categories were classified as “other” and analyzed with the total population but not in racial–ethnic subgroups. The poverty index was calculated by dividing the total family income by the poverty threshold, as defined by the U.S. Census, with adjustment for family size at the time of the interview. Questions about years of education, marital status, occupation, and military service were asked of participants 17 years of age or older. Questions about sexual behavior and illegal drug use were asked of participants 17 to 59 years old. For illegal drug use, questions were limited to the use of cocaine (including “crack” cocaine) and marijuana and did not include the method of administration or history of injection. The questionnaire also asked about some surgical procedures (e.g., hysterectomy) and the frequency of dental visits, but it did not ask whether the subjects had undergone blood transfusion.
Laboratory Methods
Testing for HCV infection was performed on serum samples collected from subjects at least six years of age who completed the examination component of NHANES III. Serum samples were tested for anti-HCV with use of a second-generation enzyme immunoassay and a supplemental test (EIA 2.0 and HCV MATRIX, Abbott Laboratories, North Chicago, Ill.). Samples that were positive according to HCV MATRIX were considered positive for anti-HCV.
Testing for HCV RNA by reverse-transcriptase–polymerase-chain-reaction (RT-PCR) amplification of the 5' noncoding region was performed on anti-HCV–positive samples as described previously.6 Samples found to be negative for HCV RNA were extracted a second time by the same procedure, with an additional incubation at 50°C for 45 minutes with 25 units of reverse transcriptase (Boehringer Mannheim, Indianapolis) and 10 units of RNAsin (Boehringer Mannheim).
Nested RT-PCR was used to amplify the 5' noncoding region and the nonstructural coding 5b (NS5b) region with use of previously described primers,6,7 except that R1 (5'GCTCTCAGGCTCGCCGCGTCCTC3') and R2 (5'GCTCTCAGGTTCCGCTGCTCCTC3') were used as internal reverse primers for NS5b amplification. PCR products were separated by electrophoresis on a 2 percent agarose gel, and positive specimens were identified by ethidium bromide staining.6 PCR products were purified and cycle-sequenced with use of internal primers with dye-terminator reaction chemistry. Electrophoresis and nucleotide identification were performed with an automated DNA sequencer (ABI 377, Applied Biosystems, Foster City, Calif.).
The genotypes of HCV RNA–positive samples were determined by the sequencing of 300 nucleotides in the NS5b region.7 We compared sequences for each genotype with published sequences, using the Wisconsin Genetic Computer Group program, with use of subprograms Gap and Pileup for pairwise alignment.8
Serum samples were also tested for serologic markers of hepatitis B virus (HBV) infection9 and antibody to herpes simplex virus type 2.10,11 Serum alanine aminotransferase activity could not be determined, because the manner in which samples were handled before testing (they were frozen at –20°C and thawed at room temperature) has been shown to result in enzyme degradation.12
Statistical Analysis
Estimates of prevalence were weighted so as to represent the total U.S. population and to account for oversampling and for nonparticipation in the household interview and physical examination.13 Weights were further ratio-adjusted according to age, sex, and race or ethnic group to match estimates of the distribution of these factors in the civilian noninstitutionalized U.S. population, with adjustment for undercounting.13,14 Standard errors were calculated with use of SUDAAN software.15 For comparisons among subgroups of the NHANES III population, data were adjusted for age by the direct method to match the 1980 U.S. population.16 Univariate t-statistics were calculated with use of a general linear-contrast procedure in SUDAAN15 so that we could examine age-adjusted or unadjusted differences in the seroprevalence of HCV between the highest and lowest levels of each variable, with a two-sided P value of less than 0.05 considered to indicate statistical significance.
Backward stepwise logistic regression in SUDAAN was used to determine independent predictors of HCV infection in a multivariate model applied to persons 17 to 59 years old. Variables with a Satterthwaite-adjusted F-statistic at P<0.05 were considered significant and were allowed to remain in the model.15
Results
Prevalence of Anti-HCV and Social and Demographic Characteristics
Of the approximately 40,000 persons who were selected for inclusion in NHANES III, 30,930 were at least six years old; 25,733 of this group agreed to be interviewed, and 23,527 agreed to be examined. Of these 23,527 subjects, 21,241 (90 percent) were tested for anti-HCV. Rates of participation were lower for subjects 6 to 11 years old (84 percent) and more than 70 years old (82 percent). Rates of participation were no different when we compared persons who reported engaging in high-risk behavior with those who did not. The prevalence of anti-HCV was 1.8 percent (95 percent confidence interval, 1.5 to 2.3 percent), which corresponds to approximately 3.9 million people in the United States (95 percent confidence interval, 3.1 million to 4.8 million) who have been infected with HCV.
The prevalence of HCV infection was higher among non-Hispanic blacks than among non-Hispanic whites and higher among male subjects than among female subjects (Table 1Table 1
Prevalence of Antibody to HCV (Anti-HCV) According to Demographic Characteristics in NHANES III.). In all racial–ethnic groups, the prevalence of infection was low among subjects in the younger and older age groups (Table 2Table 2Prevalence of Antibody to HCV (Anti-HCV) According to Age and Race or Ethnic Group in NHANES III.), although among non-Hispanic blacks prevalence began to increase at an earlier age (12 to 19 years) than in the other groups. The delayed peak in prevalence among Mexican Americans 50 to 59 years old was probably attributable to the small numbers of subjects and may not accurately reflect the true prevalence in this group. Sixty-five percent of all anti-HCV–positive persons were 30 to 49 years old. The highest observed prevalence was 9.8 percent among black men who were 40 to 49 years old. A higher prevalence of HCV infection also was observed among subjects who were below the poverty level, subjects older than 16 years who were divorced or separated, and subjects who had completed 12 or fewer years of education (Table 1). No association was found between the prevalence of HCV infection and residence in a metropolitan area or in a particular geographic region, prior military service, or foreign birth (Table 1).Risk Factors for HCV Infection
The prevalence of HCV infection was not associated with employment in a health-related occupation (Table 3Table 3
Age-Adjusted Prevalence of Antibodies to HCV (Anti-HCV) According to Race or Ethnic Group and Potential Risk Factors for Infection in NHANES III.), surgery that might have included blood transfusion (e.g., hysterectomy), or a higher frequency of dental visits (data not shown). An increased prevalence of infection was associated with a history of cocaine or marijuana use among all racial–ethnic groups, and prevalence increased with an increasing number of times each drug was used (Table 3). Approximately 14 percent of the participants 17 to 59 years old reported ever having used cocaine, with the highest frequency of use (22 percent) among 25-to-29-year-olds and 30-to-39-year-olds. Among those who had ever used cocaine, the prevalence of infection increased with age, reaching 18.8 percent among those 40 to 59 years old, although this age group reported the lowest frequency of use (6 percent). Forty-five percent of participants reported ever having smoked marijuana, and 12 percent reported smoking it 100 or more times. Although the prevalence of HCV infection among those who had smoked marijuana 100 or more times was similar among subjects in all age groups starting at 30 years (12.3 to 12.8 percent), the proportion who reported smoking marijuana 100 or more times was highest among 30-to-39-year-olds (19 percent) and declined after the age of 40 years.A higher prevalence of HCV infection was also associated with an early age at first sexual intercourse, a greater number of sexual partners, and infection with herpes simplex virus type 2 (Table 3). Twenty-eight percent of participants 17 to 59 years old reported having had 10 or more sexual partners, and 4 percent reported 50 or more. Although the highest prevalence of HCV infection among participants who reported having 10 or more sexual partners was found among persons 30 to 39 years old (7.4 percent), the proportion that reported having 10 or more partners was similar among persons in all age groups from 25 to 49 years of age (30 to 34 percent).
Among participants of all ages, those with serologic evidence of HBV infection were more than six times as likely to be positive for HCV infection as participants without evidence of HBV infection (10.2 percent vs. 1.6 percent [P<0.001], after adjustment for age). Similarly, participants who were positive for HCV infection were nearly six times as likely to be positive for HBV infection as those who were negative for HCV infection (25.7 percent vs. 4.5 percent [P<0.001], after adjustment for age). The age-adjusted prevalence of coinfection with HBV and HCV increased with an increasing number of times cocaine or marijuana was used and with an increasing number of lifetime sexual partners.
Using multivariate analysis, we found that the factors with the strongest independent associations with HCV infection among persons 17 to 59 years old were illegal drug use (ever having used cocaine or having smoked marijuana 100 or more times) and high-risk sexual behavior (an early age at first intercourse or 50 or more lifetime sexual partners) in the absence of illegal drug use (Table 4Table 4
Relative Odds of Positivity for Antibodies to HCV among Subjects 17 to 59 Years Old, According to Selected Variables in NHANES III.). Marital status, income (above or below the poverty level), and the number of years of education also remained independently associated with infection, whereas race or ethnic group did not. No significant interactions were found between age and sex, race or ethnic group and sex, or illegal drug use and high-risk sexual behavior. Including an interaction term for age and race or ethnic group in the model had no effect on the adjusted odds ratios.Prevalence of Viremia and Distribution of Genotypes
The prevalence of positivity for HCV RNA among anti-HCV–positive participants was 73.9 percent (95 percent confidence interval, 65.8 to 83.0 percent). This prevalence corresponds to an estimated 2.7 million persons (95 percent confidence interval, 2.4 million to 3.0 million) with chronic HCV infection nationwide. Non-Hispanic blacks were more likely to be HCV RNA–positive (86.2 percent; 95 percent confidence interval, 78.0 to 95.2 percent) than non-Hispanic whites (67.6 percent; 95 percent confidence interval, 56.1 to 81.6 percent) or Mexican Americans (73.6 percent; 95 percent confidence interval, 66.8 to 81.2 percent) (P=0.02 for both comparisons).
Among subjects who were anti-HCV–positive, there was little variation in the prevalence of HCV RNA according to age among those who were at least 20 years old (weighted average, 75.6 percent; 95 percent confidence interval, 67.3 to 84.9 percent). Although this prevalence was 2.5 times as high as that among younger persons (weighted average, 30.1 percent; 95 percent confidence interval, 9.8 to 92.8 percent), the validity of this difference is questionable because of the small number of HCV RNA–positive persons less than 20 years old (four subjects), and the wide, unstable confidence interval. The only significant difference according to sex was among non-Hispanic blacks, of whom male subjects were more likely to be positive for HCV RNA than female subjects (97.8 percent vs. 70.2 percent, P=0.002). Genotype was determined for 250 of the 283 HCV RNA–positive samples (88.3 percent); 56.7 percent of the 250 samples were classified as 1a, 17.0 percent as 1b, 3.5 percent as 2a, 11.4 percent as 2b, 7.4 percent as 3a, 0.9 percent as 4, and 3.2 percent as 6.
Discussion
The data from our national seroprevalence survey indicate that HCV infection is the most common chronic blood-borne infection in the United States. Our estimates of prevalence might be considered conservative. The NHANES III excluded incarcerated and homeless persons, groups that have high rates of HCV infection, and although the proportion of anti-HCV–positive persons found to have viremia was consistent with that observed in other studies,17-19 we tested only a single sample for each subject. Some HCV-infected persons are intermittently positive for HCV RNA,20 and a single negative result does not exclude the possibility of chronic infection. The predominance of genotype 1a among HCV-infected persons in our study may reflect the unselected nature of the population, as compared with populations of patients referred for evaluation and treatment in other studies.21
In most cases, transmission of HCV had occurred in the recent past, primarily among young adults as a result of drug use and high-risk sexual behavior. The low prevalence of anti-HCV among older persons is most likely due to a cohort effect, with the risk of acquiring HCV infection lower in the distant past than in the recent past. The rates of antibody loss and death from liver disease among HCV-infected persons are reportedly low.17,20 The low prevalence of anti-HCV among persons less than 20 years old also reflects a low risk of infection, since the sensitivity of second-generation anti-HCV assays for detecting HCV infections is the same in infants, children, and adults.22,23
Other studies have demonstrated that injection-drug use is the single most important risk factor for HCV infection.24-26 Because history of injection-drug use was not ascertained in the NHANES III, and because there is no biologically plausible mechanism to explain transmission through marijuana use, it has to be presumed that marijuana use serves as a surrogate for other methods of transmission (such as injection-drug use and high-risk sexual practices). In contrast, among persons who use cocaine, transmission could occur through sharing of blood-contaminated straws or other devices.18 However, intranasal cocaine use in the absence of injection-drug use has been very uncommon among patients with acute hepatitis C26; among injection-drug users with acute hepatitis C, most report also having used cocaine and marijuana (unpublished data). Although intranasal cocaine use could have contributed to the transmission of HCV, it is unlikely to explain the large number of infections associated with drug use in our study.
The lack of a biologically plausible mechanism of transmission through marijuana use, the relation among age, seroprevalence, and patterns of cocaine use, and the direct correlation between coinfection with HBV and HCV and the frequency of drug use suggest that a substantial proportion of HCV-infected persons who reported the use of illegal drugs as defined in our study also had a history of injection-drug use. However, other risk factors, such as high-risk sexual activity or blood transfusion during treatment for traumatic injuries, might be associated with the use of drugs that are not injected and might account for an unidentified proportion of infections in this risk group.
The proportion of HCV infections associated with high-risk sexual behavior was similar to that found for persons with acute hepatitis C.26 The dose–response relation between the prevalence of infection and increasing numbers of sexual partners, even after adjustment for illegal drug use, is consistent with the results of other studies.24,27-29 Although the spread of HCV through sexual activity might be inefficient, as demonstrated by the low infection rates among the spouses of persons with hepatitis C,30 the large number of chronically infected persons in the population provides numerous opportunities for exposure among persons who have multiple sexual partners.
The NHANES III did not obtain information on transfusion history, and we cannot directly estimate the proportion of infections acquired by this route. The incidence of transfusion-associated hepatitis C was relatively high during the two or more decades before the NHANES III, and older persons were disproportionately affected.31-33 On the basis of the age-specific incidence of post-transfusion hepatitis during the 20 years before this study, the CDC estimates that transfusions might have been the source of infection for about 7 percent of the 3.9 million living persons who have been infected with HCV (unpublished data). This proportion is consistent with the low prevalence of HCV infection currently observed among older persons and with the results of studies of acute community-acquired non-A, non-B hepatitis, which indicated that less than 20 percent of cases were acquired through transfusions.20,24,25,34 Since 1990, HCV has rarely been transmitted by blood transfusion in the United States.
Although occupational exposure, such as unintentional needle-stick injuries, can result in infection,30,35 health care workers in general appear not to be at increased risk for HCV infection,36-38 and they do not make up a substantial part of the HCV-infected population. The extent to which perinatal exposure contributes to HCV infection in the general population could not be measured by the NHANES III, but it is likely to be relatively low.
Neither sex nor racial–ethnic group was associated with HCV infection independently of the sociodemographic and behavioral risk factors we studied. Low socioeconomic status might represent unidentified factors that enhance the opportunity for exposure to infected persons.
In the United States, there is a large reservoir of HCV-infected persons who can transmit the infection to others and who are at risk for HCV-related chronic diseases. To prevent new infections, public health programs should focus on preventing the initiation of high-risk drug-related and sexual behavior and on providing risk-reduction counseling and services to those engaged in high-risk activities.30 In addition, we need to develop more effective therapies for persons with infection,39,40 particularly for those with genotype 1 — the most common genotype in the United States and the most difficult to treat — as well as approaches to the treatment of current or former injection-drug users. Most HCV-infected persons are younger than 50 years of age. As a result, the burden of disease associated with HCV infection is likely to increase during the next 10 to 20 years as this cohort reaches the age at which complications of chronic liver disease typically occur. The frequency of such complications might be reduced if infected persons were identified and provided with counseling and appropriate medical care.30,41
Preliminary results of this study were presented at the Ninth Triennial International Symposium on Viral Hepatitis and Liver Disease, Rome, April 21–25, 1996.
We are indebted to Stephen Lambert and Mar Than for their assistance with serologic testing.
Source Information
From the Hepatitis Branch, Division of Viral and Rickettsial Diseases, National Center for Infectious Diseases, Centers for Disease Control and Prevention, Atlanta (M.J.A., O.V.N., F.G., L.A.M., H.S.M.); the National Center for Health Statistics, Centers for Disease Control and Prevention, Hyattsville, Md. (D.K.-M., G.M.M.); and the National Institute of Allergy and Infectious Diseases, Bethesda, Md. (R.A.K.).
Address reprint requests to Dr. Alter at the Hepatitis Branch, Mailstop G37, Centers for Disease Control and Prevention, Atlanta, GA 30333.
- References
References
1
Choo QL ,Kuo G ,Weiner AJ ,Overby LR ,Bradley DW ,Houghton M . Isolation of a cDNA clone derived from a blood-borne non-A, non-B viral hepatitis genome. Science 1989;244:359-362
CrossRef | Web of Science | Medline2
Kuo G ,Choo QL ,Alter HJ , et al. An assay for circulating antibodies to a major etiologic virus of human non-A, non-B hepatitis. Science 1989;244:362-364
CrossRef | Web of Science | Medline3
Alter MJ . Epidemiology of hepatitis C in the West. Semin Liver Dis 1995;15:5-14
CrossRef | Web of Science | Medline4
Mansell CJ ,Locarnini SA . Epidemiology of hepatitis C in the East. Semin Liver Dis 1995;15:15-32
CrossRef | Web of Science | Medline5
National Center for Health Statistics. Plan and operation of the Third National Health and Nutrition Examination Survey, 1988–94. Vital and health statistics. Series 1. No. 32. Washington, D.C.: Government Printing Office, July 1994. (DHHS publication no. (PHS) 94-1308.)
6
Nainan OV ,Cromeans TL ,Margolis HS . Sequence-specific, single primer amplification and detection of PCR products for identification of hepatitis viruses. J Virol Methods 1996;61:127-134
CrossRef | Web of Science | Medline7
Simmonds P ,Holmes EC ,Cha TA , et al. Classification of hepatitis C virus into six major genotypes and a series of subtypes by phylogenetic analysis of the NS-5 region. J Gen Virol 1993;74:2391-2399
CrossRef | Web of Science | Medline8
Devereux J ,Haeberli P ,Smithies O . A comprehensive set of sequence analysis programs for the VAX. Nucleic Acids Res 1983;12:387-395
CrossRef | Web of Science9
McQuillan GM ,Coleman PJ ,Kurszon-Moran D ,Moyer LA ,Lambert SB ,Margolis HS . Prevalence of hepatitis B virus infection in the United States: the National Health and Nutrition Examination Surveys, 1976 through 1994. Am J Public Health 1999;89:14-18
Web of Science | Medline10
Lee FK ,Coleman RM ,Pereira L ,Bailey PD ,Tatsuno M ,Nahmias A . Detection of herpes simplex virus type 2-specific antibody with glycoprotein G. J Clin Microbiol 1985;22:641-644
Web of Science | Medline11
Coleman RM ,Pereira L ,Bailey PD ,Dondero D ,Wickliffe C ,Nahmias A . Determination of herpes simplex virus type-specific antibodies by enzyme-linked immunosorbent assay. J Clin Microbiol 1983;18:287-291
Web of Science | Medline12
Mosley JW ,Goodwin RF . Stability of serum-glutamic pyruvic transaminase activity on storage. Tech Bull Regist Med Technol 1965;35:183-187
Medline13
Mohadjer L, Montaquila J, Waksberg J, et al. National Health and Nutrition Examination Survey III: weighting and examination methodology. Hyattsville, Md.: National Center for Health Statistics, February 1996.
14
Ezzati T, Khare M. Nonresponse adjustments in a national health survey. In: 1992 Proceedings of the Section on Survey Research Methods. Alexandria, Va.: American Statistical Association, 1993:339-44.
15
Shah BV, Barnwell BG, Hurt PN, La Vange LM. SUDAAN users manual, release 5.30. Research Triangle Park, N.C.: Research Triangle Institute, 1991.
16
Kahn HA, Sempos CT. Statistical methods in epidemiology. New York: Oxford University Press, 1989.
17
Seeff LB ,Buskell-Bales Z ,Wright EC , et al. Long-term mortality after transfusion-associated non-A, non-B hepatitis. N Engl J Med 1992;327:1906-1911
Full Text | Web of Science | Medline18
Conry-Cantilena C ,VanRaden M ,Gibble J , et al. Routes of infection, viremia, and liver disease in blood donors found to have hepatitis C virus infection. N Engl J Med 1996;334:1691-1696
Full Text | Web of Science | Medline19
Esteban JI ,Lopez-Talavera JC ,Genesca J , et al. High rate of infectivity and liver disease in blood donors with antibodies to hepatitis C virus. Ann Intern Med 1991;115:443-449
Web of Science | Medline20
Alter MJ ,Margolis HS ,Krawczynski K , et al. The natural history of community-acquired hepatitis C in the United States. N Engl J Med 1992;327:1899-1905
Full Text | Web of Science | Medline21
Lau JY ,Mizokami M ,Kolberg JA , et al. Application of six hepatitis C virus genotyping systems to sera from chronic hepatitis C patients in the United States. J Infect Dis 1995;171:281-289
CrossRef | Web of Science | Medline22
Mast EE ,Alter MJ . Hepatitis C. Semin Pediatr Infect Dis 1997;8:17-22
CrossRef23
Thomas SL ,Newell ML ,Peckham CS ,Ades AE ,Hall AJ . Use of polymerase chain reaction and antibody tests in the diagnosis of vertically transmitted hepatitis C virus infection. Eur J Clin Microbiol Infect Dis 1997;16:711-719
CrossRef | Web of Science | Medline24
Alter MJ ,Gerety RJ ,Smallwood LA , et al. Sporadic non-A, non-B hepatitis: frequency and epidemiology in an urban U.S. population. J Infect Dis 1982;145:886-893
CrossRef | Web of Science | Medline25
Alter MJ ,Hadler SC ,Judson FN , et al. Risk factors for acute non-A, non-B hepatitis in the United States and association with hepatitis C virus infection. JAMA 1990;264:2231-2235
CrossRef | Web of Science | Medline26
Alter MJ . Epidemiology of hepatitis C. Hepatology 1997;26:Suppl 1:62S-65S
CrossRef | Web of Science | Medline27
Thomas DL ,Cannon RO ,Shapiro CN ,Hook EW III ,Alter MJ ,Quinn TC . Hepatitis C, hepatitis B, and human immunodeficiency virus infections among non-intravenous drug-using patients attending clinics for sexually transmitted diseases. J Infect Dis 1994;169:990-995
CrossRef | Web of Science | Medline28
Thomas DL ,Zenilman JM ,Alter HJ , et al. Sexual transmission of hepatitis C virus among patients attending Baltimore sexually transmitted diseases clinics -- an analysis of 309 sex partnerships. J Infect Dis 1995;171:768-775
CrossRef | Web of Science | Medline29
Alter MJ ,Coleman PJ ,Alexander WJ , et al. Importance of heterosexual activity in the transmission of hepatitis B and non-A, non-B hepatitis. JAMA 1989;262:1201-1205
CrossRef | Web of Science | Medline30
Recommendations for prevention and control of hepatitis C virus (HCV) infection and HCV-related chronic diseaseMMWR Morb Mortal Wkly Rep 1998;47:1-39
Medline31
Alter HJ ,Holland PV ,Purcell RH , et al. Posttransfusion hepatitis after exclusion of commercial and hepatitis-B antigen-positive donors. Ann Intern Med 1972;77:691-699
Web of Science | Medline32
Seeff LB ,Wright EC ,Zimmerman HJ ,McCollum RW . VA cooperative study of post-transfusion hepatitis, 1969-1974: incidence and characteristics of hepatitis and responsible risk factors. Am J Med Sci 1975;270:355-362
CrossRef | Web of Science | Medline33
Vamvakas EC ,Taswell HF . Epidemiology of blood transfusion. Transfusion 1994;34:464-470
CrossRef | Web of Science | Medline34
Francis DP ,Hadler SC ,Prendergast TJ , et al. Occurrence of hepatitis A, B, and non-A/non-B in the United States: CDC Sentinel County Hepatitis Study I. Am J Med 1984;76:69-74
CrossRef | Web of Science | Medline35
Lanphear BP ,Linnemann CC Jr ,Cannon CG ,DeRonde MM ,Pendy L ,Kerley LM . Hepatitis C virus infection in healthcare workers: risk of exposure and infection. Infect Control Hosp Epidemiol 1994;15:745-750
CrossRef | Web of Science | Medline36
Thomas DL ,Factor SH ,Kelen GD ,Washington AS ,Taylor E Jr ,Quinn TC . Viral hepatitis in health care personnel at the Johns Hopkins Hospital: the seroprevalence of and risk factors for hepatitis B virus and hepatitis C virus infection. Arch Intern Med 1993;153:1705-1712
CrossRef | Web of Science | Medline37
Panlilio AL ,Shapiro CN ,Schable CA , et al. Serosurvey of human immunodeficiency virus, hepatitis B virus, and hepatitis C virus infection among hospital-based surgeons. J Am Coll Surg 1995;180:16-24
Web of Science | Medline38
Shapiro CN, Tokars JI, Chamberland ME, American Academy of Orthopaedic Surgeons Serosurvey Study Committee. Use of hepatitis-B vaccine and infection with hepatitis B and C among orthopaedic surgeons.J Bone Joint Surg Am 1996;78:1791-800.
39
McHutchison JG ,Gordon SC ,Schiff ER , et al. Interferon alfa-2b alone or in combination with ribavirin as initial treatment for chronic hepatitis C. N Engl J Med 1998;339:1485-1492
Full Text | Web of Science | Medline40
Davis GL ,Esteban-Mur R ,Rustgi V , et al. Interferon alfa-2b alone or in combination with ribavirin for the treatment of relapse of chronic hepatitis C. N Engl J Med 1998;339:1493-1499
Full Text | Web of Science | Medline41
National Institutes of Health Consensus Development Conference Panel statement: management of hepatitis C
CrossRef | Web of Science
- Citing Articles (1039)
Citing Articles
1
Bruce R. Bacon, Omer Khalid. (2012) Triple therapy with boceprevir for HCV genotype 1 infection: phase III results in relapsers and nonresponders. Liver International 32, 51-53
CrossRef2
A. Chris Krueger, Darold L. Madigan, David W. Beno, David A. Betebenner, Robert Carrick, Brian E. Green, Wenping He, Dachun Liu, Clarence J. Maring, Keith F. McDaniel, Hongmei Mo, Akhteruzzaman Molla, Christopher E. Motter, Tami J. Pilot-Matias, Michael D. Tufano, Dale J. Kempf. (2012) Novel Hepatitis C virus replicon inhibitors: Synthesis and structure-activity relationships of fused pyrimidine derivatives. Bioorganic & Medicinal Chemistry Letters
CrossRef3
E. Delwart, E. Slikas, S. L. Stramer, H. Kamel, D. Kessler, D. Krysztof, L. H. Tobler, D. M. Carrick, W. Steele, D. Todd, D. J. Wright, S. H. Kleinman, M. P. Busch, . (2012) Genetic Diversity of Recently Acquired and Prevalent HIV, Hepatitis B Virus, and Hepatitis C Virus Infections in US Blood Donors. Journal of Infectious Diseases
CrossRef4
Timothy T. Gordon-Walker, John P. Iredale. 2012. Abnormal Liver Function Tests: Diagnostic Approach. , 144-161.
CrossRef5
S. Ramia, N. M. Melhem, K. Kreidieh. (2012) Hepatitis C virus infection in the Middle East and North Africa “MENA” region: injecting drug users (IDUs) is an under-investigated population. Infection
CrossRef6
Kevin X. Chen, Bancha Vibulbhan, Weiying Yang, Mousumi Sannigrahi, Francisco Velazquez, Tin-Yau Chan, Srikanth Venkatraman, Gopinadhan N. Anilkumar, Qingbei Zeng, Frank Bennet, Yueheng Jiang, Charles A. Lesburg, Jose Duca, Patrick Pinto, Stephen Gavalas, Yuhua Huang, Wanli Wu, Oleg Selyutin, Sony Agrawal, Boris Feld, Hsueh-Cheng Huang, Cheng Li, Kuo-Chi Cheng, Neng-Yang Shih, Joseph A. Kozlowski, Stuart B. Rosenblum, F. George Njoroge. (2012) Structure–Activity Relationship (SAR) Development and Discovery of Potent Indole-Based Inhibitors of the Hepatitis C Virus (HCV) NS5B Polymerase. Journal of Medicinal Chemistry120106152720008
CrossRef7
Handan Wand, Rebecca Guy, Matthew Law, David P. Wilson, Lisa Maher. (2012) High Rates of Late HIV Diagnosis Among People Who Inject Drugs Compared to Men Who Have Sex with Men and Heterosexual Men and Women in Australia. AIDS and Behavior
CrossRef8
Anthony D. Martinez, Robert G. Gish. (2012) HCV In At Risk Populations: Who Can be Treated and How?. Current Hepatitis Reports
CrossRef9
Alexander Ploss, Matthew J Evans. (2012) Hepatitis C virus host cell entry. Current Opinion in Virology
CrossRef10
F. M. Aslinia, S. K. Wasan, A. L. Mindikoglu, O. A. Adeyemo, B. Philosophe, C. Drachenberg, C. D. Howell. (2012) End-stage renal disease and African American race are independent predictors of mild liver fibrosis in patients with chronic hepatitis C infection. Journal of Viral Hepatitisno-no
CrossRef11
Hans L. Tillmann, John G. McHutchison. 2012. Hepatitis C. , 564-598.
CrossRef12
Jennifer E. Layden, Scott J. Cotler, Shellee A. Grim, Michael J. Fischer, Michael R. Lucey, Nina M. Clark. (2012) Impact of Donor and Recipient Race on Survival After Hepatitis C-Related Liver Transplantation. Transplantation1
CrossRef13
Anita Arora, Natalia Mendoza, Stephen K. Tyring. 2011. Antiviral Market Overview. .
CrossRef14
Jama M. Darling, Stanley M. Lemon, Michael W. Fried. 2011. Hepatitis C. , 582-652.
CrossRef15
Carla Venturi, Javier Bueno, Lluís Castells, Jesus Quintero, Isabel Casas, Helena Allende, Vicente Martinez-Ibañez, Ramón Charco. (2011) Long-term outcome of hepatitis C virus infections acquired after pediatric liver transplantation. Liver Transplantation 17:12, 1474-1480
CrossRef16
Ajay R. Bharti, Scott L. Letendre, Tanya Wolfson, David Clifford, Ann C. Collier, Benjamin Gelman, Justin McArthur, Christina Marra, Allen McCutchan, Susan Morgello, David Simpson, Ron J. Ellis, Igor Grant. (2011) Clinical variables identify seronegative HCV co-infection in HIV-infected individuals. Journal of Clinical Virology 52:4, 328-332
CrossRef17
Basmattee Boodram, Ronald C. Hershow, Scott J. Cotler, Lawrence J. Ouellet. (2011) Chronic hepatitis C virus infection and increases in viral load in a prospective cohort of young, HIV-uninfected injection drug users. Drug and Alcohol Dependence 119:3, 166-171
CrossRef18
Xu Wang, Ting Zhang, Wen-Zhe Ho. (2011) Opioids and HIV/HCV Infection. Journal of Neuroimmune Pharmacology 6:4, 477-489
CrossRef19
Alla Kachko, Galina Kochneva, Galina Sivolobova, Antonina Grazhdantseva, Tatyana Lupan, Iryna Zubkova, Frances Wells, Michael Merchlinsky, Ollie Williams, Hisayoshi Watanabe, Alla Ivanova, Aleksander Shvalov, Valeriy Loktev, Sergei Netesov, Marian E. Major. (2011) New neutralizing antibody epitopes in hepatitis C virus envelope glycoproteins are revealed by dissecting peptide recognition profiles. Vaccine 30:1, 69-77
CrossRef20
Omer Khalid, Bruce R Bacon. (2011) Boceprevir in the treatment of hepatitis C infection: rationale and clinical data. Clinical Investigation 1:12, 1717-1729
CrossRef21
Anthony F. Porto, Lauren Tormey, Joseph K. Lim. (2011) Management of chronic hepatitis C infection in children. Current Opinion in Pediatrics1
CrossRef22
Kathleen B. Schwarz. 2011. HCV and the Pediatric Population. , 190-195.
CrossRef23
Yolanda R. Davila, Elizabeth Reifsnider, Irma Pecina. (2011) Familismo: influence on Hispanic health behaviors. Applied Nursing Research 24:4, e67-e72
CrossRef24
Peter A. Hevezi, Edward Tom, Keith Wilson, Peter Lambert, Gabriela Gutierrez-Reyes, David Kershenobich, Albert Zlotnik. (2011) Gene expression patterns in livers of Hispanic patients infected with hepatitis C virus. Autoimmunity 44:7, 532-542
CrossRef25
Donna M. Evon, Denise A. Esserman, Darmendra Ramcharran, Jason E. Bonner, Michael W. Fried. (2011) Social support and clinical outcomes during antiviral therapy for chronic hepatitis C. Journal of Psychosomatic Research 71:5, 349-356
CrossRef26
K. A. Forde, K. Haynes, A. B. Troxel, S. Trooskin, M. T. Osterman, S. E. Kimmel, J. D. Lewis, V. Lo Re. (2011) Risk of myocardial infarction associated with chronic hepatitis C virus infection: a population-based cohort study*. Journal of Viral Hepatitisno-no
CrossRef27
Hamisu M. Salihu, Laura Connell, Jason L. Salemi, Euna M. August, Hanna E. Weldeselasse, Amina P. Alio. (2011) Prevalence and Temporal Trends of Hepatitis B, Hepatitis C, and HIV/AIDS Co-infection During Pregnancy Across the Decade, 1998–2007. Journal of Women's Health111019074632004
CrossRef28
Donna M Evon, Kelly Simpson, Scott Kixmiller, Joseph Galanko, Karen Dougherty, Carol Golin, Michael W Fried. (2011) A Randomized Controlled Trial of an Integrated Care Intervention to Increase Eligibility for Chronic Hepatitis C Treatment. The American Journal of Gastroenterology 106:10, 1777-1786
CrossRef29
Benjamin Terrier, Fabrice Carrat, Guillaume Geri, Stanislas Pol, Lionel Piroth, Philippe Halfon, Thierry Poynard, Jean-Claude Souberbielle, Patrice Cacoub. (2011) Low 25-OH vitamin D serum levels correlate with severe fibrosis in HIV-HCV co-infected patients with chronic hepatitis. Journal of Hepatology 55:4, 756-761
CrossRef30
Andres F. Carrion, Ravi Ghanta, Olveen Carrasquillo, Paul Martin. (2011) Chronic Liver Disease in the Hispanic Population of the United States. Clinical Gastroenterology and Hepatology 9:10, 834-841
CrossRef31
Weihua Wang, Jianguo Lin, De Tan, Yanjuan Xu, Elizabeth M. Brunt, Xiaofeng Fan, Adrian M. Di Bisceglie. (2011) Divergent quasispecies evolution in de novo hepatitis C virus infection associated with bone marrow transplantation. Biochemical and Biophysical Research Communications 414:1, 148-152
CrossRef32
Joerg-Patrick Stübgen. (2011) Immune-mediated myelitis associated with Hepatitis virus infections. Journal of Neuroimmunology 239:1-2, 21-27
CrossRef33
Gopinadhan N. Anilkumar, Oleg Selyutin, Stuart B. Rosenblum, Qingbei Zeng, Yueheng Jiang, Tin-Yau Chan, Haiyan Pu, Li Wang, Frank Bennett, Kevin X. Chen, Charles A. Lesburg, Jose Duca, Stephen Gavalas, Yuhua Huang, Patrick Pinto, Mousumi Sannigrahi, Francisco Velazquez, Srikanth Venkatraman, Bancha Vibulbhan, Sony Agrawal, Eric Ferrari, Chuan-kui Jiang, H.-C. Huang, Neng-Yang Shih, F. George Njoroge, Joseph A. Kozlowski. (2011) II. Novel HCV NS5B polymerase inhibitors: Discovery of indole C2 acyl sulfonamides. Bioorganic & Medicinal Chemistry Letters
CrossRef34
Gopinadhan N. Anilkumar, Charles A. Lesburg, Oleg Selyutin, Stuart B. Rosenblum, Qingbei Zeng, Yueheng Jiang, Tin-Yau Chan, Haiyan Pu, Henry Vaccaro, Li Wang, Frank Bennett, Kevin X. Chen, Jose Duca, Stephen Gavalas, Yuhua Huang, Patrick Pinto, Mousumi Sannigrahi, Francisco Velazquez, Srikanth Venkatraman, Bancha Vibulbhan, Sony Agrawal, Nancy Butkiewicz, Boris Feld, Eric Ferrari, Zhiqing He, Chuan-kui Jiang, Robert E. Palermo, Patricia Mcmonagle, H.-C. Huang, Neng-Yang Shih, George Njoroge, Joseph A. Kozlowski. (2011) I. Novel HCV NS5B polymerase inhibitors: Discovery of indole 2-carboxylic acids with C3-heterocycles. Bioorganic & Medicinal Chemistry Letters 21:18, 5336-5341
CrossRef35
Ghina Ghazeeri, Lina Abdullah, Ossama Abbas. (2011) Immunological Differences in Women Compared with Men: Overview and Contributing Factors. American Journal of Reproductive Immunology 66:3, 163-169
CrossRef36
Eric Chak, Andrew H. Talal, Kenneth E. Sherman, Eugene R. Schiff, Sammy Saab. (2011) Hepatitis C virus infection in USA: an estimate of true prevalence. Liver International 31:8, 1090-1101
CrossRef37
Choongho Lee. (2011) Discovery of hepatitis C virus NS5A inhibitors as a new class of anti-HCV therapy. Archives of Pharmacal Research 34:9, 1403-1407
CrossRef38
Omer Khalid, Bruce R. Bacon. (2011) Management of the Treatment-Experienced Patient Infected with Hepatitis C Virus Genotype 1: Options and Considerations. Clinics in Liver Disease 15:3, 573-583
CrossRef39
Elisabetta Cariani, Erica Villa, Cristina Rota, Rosina Critelli, Tommaso Trenti. (2011) Translating pharmacogenetics into clinical practice: interleukin (IL)28B and inosine triphosphatase (ITPA) polymophisms in hepatitis C virus (HCV) infection. Clinical Chemistry and Laboratory Medicine 49:8, 1247-1256
CrossRef40
X. Q. Lao, A. Thompson, J. G. McHutchison, J. J. McCarthy. (2011) Sex and age differences in lipid response to chronic infection with the hepatitis C virus in the United States National Health and Nutrition Examination Surveys. Journal of Viral Hepatitis 18:8, 571-579
CrossRef41
Debasis Das, Jian Hong, Shu-Hui Chen, Guangyi Wang, Leonid Beigelman, Scott D. Seiwert, Brad O. Buckman. (2011) Recent advances in drug discovery of benzothiadiazine and related analogs as HCV NS5B polymerase inhibitors. Bioorganic & Medicinal Chemistry 19:16, 4690-4703
CrossRef42
Shimian Zou, Susan L. Stramer, Roger Y. Dodd. (2011) Donor Testing and Risk: Current Prevalence, Incidence, and Residual Risk of Transfusion-Transmissible Agents in US Allogeneic Donations. Transfusion Medicine Reviews
CrossRef43
Archita P. Desai, Nancy Reau. (2011) Naives, Nonresponders, Relapsers: Who Is There Left to Treat?. Clinics in Liver Disease 15:3, 483-495
CrossRef44
Shahriar Tavakoli-Tabasi, Ameena Bagree. (2011) A Longitudinal Cohort Study of Mucocutaneous Drug Eruptions During Interferon and Ribavirin Treatment of Hepatitis C. Journal of Clinical Gastroenterology1
CrossRef45
S. S. El-Kamary, R. Jhaveri, M. D. Shardell. (2011) All-Cause, Liver-Related, and Non-Liver-Related Mortality Among HCV-Infected Individuals in the General US Population. Clinical Infectious Diseases 53:2, 150-157
CrossRef46
Zack S. Moore, Melissa K. Schaefer, Karen K. Hoffmann, Susan C. Thompson, Guo-Liang Xia, Yulin Lin, Yury Khudyakov, Jean-Marie Maillard, Jeffrey P. Engel, Joseph F. Perz, Priti R. Patel, Nicola D. Thompson. (2011) Transmission of Hepatitis C Virus During Myocardial Perfusion Imaging in an Outpatient Clinic. The American Journal of Cardiology 108:1, 126-132
CrossRef47
Sanjay Kulkarni, Tamar H. Taddei. (2011) When should a hepatitis C-positive ESRD patient receive a renal transplant?. Seminars in Dialysis 24:4, 438-439
CrossRef48
Jong Yeop Kim, Ji Eon Won, Sook-Hyang Jeong, Sang Jong Park, Seong Gyu Hwang, Sook-Kyoung Kang, Si Hyun Bae, Young Seok Kim, Han Chu Lee. (2011) Acute hepatitis C in Korea: Different modes of infection, high rate of spontaneous recovery, and low rate of seroconversion. Journal of Medical Virology 83:7, 1195-1202
CrossRef49
B. P. Linas, B. Wang, M. Smurzynski, E. Losina, R. J. Bosch, B. R. Schackman, J. Rong, P. E. Sax, R. P. Walensky, J. Schouten, K. A. Freedberg. (2011) The impact of HIV/HCV co-infection on health care utilization and disability: results of the ACTG Longitudinal Linked Randomized Trials (ALLRT) Cohort. Journal of Viral Hepatitis 18:7, 506-512
CrossRef50
W. N. Southern, M.-L. Drainoni, B. D. Smith, C. L. Christiansen, D. McKee, A. L. Gifford, C. M. Weinbaum, D. Thompson, E. Koppelman, S. Maher, A. H. Litwin. (2011) Hepatitis C testing practices and prevalence in a high-risk urban ambulatory care setting. Journal of Viral Hepatitis 18:7, 474-481
CrossRef51
Valentina Santi, Daniela Buccione, Antonio Di Micoli, Gianluca Fatti, Marta Frigerio, Fabio Farinati, Paolo Del Poggio, Gianludovico Rapaccini, Maria Anna Di Nolfo, Luisa Benvegnù, Marco Zoli, Franco Borzio, Edoardo Giovanni Giannini, Eugenio Caturelli, Maria Chiaramonte, Mauro Bernardi, Franco Trevisani. (2011) The changing scenario of hepatocellular carcinoma over the last two decades in Italy. Journal of Hepatology
CrossRef52
R. J. Harris, M. Ramsay, V. D. Hope, L. Brant, M. Hickman, G. R. Foster, D. De Angelis. (2011) Hepatitis C prevalence in England remains low and varies by ethnicity: an updated evidence synthesis. The European Journal of Public Health
CrossRef53
Rosen, Hugo R., . (2011) Chronic Hepatitis C Infection. New England Journal of Medicine 364:25, 2429-2438
Full Text54
Randy W. Jackson, Matthew G. LaPorte, Torsten Herbertz, Tandy L. Draper, Janet A. Gaboury, Susan R. Rippin, Ravi Patel, Srinivas K. Chunduru, Christopher A. Benetatos, Dorothy C. Young, Christopher J. Burns, Stephen M. Condon. (2011) The discovery and structure–activity relationships of pyrano[3,4-b]indole-based inhibitors of hepatitis C virus NS5B polymerase. Bioorganic & Medicinal Chemistry Letters 21:11, 3227-3231
CrossRef55
Julio Granados-Montiel, Joaquin Zúñiga, Jose Azocar, Edmond J. Feris, Daniel Terreros, Charles E. Larsen, Olga P. Clavijo, Alfredo Cruz-Lagunas, Derek Middleton, Chester A. Alper, Janardan P. Pandey, Edmond J. Yunis. (2011) Interaction between immunoglobulin allotypes and NK receptor genes in diabetes post-hepatitis C virus infection. Immunobiology 216:6, 686-691
CrossRef56
Donna L. White, Peter A. Richardson, Mukhtar Al-Saadi, Stephanie J. Fitzgerald, Linda Green, Chami Amaratunge, Manvir Anand, Hashem B. El-Serag. (2011) Dietary History and Physical Activity and Risk of Advanced Liver Disease in Veterans with Chronic Hepatitis C Infection. Digestive Diseases and Sciences 56:6, 1835-1847
CrossRef57
Tommaso Stroffolini, Franco Trevisani, Giovanbattista Pinzello, Franco Brunello, Maurizio A. Tommasini, Massimo Iavarone, Vito Di Marco, Fabio Farinati, Paolo Del Poggio, Franco Borzio, Mauro Borzio, Eugenio Caturelli, Maria Anna Di Nolfo, Marta Frigerio, Giuseppina Brancaccio, Giovanni Battista Gaeta. (2011) Changing aetiological factors of hepatocellular carcinoma and their potential impact on the effectiveness of surveillance. Digestive and Liver Disease
CrossRef58
Choongho Lee, Han Ma, Julie Qi Hang, Vincent Leveque, Ella H. Sklan, Menashe Elazar, Klaus Klumpp, Jeffrey S. Glenn. (2011) The hepatitis C virus NS5A inhibitor (BMS-790052) alters the subcellular localization of the NS5A non-structural viral protein. Virology 414:1, 10-18
CrossRef59
Fred M. Wu, Chinweike Ukomadu, Robert D. Odze, Anne Marie Valente, John E. Mayer Jr., Michael G. Earing. (2011) Liver Disease in the Patient with Fontan Circulation. Congenital Heart Disease 6:3, 190-201
CrossRef60
Nagaraju Sarabu, Geetha Maddukuri, Devaraj Munikrishnappa, Kevin J. Martin, Rizwan A. Qazi, Alejandro Alvarez, Paul G. Schmitz. (2011) Safety and Efficacy of Transjugular Renal Biopsy Performed by Interventional Nephrologists. Seminars in Dialysis 24:3, 343-348
CrossRef61
E. J. Groessl, K. R. Weingart, C. J. Stepnowsky, A. L. Gifford, S. M. Asch, S. B. Ho. (2011) The hepatitis C self-management programme: a randomized controlled trial. Journal of Viral Hepatitis 18:5, 358-368
CrossRef62
Julie Samantray, Suchitra Zambare, Berhane Seyoum, Abdul B. Abou-Samra. (2011) Glucose Control and Lipid Metabolism in African American Patients with Type 2 Diabetes Mellitus and Chronic Hepatitis C Viral Infection. Endocrine Practice 17:3, 363-368
CrossRef63
Tesfay Abreha, Yimtubezinash Woldeamanuel, Corinna Pietsch, Melanie Maier, Daniel Asrat, Almaz Abebe, Bereket Hailegiorgis, Abraham Aseffa, Uwe Gerd Liebert. (2011) Genotypes and viral load of hepatitis C virus among persons attending a voluntary counseling and testing center in Ethiopia. Journal of Medical Virology 83:5, 776-782
CrossRef64
Erik J. Groessl, Kimberly R. Weingart, Allen L. Gifford, Steven M. Asch, Samuel B. Ho. (2011) Development of the Hepatitis C Self-Management Program. Patient Education and Counseling 83:2, 252-255
CrossRef65
Mary Jane Burton, Imran Sunesara, Alan Penman, Huan Pham, Nora Oliver, Casey A. Young, Novell McGloster, Brendan M. McGuire. (2011) Comparing the Aspartate Aminotransferase (AST) to Platelet Ratio Index (APRI) Between African American and White Veterans with Chronic Hepatitis C. Southern Medical Journal 104:5, 309-314
CrossRef66
Bret E. Fuller, Veronica L. Rodriguez, Alex Linke, Mirko Sikirica, Riad Dirani, Peter Hauser. (2011) Prevalence of liver disease in veterans with bipolar disorder or schizophrenia. General Hospital Psychiatry 33:3, 232-237
CrossRef67
Thomas Astell-Burt, Robin Flowerdew, Paul J. Boyle, John F. Dillon. (2011) Does geographic access to primary healthcare influence the detection of hepatitis C?. Social Science & Medicine 72:9, 1472-1481
CrossRef68
Maria Guido, Flavia Bortolotti. (2011) Viral hepatitis: Treating hepatitis C in children: an open horizon. Nature Reviews Gastroenterology & Hepatology
CrossRef69
B. Boodram, R. C. Hershow, D. Klinzman, J. T. Stapleton. (2011) GB virus C infection among young, HIV-negative injection drug users with and without hepatitis C virus infection. Journal of Viral Hepatitis 18:4, e153-e159
CrossRef70
M. Arshad, S. S. El-Kamary, R. Jhaveri. (2011) Hepatitis C virus infection during pregnancy and the newborn period - are they opportunities for treatment?. Journal of Viral Hepatitis 18:4, 229-236
CrossRef71
Yi He, Jie Zhang, Li Zhong, Xue Chen, Hu-Min Liu, Li-Ke Wan, Huan Wang, Hong Li, Li Tian, Jin-Liang Hu, Ping Luo, Lei Wang, Yan Chen, Tao Liu, Shuang-Li Liu, Wen-Bin Lü. (2011) Prevalence of and risk factors for hepatitis C virus infection among blood donors in Chengdu, China. Journal of Medical Virology 83:4, 616-621
CrossRef72
Seth Himelhoch, Richard Goldberg, Christine Calmes, Deborah Medoff, Eric Slade, Lisa Dixon, Gerard Gallucci, Stanley Rosenberg. (2011) Screening for and prevalence of HIV and Hepatitis C among an outpatient urban sample of people with serious mental illness and co-occurring substance abuse. Journal of Community Psychology 39:2, 231-239
CrossRef73
S. Sockalingam, P. S. Links, S. E. Abbey. (2011) Suicide risk in hepatitis C and during interferon-alpha therapy: a review and clinical update. Journal of Viral Hepatitis 18:3, 153-160
CrossRef74
Kimberly A. Forde, K. Rajender Reddy. (2011) Hormones: A Potential Explanation for Differences in Response Rates to Therapy for Chronic Hepatitis C Infection. Gastroenterology 140:3, 776-779
CrossRef75
Markus Peck–Radosavljevic, John Boletis, Fatih Besisik, Maria Lúcia Ferraz, Laurent Alric, Didier Samuel, Diethelm Messinger, Andreas Tietz, Hugo Cheinquer. (2011) Low-Dose Peginterferon Alfa-2a Is Safe and Produces a Sustained Virologic Response in Patients With Chronic Hepatitis C and End-Stage Renal Disease. Clinical Gastroenterology and Hepatology 9:3, 242-248
CrossRef76
Noha H. Farag, Hebat-Allah Rashed, Magda Hassan, Alaa Darweesh, Mohamed Shehata, Tarek Hassanein, Paul J. Mills. (2011) Hepatitis C infection, Cognition, and inflammation in an Egyptian sample. Journal of Medical Virology 83:2, 261-266
CrossRef77
Yasuteru Kondo, Yoshiyuki Ueno, Eiji Kakazu, Koju Kobayashi, Masaaki Shiina, Keiichi Tamai, Keigo Machida, Jun Inoue, Yuta Wakui, Koji Fukushima, Noriyuki Obara, Osamu Kimura, Tooru Shimosegawa. (2011) Lymphotropic HCV strain can infect human primary naïve CD4+ cells and affect their proliferation and IFN-γ secretion activity. Journal of Gastroenterology 46:2, 232-241
CrossRef78
E. H. Nagami, A. Y. Kim, C. E. Birch, M. J. Bowen, B. H. McGovern. (2011) A "One-Two Punch" Leading to Hepatitis C Seroconversion. Clinical Infectious Diseases 52:3, 361-363
CrossRef79
Brian L. Pearlman. (2011) The IL-28 Genotype: How It Will Affect the Care of Patients with Hepatitis C Virus Infection. Current Gastroenterology Reports 13:1, 78-86
CrossRef80
Fred Poordad, Dickens Theodore, Jane Sullivan, Kelly Grotzinger. (2011) Medical resource utilisation and healthcare costs in patients with chronic hepatitis C viral infection and thrombocytopenia. Journal of Medical Economics 14:2, 194-206
CrossRef81
Tabinda Burney, Geoffrey Dusheiko. (2011) Overview of the PROVE studies evaluating the use of telaprevir in chronic hepatitis C genotype 1 patients. Expert Review of Anti-infective Therapy 9:2, 151-160
CrossRef82
Young-Hee Yoon, Hsiao-ye Yi, Patricia C. Thomson. (2011) Alcohol-Related and Viral Hepatitis C-Related Cirrhosis Mortality among Hispanic Subgroups in the United States, 2000-2004. Alcoholism: Clinical and Experimental Research 35:2, 240-249
CrossRef83
Kathleen B. Schwarz, Regino P. Gonzalez–Peralta, Karen F. Murray, Jean P. Molleston, Barbara A. Haber, Maureen M. Jonas, Philip Rosenthal, Parvathi Mohan, William F. Balistreri, Michael R. Narkewicz, Lesley Smith, Steven J. Lobritto, Stephen Rossi, Alexandra Valsamakis, Zachary Goodman, Patricia R. Robuck, Bruce A. Barton. (2011) The Combination of Ribavirin and Peginterferon Is Superior to Peginterferon and Placebo for Children and Adolescents With Chronic Hepatitis C. Gastroenterology 140:2, 450-458.e1
CrossRef84
Mehwish Riaz, Muhamad Idrees, Hifza Kanwal, Firoz Kabir. (2011) An overview of Triple infection with Hepatitis B, C and D viruses. Virology Journal 8:1, 368
CrossRef85
Chia C. Wang, Linda Cook, Kenneth A. Tapia, Sarah Holte, Meighan Krows, Arthur Bagabag, Anna Santos, Lawrence Corey, Keith R. Jerome. (2011) Cervicovaginal shedding of hepatitis C viral RNA is associated with the presence of menstrual or other blood in cervicovaginal fluids. Journal of Clinical Virology 50:1, 4-7
CrossRef86
Pyung Gohn Goh, Min Jung Kim, Hye Jin Kim, Hyuk Soo Eun, Eui Sik Kim, Yun Jeung Kim, Soo Youn Lee, Hee Seok Moon, Eaum Seok Lee, Seok Hyun Kim, Byung Seok Lee, Heon Young Lee. (2011) Importance of Medication Adherence to Peginterferon-Ribavirin Combination Therapy in Patients with Chronic Hepatitis C. The Korean Journal of Gastroenterology 57:5, 294
CrossRef87
Onpan Cheung, Richard K. Sterling, Jennifer Salvatori, Kim Williams, Sarah Hubbard, Velimir A. Luketic, Todd R. Stravitz, Arun J. Sanyal, Melissa J. Contos, Scott Mills, Mitchell L. Shiffman. (2011) Mild Alcohol Consumption is Not Associated With Increased Fibrosis in Patients With Chronic Hepatitis C. Journal of Clinical Gastroenterology 45:1, 76-82
CrossRef88
Melanie C.M. Murray, Rolando Barrios, Wendy Zhang, Mark Hull, Valentina Montessori, Robert S. Hogg, Julio S.G. Montaner. (2011) Hepatitis C virus treatment rates and outcomes in HIV/hepatitis C virus co-infected individuals at an urban HIV clinic. European Journal of Gastroenterology & Hepatology 23:1, 45-50
CrossRef89
Jae Young Jang, Raymond T. Chung. (2011) Chronic Hepatitis C. Gut and Liver 5:2, 117
CrossRef90
Vjollca Durro, Shpetim Qyra. (2011) Trends in prevalence of hepatitis B virus infection among Albanian blood donors, 1999-2009. Virology Journal 8:1, 96
CrossRef91
Diana Nurutdinova, Arbi B Abdallah, Susan Bradford, Catina C O'Leary, Linda B Cottler. (2011) Risk factors associated with Hepatitis C among female substance users enrolled in community-based HIV prevention studies. BMC Research Notes 4:1, 126
CrossRef92
Yasuteru Kondo, Yoshiyuki Ueno, Tooru Shimosegawa. (2011) Dysfunction of Immune Systems and Host Genetic Factors in Hepatitis C Virus Infection with Persistent Normal ALT. Hepatitis Research and Treatment 2011, 1-7
CrossRef93
Heidi Yeh, Elizabeth Smoot, David A. Schoenfeld, James F. Markmann. (2010) Geographic Inequity in Access to Livers for Transplantation. Transplantation1
CrossRef94
Ju Dong Yang, Lewis R. Roberts. (2010) Epidemiology and Management of Hepatocellular Carcinoma. Infectious Disease Clinics of North America 24:4, 899-919
CrossRef95
Stacey B. Trooskin, Maricruz Vega, Steven K. Herrine, A. Scott McNeal, Robert J. Winn, David J. Axelrod, Victor J. Navarro. (2010) Prevalence of HCV Risk Factors in Hispanic-American Sub Populations. Journal of Immigrant and Minority Health 12:6, 915-920
CrossRef96
Diane M. Settles, Rakesh Vinayek. (2010) Hepatitis C and End-stage Liver Disease. Current Hepatitis Reports 9:4, 243-252
CrossRef97
Naveen C. Srivastav, Neeraj Shakya, Michelle Mak, Chao Liang, D. Lorne J. Tyrrell, Babita Agrawal, Rakesh Kumar. (2010) Synthesis and in vitro antiviral activities of 3′-fluoro (or chloro) and 2′,3′-difluoro 2′,3′-dideoxynucleoside analogs against hepatitis B and C viruses. Bioorganic & Medicinal Chemistry 18:21, 7542-7547
CrossRef98
Khoa D. Lam, Huy N. Trinh, Son T. Do, Thuan T. Nguyen, Ruel T. Garcia, Tuan Nguyen, Quang Q. Phan, Huy A. Nguyen, Khanh K. Nguyen, Long H. Nguyen, Mindie H. Nguyen. (2010) Randomized controlled trial of pegylated interferon-alfa 2a and ribavirin in treatment-naive chronic hepatitis C genotype 6. Hepatology 52:5, 1573-1580
CrossRef99
Siavash Jafari, Ray Copes, Souzan Baharlou, Mahyar Etminan, Jane Buxton. (2010) Tattooing and the risk of transmission of hepatitis C: a systematic review and meta-analysis. International Journal of Infectious Diseases 14:11, e928-e940
CrossRef100
Suganya Selvarajah, Leslie H Tobler, Graham Simmons, Michael P Busch. (2010) Host genetic basis for hepatitis C virus clearance: a role for blood collection centers. Current Opinion in Hematology 17:6, 550-557
CrossRef101
D. M. Evon, K. M. Simpson, D. Esserman, A. Verma, S. Smith, M. W. Fried. (2010) Barriers to accessing care in patients with chronic hepatitis C: the impact of depression. Alimentary Pharmacology & Therapeutics 32:9, 1163-1173
CrossRef102
Shailaja Jamma, Ghazi Hussain, Daryl T.-Y. Lau. (2010) Current Concepts of HBV/HCV Coinfection: Coexistence, but Not Necessarily in Harmony. Current Hepatitis Reports 9:4, 260-269
CrossRef103
Luis A Balart, Mauricio Lisker-Melman, Fayez M Hamzeh, Ambrose Kwok, Ellen Lentz, Maribel Rodriguez-Torres. (2010) Peginterferon α-2a Plus Ribavirin in Latino and Non-Latino Whites With HCV Genotype 1: Histologic Outcomes and Tolerability From the LATINO Study. The American Journal of Gastroenterology 105:10, 2177-2185
CrossRef104
Herbert A. Perkins, Michael P. Busch. (2010) Transfusion-associated infections: 50 years of relentless challenges and remarkable progress. Transfusion 50:10, 2080-2099
CrossRef105
Robert J. Basseri, Michael T. Schmidt, Benjamin Basseri. (2010) Autoimmune hemolytic anemia in treatment-naive chronic hepatitis C infection: a case report and review of literature. Clinical Journal of Gastroenterology 3:5, 237-242
CrossRef106
Harel Dahari, Stephen M. Feinstone, Marian E. Major. (2010) Meta-Analysis of Hepatitis C Virus Vaccine Efficacy in Chimpanzees Indicates an Importance for Structural Proteins. Gastroenterology 139:3, 965-974
CrossRef107
Jonathan Krakoff, Jeanne M. Clark, Jill P. Crandall, Charlton Wilson, Mark E. Molitch, Frederick L. Brancati, Sharon L. Edelstein, William C. Knowler. (2010) Effects of Metformin and Weight Loss on Serum Alanine Aminotransferase Activity in the Diabetes Prevention Program. Obesity 18:9, 1762-1767
CrossRef108
Zohreh Sharifi, Mahmood Mahmoodian Shooshtari, Fahimeh Rangbar Kermani. (2010) Identification of HCV genotypes in HCV infected blood donors. Indian Journal of Microbiology 50:3, 275-279
CrossRef109
Grazia Sellitto, Aurora Faruolo, Paolo de Caprariis, Sergio Altamura, Giacomo Paonessa, Gennaro Ciliberto. (2010) Synthesis and anti-hepatitis C virus activity of novel ethyl 1H-indole-3-carboxylates in vitro. Bioorganic & Medicinal Chemistry 18:16, 6143-6148
CrossRef110
Ju Dong Yang, Lewis R. Roberts. (2010) Hepatocellular carcinoma: a global view. Nature Reviews Gastroenterology & Hepatology 7:8, 448-458
CrossRef111
Michael R Narkewicz, Philip Rosenthal, Kathleen B Schwarz, Arlene Drack, Todd Margolis, Michael X Repka. (2010) Ophthalmologic Complications in Children With Chronic Hepatitis C Treated With Pegylated Interferon. Journal of Pediatric Gastroenterology and Nutrition 51:2, 183-186
CrossRef112
Xiaoan Zhang, Xiaofeng Fan, Yanjuan Xu, Adrian M. Di Bisceglie. (2010) Enhanced protocol for determining the 3′ terminus of hepatitis C virus. Journal of Virological Methods 167:2, 158-164
CrossRef113
Eric Chak, Sammy Saab. (2010) Pegylated Interferon and Ribavirin Dosing Strategies to Enhance Sustained Virologic Response. Current Hepatitis Reports 9:3, 147-154
CrossRef114
Benjamin Basseri, David Yamini, Grace Chee, Pharm D. Pedram Enayati, Tram Tran, Fred Poordad. (2010) Comorbidities associated with the increasing burden of hepatitis C infection. Liver International 30:7, 1012-1018
CrossRef115
Aymin Delgado-Borrego, David Healey, Betania Negre, Marielle Christofi, Sabina Sabharwal, David A Ludwig, Raymond T Chung, Maureen M Jonas. (2010) Influence of Body Mass Index on Outcome of Pediatric Chronic Hepatitis C Virus Infection. Journal of Pediatric Gastroenterology and Nutrition 51:2, 191-197
CrossRef116
Carolina Posada, David J. Moore, Steven Paul Woods, Ofilio Vigil, Chris Ake, William Perry, Tarek I. Hassanein, Scott L. Letendre, Igor Grant, the HIV Neurobehavioral Research Ce. (2010) Implications of hepatitis C virus infection for behavioral symptoms and activities of daily living. Journal of Clinical and Experimental Neuropsychology 32:6, 637-644
CrossRef117
Licui Wang, Qiuxia Fu, Yafeng Dong, Yong Zhou, Shuaizheng Jia, Juan Du, Fang Zhao, Yingli Wang, Xiaohui Wang, Jianchun Peng, Shuhua Yang, Linsheng Zhan. (2010) Bioluminescence imaging of Hepatitis C virus NS3/4A serine protease activity in cells and living animals. Antiviral Research 87:1, 50-56
CrossRef118
Hanneke van Soest, Peter J. van der Schaar, Ger H. Koek, Richard A. de Vries, Nancy A. van Ooteghem, Bart van Hoek, Joost P.H. Drenth, Jan M. Vrolijk, Rob J. Lieverse, Peter Houben, Annet van der Sluys Veer, Peter D. Siersema, Marguerite E.I. Schipper, Karel J. van Erpecum, Greet J. Boland. (2010) No beneficial effects of amantadine in treatment of chronic hepatitis C patients. Digestive and Liver Disease 42:7, 496-502
CrossRef119
Benjamin J. Morasco, Marilyn Huckans, Jennifer M. Loftis, Jonathan Woodhouse, Adriana Seelye, Dennis C. Turk, Peter Hauser. (2010) Predictors of pain intensity and pain functioning in patients with the hepatitis C virus. General Hospital Psychiatry 32:4, 413-418
CrossRef120
Kelly P. Burke, Andrea L. Cox. (2010) Hepatitis C virus evasion of adaptive immune responses: a model for viral persistence. Immunologic Research 47:1-3, 216-227
CrossRef121
Latha G. Nair, Stephane Bogen, Frank Bennett, Kevin Chen, Bancha Vibulbhan, Yuhua Huang, Weing Yang, Ronald J. Doll, N.-Y. Shih, F. George Njoroge. (2010) Design and synthesis of novel fluoro amino acids: synthons for potent macrocyclic HCV NS3 protease inhibitors. Tetrahedron Letters 51:23, 3057-3061
CrossRef122
Akira Matsumori, Miho Shimada, Tsutomu Obata. (2010) Leukocytes are the major target of hepatitis C virus infection: Possible mechanism of multiorgan involvement including the heart. CVD Prevention and Control 5:2, 51-58
CrossRef123
A.E. Shafii, J.W. Su, N.G. Smedira, J.L. Navia, D.O. Taylor, R.C. Starling, G. Gonzalez-Stawinski. (2010) The Effect of Recipient Hepatitis C Virus Infection on Outcomes Following Heart Transplantation. Transplantation Proceedings 42:5, 1784-1787
CrossRef124
Jeanette J. McCarthy, Josephine H. Li, Alexander Thompson, Sunil Suchindran, Xiang Qian Lao, Keyur Patel, Hans L. Tillmann, Andrew J. Muir, John G. McHutchison. (2010) Replicated Association Between an IL28B Gene Variant and a Sustained Response to Pegylated Interferon and Ribavirin. Gastroenterology 138:7, 2307-2314
CrossRef125
R. F. Gillum, Cheryl L. Holt. (2010) Religious Involvement and Seroprevalence of Six Infectious Diseases in US Adults. Southern Medical Journal 103:5, 403-408
CrossRef126
Matthew G. LaPorte, Tandy L. Draper, Lori E. Miller, Charles W. Blackledge, Lara K. Leister, Eugene Amparo, Alison R. Hussey, Dorothy C. Young, Srinivas K. Chunduru, Christopher A. Benetatos, Gerry Rhodes, Ariamala Gopalsamy, Torsten Herbertz, Christopher J. Burns, Stephen M. Condon. (2010) The discovery and structure–activity relationships of pyrano[3,4-b]indole based inhibitors of hepatitis C virus NS5B polymerase. Bioorganic & Medicinal Chemistry Letters 20:9, 2968-2973
CrossRef127
Nazish Bostan, Tariq Mahmood. (2010) An overview about hepatitis C: A devastating virus. Critical Reviews in Microbiology 36:2, 91-133
CrossRef128
K. Yusim, W. Fischer, H. Yoon, J. Thurmond, P. W. Fenimore, G. Lauer, B. Korber, C. Kuiken. (2010) Genotype 1 and global hepatitis C T-cell vaccines designed to optimize coverage of genetic diversity. Journal of General Virology 91:5, 1194-1206
CrossRef129
L. RAGAB, S. HELAL, N. ZAGHLOUL, M. EL-RAZIKY, R. AFIFI, K. M. MUSALLAM, A. T. TAHER. (2010) Clinicovirologic analysis of hepatitis C infection in transfusion-dependent β-thalassemia major children. International Journal of Laboratory Hematology 32:2, 184-190
CrossRef130
Christine Meffre, Yann Le Strat, Elisabeth Delarocque-Astagneau, Fréderic Dubois, Denise Antona, Jean-Marie Lemasson, Josiane Warszawski, Josiane Steinmetz, Dominique Coste, Jean-François Meyer, Sandrine Leiser, Jean-Pierre Giordanella, René Gueguen, Jean-Claude Desenclos. (2010) Prevalence of hepatitis B and hepatitis C virus infections in France in 2004: Social factors are important predictors after adjusting for known risk factors. Journal of Medical Virology 82:4, 546-555
CrossRef131
Omar Mohamed E. Abdel Salam, Amany A. Sleem, Nermeen Shafee. (2010) Hepatoprotective effects of the nitric oxide donor isosorbide-5-mononitrate alone and in combination with the natural hepatoprotectant, silymarin, on carbon tetrachloride-induced hepatic injury in rats. Inflammopharmacology 18:2, 87-94
CrossRef132
Frank Bennett, Yuhua Huang, Siska Hendrata, Raymond Lovey, Stephane L. Bogen, Weidong Pan, Zhuyan Guo, Andrew Prongay, Kevin X. Chen, Ashok Arasappan, Srikanth Venkatraman, Francisco Velazquez, Latha Nair, Mousumi Sannigrahi, Xiao Tong, John Pichardo, Kuo-Chi Cheng, Viyyoor M. Girijavallabhan, Anil K. Saksena, F. George Njoroge. (2010) The introduction of P4 substituted 1-methylcyclohexyl groups into Boceprevir®: A change in direction in the search for a second generation HCV NS3 protease inhibitor. Bioorganic & Medicinal Chemistry Letters 20:8, 2617-2621
CrossRef133
Katherine E McGoogan, P Brian Smith, Steve S Choi, Wallace Berman, Ravi Jhaveri. (2010) Performance of the AST-to-Platelet Ratio Index as a Noninvasive Marker of Fibrosis in Pediatric Patients With Chronic Viral Hepatitis. Journal of Pediatric Gastroenterology and Nutrition 50:3, 344-346
CrossRef134
Charalabos-Markos Dintsios, Alexander Haverkamp, Johannes Wiegand, Tilman Gerlach, Heiner Wedemeyer, Gerd Pape, Michael Peter Manns, Christian Krauth. (2010) Economic evaluation of early monotherapy versus delayed monotherapy or combination therapy in patients with acute hepatitis C in Germany. European Journal of Gastroenterology & Hepatology 22:3, 278-288
CrossRef135
I. M. V. G. de Carvalho-Mello, J. E. M. Filho, M. S. Gomes-Gouvea, F. de Mello Malta, A. T. L. de Queiroz, J. R. R. Pinho, F. J. Carrilho. (2010) Molecular evidence of horizontal transmission of hepatitis C virus within couples. Journal of General Virology 91:3, 691-696
CrossRef136
K. E. Corey, J. Mendez-Navarro, E. C. Gorospe, H. Zheng, R. T. Chung. (2010) Early treatment improves outcomes in acute hepatitis C virus infection: a meta-analysis. Journal of Viral Hepatitis 17:3, 201-207
CrossRef137
Stéphane L. Bogen, Ashok Arasappan, Francisco Velazquez, Melissa Blackman, Regina Huelgas, Weidong Pan, Elise Siegel, Latha G. Nair, Srikanth Venkatraman, Zhuyan Guo, Ronald Doll, Neng-Yang Shih, F. George Njoroge. (2010) Discovery of potent sulfonamide P4-capped ketoamide second generation inhibitors of hepatitis C virus NS3 serine protease with favorable pharmacokinetic profiles in preclinical species. Bioorganic & Medicinal Chemistry 18:5, 1854-1865
CrossRef138
Brian J. McMahon, Dana Bruden, Michael G. Bruce, Stephen Livingston, Carol Christensen, Chriss Homan, Thomas W. Hennessy, James Williams, Daniel Sullivan, Hugo R. Rosen, David Gretch. (2010) Adverse Outcomes in Alaska Natives Who Recovered From or Have Chronic Hepatitis C Infection. Gastroenterology 138:3, 922-931.e1
CrossRef139
Latha G. Nair, Stephane Bogen, Sumei Ruan, Weidong Pan, Russel Pike, Xiao Tong, Kuo-Chi Cheng, Zhuyan Guo, Ronald J. Doll, F. George Njoroge. (2010) Towards the second generation of Boceprevir: Dithianes as an alternative P2 substituent for 2,2-dimethyl cycloproyl proline in HCV NS3 protease inhibitors. Bioorganic & Medicinal Chemistry Letters 20:5, 1689-1692
CrossRef140
Ajit Sood, Vandana Midha, Neena Sood, Amarjit Kaur, Sandeep Puri. (2010) Response to antiviral treatment in patients with chronic hepatitis C with persistently normal liver enzymes. Indian Journal of Gastroenterology 29:2, 90-91
CrossRef141
Hitoshi Ohto, Tsutomu Ishii, Junichi Kitazawa, Seiji Sugiyama, Niro Ujiie, Keiya Fujimori, Hiromichi Ariga, Tomoko Satoh, Kenneth E. Nollet, Hiroaki Okamoto, Tanji Hoshi. (2010) TRANSFUSION COMPLICATIONS: Declining hepatitis C virus (HCV) prevalence in pregnant women: impact of anti-HCV screening of donated blood. Transfusion 50:3, 693-700
CrossRef142
Philip R Spradling, James T Richardson, Kate Buchacz, Anne C Moorman, Lyn Finelli, Beth P Bell, John T Brooks. (2010) Trends in Hepatitis C Virus Infection Among Patients in the HIV Outpatient Study, 1996-2007. JAIDS Journal of Acquired Immune Deficiency Syndromes 53:3, 388-396
CrossRef143
Jeffery M. Klco, Bob Geng, Elizabeth M. Brunt, Anjum Hassan, Tu-Dung Nguyen, Friederike H. Kreisel, Mauricio Lisker-Melman, John L. Frater. (2010) Bone marrow biopsy in patients with hepatitis C virus infection: Spectrum of findings and diagnostic utility. American Journal of Hematology 85:2, 106-110
CrossRef144
Gary L. Davis, Miriam J. Alter, Hashem El–Serag, Thierry Poynard, Linda W. Jennings. (2010) Aging of Hepatitis C Virus (HCV)-Infected Persons in the United States: A Multiple Cohort Model of HCV Prevalence and Disease Progression. Gastroenterology 138:2, 513-521.e6
CrossRef145
Jennifer G. Plebani, Carlos F. Tirado, Helen M. Pettinati, Kyle M. Kampman, Joseph R. Volpicelli, David W. Oslin. (2010) Combined effects of alcohol and hepatitis C: A secondary analysis of alcohol use biomarkers and high-risk behaviors from two medication trials for alcohol dependence. Addictive Behaviors 35:2, 123-128
CrossRef146
D. R. SILVA, J. STIFFT, H. CHEINQUER, M. M. KNORST. (2010) Prevalence of hepatitis C virus infection in patients with COPD. Epidemiology and Infection 138:02, 167
CrossRef147
Chia-Yen Dai, Chi-Kung Ho, Jee-Fu Huang, Ming-Yen Hsieh, Nai-Jen Hou, Zu-Yau Lin, Shinn-Cherng Chen, Ming-Yuh Hsieh, Liang-Yen Wang, Wen-Yu Chang, Ming-Lung Yu, Wan-Long Chuang. (2010) Hepatitis C virus viremia and low platelet count: A study in a hepatitis B & C endemic area in Taiwan. Journal of Hepatology 52:2, 160-166
CrossRef148
Naoyuki Nishimura, Norio Isoda, Toshihiko Higashizawa, Toshiya Otake, Mamiko Tsukui, Shigeo Nagashima, Masaharu Takahashi, Hiroaki Okamoto, Kentaro Sugano. (2010) A case of acute hepatitis C caused by interspousal transmission after 30 years of marriage. Clinical Journal of Gastroenterology 3:1, 50-56
CrossRef149
Andrea A Howard, Donald R Hoover, Kathryn Anastos, Xi Wu, Qiuhu Shi, Howard D Strickler, Stephen R Cole, Mardge H Cohen, Andrea Kovacs, Michael Augenbraun, Patricia S Latham, Phyllis C Tien. (2010) The Effects of Opiate Use and Hepatitis C Virus Infection on Risk of Diabetes Mellitus in the Womenʼs Interagency HIV Study. JAIDS Journal of Acquired Immune Deficiency Syndromes1
CrossRef150
Sanjaya K. Satapathy, Chandra Sekhar Lingisetty, Shawnette Proper, Shobhana Chaudhari, Susan Williams. (2010) Equally Poor Outcomes to Pegylated Interferon-based Therapy in African Americans and Hispanics With Chronic Hepatitis C Infection. Journal of Clinical Gastroenterology 44:2, 140-145
CrossRef151
Su-Hyung Park, Mi-Young Song, Hyo Jung Nam, Se Jin Im, Young-Chul Sung. (2010) Codelivery of IL-7 Augments Multigenic HCV DNA Vaccine-induced Antibody as well as Broad T Cell Responses in Cynomolgus Monkeys. Immune Network 10:6, 198
CrossRef152
Michael P. Wilson, Edward M. Castillo, Andrew M. Batey, Jeffrey Sapyta, Sari Aronson. (2010) Hepatitis C and Depressive Symptoms: Psychological and Social Factors Matter More Than Liver Injury. The International Journal of Psychiatry in Medicine 40:2, 199-215
CrossRef153
C. Kent Martin, Jeffrey E. Hostetter, John J. Hagan. (2010) New Opportunities for the Management and Therapy of Hepatitis C in Correctional Settings. American Journal of Public Health 100:1, 13-17
CrossRef154
Latha G. Nair, Mousumi Sannigrahi, Stephane Bogen, Patrick Pinto, Kevin X. Chen, Andrew Prongay, Xiao Tong, K.-C. Cheng, Viyyoor Girijavallabhan, F. George Njoroge. (2010) P4 capped amides and lactams as HCV NS3 protease inhibitors with improved potency and DMPK profile. Bioorganic & Medicinal Chemistry Letters 20:2, 567-570
CrossRef155
Mariana Cherner, Paola Suarez, Corinna Casey, Robert Deiss, Scott Letendre, Thomas Marcotte, Florin Vaida, J. Hampton Atkinson, Igor Grant, Robert K. Heaton. (2010) Methamphetamine use parameters do not predict neuropsychological impairment in currently abstinent dependent adults. Drug and Alcohol Dependence 106:2-3, 154-163
CrossRef156
Mobin Khan, Md. Golam Mustafa, Nooruddin Ahmad, Md. Shahinul Alam, Rahat Hasan Baig, Ziaur Rahman Chowdhry, Mostaq Ahmed. (2010) Seroprevalence of hepatitis C virus in rural population of Bangladesh. Indian Journal of Gastroenterology 29:1, 44-45
CrossRef157
Sumeet K. Asrani, Paula Buchanan, Brett Pinsky, Lisa Rocca Rey, Mark Schnitzler, Fasiha Kanwal. (2010) Lack of Association Between Hepatitis C Infection and Chronic Kidney Disease. Clinical Gastroenterology and Hepatology 8:1, 79-84
CrossRef158
Gennady I. Ruban, Vladimir V. Berdnik, Dmitry V. Marinitch, Natalia V. Goncharova, Valery A. Loiko. (2010) Light scattering and morphology of the lymphocyte as applied to flow cytometry for distinguishing healthy and infected individuals. Journal of Biomedical Optics 15:5, 057008
CrossRef159
Edmund J. Bini, Ponni V. Perumalswami. (2010) Hepatitis B virus infection among American patients with chronic hepatitis C virus infection: Prevalence, racial/ethnic differences, and viral interactions. HepatologyNA-NA
CrossRef160
Yeon-Soon Ahn. (2010) Infectious Diseases among Healthcare Workers. Journal of the Korean Medical Association 53:6, 454
CrossRef161
Rafael Guerrero-Preston, Abby Siegel, John Renz, David Vlahov, Alfred Neugut. (2009) HCV Infection and Cryptogenic Cirrhosis are Risk Factors for Hepatocellular Carcinoma Among Latinos in New York City. Journal of Community Health 34:6, 500-505
CrossRef162
Loredana Sansonno, Felicia Anna Tucci, Silvia Sansonno, Gianfranco Lauletta, Laura Troiani, Domenico Sansonno. (2009) B cells and HCV: An infection model of autoimmunity. Autoimmunity Reviews 9:2, 93-94
CrossRef163
M. Acalovschi, C. Buzas, C. Radu, M. Grigorescu. (2009) Hepatitis C virus infection is a risk factor for gallstone disease: a prospective hospital-based study of patients with chronic viral C hepatitis. Journal of Viral Hepatitis 16:12, 860-866
CrossRef164
Ted Myers, Dan Allman, Kunyong Xu, Robert S. Remis, Jeffrey Aguinaldo, Ann Burchell, Liviana Calzavara, Carol Swantee. (2009) The prevalence and correlates of hepatitis C virus (HCV) infection and HCV–HIV co-infection in a community sample of gay and bisexual men. International Journal of Infectious Diseases 13:6, 730-739
CrossRef165
W. Ray Kim, Norah A. Terrault, Rachel A. Pedersen, Terry M. Therneau, Erick Edwards, Andrew A. Hindman, Carol L. Brosgart. (2009) Trends in Waiting List Registration for Liver Transplantation for Viral Hepatitis in the United States. Gastroenterology 137:5, 1680-1686
CrossRef166
Ma Somsouk, Hal F. Yee, Scott W. Biggins. (2009) Understanding Liver Health Using the National Center for Health Statistics. Digestive Diseases and Sciences 54:11, 2325-2329
CrossRef167
Katherine Bornschlegel, Magdalena Berger, Renu K. Garg, Amado Punsalang, Christy M. McKinney, R. Charon Gwynn, Lorna E. Thorpe. (2009) Prevalence of Hepatitis C Infection in New York City, 2004. Journal of Urban Health 86:6, 909-917
CrossRef168
Andre Boonstra, Luc J. W. van der Laan, Thomas Vanwolleghem, Harry L. A. Janssen. (2009) Experimental models for hepatitis C viral infection. Hepatology 50:5, 1646-1655
CrossRef169
David A. Ellis, Julie K. Blazel, Chinh V. Tran, Frank Ruebsam, Douglas E. Murphy, Lian-Sheng Li, Jingjing Zhao, Yuefen Zhou, Helen M. McGuire, Alan X. Xiang, Stephen E. Webber, Qiang Zhao, Qing Han, Charles R. Kissinger, Matthew Lardy, Alberto Gobbi, Richard E. Showalter, Amit M. Shah, Mei Tsan, Rupal A. Patel, Laurie A. LeBrun, Ruhi Kamran, Darian M. Bartkowski, Thomas G. Nolan, Daniel A. Norris, Maria V. Sergeeva, Leo Kirkovsky. (2009) 5,5′- and 6,6′-Dialkyl-5,6-dihydro-1H-pyridin-2-ones as potent inhibitors of HCV NS5B polymerase. Bioorganic & Medicinal Chemistry Letters 19:21, 6047-6052
CrossRef170
Michael D. Stein, Debra S. Herman, Bradley J. Anderson. (2009) A Trial to Reduce Hepatitis C Seroincidence in Drug Users. Journal of Addictive Diseases 28:4, 389-398
CrossRef171
L. A. King, Y. Le Strat, C. Meffre, E. Delarocque-Astagneau, J.-C. Desenclos. (2009) Assessment and proposal of a new combination of screening criteria for hepatitis C in France. The European Journal of Public Health 19:5, 527-533
CrossRef172
Javier de Vicente, Robert T. Hendricks, David B. Smith, Jay B. Fell, John Fischer, Stacey R. Spencer, Peter J. Stengel, Peter Mohr, John E. Robinson, James F. Blake, Ramona K. Hilgenkamp, Calvin Yee, Junping Zhao, Todd R. Elworthy, Jahari Tracy, Elbert Chin, Jim Li, Al Lui, Beihan Wang, Connie Oshiro, Seth F. Harris, Manjiri Ghate, Vincent J.P. Leveque, Isabel Najera, Sophie Le Pogam, Sonal Rajyaguru, Gloria Ao-Ieong, Ludmila Alexandrova, Bill Fitch, Michael Brandl, Mohammad Masjedizadeh, Shao-yong Wu, Steve de Keczer, Tatyana Voronin. (2009) Non-nucleoside inhibitors of HCV polymerase NS5B. Part 3: Synthesis and optimization studies of benzothiazine-substituted tetramic acids. Bioorganic & Medicinal Chemistry Letters 19:19, 5648-5651
CrossRef173
Javier de Vicente, Robert T. Hendricks, David B. Smith, Jay B. Fell, John Fischer, Stacey R. Spencer, Peter J. Stengel, Peter Mohr, John E. Robinson, James F. Blake, Ramona K. Hilgenkamp, Calvin Yee, George Adjabeng, Todd R. Elworthy, Jim Li, Beihan Wang, Joe T. Bamberg, Seth F. Harris, April Wong, Vincent J.P. Leveque, Isabel Najera, Sophie Le Pogam, Sonal Rajyaguru, Gloria Ao-Ieong, Ludmila Alexandrova, Susan Larrabee, Michael Brandl, Andrew Briggs, Sunil Sukhtankar, Robert Farrell. (2009) Non-nucleoside inhibitors of HCV polymerase NS5B. Part 4: Structure-based design, synthesis, and biological evaluation of benzo[d]isothiazole-1,1-dioxides. Bioorganic & Medicinal Chemistry Letters 19:19, 5652-5656
CrossRef174
(2009) Selective Synthesis of 1'(α),2'(β)-C-Dimethyl Carbocyclic Adenosine Analogue as Potential anti-HCV Agent. Bulletin of the Korean Chemical Society 30:9, 2039-2042
CrossRef175
Shirley X. Hu, Namgyal L. Kyulo, Victor W. Xia, Donald J. Hillebrand, Ke-Qin Hu. (2009) Factors Associated With Hepatic Fibrosis In Patients With Chronic Hepatitis C. Journal of Clinical Gastroenterology 43:8, 758-764
CrossRef176
Amani M. Ismail, Hala N. Ziada, Hussein A. Sheashaa, Ahmed B. Shehab El-Din. (2009) Decline of viral hepatitis prevalence among asymptomatic Egyptian blood donors: A glimmer of hope. European Journal of Internal Medicine 20:5, 490-493
CrossRef177
Vincent Lo Re, Kevin Haynes, Kimberly A. Forde, A. Russell Localio, Rita Schinnar, James D. Lewis. (2009) Validity of The Health Improvement Network (THIN) for epidemiologic studies of hepatitis C virus infection. Pharmacoepidemiology and Drug Safety 18:9, 807-814
CrossRef178
Malte Meppen, Barbara Pacini, Renzo Bazzo, Uwe Koch, Joseph F. Leone, Kenneth A. Koeplinger, Michael Rowley, Sergio Altamura, Annalise Di Marco, Fabrizio Fiore, Claudio Giuliano, Odalys Gonzalez-Paz, Ralph Laufer, Vincenzo Pucci, Frank Narjes, Cristina Gardelli. (2009) Cyclic phosphoramidates as prodrugs of 2′-C-methylcytidine. European Journal of Medicinal Chemistry 44:9, 3765-3770
CrossRef179
Tawhida Yassin Abdel Ghaffar, Suzan Naghy, Hatem Sebaie, Magda Monaiery, Aisha Yassin Abdel Ghaffar. (2009) Pegylated α interferon 2B plus ribavirin in the treatment of HCV genotype 4 infection. The Indian Journal of Pediatrics 76:9, 895-898
CrossRef180
Robert J. Wong, Douglas A. Corley. (2009) Survival Differences by Race/Ethnicity and Treatment for Localized Hepatocellular Carcinoma Within the United States. Digestive Diseases and Sciences 54:9, 2031-2039
CrossRef181
R. Lee. (2009) Occupational transmission of bloodborne diseases to healthcare workers in developing countries: meeting the challenges. Journal of Hospital Infection 72:4, 285-291
CrossRef182
S. Amini Kafi-Abad, H. Rezvan, H. Abolghasemi. (2009) Trends in prevalence of hepatitis B virus infection among Iranian blood donors, 1998-2007. Transfusion Medicine 19:4, 189-194
CrossRef183
Kara W. Chew, Scott A. Allen, Lynn E. Taylor, Josiah D. Rich, Edward Feller. (2009) Treatment Outcomes With Pegylated Interferon and Ribavirin for Male Prisoners With Chronic Hepatitis C. Journal of Clinical Gastroenterology 43:7, 686-691
CrossRef184
Tatjana Vilibic Cavlek, Ira Gjenero Margan, Snjezana Zidovec Lepej, Branko Kolaric, Adriana Vince. (2009) Seroprevalence, risk factors, and hepatitis C virus genotypes in groups with high-risk sexual behavior in Croatia. Journal of Medical Virology 81:8, 1348-1353
CrossRef185
Mark E. Mailliard, Mary E. Capadano, Matthew J. Hrnicek, Richard K. Gilroy, James M. Gulizia. (2009) Outcomes of a patient-to-patient outbreak of genotype 3a hepatitis C. Hepatology 50:2, 361-368
CrossRef186
Elizabeth Kenny-Walsh. (2009) Increased liver-related mortality to hepatitis C viremia defined on the 20th anniversary of its identification. Hepatology 50:2, 349-351
CrossRef187
Kimberly A. Forde, K. Rajender Reddy. (2009) Hepatitis C Virus Infection and Immunomodulatory Therapies. Clinics in Liver Disease 13:3, 391-401
CrossRef188
Joaquín Zúñiga, Viviana Romero, José Azocar, Daniel Terreros, María Inés Vargas-Rojas, Diana Torres-García, Luis Jiménez-Alvarez, Gilberto Vargas-Alarcón, Julio Granados-Montiel, Zaheed Husain, Raymond T. Chung, Chester A. Alper, Edmond J. Yunis. (2009) Protective KIR–HLA interactions for HCV infection in intravenous drug users. Molecular Immunology 46:13, 2723-2727
CrossRef189
Gowdara Divakara Murthy, Khoa Vu, Sushma Venugopal. (2009) Prevalence and treatment of hyperlipidemia in patients with chronic hepatitis C infection. European Journal of Gastroenterology & Hepatology 21:8, 902-907
CrossRef190
Javier de Vicente, Robert T. Hendricks, David B. Smith, Jay B. Fell, John Fischer, Stacey R. Spencer, Peter J. Stengel, Peter Mohr, John E. Robinson, James F. Blake, Ramona K. Hilgenkamp, Calvin Yee, George Adjabeng, Todd R. Elworthy, Jahari Tracy, Elbert Chin, Jim Li, Beihan Wang, Joe T. Bamberg, Rebecca Stephenson, Connie Oshiro, Seth F. Harris, Manjiri Ghate, Vincent Leveque, Isabel Najera, Sophie Le Pogam, Sonal Rajyaguru, Gloria Ao-Ieong, Ludmila Alexandrova, Susan Larrabee, Michael Brandl, Andrew Briggs, Sunil Sukhtankar, Robert Farrell, Brian Xu. (2009) Non-nucleoside inhibitors of HCV polymerase NS5B. Part 2: Synthesis and structure–activity relationships of benzothiazine-substituted quinolinediones. Bioorganic & Medicinal Chemistry Letters 19:13, 3642-3646
CrossRef191
Daniel F. Wallace, V. Nathan Subramaniam. (2009) Co-factors in liver disease: The role of HFE-related hereditary hemochromatosis and iron. Biochimica et Biophysica Acta (BBA) - General Subjects 1790:7, 663-670
CrossRef192
Shyam Kottilil, Michael Y. Yan, Kristin N. Reitano, Xiaozhen Zhang, Richard Lempicki, Gregg Roby, Marybeth Daucher, Jun Yang, Karoll J. Cortez, Marc Ghany, Michael A. Polis, Anthony S. Fauci. (2009) Human immunodeficiency virus and hepatitis C infections induce distinct immunologic imprints in peripheral mononuclear cells. Hepatology 50:1, 34-45
CrossRef193
Kathleen A. Brady, Mark Weiner, Barbara J. Turner. (2009) Undiagnosed hepatitis C on the general medicine and trauma services of two urban hospitals. Journal of Infection 59:1, 62-69
CrossRef194
Stanley Yu, Jeffrey M Douglass, Clifford Qualls, Sanjeev Arora, Jeffrey C Dunkelberg. (2009) Response to Therapy With Pegylated Interferon and Ribavirin for Chronic Hepatitis C in Hispanics Compared to Non-Hispanic Whites. The American Journal of Gastroenterology 104:7, 1686-1692
CrossRef195
Albert Lecube, Cristina Hernández, Rafael Simó. (2009) Glucose abnormalities in non-alcoholic fatty liver disease and chronic hepatitis C virus infection: the role of iron overload. Diabetes/Metabolism Research and Reviews 25:5, 403-410
CrossRef196
Robert T. Hendricks, Jay B. Fell, James F. Blake, John P. Fischer, John E. Robinson, Stacey R. Spencer, Peter J. Stengel, April L. Bernacki, Vincent J.P. Leveque, Sophie Le Pogam, Sonal Rajyaguru, Isabel Najera, John A. Josey, Jason R. Harris, Steven Swallow. (2009) Non-nucleoside inhibitors of HCV NS5B polymerase. Part 1: Synthetic and computational exploration of the binding modes of benzothiadiazine and 1,4-benzothiazine HCV NS5b polymerase inhibitors. Bioorganic & Medicinal Chemistry Letters 19:13, 3637-3641
CrossRef197
C. Li, L. Lu, X. Zhang, D. Murphy. (2009) Entire genome sequences of two new HCV subtypes, 6r and 6s, and characterization of unique HVR1 variation patterns within genotype 6. Journal of Viral Hepatitis 16:6, 406-417
CrossRef198
Akira Matsumori. (2009) Global alert and response network for hepatitis C virus-derived heart diseases: A call to action. CVD Prevention and Control 4:2, 109-118
CrossRef199
Amy J. Harzke, Jacques G. Baillargeon, Karen J. Goodman, Sandi L. Pruitt. (2009) Liver cancer mortality among male prison inmates in Texas, 1992–2003. Preventive Medicine 48:6, 588-592
CrossRef200
Kimberly A. Dowd, Dale M. Netski, Xiao–Hong Wang, Andrea L. Cox, Stuart C. Ray. (2009) Selection Pressure From Neutralizing Antibodies Drives Sequence Evolution During Acute Infection With Hepatitis C Virus. Gastroenterology 136:7, 2377-2386
CrossRef201
Anu Osinusi, David Kleiner, Brad Wood, Michael Polis, Henry Masur, Shyam Kottilil. (2009) Rapid Development of Advanced Liver Fibrosis after Acquisition of Hepatitis C Infection during Primary HIV Infection. AIDS Patient Care and STDs 23:6, 403-406
CrossRef202
Eileen M. Martin-Thormeyer, Robert H. Paul. (2009) Drug Abuse and Hepatitis C Infection as Comorbid Features of HIV Associated Neurocognitive Disorder: Neurocognitive and Neuroimaging Features. Neuropsychology Review 19:2, 215-231
CrossRef203
Ryota Masuzaki, Ryosuke Tateishi, Haruhiko Yoshida, Eriko Goto, Takahisa Sato, Takamasa Ohki, Jun Imamura, Tadashi Goto, Fumihiko Kanai, Naoya Kato, Hitoshi Ikeda, Shuichiro Shiina, Takao Kawabe, Masao Omata. (2009) Prospective risk assessment for hepatocellular carcinoma development in patients with chronic hepatitis C by transient elastography. Hepatology 49:6, 1954-1961
CrossRef204
Paul Strock, Joël Mossong, Karine Hawotte, Vic Arendt. (2009) Access to Treatment of Hepatitis C in Prison Inmates. Digestive Diseases and Sciences 54:6, 1325-1330
CrossRef205
W. Ray Kim. (2009) Epidemiology of hepatitis B in the United States. Hepatology 49:S5, S28-S34
CrossRef206
I. Zubkova, Y.H. Choi, E. Chang, K. Pirollo, T. Uren, H. Watanabe, F. Wells, A. Kachko, K. Krawczynski, M.E. Major. (2009) T-cell vaccines that elicit effective immune responses against HCV in chimpanzees may create greater immune pressure for viral mutation. Vaccine 27:19, 2594-2602
CrossRef207
A. J. V. THOMPSON, J. G. MCHUTCHISON. (2009) Review article: investigational agents for chronic hepatitis C. Alimentary Pharmacology & Therapeutics 29:7, 689-705
CrossRef208
J. D. Rempel, K. B. Aborsangaya, M. P. Alphonse, G. Y. Minuk. (2009) The influence of North American Aboriginal ethnicity on pro-inflammatory and anti-inflammatory cytokine responses to IFN-alpha. Journal of Viral Hepatitis 16:4, 292-297
CrossRef209
Kenneth Freedman, Jay Nathanson. (2009) Interferon-based hepatitis C treatment in patients with pre-existing severe mental illness and substance use disorders. Expert Review of Anti-infective Therapy 7:3, 363-376
CrossRef210
G. T. EVERSON, M. L. SHIFFMAN, J. C. HOEFS, T. R. MORGAN, R. K. STERLING, D. A. WAGNER, J. L. DESANTO, T. M. CURTO, E. C. WRIGHT, . (2009) Quantitative tests of liver function measure hepatic improvement after sustained virological response: results from the HALT-C trial. Alimentary Pharmacology & Therapeutics 29:5, 589-601
CrossRef211
Sumalee Thitinan, Jason T. McConville. (2009) Interferon alpha delivery systems for the treatment of hepatitis C. International Journal of Pharmaceutics 369:1-2, 121-135
CrossRef212
K. Patel, Y. Benhamou, E. M. Yoshida, K. D. Kaita, S. Zeuzem, M. Torbenson, E. Pulkstenis, G. M. Subramanian, J. G. McHutchison. (2009) An independent and prospective comparison of two commercial fibrosis marker panels (HCV FibroSURE and FIBRO Spect II) during albinterferon alfa-2b combination therapy for chronic hepatitis C. Journal of Viral Hepatitis 16:3, 178-186
CrossRef213
James R Rodrigue, William Balistreri, Barbara Haber, Maureen M Jonas, Parvathi Mohan, Jean P Molleston, Karen F Murray, Michael R Narkewicz, Philip Rosenthal, Lesley J Smith, Kathleen B Schwarz, Patricia Robuck, Bruce Barton, Regino P González-Peralta. (2009) Impact of Hepatitis C Virus Infection on Children and Their Caregivers: Quality of Life, Cognitive, and Emotional Outcomes. Journal of Pediatric Gastroenterology and Nutrition 48:3, 341-347
CrossRef214
Norman M. Kneteman, Anita Y. M. Howe, Tiejun Gao, Jamie Lewis, Dan Pevear, Gary Lund, Donna Douglas, David F. Mercer, D. Lorne J. Tyrrell, Frederick Immermann, Inder Chaudhary, John Speth, Stephen A. Villano, John O'Connell, Marc Collett. (2009) HCV796: A selective nonstructural protein 5B polymerase inhibitor with potent anti-hepatitis C virus activity In Vitro , in mice with chimeric human livers, and in humans infected with hepatitis C virus. Hepatology 49:3, 745-752
CrossRef215
A. K. Silberbogen, E. W. Ulloa, E. A. Janke, D. L. Mori. (2009) Psychosocial Issues and Mental Health Treatment Recommendations for Patients With Hepatitis C. Psychosomatics 50:2, 114-122
CrossRef216
Ayse L. Mindikoglu, Ram R. Miller. (2009) Hepatitis C in the Elderly: Epidemiology, Natural History, and Treatment. Clinical Gastroenterology and Hepatology 7:2, 128-134
CrossRef217
J. Foucher, B. Reiller, V. Jullien, F. Léal, E. S. di Cesare, W. Merrouche, J.-M. Delile, V. de Lédinghen. (2009) FibroScan used in street-based outreach for drug users is useful for hepatitis C virus screening and management: a prospective study. Journal of Viral Hepatitis 16:2, 121-131
CrossRef218
Kevin X. Chen, Bancha Vibulbhan, Weiying Yang, Latha G. Nair, Xiao Tong, Kuo-Chi Cheng, F. George Njoroge. (2009) Novel potent inhibitors of hepatitis C virus (HCV) NS3 protease with cyclic sulfonyl P3 cappings. Bioorganic & Medicinal Chemistry Letters 19:4, 1105-1109
CrossRef219
Gayle E Fischer, Stephanie P Bialek, Chriss E Homan, Stephen E Livingston, Brian J McMahon. (2009) Chronic Liver Disease among Alaska-Native People, 2003–2004. The American Journal of Gastroenterology 104:2, 363-370
CrossRef220
Nam-Joon Cho, Menashe Elazar, Anming Xiong, Wonjae Lee, Eric Chiao, Julie Baker, Curtis W Frank, Jeffrey S Glenn. (2009) Viral infection of human progenitor and liver-derived cells encapsulated in three-dimensional PEG-based hydrogel. Biomedical Materials 4:1, 011001
CrossRef221
David R. McGivern, Stanley M. Lemon. (2009) Tumor Suppressors, Chromosomal Instability, and Hepatitis C Virus–Associated Liver Cancer. Annual Review of Pathology: Mechanisms of Disease 4:1, 399-415
CrossRef222
Rodriguez-Torres, Maribel, Jeffers, Lennox J., Sheikh, Muhammad Y., Rossaro, Lorenzo, Ankoma-Sey, Victor, Hamzeh, Fayez M., Martin, Paul, . (2009) Peginterferon Alfa-2a and Ribavirin in Latino and Non-Latino Whites with Hepatitis C. New England Journal of Medicine 360:3, 257-267
Full Text223
R. Charon Gwynn, Renu K. Garg, Bonnie D. Kerker, Thomas R. Frieden, Lorna E. Thorpe. (2009) Contributions of a Local Health Examination Survey to the Surveillance of Chronic and Infectious Diseases in New York City. American Journal of Public Health 99:1, 152-159
CrossRef224
Natasha Walzer, Steven L Flamm. (2009) Pegylated IFN-α and ribavirin: emerging data in the treatment of special populations. Expert Review of Clinical Pharmacology 2:1, 67-76
CrossRef225
S. Gitto, L. Micco, F. Conti, P. Andreone, M. Bernardi. (2009) Alcohol and viral hepatitis: A mini-review. Digestive and Liver Disease 41:1, 67-70
CrossRef226
Francois H. T. Duong, Verena Christen, Shanshan Lin, Markus H. Heim. (2009) Hepatitis C virusâinduced up-regulation of protein phosphatase 2A inhibits histone modification and DNA damage repair. HepatologyNA-NA
CrossRef227
H. PATEL, E. J. HEATHCOTE. (2009) When to treat and the benefits of treating hepatitis C in patients with haemophilia. Haemophilia 15:1, 20-32
CrossRef228
S. Himelhoch, J. F. McCarthy, D. Ganoczy, D. Medoff, A. Kilbourne, R. Goldberg, L. Dixon, F. C. Blow. (2009) Understanding Associations Between Serious Mental Illness and Hepatitis C Virus Among Veterans: A National Multivariate Analysis. Psychosomatics 50:1, 30-37
CrossRef229
Erik J. Groessl, Kimberly R. Weingart, Robert M. Kaplan, Jack A. Clark, Allen L. Gifford, Samuel B. Ho. (2008) Living with Hepatitis C: Qualitative Interviews with Hepatitis C-infected Veterans. Journal of General Internal Medicine 23:12, 1959-1965
CrossRef230
Lorenzo Rossaro, Christopher Aoki, Jihey Yuk, Colette Prosser, Jennifer Goforth, Frank Martinez. (2008) The Evaluation of Patients with Hepatitis C Living in Rural California via Telemedicine. Telemedicine and e-Health 14:10, 1127-1129
CrossRef231
Larisa Stojanovič, Tomaž Lunder, Mario Poljak, Tomaž Marš, Boštjan Mlakar, Mojca Matičič. (2008) Lack of evidence for hepatitis C virus infection in association with lichen planus. International Journal of Dermatology 47:12, 1250-1256
CrossRef232
Karsten Wursthorn, Michael P. Manns, Heiner Wedemeyer. (2008) Natural history: The importance of viral load, liver damage and HCC. Best Practice & Research Clinical Gastroenterology 22:6, 1063-1079
CrossRef233
Andre Boonstra, Andrea M. Woltman, Harry L.A. Janssen. (2008) Immunology of hepatitis B and hepatitis C virus infections. Best Practice & Research Clinical Gastroenterology 22:6, 1049-1061
CrossRef234
Gregory A. Smallwood, Renee Devine, Carlos Fasola, Andrei C. Stieber, Thomas G. Heffron. (2008) Does Interferon Use Prior to Liver Transplant Influence Hepatitis C Outcomes Following Transplantation?. Transplantation 86:12, 1795-1798
CrossRef235
Soley Seren, Milton Mutchnick, Daryl Hutchinson, Ozgur Harmanci, Yusuf Bayraktar, Sean Mutchnick, Kazim Sahin, Omer Kucuk. (2008) Potential Role of Lycopene in the Treatment of Hepatitis C and Prevention of Hepatocellular Carcinoma. Nutrition and Cancer 60:6, 729-735
CrossRef236
Naim Alkhouri, Nizar N. Zein. (2008) Hepatitis C in children and adolescents: The good, the bad, and the ugly. Current Hepatitis Reports 7:4, 145-151
CrossRef237
Kerry N. Whitt, Jaquelyn F. Fleckenstein. (2008) Hepatitis C in African Americans. Current Hepatitis Reports 7:4, 139-144
CrossRef238
Paul B. Watkins, Paul J. Seligman, John S. Pears, Mark I. Avigan, John R. Senior. (2008) Using controlled clinical trials to learn more about acute drug-induced liver injury. Hepatology 48:5, 1680-1689
CrossRef239
E. A. Janke, S. McGraw, G. Garcia-Tsao, L. Fraenkel. (2008) Psychosocial Issues in Hepatitis C: A Qualitative Analysis. Psychosomatics 49:6, 494-501
CrossRef240
Matthew G. LaPorte, Randy W. Jackson, Tandy L. Draper, Janet A. Gaboury, Kristin Galie, Torsten Herbertz, Alison R. Hussey, Susan R. Rippin, Christopher A. Benetatos, Srinivas K. Chunduru, Joel S. Christensen, Glen A. Coburn, Christopher J. Rizzo, Gerry Rhodes, John O'Connell, Anita Y. M. Howe, Tarek S. Mansour, Marc S. Collett, Daniel C. Pevear, Dorothy C. Young, Tiejun Gao, D. Lorne J. Tyrrell , Norman M. Kneteman, Christopher J. Burns, Stephen M. Condon. (2008) The Discovery of Pyrano[3,4- b ]indole-Based Allosteric Inhibitors of HCV NS5B Polymerase with In Vivo Activity. ChemMedChem 3:10, 1508-1515
CrossRef241
Beilei Lei, Juan Du, Shuyan Li, Huanxiang Liu, Yueying Ren, Xiaojun Yao. (2008) Comparative molecular field analysis (CoMFA) and comparative molecular similarity indices analysis (CoMSIA) of thiazolone derivatives as hepatitis C virus NS5B polymerase allosteric inhibitors. Journal of Computer-Aided Molecular Design 22:10, 711-725
CrossRef242
Renee Pozza. (2008) Clinical management of HIV/hepatitis C virus coinfection. Journal of the American Academy of Nurse Practitioners 20:10, 496-505
CrossRef243
Amir Manzur, Abdul Hameed Siddiqui. (2008) Necrolytic acral erythema: successful treatment with topical tacrolimus ointment. International Journal of Dermatology 47:10, 1073-1075
CrossRef244
Jennifer S. Read, Michael J. Cannon, Lawrence R. Stanberry, Susan Schuval. (2008) Prevention of Mother-to-Child Transmission of Viral Infections. Current Problems in Pediatric and Adolescent Health Care 38:9, 274-297
CrossRef245
Sabina Sabharwal, Aymin Delgado-Borrego, Raymond T. Chung. (2008) Extrahepatic hepatitis C virus after transplantation: Diabetes and renal dysfunction. Liver Transplantation 14:S2, S51-S57
CrossRef246
Teresa Santantonio, Johannes Wiegand, J. Tilman Gerlach. (2008) Acute hepatitis C: Current status and remaining challenges. Journal of Hepatology 49:4, 625-633
CrossRef247
Dale M Netski, Qing Mao, Stuart C Ray, Robert S Klein. (2008) Genetic Divergence of Hepatitis C Virus: The Role of HIV-Related Immunosuppression. JAIDS Journal of Acquired Immune Deficiency Syndromes 49:2, 136-141
CrossRef248
Xueshan Xia, Wenhua Zhao, Kok Keng Tee, Yue Feng, Yutaka Takebe, Qihan Li, Oliver G. Pybus, Ling Lu. (2008) Complete genome sequencing and phylogenetic analysis of HCV isolates from China reveals a new subtype, designated 6u. Journal of Medical Virology 80:10, 1740-1746
CrossRef249
James Fung, Ching‐Lung Lai, Ivan Hung, John Young, Charles Cheng, Danny Wong, Man‐Fung Yuen. (2008) Chronic Hepatitis C Virus Genotype 6 Infection: Response to Pegylated Interferon and Ribavirin. The Journal of Infectious Diseases 198:6, 808-812
CrossRef250
Minhee Kang, Uwe Nicolay. (2008) Evaluation of operational chronic infection endpoints for HCV vaccine trials. Contemporary Clinical Trials 29:5, 671-678
CrossRef251
Frank Ruebsam, Zhongxiang Sun, Benjamin K. Ayida, Stephen E. Webber, Yuefen Zhou, Qiang Zhao, Charles R. Kissinger, Richard E. Showalter, Amit M. Shah, Mei Tsan, Rupal Patel, Laurie A. LeBrun, Ruhi Kamran, Maria V. Sergeeva, Darian M. Bartkowski, Thomas G. Nolan, Daniel A. Norris, Leo Kirkovsky. (2008) Hexahydro-pyrrolo- and hexahydro-1H-pyrido[1,2-b]pyridazin-2-ones as potent inhibitors of HCV NS5B polymerase. Bioorganic & Medicinal Chemistry Letters 18:18, 5002-5005
CrossRef252
G.R. Ndong-Atome, M. Makuwa, O. Ouwe-Missi-Oukem-Boyer, O.G. Pybus, M. Branger, S. Le Hello, S.B. Boye-Cheik, F. Brun-Vezinet, M. Kazanji, P. Roques, S. Bisser. (2008) High prevalence of hepatitis C virus infection and predominance of genotype 4 in rural gabon. Journal of Medical Virology 80:9, 1581-1587
CrossRef253
Michiko Shindo, Kazushige Hamada, Teruhisa Morikawa, Yuichi Harano, Tomoaki Nakajima, Tadao Okuno. (2008) In vivo interferon system assessed by 2′-5′ oligoadenylate synthetase activity in chronic hepatitis C virus patients treated with pegylated interferon and ribavirin. Hepatology Research
CrossRef254
Nathan J. Shores, Ivana Maida, Vincent Soriano, Marina Núňez. (2008) Sexual transmission is associated with spontaneous HCV clearance in HIV-infected patients. Journal of Hepatology 49:3, 323-328
CrossRef255
Juan F. Gallegos-Orozco, Jorge Rakela, Marianne J. Rosati, Hugo E. Vargas, Vijayan Balan. (2008) Persistence of Hepatitis C Virus in Peripheral Blood Mononuclear Cells of Sustained Viral Responders to Pegylated Interferon and Ribavirin Therapy. Digestive Diseases and Sciences 53:9, 2564-2568
CrossRef256
Firdous A. Siddiqui, Murray N. Ehrinpreis, James Janisse, Ravi Dhar, Elizabeth May, Milton G. Mutchnick. (2008) Demographics of a large cohort of urban chronic hepatitis C patients. Hepatology International 2:3, 376-381
CrossRef257
Roberto Gedaly, Timothy M. Clifford, Patrick P. McHugh, Hoonbae Jeon, Thomas D. Johnston, Dinesh Ranjan. (2008) Prevalent immunosuppressive strategies in liver transplantation for hepatitis C: results of a multi-center international survey. Transplant International 21:9, 867-872
CrossRef258
M. Gambarin-Gelwan, I. M. Jacobson. (2008) Optimal dose of peginterferon and ribavirin for treatment of chronic hepatitis C. Journal of Viral Hepatitis 15:9, 623-633
CrossRef259
Emuejevoke J. Okoh, Jay R. Bucci, James F. Simon, Stephen A. Harrison. (2008) HCV in Patients With End-Stage Renal Disease. The American Journal of Gastroenterology 103:8, 2123-2134
CrossRef260
Sumathi Ramachandran, Guo-liang Xia, Lilia M. Ganova-Raeva, Omana V. Nainan, Yury Khudyakov. (2008) End-point limiting-dilution real-time PCR assay for evaluation of hepatitis C virus quasispecies in serum: Performance under optimal and suboptimal conditions. Journal of Virological Methods 151:2, 217-224
CrossRef261
Andrea E. Reid. (2008) Viral hepatitis in African Americans. Current Hepatitis Reports 7:3, 120-126
CrossRef262
Eliza M. F. Berkley, Kimberly K. Leslie, Sanjeev Arora, Clifford Qualls, Jeffrey C. Dunkelberg. (2008) Chronic Hepatitis C in Pregnancy. Obstetrics & Gynecology 112:2, Part 1, 304-310
CrossRef263
David A. Ellis, Julie K. Blazel, Stephen E. Webber, Chinh V. Tran, Peter S. Dragovich, Zhongxiang Sun, Frank Ruebsam, Helen M. McGuire, Alan X. Xiang, Jingjing Zhao, Lian-Sheng Li, Yuefen Zhou, Qing Han, Charles R. Kissinger, Richard E. Showalter, Matthew Lardy, Amit M. Shah, Mei Tsan, Rupal Patel, Laurie A. LeBrun, Ruhi Kamran, Darian M. Bartkowski, Thomas G. Nolan, Daniel A. Norris, Maria V. Sergeeva, Leo Kirkovsky. (2008) 4-(1,1-Dioxo-1,4-dihydro-1λ6-benzo[1,4]thiazin-3-yl)-5-hydroxy-2H-pyridazin-3-ones as potent inhibitors of HCV NS5B polymerase. Bioorganic & Medicinal Chemistry Letters 18:16, 4628-4632
CrossRef264
Maribel Rodríguez-Torres. (2008) Chronic hepatitis C in the Latino population. Current Hepatitis Reports 7:3, 106-112
CrossRef265
Onpan Cheung, Arun J. Sanyal. (2008) Hepatitis C Infection and Nonalcoholic Fatty Liver Disease. Clinics in Liver Disease 12:3, 573-585
CrossRef266
Wojciech Blonski, K. Rajender Reddy. (2008) Hepatitis C Virus Infection and Hepatocellular Carcinoma. Clinics in Liver Disease 12:3, 661-674
CrossRef267
Vinod K. Rustgi, Gary L. Davis, Steven K. Herrine, Arthur J. McCullough, Scott L. Friedman, Gregory J. Gores. (2008) Future trends in hepatology: Challenges and opportunities. Hepatology 48:2, 655-661
CrossRef268
Su-Hyung Park, Sang Rae Lee, Byung Hwa Hyun, Byong-Moon Kim, Young Chul Sung. (2008) Codelivery of PEG-IFN-α inhibits HCV DNA vaccine-induced T cell responses but not humoral responses in African green monkeys. Vaccine 26:32, 3978-3983
CrossRef269
S. Bogen, A. Arasappan, W. Pan, S. Ruan, A. Padilla, A.K. Saksena, V. Girijavallabhan, F.G. Njoroge. (2008) Hepatitis C virus NS3-4A serine protease inhibitors: SAR of new P1 derivatives of SCH 503034. Bioorganic & Medicinal Chemistry Letters 18:14, 4219-4223
CrossRef270
Jessica Willner-Reid, Katherine A. Belendiuk, David H. Epstein, John Schmittner, Kenzie L. Preston. (2008) Hepatitis C and human immunodeficiency virus risk behaviors in polydrug users on methadone maintenance. Journal of Substance Abuse Treatment 35:1, 78-86
CrossRef271
Sun Hee Kim, Martin T. Tran, Frank Ruebsam, Alan X. Xiang, Benjamin Ayida, Helen McGuire, David Ellis, Julie Blazel, Chinh V. Tran, Douglas E. Murphy, Stephen E. Webber, Yuefen Zhou, Amit M. Shah, Mei Tsan, Richard E. Showalter, Rupal Patel, Alberto Gobbi, Laurie A. LeBrun, Darian M. Bartkowski, Thomas G. Nolan, Daniel A. Norris, Maria V. Sergeeva, Leo Kirkovsky, Qiang Zhao, Qing Han, Charles R. Kissinger. (2008) Structure-based design, synthesis, and biological evaluation of 1,1-dioxoisothiazole and benzo[b]thiophene-1,1-dioxide derivatives as novel inhibitors of hepatitis C virus NS5B polymerase. Bioorganic & Medicinal Chemistry Letters 18:14, 4181-4185
CrossRef272
Marie Csete. (2008) Gender Issues in Transplantation. Anesthesia & Analgesia 107:1, 232-238
CrossRef273
Anurag Maheshwari, Stuart Ray, Paul J Thuluvath. (2008) Acute hepatitis C. The Lancet 372:9635, 321-332
CrossRef274
Douglas K. Hutchinson, Teresa Rosenberg, Larry L. Klein, Todd D. Bosse, Daniel P. Larson, Wenping He, Wen W. Jiang, Warren M. Kati, William E. Kohlbrenner, Yaya Liu, Sherie V. Masse, Tim Middleton, Akhteruzzaman Molla, Debra A. Montgomery, David W.A. Beno, Kent D. Stewart, Vincent S. Stoll, Dale J. Kempf. (2008) Hepatitis C NS5B polymerase inhibitors: 4,4-Dialkyl-1-hydroxy-3-oxo-3,4-dihydronaphthalene-3-yl benzothiadiazine derivatives. Bioorganic & Medicinal Chemistry Letters 18:14, 3887-3890
CrossRef275
C. BROUARD, P. PRADAT, E. DELAROCQUE-ASTAGNEAU, C. SILVAIN. (2008) Epidemiological characteristics and medical follow-up of 61 patients with acute hepatitis C identified through the hepatitis C surveillance system in France. Epidemiology and Infection 136:07,
CrossRef276
Guaniri Mateu, Ruben O. Donis, Takaji Wakita, Jens Bukh, Arash Grakoui. (2008) Intragenotypic JFH1 based recombinant hepatitis C virus produces high levels of infectious particles but causes increased cell death. Virology 376:2, 397-407
CrossRef277
Steven A. Pergam, Chia C. Wang, Carolyn M. Gardella, Taylor G. Sandison, Warren T. Phipps, Stephen E. Hawes. (2008) Pregnancy complications associated with hepatitis C: data from a 2003-2005 Washington state birth cohort. American Journal of Obstetrics and Gynecology 199:1, 38.e1-38.e9
CrossRef278
Juan Macías, Rosa B. Palacios, Evangelina Claro, Julio Vargas, Salvador Vergara, José A. Mira, Nicolás Merchante, Juan E. Corzo, Juan A. Pineda. (2008) High prevalence of hepatitis C virus infection among noninjecting drug users: association with sharing the inhalation implements of crack. Liver International 28:6, 781-786
CrossRef279
Yoichi Hiasa, Hiroyuki Kuzuhara, Yoshio Tokumoto, Ichiro Konishi, Nobuyuki Yamashita, Bunzo Matsuura, Kojiro Michitaka, Raymond T. Chung, Morikazu Onji. (2008) Hepatitis C virus replication is inhibited by 22β-methoxyolean-12-ene-3β, 24(4β)-diol (ME3738) through enhancing interferon-β. Hepatology 48:1, 59-69
CrossRef280
Lian-Sheng Li, Yuefen Zhou, Douglas E. Murphy, Nebojsa Stankovic, Jingjing Zhao, Peter S. Dragovich, Thomas Bertolini, Zhongxiang Sun, Benjamin Ayida, Chinh V. Tran, Frank Ruebsam, Stephen E. Webber, Amit M. Shah, Mei Tsan, Richard E. Showalter, Rupal Patel, Laurie A. LeBrun, Darian M. Bartkowski, Thomas G. Nolan, Daniel A. Norris, Ruhi Kamran, Jennifer Brooks, Maria V. Sergeeva, Leo Kirkovsky, Qiang Zhao, Charles R. Kissinger. (2008) Novel HCV NS5B polymerase inhibitors derived from 4-(1′,1′-dioxo-1′,4′-dihydro-1′λ6-benzo[1′,2′,4′]thiadiazin-3′-yl)-5-hydroxy-2H-pyridazin-3-ones. Part 3: Further optimization of the 2-, 6-, and 7′-substituents and initial pharmacokinetic assessments. Bioorganic & Medicinal Chemistry Letters 18:11, 3446-3455
CrossRef281
Jose L. Tovar, Maria Buti, Alfonso Segarra, Joaquim Majó, Rafael Esteban. (2008) De novo nephrotic syndrome following pegylated interferon alfa 2b/ribavirin therapy for chronic hepatitis C infection. International Urology and Nephrology 40:2, 539-541
CrossRef282
Evelyn K Hsu, Karen F Murray. (2008) Hepatitis B and C in children. Nature Clinical Practice Gastroenterology & Hepatology 5:6, 311-320
CrossRef283
James H. Tabibian, Donna A. Wirshing, Joseph M. Pierre, Lisa H. Guzik, Michael D. Kisicki, Itai Danovitch, Shirley J. Mena, William C. Wirshing. (2008) Hepatitis B and C Among Veterans on a Psychiatric Ward. Digestive Diseases and Sciences 53:6, 1693-1698
CrossRef284
M. Mazen Jamal, Jason B. Samarasena, Mehrtash Hashemzadeh, Kenneth J. Vega. (2008) Declining Hospitalization Rate of Esophageal Variceal Bleeding in the United States. Clinical Gastroenterology and Hepatology 6:6, 689-695
CrossRef285
Hui Li, Brian J. McMahon, Susan McArdle, Dana Bruden, Daniel G. Sullivan, Dave Shelton, Heike Deubner, David R. Gretch. (2008) Hepatitis C virus envelope glycoprotein co-evolutionary dynamics during chronic hepatitis C. Virology 375:2, 580-591
CrossRef286
Frank Ruebsam, Stephen E. Webber, Martin T. Tran, Chinh V. Tran, Douglas E. Murphy, Jingjing Zhao, Peter S. Dragovich, Sun Hee Kim, Lian-Sheng Li, Yuefen Zhou, Qing Han, Charles R. Kissinger, Richard E. Showalter, Matthew Lardy, Amit M. Shah, Mei Tsan, Rupal Patel, Laurie A. LeBrun, Ruhi Kamran, Maria V. Sergeeva, Darian M. Bartkowski, Thomas G. Nolan, Daniel A. Norris, Leo Kirkovsky. (2008) Pyrrolo[1,2-b]pyridazin-2-ones as potent inhibitors of HCV NS5B polymerase. Bioorganic & Medicinal Chemistry Letters 18:12, 3616-3621
CrossRef287
Robert Wong, Douglas A. Corley. (2008) Racial and Ethnic Variations in Hepatocellular Carcinoma Incidence within the United States. The American Journal of Medicine 121:6, 525-531
CrossRef288
Xibin Liao, Gabor Butora, David B. Olsen, Steven S. Carroll, Daniel R. McMasters, Joseph F. Leone, Mark Stahlhut, George A. Doss, Lihu Yang, Malcolm MacCoss. (2008) Synthesis of 2′-β-C-methyl-neplanocin derivatives as anti-HCV agents. Tetrahedron Letters 49:26, 4149-4152
CrossRef289
Sharon M. Moe, A.J. Pampalone, Susan Ofner, Marc Rosenman, Evgenia Teal, Siu L. Hui. (2008) Association of Hepatitis C Virus Infection With Prevalence and Development of Kidney Disease. American Journal of Kidney Diseases 51:6, 885-892
CrossRef290
Kenrad E. Nelson, Hua Shan. (2008) Confirmatory testing of hepatitis C virus–positive enzyme immunoassay results in limited-resource countries: should it be attempted?. Transfusion 48:6, 1239-1244
CrossRef291
Z.M. Hassan, M.A. Wahsheh, K.R. Shishani, E.R. Pryor. (2008) Hepatitis needs assessment among Jordanian healthcare workers. International Nursing Review 55:2, 142-147
CrossRef292
Jules L. Dienstag. (2008) Hepatitis A: The Vaccine Dividend. The Journal of Infectious Diseases 197:9, 1220-1222
CrossRef293
Maribel Rodríguez–Torres. (2008) Latinos and Chronic Hepatitis C: A Singular Population. Clinical Gastroenterology and Hepatology 6:5, 484-490
CrossRef294
Q-S Wang, J Yuan, S-Y Zhou, J-Q Chen. (2008) Chronic hepatitis C virus infection is not associated with Mooren's ulcer. Eye 22:5, 697-700
CrossRef295
Christine M. Rousseau, George N. Ioannou, Jeffrey A. Todd-Stenberg, Kevin L. Sloan, Meaghan F. Larson, Christopher W. Forsberg, Jason A. Dominitz. (2008) Racial Differences in the Evaluation and Treatment of Hepatitis C Among Veterans: A Retrospective Cohort Study. American Journal of Public Health 98:5, 846-852
CrossRef296
Mindie H. Nguyen, Huy N. Trinh, Ruel Garcia, Gloria Nguyen, Khoa D. Lam, Emmet B. Keeffe. (2008) Higher Rate of Sustained Virologic Response in Chronic Hepatitis C Genotype 6 Treated With 48 Weeks Versus 24 Weeks of Peginterferon Plus Ribavirin. The American Journal of Gastroenterology 103:5, 1131-1135
CrossRef297
Jacqueline G. O'Leary, Rita Lepe, Gary L. Davis. (2008) Indications for Liver Transplantation. Gastroenterology 134:6, 1764-1776
CrossRef298
Jayant N. Acharya, Vitor H. Pacheco. (2008) Neurologic Complications of Hepatitis C. The Neurologist 14:3, 151-156
CrossRef299
J. T. Blackard, K. E. Sherman. (2008) HCV/ HIV co-infection: time to re-evaluate the role of HIV in the liver?. Journal of Viral Hepatitis 15:5, 323-330
CrossRef300
Charles D. Howell, Thomas C. Dowling, Marika Paul, Abdus S. Wahed, Norah A. Terrault, Milton Taylor, Lennox Jeffers, Jay H. Hoofnagle. (2008) Peginterferon Pharmacokinetics in African American and Caucasian American Patients With Hepatitis C Virus Genotype 1 Infection. Clinical Gastroenterology and Hepatology 6:5, 575-583
CrossRef301
E. Dieperink, J. Leskela, M. E. Dieperink, B. Evans, P. Thuras, S. B. Ho. (2008) The Effect of Pegylated Interferon- 2b and Ribavirin on Posttraumatic Stress Disorder Symptoms. Psychosomatics 49:3, 225-229
CrossRef302
Nader Dbouk, Miguel R. Arguedas, Aasim Sheikh. (2008) Assessment of the PHQ-9 as a Screening Tool for Depression in Patients with Chronic Hepatitis C. Digestive Diseases and Sciences 53:4, 1100-1106
CrossRef303
Eva A. Operskalski, Wendy J. Mack, Howard D. Strickler, Audrey L. French, Michael Augenbraun, Phyllis C. Tien, Maria C. Villacres, LaShonda Y. Spencer, Marina DeGiacomo, Andrea Kovacs. (2008) Factors associated with hepatitis C viremia in a large cohort of HIV-infected and -uninfected women. Journal of Clinical Virology 41:4, 255-263
CrossRef304
Matthew Wise, Stephanie Bialek, Lyn Finelli, Beth P. Bell, Frank Sorvillo. (2008) Changing trends in hepatitis C-related mortality in the United States, 1995-2004. Hepatology 47:4, 1128-1135
CrossRef305
W. Ray Kim, Steven L. Flamm, Adrian M. Di Bisceglie, Henry C. Bodenheimer. (2008) Serum activity of alanine aminotransferase (ALT) as an indicator of health and disease. Hepatology 47:4, 1363-1370
CrossRef306
P. De, É. Roy, J.-F. Boivin, J. Cox, C. Morissette. (2008) Risk of hepatitis C virus transmission through drug preparation equipment: a systematic and methodological review. Journal of Viral Hepatitis 15:4, 279-292
CrossRef307
Ma Somsouk, Deston E. Langfield, John M. Inadomi, Hal F. Yee. (2008) A Cost-Identification Analysis of Screening and Surveillance of Hepatitis C Infection in a Prospective Cohort of Dialysis Patients. Digestive Diseases and Sciences 53:4, 1093-1099
CrossRef308
Marcello Romano, Marco Vacante, Erika Cristaldi, Valentina Colonna, Maria Pia Gargante, Lisa Cammalleri, Mariano Malaguarnera. (2008) l-Carnitine Treatment Reduces Steatosis in Patients with Chronic Hepatitis C Treated with α-Interferon and Ribavirin. Digestive Diseases and Sciences 53:4, 1114-1121
CrossRef309
L. Ye, J. S. Peng, X. Wang, Y. J. Wang, G. X. Luo, W. Z. Ho. (2008) Methamphetamine enhances Hepatitis C virus replication in human hepatocytes. Journal of Viral Hepatitis 15:4, 261-270
CrossRef310
Takamasa Ohki, Ryosuke Tateishi, Takahisa Sato, Ryota Masuzaki, Jun Imamura, Tadashi Goto, Noriyo Yamashiki, Hideo Yoshida, Fumihiko Kanai, Naoya Kato, Shuichiro Shiina, Haruhiko Yoshida, Takao Kawabe, Masao Omata. (2008) Obesity Is an Independent Risk Factor for Hepatocellular Carcinoma Development in Chronic Hepatitis C Patients. Clinical Gastroenterology and Hepatology 6:4, 459-464
CrossRef311
Annette M. Matthews, Peter Hauser. (2008) Hepatitis C Screening in Bipolar Veterans. Addictive Disorders & Their Treatment 7:1, 41-45
CrossRef312
Elisabeth Monnet, Cécile Ramée, Anne Minello, Valérie Jooste, Didier Carel, Vincent Di Martino. (2008) Socioeconomic context, distance to primary care and detection of hepatitis C: A French population-based study. Social Science & Medicine 66:5, 1046-1056
CrossRef313
Daryl T.-Y. Lau, Penny Mar Fish, Mala Sinha, David M. Owen, Stanley M. Lemon, Michael Gale. (2008) Interferon regulatory factor-3 activation, hepatic interferon-stimulated gene expression, and immune cell infiltration in hepatitis C virus patients. Hepatology 47:3, 799-809
CrossRef314
Tatehiro Kagawa, Hirokazu Shiozawa, Sei-ichiro Kojima, Shinji Takashimizu, Naruhiko Nagata, Makoto Numata, Fumitoshi Morino, Yasuhiro Nishizaki, Kaori Mochizuki, Norihito Watanabe, Tetsu Watanabe, Shohei Matsuzaki, Tetsuya Mine. (2008) Eight-week oral administration of meloxicam, a non-steroidal anti-inflammatory drug, prevents dose reduction of pegylated interferon α-2a in the treatment of chronic hepatitis C. Hepatology Research 38:3, 259-266
CrossRef315
Geoffrey C. Nguyen, Paul J. Thuluvath. (2008) Racial disparity in liver disease: Biological, cultural, or socioeconomic factors. Hepatology 47:3, 1058-1066
CrossRef316
Annette M Matthews, Marilyn S Huckans, Aaron D Blackwell, Peter Hauser. (2008) Hepatitis C testing and infection rates in bipolar patients with and without comorbid substance use disorders. Bipolar Disorders 10:2, 266-270
CrossRef317
Wulf O. Böcher, Christian Wallasch, Thomas Höhler, Peter R. Galle. (2008) All-trans retinoic acid for treatment of chronic hepatitis C. Liver International 28:3, 347-354
CrossRef318
Edmond Vartany, Cary A. Caldwell, Terence K. Trow. (2008) Adult respiratory distress syndrome after treatment with pegylated interferon α-2a and ribavirin. Heart & Lung: The Journal of Acute and Critical Care 37:2, 153-156
CrossRef319
J. G. MCHUTCHISON, K. PATEL, E. R. SCHIFF, N. GITLIN, R. E. MUR, G. T. EVERSON, R. L. CARITHERS, G. L. DAVIS, P. MARCELLIN, M. L. SHIFFMAN, J. HARVEY, J. K. ALBRECHT, . (2008) Clinical trial: interferon alpha-2b continuous long-term therapy vs. repeated 24-week cycles for re-treating chronic hepatitis C. Alimentary Pharmacology & Therapeutics 27:5, 422-432
CrossRef320
Zachary D. Goodman, Hala R. Makhlouf, Lea Liu, William Balistreri, Regino P. Gonzalez-Peralta, Barbara Haber, Maureen M. Jonas, Parvathi Mohan, Jean P. Molleston, Karen F. Murray, Michael R. Narkewicz, Philip Rosenthal, Lesley J. Smith, Patricia R. Robuck, Kathleen B. Schwarz. (2008) Pathology of chronic hepatitis C in children: Liver biopsy findings in the Peds-C Trial. Hepatology 47:3, 836-843
CrossRef321
Jason Grebely, Stanley Devlaming, Fiona Duncan, Mark Viljoen, Brian Conway. (2008) Current Approaches to HCV Infection in Current and Former Injection Drug Users. Journal of Addictive Diseases 27:2, 25-35
CrossRef322
V. González, E. Martró, C. Folch, A. Esteve, L. Matas, A. Montoliu, J. R. Grífols, F. Bolao, C. Tural, R. Muga, J. V. Parry, V. Ausina, J. Casabona. (2008) Detection of hepatitis C virus antibodies in oral fluid specimens for prevalence studies. European Journal of Clinical Microbiology & Infectious Diseases 27:2, 121-126
CrossRef323
Keyur Patel, David R. Nelson, Don C. Rockey, Nezam H. Afdhal, Katie M. Smith, Esther Oh, Keith Hettinger, Marc Vallée, Anouk Dev, Margaret Smith–Riggs, John G. McHutchison. (2008) Correlation of FIBROSpect II With Histologic and Morphometric Evaluation of Liver Fibrosis in Chronic Hepatitis C. Clinical Gastroenterology and Hepatology 6:2, 242-247
CrossRef324
Suzanne Norris, Diarmaid Houlihan. (2008) Liver transplantation in HIV-positive patients. Expert Review of Gastroenterology & Hepatology 2:1, 39-46
CrossRef325
R. MARTÍN-SANTOS, C. DÍEZ-QUEVEDO, P. CASTELLVÍ, R. NAVINÉS, M. MIQUEL, H. MASNOU, A. SOLER, M. ARDEVOL, F. GARCÍA, J. A. GALERAS, R. PLANAS, R. SOLÀ. (2008) De novo depression and anxiety disorders and influence on adherence during peginterferon-alpha-2a and ribavirin treatment in patients with hepatitis C. Alimentary Pharmacology & Therapeutics 27:3, 257-265
CrossRef326
Yuefen Zhou, Stephen E. Webber, Douglas E. Murphy, Lian-Sheng Li, Peter S. Dragovich, Chinh V. Tran, Zhongxiang Sun, Frank Ruebsam, Amit M. Shah, Mei Tsan, Richard E. Showalter, Rupal Patel, Bin Li, Qiang Zhao, Qing Han, Thomas Hermann, Charles R. Kissinger, Laurie LeBrun, Maria V. Sergeeva, Leo Kirkovsky. (2008) Novel HCV NS5B polymerase inhibitors derived from 4-(1′,1′-dioxo-1′,4′-dihydro-1′λ6-benzo[1′,2′,4′]thiadiazin-3′-yl)-5-hydroxy-2H-pyridazin-3-ones. Part 1: Exploration of 7′-substitution of benzothiadiazine. Bioorganic & Medicinal Chemistry Letters 18:4, 1413-1418
CrossRef327
William Perry, Robin C. Hilsabeck, Tarek I. Hassanein. (2008) Cognitive Dysfunction in Chronic Hepatitis C: A Review. Digestive Diseases and Sciences 53:2, 307-321
CrossRef328
Antonio Craxì, Giacomo Laffi, Anna Linda Zignego. (2008) Hepatitis C virus (HCV) infection: A systemic disease. Molecular Aspects of Medicine 29:1-2, 85-95
CrossRef329
Holly Groom, Eric Dieperink, David B. Nelson, Judith Garrard, James R. Johnson, Stephen L. Ewing, Herbert Stockley, Janet Durfee, Yvonne Jonk, Mark L. Willenbring, Samuel B. Ho. (2008) Outcomes of a Hepatitis C Screening Program at a Large Urban VA Medical Center. Journal of Clinical Gastroenterology 42:1, 97-106
CrossRef330
Carol Mallette, Maura A Flynn, Kittichai Promrat. (2008) Outcome of Screening for Hepatitis C Virus Infection Based on Risk Factors. The American Journal of Gastroenterology 103:1, 131-137
CrossRef331
Daniel R. Lefebvre, Louise F. Strande, Charles W. Hewitt. (2008) An Enzyme-Mediated Assay to Quantify Inoculation Volume Delivered by Suture Needlestick Injury: Two Gloves Are Better Than One. Journal of the American College of Surgeons 206:1, 113-122
CrossRef332
Eva Martínez-Bauer, Xavier Forns, Mercé Armelles, Ramon Planas, Ricard Solà, Mercé Vergara, Silvia Fàbregas, Roser Vega, Javier Salmerón, Moisés Diago, Jose María Sánchez-Tapias, Miquel Bruguera. (2008) Hospital admission is a relevant source of hepatitis C virus acquisition in Spain. Journal of Hepatology 48:1, 20-27
CrossRef333
Myoung Joo Kang, Eun Uk Jung, Sang Won Park, Paul Choi, Ji Hyun Kim, Sung Jae Park, Eun Taek Park, Youn Jae Lee, Sang Hyuk Lee, Sang Yong Seol. (2008) Effects of pegylated interferon and ribavirin in Korean patients with chronic hepatitis C virus infection. The Korean Journal of Hepatology 14:3, 318
CrossRef334
Ke-Qin Hu, John M. Vierling, Allan G. Redeker. (2008) Viral, host and interferon-related factors modulating the effect of interferon therapy for hepatitis C virus infection. Journal of Viral Hepatitis 8:1, 1
CrossRef335
Muhammad Naeem Khattak, Saeed Akhtar, Sadia Mahmud, Tariq Mahmood Roshan. (2008) Factors Influencing Hepatitis C Virus Sero-prevalence among Blood Donors in North West Pakistan. Journal of Public Health Policy 29:2, 207-225
CrossRef336
AA Modi, TJ Liang. (2008) Hepatitis C: a clinical review. Oral Diseases 14:1, 10-14
CrossRef337
Adnan Said, Nasia Safdar, Jennifer Wells, Michael R. Lucey. 2008. Liver Disease in Renal Transplant Recipients. , 508-533.
CrossRef338
He-Jun Yuan, William M Lee. (2008) Nonresponse to Treatment for Hepatitis C. Drugs 68:1, 27-42
CrossRef339
Steven A Pergam, Stephen E Hawes, Carolyn M Gardella, Chia C Wang. (2008) HCV and pregnancy: is now the time for universal testing?. Future Virology 3:1, 1-5
CrossRef340
Tatsuya Aikawa, Maki Kojima, Kuniko Miyamoto, Chisato Ueno, Masaharu Takahashi, Hiroaki Okamoto. (2008) A case of acute hepatitis C, most likely by interspousal sexual transmission after 40 years of marriage. Kanzo 49:8, 352-361
CrossRef341
Prithwish De, Joseph Cox, Jean-François Boivin, Robert W. Platt, Ann M. Jolly. (2008) Social Network-Related Risk Factors for Bloodborne Virus Infections Among Injection Drug Users Receiving Syringes through Secondary Exchange. Journal of Urban Health 85:1, 77-89
CrossRef342
Carrie Reed, Sherri O. Stuver, Sheila Tumilty, David Nunes, Jessica E. Murray, Camilla S. Graham, Margaret James Koziel, Donald E. Craven, Paul R. Skolnik, C. Robert Horsburgh. (2008) Predictors of Treatment for Hepatitis C Virus (HCV) Infection in Drug Users. Substance Abuse 29:1, 5-15
CrossRef343
Sue L. Currie, James C. Ryan, Daniel Tracy, Teresa L. Wright, Sally George, Rosemary McQuaid, Michael Kim, Hui Shen, Alexander Monto. (2008) A prospective study to examine persistent HCV reinfection in injection drug users who have previously cleared the virus. Drug and Alcohol Dependence 93:1-2, 148-154
CrossRef344
Fasiha Kanwal, Tuyen Hoang, Brennan M.R. Spiegel, Seth Eisen, Jason A. Dominitz, Allen Gifford, Mathew Goetz, Steven M. Asch. (2007) Predictors of treatment in patients with chronic hepatitis C infection
Role of patient versus nonpatient factors. Hepatology 46:6, 1741-1749
CrossRef345
Weiliang Tang, Catherine A. Lázaro, Jean S. Campbell, W. Tony Parks, Michael G. Katze, Nelson Fausto. (2007) Responses of Nontransformed Human Hepatocytes to Conditional Expression of Full-Length Hepatitis C Virus Open Reading Frame. The American Journal of Pathology 171:6, 1831-1846
CrossRef346
Katerina Lagios, Frank P. Deane. (2007) Severe mental illness is a new risk marker for blood-borne viruses and sexually transmitted infections. Australian and New Zealand Journal of Public Health 31:6, 562-566
CrossRef347
Karina Razali, Hla Hla Thein, Jane Bell, Mark Cooper-Stanbury, Kate Dolan, Greg Dore, Jacob George, John Kaldor, Maria Karvelas, Jiong Li, Lisa Maher, Sharyn McGregor, Margaret Hellard, Fiona Poeder, Julianne Quaine, Kim Stewart, Helen Tyrrell, Martin Weltman, Owen Westcott, Alex Wodak, Matthew Law. (2007) Modelling the hepatitis C virus epidemic in Australia. Drug and Alcohol Dependence 91:2-3, 228-235
CrossRef348
Shimian Zou, Fatemeh Musavi, Edward P. Notari, Chyang T. Fang, . (2007) Changing age distribution of the blood donor population in the United States. Transfusion 0:0, 071117010348009-???
CrossRef349
L. T. F. Yeung, T. To, S. M. King, E. A. Roberts. (2007) Spontaneous clearance of childhood hepatitis C virus infection. Journal of Viral Hepatitis 14:11, 797-805
CrossRef350
Frank Yeh, Fredric D Gordon. (2007) Peginterferon alfa-2b and ribavirin combination therapy for chronic hepatitis C. Future Virology 2:6, 553-563
CrossRef351
Omer Junaidi, Adrian M. Di Bisceglie. (2007) Aging Liver and Hepatitis. Clinics in Geriatric Medicine 23:4, 889-903
CrossRef352
Jawad Ahmad, Kathy K. Downey, Mohamed Akoad, Thomas V. Cacciarelli. (2007) Impact of the MELD score on waiting time and disease severity in liver transplantation in United States veterans. Liver Transplantation 13:11, 1564-1569
CrossRef353
Siobhan Sutcliffe, Sabine Rohrmann, Edward Giovannucci, Kenrad E. Nelson, Angelo M. De Marzo, William B. Isaacs, William G. Nelson, Elizabeth A. Platz. (2007) Viral Infections and Lower Urinary Tract Symptoms in the Third National Health and Nutrition Examination Survey. The Journal of Urology 178:5, 2181-2185
CrossRef354
Marc S. Itskowitz. (2007) Hepatitis C: Epidemiology, Diagnosis, and Management. Comprehensive Therapy 33:2, 87-93
CrossRef355
Subhas Banerjee, Douglas B. Nelson, Jason A. Dominitz, Steven O. Ikenberry, Michelle A. Anderson, Brooks D. Cash, Seng-Ian Gan, M. Edwyn Harrison, Bo Shen, Todd H. Baron, Trina Van Guilder, Kenneth K. Lee. (2007) Reprocessing failure. Gastrointestinal Endoscopy 66:5, 869-871
CrossRef356
John G. McHutchison, Bruce R. Bacon, Stuart C. Gordon, Eric Lawitz, Mitchell Shiffman, Nezam H. Afdhal, Ira M. Jacobson, Andrew Muir, Mohammed Al-Adhami, Mary L. Morris, Julie A. Lekstrom-Himes, Susan M. Efler, Heather L. Davis. (2007) Phase 1B, randomized, double-blind, dose-escalation trial of CPG 10101 in patients with chronic hepatitis C virus. Hepatology 46:5, 1341-1349
CrossRef357
Zania Stamataki, Stephen Coates, Matthew J. Evans, Mark Wininger, Kevin Crawford, Christine Dong, Yiu-lian Fong, David Chien, Sergio Abrignani, Peter Balfe, Charles M. Rice, Jane A. McKeating, Michael Houghton. (2007) Hepatitis C virus envelope glycoprotein immunization of rodents elicits cross-reactive neutralizing antibodies. Vaccine 25:45, 7773-7784
CrossRef358
Carla W. Brady, Cynthia J. Coffman, Dawn Provenzale. (2007) Compliance With Referral for Hepatitis C Evaluation Among Veterans. Journal of Clinical Gastroenterology 41:10, 927-931
CrossRef359
Th. Witthöft, B. Möller, K. H. Wiedmann, St. Mauss, R. Link, J. Lohmeyer, M. Lafrenz, C. M. Gelbmann, D. Hüppe, C. Niederau, U. Alshuth. (2007) Safety, tolerability and efficacy of peginterferon alpha-2a and ribavirin in chronic hepatitis C in clinical practice: The German Open Safety Trial. Journal of Viral Hepatitis 14:11, 788-796
CrossRef360
Prithwish De, Joseph Cox, Jean-François Boivin, Robert W. Platt, Ann M. Jolly. (2007) The importance of social networks in their association to drug equipment sharing among injection drug users: a review. Addiction 102:11, 1730-1739
CrossRef361
Swati Pawa, Murray Ehrinpreis, Milton Mutchnick, James Janisse, Ravi Dhar, Firdous A. Siddiqui. (2007) Percutaneous Liver Biopsy Is Safe in Chronic Hepatitis C Patients With End-Stage Renal Disease. Clinical Gastroenterology and Hepatology 5:11, 1316-1320
CrossRef362
Jason Smith, Steven-Huy B. Han. (2007) “True” weight-based dosing versus “flat” dosing of ribavirin: Will the WIN-R please come forward?. Hepatology 46:4, 953-956
CrossRef363
Elisabeth Delarocque-Astagneau, Josiane Pillonel, Henriette De Valk, Alberto Perra, Syria Laperche, Jean-Claude Desenclos. (2007) An Incident Case–Control Study of Modes of Hepatitis C Virus Transmission in France. Annals of Epidemiology 17:10, 755-762
CrossRef364
Stephen A. Harrison. (2007) Small Molecule and Novel Treatments for Chronic Hepatitis C Virus Infection. The American Journal of Gastroenterology 102:10, 2332-2338
CrossRef365
Nizar N Zein. (2007) Hepatitis C in children: recent advances. Current Opinion in Pediatrics 19:5, 570-574
CrossRef366
Ira M. Jacobson, Robert S. Brown, Jonathan McCone, Martin Black, Clive Albert, Michael S. Dragutsky, Firdous A. Siddiqui, Thomas Hargrave, Paul Y. Kwo, Louis Lambiase, Greg W. Galler, Victor Araya, Bradley Freilich, Joann Harvey, Louis H. Griffel, Clifford A. Brass, . (2007) Impact of weight-based ribavirin with peginterferon alfa-2b in african americans with hepatitis C virus genotype 1. Hepatology 46:4, 982-990
CrossRef367
Jacques Baillargeon, Roger D. Soloway, David Paar, Thomas P. Giordano, Owen Murray, James Grady, Brie Williams, John Pulvino, Ben G. Raimer. (2007) End-Stage Liver Disease in a State Prison Population. Annals of Epidemiology 17:10, 808-813
CrossRef368
O. Freudenreich, R. T. Gandhi, J. P. Walsh, D. C. Henderson, D. C. Goff. (2007) Hepatitis C in Schizophrenia: Screening Experience in a Community-Dwelling Clozapine Cohort. Psychosomatics 48:5, 405-411
CrossRef369
S. S. Toussi, J. Abadi, M. Rosenberg, D. Levanon. (2007) Prevalence of Hepatitis B and C Virus Infections in Children Infected with HIV. Clinical Infectious Diseases 45:6, 795-798
CrossRef370
Jorge L. Herrera. (2007) PRO: Management of Hepatitis C by Liver Disease Specialists. The American Journal of Gastroenterology 102:9, 1837-1839
CrossRef371
Flavien Bernardin, Susan L. Stramer, Barbara Rehermann, Kimberly Page-Shafer, Stewart Cooper, David R. Bangsberg, Judith Hahn, Leslie Tobler, Michael Busch, Eric Delwart. (2007) High levels of subgenomic HCV plasma RNA in immunosilent infections. Virology 365:2, 446-456
CrossRef372
Felice Piccinino, Nicola Coppola. (2007) Antiviral treatment of HCV-related cirrhosis. Digestive and Liver Disease 39, S96-S101
CrossRef373
Judith Garrard, Veena Choudary, Holly Groom, Eric Dieperink, Mark L. Willenbring, Janet M. Durfee, Samuel B. Ho. (2007) Organizational change in management of hepatitis C: Evaluation of a CME program. Journal of Continuing Education in the Health Professions 26:2, 145-160
CrossRef374
Scott Seronello, Muhammad Y. Sheikh, Jinah Choi. (2007) Redox regulation of hepatitis C in nonalcoholic and alcoholic liver. Free Radical Biology and Medicine 43:6, 869-882
CrossRef375
Ashwani K. Singal, Bhupinder S. Anand. (2007) Mechanisms of Synergy Between Alcohol and Hepatitis C Virus. Journal of Clinical Gastroenterology 41:8, 761-772
CrossRef376
Y. Zhou, Y. Lukes, J. Anderson, B. Fileta, B. Reinhardt, M. Sjogren. (2007) Hepatitis C virus E2 envelope protein induces dendritic cell maturation. Journal of Viral Hepatitis 0:0, 070901052026004-???
CrossRef377
Hirofumi Uto, Joji Kurogi, Yuka Takahama, Kazunori Kusumoto, Katsuhiro Hayashi, Akio Ido, Michinori Kohara, Sherri O Stuver, Akihiro Moriuchi, Susumu Hasegawa, Makoto Oketani, Hirohito Tsubouchi. (2007) Alanine aminotransferase flare-up in hepatitis C virus carriers with persistently normal alanine aminotransferase levels in a hyperendemic area of Japan. Journal of Gastroenterology 42:8, 673-680
CrossRef378
Fitzroy W. Dawkins, Victor R. Gordeuk, Beverly M. Snively, Laura Lovato, James C. Barton, Ronald T. Acton, Gordon D. McLaren, Catherine Leiendecker-Foster, Christine E. McLaren, Paul C. Adams, Mark Speechley, Emily L. Harris, Sharon Jackson, Elizabeth J. Thomson. (2007) African Americans at Risk for Increased Iron Stores or Liver Disease. The American Journal of Medicine 120:8, 734.e1-734.e9
CrossRef379
Verena Christen, Susan Treves, Francois H. T. Duong, Markus H. Heim. (2007) Activation of endoplasmic reticulum stress response by hepatitis viruses up-regulates protein phosphatase 2A. Hepatology 46:2, 558-565
CrossRef380
Margarita Dehesa-Violante, Rafael Nuñez-Nateras. (2007) Epidemiology of Hepatitis Virus B and C. Archives of Medical Research 38:6, 606-611
CrossRef381
Hugo R. Rosen, Scott J. Weston, KyungAh Im, Huiying Yang, James R. Burton, Henry Erlich, Jared Klarquist, Steven H. Belle, . (2007) Selective decrease in hepatitis C virus-specific immunity among African Americans and outcome of antiviral therapy. Hepatology 46:2, 350-358
CrossRef382
Konrad Tang-Tat Fung, James Fung, Ching-Lung Lai, Man-Fung Yuen. (2007) Etiologies of chronic liver diseases in Hong Kong. European Journal of Gastroenterology & Hepatology 19:8, 659-664
CrossRef383
Charles S. Whang, Ke-Qin Hu. (2007) Hepatitis C in patients with chronic kidney disease: Course and management. Current Hepatitis Reports 6:3, 96-102
CrossRef384
A. A. Butt, U. A. Khan, K. A. McGinnis, M. Skanderson, C. Kent Kwoh. (2007) Co-morbid medical and psychiatric illness and substance abuse in HCV-infected and uninfected veterans. Journal of Viral Hepatitis 0:0, 070729180316002-???
CrossRef385
Vinod K. Rustgi. (2007) The epidemiology of hepatitis C infection in the United States. Journal of Gastroenterology 42:7, 513-521
CrossRef386
Michal Kori, Orna Flidel-Rimon, Erica Sigler, Eric Shinwell, Esther Granot. (2007) Look-back study of Hepatitis C in teenagers after blood transfusions as neonates. Acta Paediatrica 96:7, 1050-1052
CrossRef387
Hana Kerzman, Manfred S. Green, Eilat Shinar. (2007) Risk factors for hepatitis
CrossRef388
Kapil Gupta, Denise Romney, Muriel Briggs, Karen Benker. (2007) Effects Of A Brief Educational Program On Knowledge And Willingness To Accept Treatment Among Patients With Hepatitis C At Inner-City Hospitals. Journal of Community Health 32:4, 221-230
CrossRef389
DAN H. BOURLA, ROBERT S. WIRTHLIN, NIRIT BOURLA, ANURAG GUPTA, DINU STANESCU-SEGALL, STEVEN D. SCHWARTZ, RUTH AXER-SIEGEL. (2007) RISK FOR EYE SPLASH INJURY DURING ADMINISTRATION OF INTRAOCULAR INJECTIONS. Retina 27:5, 609-612
CrossRef390
Alexander V. Vlassov, Brent Korba, Kristine Farrar, Sampa Mukerjee, Attila A. Seyhan, Heini Ilves, Roger L. Kaspar, Devin Leake, Sergei A. Kazakov, Brian H. Johnston. (2007) shRNAs Targeting Hepatitis C: Effects of Sequence and Structural Features, and Comparision with siRNA. Oligonucleotides 17:2, 223-236
CrossRef391
Wei-Shi Yeh, Edward P Armstrong, Grant H Skrepnek, Daniel C Malone. (2007) Peginterferon alfa-2a versus Peginterferon alfa-2b as Initial Treatment of Hepatitis C Virus Infection: A Cost-Utility Analysis from the Perspective of the Veterans Affairs Health Care System. Pharmacotherapy 27:6, 813-824
CrossRef392
Martin Braddock. (2007) 11th Annual Inflammatory and Immune Diseases Drug Discovery and Development Summit. Expert Opinion on Investigational Drugs 16:6, 909-917
CrossRef393
Isabelle Desombere, Hans Van Vlierberghe, Ola Weiland, Catharina Hultgren, Matti Sällberg, Juan Quiroga, Vicente Carreño, Geert Leroux-Roels. (2007) Serum levels of anti-NS4a and anti-NS5a predict treatment response of patients with chronic hepatitis C. Journal of Medical Virology 79:6, 701-713
CrossRef394
Judith I. Tsui, David R. Bangsberg, Kathleen Ragland, Christopher S. Hall, Elise D. Riley. (2007) The Impact of Chronic Hepatitis C on Health-Related Quality of Life in Homeless and Marginally Housed Individuals with HIV. AIDS and Behavior 11:4, 603-610
CrossRef395
C. M. Behler, E. Vittinghoff, F. Lin, R. T. Chung, M. G. Peters, G. K. Robbins, P. A. Volberding. (2007) Hematologic Toxicity Associated with Interferon-Based Hepatitis C Therapy in HIV Type 1-Coinfected Subjects. Clinical Infectious Diseases 44:10, 1375-1383
CrossRef396
Maria H. Sjogren, Robert Sjogren, Michael F. Lyons, Michael Ryan, John Santoro, Coleman Smith, K. Rajender Reddy, Herbert Bonkovsky, Brooke Huntley, Sima Faris-Young. (2007) Antiviral Response of HCV Genotype 1 to Consensus Interferon and Ribavirin Versus Pegylated Interferon and Ribavirin. Digestive Diseases and Sciences 52:6, 1540-1547
CrossRef397
Samir Parekh, Frank A. Anania. (2007) Abnormal Lipid and Glucose Metabolism in Obesity: Implications for Nonalcoholic Fatty Liver Disease. Gastroenterology 132:6, 2191-2207
CrossRef398
George N. Ioannou, Noel S. Weiss, Kris V. Kowdley. (2007) Relationship Between Transferrin-Iron Saturation, Alcohol Consumption, and the Incidence of Cirrhosis and Liver Cancer. Clinical Gastroenterology and Hepatology 5:5, 624-629
CrossRef399
Flor H. Pujol, Carmen L. Loureiro. (2007) Replacement of Hepatitis C Virus Genotype 1b by Genotype 2 Over a 10-year Period in Venezuela. Journal of Clinical Gastroenterology 41:5, 518-520
CrossRef400
Geoffrey C. Nguyen, Dorry L. Segev, Paul J. Thuluvath. (2007) Racial disparities in the management of hospitalized patients with cirrhosis and complications of portal hypertension: A national study. Hepatology 45:5, 1282-1289
CrossRef401
J. Timm, M. Neukamm, T. Kuntzen, A. Y. Kim, R. T. Chung, C. Brander, G. M. Lauer, B. D. Walker, T. M. Allen. (2007) Characterization of full-length hepatitis C virus genotype 4 sequences. Journal of Viral Hepatitis 14:5, 330-337
CrossRef402
Ann W. Hsing, Yu-Tang Gao, Katherine A. McGlynn, Shelley Niwa, Mingdong Zhang, Tian-Quan Han, Bing-Sheng Wang, Jinbo Chen, Lori C. Sakoda, Ming-Chang Shen, Bai-He Zhang, Jie Deng, Asif Rashid. (2007) Biliary tract cancer and stones in relation to chronic liver conditions: A population-based study in Shanghai, China. International Journal of Cancer 120:9, 1981-1985
CrossRef403
Cristina Bosetti, Fabio Levi, Franca Lucchini, Witold A. Zatonski, Eva Negri, Carlo La Vecchia. (2007) Worldwide mortality from cirrhosis: An update to 2002. Journal of Hepatology 46:5, 827-839
CrossRef404
Chu Chieh Hsia, Vladimir E. Chizhikov, Amy X. Yang, Angamuthu Selvapandiyan, Indira Hewlett, Robert Duncan, Raj K. Puri, Hira L. Nakhasi, Gerardo G. Kaplan. (2007) Microarray multiplex assay for the simultaneous detection and discrimination of hepatitis B, hepatitis C, and human immunodeficiency type-1 viruses in human blood samples. Biochemical and Biophysical Research Communications 356:4, 1017-1023
CrossRef405
Santiago Tomé, Julio Pascual, John D. Pirsch, Alexandru Musat, Michael R. Lucey. (2007) Hepatitis C infection in kidney transplantation. Transplantation Reviews 21:2, 86-96
CrossRef406
Kazuaki Inoue, Takuya Umehara, Urs T. Ruegg, Fumihiko Yasui, Tsunamasa Watanabe, Hiroshi Yasuda, Jean-Maurice Dumont, Pietro Scalfaro, Makoto Yoshiba, Michinori Kohara. (2007) Evaluation of a cyclophilin inhibitor in hepatitis C virus-infected chimeric mice in vivo. Hepatology 45:4, 921-928
CrossRef407
Naomi L.C. Luban, Camilla A. Colvin, Parvathi Mohan, Harvey J. Alter. (2007) The epidemiology of transfusion-associated hepatitis
CrossRef408
A. Chris Krueger, Darold L. Madigan, Brian E. Green, Douglas K. Hutchinson, Wen W. Jiang, Warren M. Kati, Yaya Liu, Clarence J. Maring, Sherie V. Masse, Keith F. McDaniel, Tim R. Middleton, Hongmei Mo, Akhteruzzaman Molla, Debra A. Montgomery, Teresa I. Ng, Dale J. Kempf. (2007) Inhibitors of HCV NS5B polymerase: Synthesis and structure–activity relationships of unsymmetrical 1-hydroxy-4,4-dialkyl-3-oxo-3,4-dihydronaphthalene benzothiadiazine derivatives. Bioorganic & Medicinal Chemistry Letters 17:8, 2289-2292
CrossRef409
Yasuteru Kondo, Vicky M.H. Sung, Keigo Machida, Minyi Liu, Michael M.C. Lai. (2007) Hepatitis C virus infects T cells and affects interferon-γ signaling in T cell lines. Virology 361:1, 161-173
CrossRef410
Lennox J. Jeffers. (2007) Treating hepatitis C in African Americans. Liver International 27:3, 313-322
CrossRef411
R. K. STERLING, C. D. LYONS, R. T. STRAVITZ, V. A. LUKETIC, A. J. SANYAL, M. E. CARR, T. J. SMITH, M. H. HACKNEY, M. J. CONTOS, S. A. MILLS, J. G. KUHN, M. E. NOLTE, M. L. SHIFFMAN. (2007) Percutaneous liver biopsy in adult haemophiliacs with hepatitis C virus: safety of outpatient procedure and impact of human immunodeficiency virus coinfection on the spectrum of liver disease. Haemophilia 13:2, 164-171
CrossRef412
Koko Bate Aborsangaya, Iga Dembinski, Suresh Khatkar, Martin Prince Alphonse, Peter Nickerson, Julia D. Rempel. (2007) Impact of aboriginal ethnicity on HCV core-induced IL-10 synthesis: Interaction with IL-10 gene polymorphisms. Hepatology 45:3, 623-630
CrossRef413
Thea Thomas, Graham Foster. (2007) Nanomedicines in the treatment of chronic hepatitis C ? focus on pegylated interferon alpha-2a. International Journal of Nanomedicine 2:1, 19-24
CrossRef414
Richard D Semba, Erin P Ricketts, Shruti Mehta, Dale Netski, David Thomas, Gregory Kirk, Albert W Wu, David Vlahov. (2007) Effect of Micronutrients and Iron Supplementation on Hemoglobin, Iron Status, and Plasma Hepatitis C and HIV RNA Levels in Female Injection Drug Users. JAIDS Journal of Acquired Immune Deficiency Syndromes PAP,
CrossRef415
Yih-Ing Hser. (2007) Predicting Long-Term Stable Recovery from Heroin Addiction. Journal of Addictive Diseases 26:1, 51-60
CrossRef416
Mohammad Saeid Hejazi ., Reza Ghotaslou ., Majid Farshdoosty Hagh ., Yashar Mohammadzadeh Sadigh .. (2007) Genotyping of Hepatitis C Virus in Northwest of Iran. Biotechnology(Faisalabad) 6:3, 302-308
CrossRef417
Jaydeep S. Kadam, Andrew H. Talal. (2007) Changing Treatment Paradigms: Hepatitis C Virus in HIV-Infected Patients. AIDS Patient Care and STDs 21:3, 154-168
CrossRef418
Vincent Lo Re, Jay R Kostman, Robert Gross, K Rajender Reddy, Karam Mounzer, Babette S Zemel, Hanna Rennert, Donald D Stieritz, Mary Putt, Ian Frank, Brian L Strom. (2007) Incidence and Risk Factors for Weight Loss During Dual HIV/Hepatitis C Virus Therapy. JAIDS Journal of Acquired Immune Deficiency Syndromes 44:3, 344-350
CrossRef419
Andrea A Howard, Yungtai Lo, Michelle Floris-Moore, Robert S Klein, Norman Fleischer, Ellie E Schoenbaum. (2007) Hepatitis C virus infection is associated with insulin resistance among older adults with or at risk of HIV infection. AIDS 21:5, 633-641
CrossRef420
Vincent Lo Re, Ian Frank, Robert Gross, Marie Synnestvedt, A. Russell Localio, Jay R. Kostman, Brian L. Strom. (2007) Self-reported hepatitis B and C virus infections had low sensitivity among HIV-infected patients. Journal of Clinical Epidemiology 60:3, 294-299
CrossRef421
S. Deuffic-Burban, T. Poynard, M. S. Sulkowski, J. B. Wong. (2007) Estimating the future health burden of chronic hepatitis C and human immunodeficiency virus infections in the United States. Journal of Viral Hepatitis 14:2, 107-115
CrossRef422
Fadia T. Shaya, Confidence M. Gbarayor, Huiwen Keri Yang, Marriette Agyeman-Duah, Elijah Saunders. (2007) A perspective on African American participation in clinical trials. Contemporary Clinical Trials 28:2, 213-217
CrossRef423
Chiung M. Chen, Young-Hee Yoon, Hsiao-ye Yi, Diane L. Lucas. (2007) Alcohol and Hepatitis C Mortality Among Males and Females in the United States: A Life Table Analysis. Alcoholism: Clinical and Experimental Research 31:2, 285-292
CrossRef424
Nikolaos Pyrsopoulos, Lennox Jeffers. (2007) Hepatitis C in African Americans. Journal of Clinical Gastroenterology 41:2, 185-193
CrossRef425
Belén Ramos, Marina Núñez, Carlos Toro, Julie Sheldon, Javier García-Samaniego, Pilar Ríos, Vincent Soriano. (2007) Changes in the distribution of hepatitis C virus (HCV) genotypes over time in Spain according to HIV serostatus: Implications for HCV therapy in HCV/HIV-coinfected patients. Journal of Infection 54:2, 173-179
CrossRef426
Sanjeev Arora, Cynthia M. A. Geppert, Summers Kalishman, Denise Dion, Frank Pullara, Barbara Bjeletich, Gary Simpson, Dale C. Alverson, Lori B. Moore, Dave Kuhl, Joseph V. Scaletti. (2007) Academic Health Center Management of Chronic Diseases through Knowledge Networks: Project ECHO. Academic Medicine 82:2, 154-160
CrossRef427
T. Bizollon, P. Pradat, J.-Y. Mabrut, S. Radenne, C. Ducerf, J. Baulieux, J. C. Souquet, C. Trepo. (2007) Histological Benefit of Retreatment by Pegylated Interferon Alfa-2b and Ribavirin in Patients with Recurrent Hepatitis C Virus Infection Posttransplantation. American Journal of Transplantation 7:2, 448-453
CrossRef428
Ke-Qin Hu, Sue L. Currie, Hui Shen, Ramsey C. Cheung, Samuel B. Ho, Edmund J. Bini, John D. McCracken, Tim Morgan, Norbert Bräu, Warren N. Schmidt, Lennox Jeffers, Teresa L. Wright, . (2007) Clinical Implications of Hepatic Steatosis in Patients with Chronic Hepatitis C: A Multicenter Study of U.S. Veterans. Digestive Diseases and Sciences 52:2, 570-578
CrossRef429
Mohamed A. Metwally, Claudia O. Zein, Nizar N. Zein. (2007) Predictors and Noninvasive Identification of Severe Liver Fibrosis in Patients with Chronic Hepatitis C. Digestive Diseases and Sciences 52:2, 582-588
CrossRef430
Maribel Rodríguez-Torres, José F. Rodríguez-Orengo, Carlos F. Ríos-Bedoya, Alberto Fernández-Carbia, Elsa González-Lassalle, Rosa Salgado-Mercado, Acisclo M. Marxuach-Cuétara. (2007) Efficacy and safety of peg-IFN alfa-2a with ribavirin for the treatment of HCV/HIV coinfected patients who failed previous IFN based therapy. Journal of Clinical Virology 38:1, 32-38
CrossRef431
L. H. Tobler, S. L. Stramer, D. Y. Chien, S. Lin, P. Arcangel, B. H. Phelps, S. L. Cooper, M. P. Busch. (2007) Antibodies to a novel antigen in acute hepatitis C virus infections. Vox Sanguinis 92:1, 1-7
CrossRef432
Rita Jakiche, Matthew E. Borrego, Dennis W. Raisch, Gireesh V. Gupchup, Manjunath A. Pai, Antoine Jakiche. (2007) The Cost-Effectiveness of Two Strategies for Vaccinating U.S. Veterans with Hepatitis C Virus Infection against Hepatitis A and Hepatitis B Viruses. The American Journal of the Medical Sciences 333:1, 26-34
CrossRef433
Eric S. Weiss, Edward E. Cornwell, Theresa Wang, Dora Syin, E. Anne Millman, Peter J. Pronovost, David Chang, Martin A. Makary. (2007) Human immunodeficiency virus and hepatitis testing and prevalence among surgical patients in an urban university hospital. The American Journal of Surgery 193:1, 55-60
CrossRef434
Erwin Chiquete, Arturo Panduro. (2007) Low Prevalence of Anti-Hepatitis C Virus Antibodies in Mexico: A Systematic Review. Intervirology 50:1, 1-8
CrossRef435
Andrew R Lloyd, Emma Jagger, Jeffrey J Post, Lee-Ann Crooks, William D Rawlinson, Young S Hahn, Rosemary A Ffrench. (2007) Host and viral factors in the immunopathogenesis of primary hepatitis C virus infection. Immunology and Cell Biology 85:1, 24-32
CrossRef436
Byoung-Kwon Chun, Peiyuan Wang, Abdalla Hassan, Jinfa Du, Phillip M. Tharnish, Eisuke Murakami, Lieven Stuyver, Michael J. Otto, Raymond F. Schinazi, Kyoichi A. Watanabe. (2007) Synthesis and Biological Activity of 5′,9-Anhydro - 3-Purine- ISO Nucleosides as Potential Anti-Hepatitis C Virus Agents. Nucleosides, Nucleotides and Nucleic Acids 26:1, 83-97
CrossRef437
J.S. Barkin. (2007) Incidence of Statin Hepatotoxicity in Patients With Hepatitis C. Yearbook of Medicine 2007, 446-448
CrossRef438
James Knoll. (2006) A Tale of Two Crises: Mental Health Treatment in Corrections. Journal of Dual Diagnosis 3:1, 7-21
CrossRef439
L. I. Backus, D. B. Boothroyd, B. R. Phillips, L. A. Mole. (2006) Pretreatment assessment and predictors of hepatitis C virus treatment in US veterans coinfected with HIV and hepatitis C virus. Journal of Viral Hepatitis 13:12, 799-810
CrossRef440
Sharon J Hutchinson, Sheila M Bird, David J Goldberg. (2006) Review of models used to predict the future numbers of individuals with severe hepatitis C disease: therapeutic and cost implications. Expert Review of Pharmacoeconomics & Outcomes Research 6:6, 627-639
CrossRef441
Gregory T. Everson, John C. Hoefs, Leonard B. Seeff, Herbert L. Bonkovsky, Deepa Naishadham, Mitchell L. Shiffman, Jeffrey A. Kahn, Anna S. F. Lok, Adrian M. Di Bisceglie, William M. Lee, Jules L. Dienstag, Marc G. Ghany, Chihiro Morishima, . (2006) Impact of disease severity on outcome of antiviral therapy for chronic hepatitis C: Lessons from the HALT-C trial. Hepatology 44:6, 1675-1684
CrossRef442
Susan Salter Davidson, William H. Benjamin. (2006) Risk of infection and tracking of work-related infectious diseases in the funeral industry. American Journal of Infection Control 34:10, 655-660
CrossRef443
Tobias Marcello, Arash Grakoui, Giovanna Barba–Spaeth, Erica S. Machlin, Sergei V. Kotenko, Margaret R. Macdonald, Charles M. Rice. (2006) Interferons α and λ Inhibit Hepatitis C Virus Replication With Distinct Signal Transduction and Gene Regulation Kinetics. Gastroenterology 131:6, 1887-1898
CrossRef444
A. Mathew, L. P. Peiffer, K. Rhoades, T. McGarrity. (2006) Sustained Viral Response to Pegylated Interferon α-2b and Ribavirin in Chronic Hepatitis C Refractory to Prior Treatment. Digestive Diseases and Sciences 51:11, 1956-1961
CrossRef445
W.-A. LIN, Y.-H. TARN, S.-L. TANG. (2006) Cost?utility analysis of different peg-interferon alpha-2b plus ribavirin treatment strategies as initial therapy for na
CrossRef446
R Bedimo, R Ghurani, M Nsuami, D Turner, M-B Kvanli, G Brown, D Margolis. (2006) Lipid abnormalities in HIV/hepatitis C virus-coinfected patients. HIV Medicine 7:8, 530-536
CrossRef447
Raymundo Paraná, Maria Isabel Schinoni, Luiz A. R. de Freitas, Liana Codes, Marla Cruz, Zilton Andrade, Christian Trepo. (2006) Anti-Golgi complex antibodies during pegylated-interferon therapy for hepatitis C. Liver International 26:9, 1148-1154
CrossRef448
G. Narasimhan, T. N. Sargios, R. Kalakuntla, P. Homel, D. J. Clain, N. D. Theise, H. C. Bodenheimer, A. D. Min. (2006) Treatment rates in patients with chronic hepatitis C after liver biopsy. Journal of Viral Hepatitis 13:11, 783-786
CrossRef449
M. Karmochkine, F. Carrat, O. Dos Santos, P. Cacoub, G. Raguin, . (2006) A case?control study of risk factors for hepatitis C infection in patients with unexplained routes of infection. Journal of Viral Hepatitis 13:11, 775-782
CrossRef450
Robert J. Fontana, David E. Kleiner, Richard Bilonick, Norah Terrault, Nezam Afdhal, Steven H. Belle, Lennox J. Jeffers, Darmendra Ramcharran, Marc G. Ghany, Jay H. Hoofnagle, . (2006) Modeling hepatic fibrosis in African American and Caucasian American patients with chronic hepatitis C virus infection. Hepatology 44:4, 925-935
CrossRef451
Kathleen E. Corey, Andrew S. Ross, Alysse Wurcel, Julian Schulze zur Wiesch, Arthur Y. Kim, Georg M. Lauer, Raymond T. Chung. (2006) Outcomes and Treatment of Acute Hepatitis C Virus Infection in a United States Population. Clinical Gastroenterology and Hepatology 4:10, 1278-1282
CrossRef452
Sanaa M. Kamal. (2006) Genotypic variations around the world: Is hepatitis C virus evolving?. Current Hepatitis Reports 5:4, 142-149
CrossRef453
C. Christensen, D. Bruden, S. Livingston, H. Deubner, C. Homan, K. Smith, E. Oh, D. Gretch, J. Williams, B. McMahon. (2006) Diagnostic accuracy of a fibrosis serum panel (FIBROSpect II) compared with Knodell and Ishak liver biopsy scores in chronic hepatitis C patients. Journal of Viral Hepatitis 13:10, 652-658
CrossRef454
M. K. CHAPKO, J. A. DOMINITZ. (2006) Cost-effectiveness of growth factors during hepatitis C anti-viral therapy. Alimentary Pharmacology and Therapeutics 24:7, 1067-1077
CrossRef455
Pierluigi Toniutto, Carlo Fabris, Mario Pirisi. (2006) Antiviral treatment of hepatitis C. Expert Opinion on Pharmacotherapy 7:15, 2025-2035
CrossRef456
Matthew L Cowan, James D Maxwell. (2006) Treatment of hepatitis C virus infection in intravenous drug users. Acta Neuropsychiatrica 18:5, 183-192
CrossRef457
James Airoldi, Vincenzo Berghella. (2006) Hepatitis C and Pregnancy. Obstetrical & Gynecological Survey 61:10, 666-672
CrossRef458
Helen S. Yee, Sue L. Currie, Jama M. Darling, Teresa L. Wright. (2006) Management and Treatment of Hepatitis C Viral Infection: Recommendations from the Department of Veterans Affairs Hepatitis C Resource Center Program and the National Hepatitis C Program Office. The American Journal of Gastroenterology 101:10, 2360-2378
CrossRef459
Magdy Dawood, Gerry Smart, Michelyn Wood, Hong-Xing Wu, Shirley Paton, Jun Wu. (2006) Hepatitis C virus infection among First Nation and non-First Nation people in Manitoba, Canada — a public health laboratory study. Canadian Journal of Microbiology 52:10, 999-1005
CrossRef460
Juan Buenestado-García, Manuel Rubio-Rivas, Josep Maria Reñé-Espinet, Carmen Piñol-Felis, Ramón Egido-García, Manuel Rubio-Caballero. (2006) Valor de la respuesta virológica precoz como factor predictivo de respuesta virológica sostenida al tratamiento con interferón α-2b y ribavirina en pacientes con hepatitis crónica C con o sin coinfección por el VIH. Medicina Clínica 127:15, 561-566
CrossRef461
Astrid Knott, Eric Dieperink, Mark L. Willenbring, Sara Heit, Janet M. Durfee, Mary Wingert, James R. Johnson, Paul Thuras, Samuel B. Ho. (2006) Integrated Psychiatric/Medical Care in a Chronic Hepatitis C Clinic: Effect on Antiviral Treatment Evaluation and Outcomes. The American Journal of Gastroenterology 101:10, 2254-2262
CrossRef462
Shigeru Marubashi, Keizo Dono, Atsushi Miyamoto, Yutaka Takeda, Hiroaki Nagano, Koji Umeshita, Morito Monden. (2006) Liver transplantation for hepatitis C. Journal of Hepato-Biliary-Pancreatic Surgery 13:5, 382-392
CrossRef463
Masaaki Shiina, Koju Kobayashi, Tomoo Kobayashi, Yasuteru Kondo, Yoshiyuki Ueno, Tooru Shimosegawa. (2006) Dynamics of immature subsets of dendritic cells during antiviral therapy in HLA-A24–positive chronic hepatitis C patients. Journal of Gastroenterology 41:8, 758-764
CrossRef464
C. M. Arcari, K. E. Nelson, D. M. Netski, F. J. Nieto, C. A. Gaydos. (2006) No Association between Hepatitis C Virus Seropositivity and Acute Myocardial Infarction. Clinical Infectious Diseases 43:6, e53-e56
CrossRef465
Rachel Gonzales, Patricia Marinelli-Casey, Steven Shoptaw, Alfonso Ang, Richard A. Rawson. (2006) Hepatitis C virus infection among methamphetamine-dependent individuals in outpatient treatment. Journal of Substance Abuse Treatment 31:2, 195-202
CrossRef466
Michael W. Fried, Barbara L. Kroner, Liliana R. Preiss, Kirk Wilhelmsen, James J. Goedert. (2006) Hemophilic Siblings With Chronic Hepatitis C: Familial Aggregation of Spontaneous and Treatment-Related Viral Clearance. Gastroenterology 131:3, 757-764
CrossRef467
Montserrat Puig, Kathleen Mihalik, John C. Tilton, Ollie Williams, Michael Merchlinsky, Mark Connors, Stephen M. Feinstone, Marian E. Major. (2006) CD4+ immune escape and subsequent T-cell failure following chimpanzee immunization against hepatitis C virus. Hepatology 44:3, 736-745
CrossRef468
Sumit Mohan, Manasvi Jaitly, Jen-Tse Cheng, Vivette D. D’Agati, Velvie A. Pogue. (2006) Unusual Biopsy Findings in a Hepatitis C–Infected White Man With Cryoglobulinemia, Purpuric Rash, and Renal Failure. American Journal of Kidney Diseases 48:3, 513-517
CrossRef469
Perdita Wietzke-Braun, Adil B. Maouzi, Larissa B. M??nhardt, Heike Bickeb??ller, Giuliano Ramadori, Sabine Mihm. (2006) Interferon regulatory factor-1 promoter polymorphism and the outcome of hepatitis C virus infection. European Journal of Gastroenterology & Hepatology 18:9, 991-997
CrossRef470
Corrine E. Munoz-Plaza, Shiela M. Strauss, Janetta M. Astone-Twerwll, Don C. Des Jarlais, Holly Hagan. (2006) Staff Perspectives on Facilitating the Implementation of Hepatitis C Services at Drug Treatment Programs. Journal of Psychoactive Drugs 38:3, 233-241
CrossRef471
Ian W. Udell, Neal R. Barshes, Milton J. Finegold, Timothy C. Lee, Jaymee D. Scott, Beth Carter, Saul Karpen, John A. Goss. (2006) Hepatitis C viral recurrence in a pediatric patient following liver transplantation. Pediatric Transplantation 10:5, 617-622
CrossRef472
Carolina Rumbo, Rima L. Fawaz, Sukru H. Emre, Frederick J. Suchy, Nanda Kerkar, Raffaella A. Morotti, Benjamin L. Shneider. (2006) Hepatitis C in Children. Journal of Pediatric Gastroenterology and Nutrition 43:2, 209-216
CrossRef473
Efsevia Albanis, Scott L. Friedman. (2006) Antifibrotic targets and therapy in HCV. Current Hepatitis Reports 5:3, 94-100
CrossRef474
Justin Shah, Eric M. Yoshida, Joseph Connors, Sharlene Gill. (2006) Hepatic Dysfunction During and After Lymphoma Chemotherapy in Patients With Hepatitis C. Journal of Clinical Gastroenterology 40:7, 636-638
CrossRef475
Omana V. Nainan, Miriam J. Alter, Deanna Kruszon-Moran, Feng-Xiang Gao, Guoliang Xia, Geraldine McQuillan, Harold S. Margolis. (2006) Hepatitis C Virus Genotypes and Viral Concentrations in Participants of a General Population Survey in the United States. Gastroenterology 131:2, 478-484
CrossRef476
Carla W. Brady, Andrew J. Muir. (2006) The impact of race and ethnicity on the treatment of hepatitis C disease. Current Hepatitis Reports 5:3, 79-85
CrossRef477
Lu-Yu Hwang, Jennifer R. Kramer, Catherine Troisi, Lara Bull, Carolyn Z. Grimes, Rob Lyerla, Miriam J. Alter. (2006) Relationship of cosmetic procedures and drug use to hepatitis C and hepatitis B virus infections in a low-risk population. Hepatology 44:2, 341-351
CrossRef478
Jennifer E. Layden-Almer, Scott J. Cotler, Thomas J. Layden. (2006) Viral kinetics in the treatment of chronic hepatitis C. Journal of Viral Hepatitis 13:8, 499-504
CrossRef479
F. Bernardin, B. Herring, K. Page-Shafer, C. Kuiken, E. Delwart. (2006) Absence of HCV viral recombination following superinfection. Journal of Viral Hepatitis 13:8, 532-537
CrossRef480
Haldun Selcuk, Mehmet Kanbay, Murat Korkmaz, Gurden Gur, Ali Akcay, Hande Arslan, Nurhan Ozdemir, Ugur Yilmaz, Sedat Boyacioglu. (2006) Distribution of HCV Genotypes in Patients with End-Stage Renal Disease According to Type of Dialysis Treatment. Digestive Diseases and Sciences 51:8, 1420-1425
CrossRef481
Barbara Horoldt, Geoffrey Haydon, Katrina O'Donnell, Tracey Dudley, Peter Nightingale, David Mutimer. (2006) Results of combination treatment with pegylated interferon and ribavirin in cirrhotic patients with hepatitis C infection. Liver International 26:6, 650-659
CrossRef482
Gaston R. Picchio, Patricia C. Bare, Valeria I. Descalzi, Maria V. Bussy, Sonia M. Soria, Maria P. Raffa, Nancy E. Mazzencio, Silvina Etchehun, Juan A. Camera, Donald E. Mosier, Federico G. Villamil. (2006) High prevalence of infection with a single hepatitis C virus genotype in a small rural community of Argentina. Liver International 26:6, 660-665
CrossRef483
Carla AL Matos, Renata M Perez, Mauricio S Pacheco, Claudio G Figueiredo-Mendes, Edmundo Lopes-Neto, Evandro B Oliveira, Valeria P Lanzoni, Antonio EB Silva, Maria LG Ferraz. (2006) Steatosis in chronic hepatitis C: Relationship to the virus and host risk factors. Journal of Gastroenterology and Hepatology 21:8, 1236-1239
CrossRef484
Sumita Verma, Maurizio Bonacini, Sugantha Govindarajan, Gary Kanel, Karen L. Lindsay, Allan Redeker. (2006) More Advanced Hepatic Fibrosis in Hispanics with Chronic Hepatitis C Infection: Role of Patient Demographics, Hepatic Necroinflammation, and Steatosis. The American Journal of Gastroenterology 101:8, 1817-1823
CrossRef485
Shirin Khorashadi, Noelle K. Hasson, Ramsey C. Cheung. (2006) Incidence of Statin Hepatotoxicity in Patients With Hepatitis C. Clinical Gastroenterology and Hepatology 4:7, 902-907
CrossRef486
Martin A. Makary, Peter J. Pronovost, Eric S. Weiss, E. Anne Millman, David Chang, Susan P. Baker, Edward E. Cornwell, Dora Syin, Julie A. Freischlag. (2006) Sharpless Surgery: A Prospective Study of the Feasibility of Performing Operations using Non-sharp Techniques in an Urban, University-based Surgical Practice. World Journal of Surgery 30:7, 1224-1229
CrossRef487
Neal R. Barshes, Ian W. Udell, Timothy C. Lee, Christine A. O'Mahony, Saul J. Karpen, Beth A. Carter, John A. Goss. (2006) The natural history of hepatitis C virus in pediatric liver transplant recipients. Liver Transplantation 12:7, 1119-1123
CrossRef488
Joseph K. Lim, Ruth Cronkite, Mary K. Goldstein, Ramsey C. Cheung. (2006) The Impact of Chronic Hepatitis C and Comorbid Psychiatric Illnesses on Health-related Quality of Life. Journal of Clinical Gastroenterology 40:6, 528-534
CrossRef489
Liana Fraenkel, Sarah McGraw, Suchat Wongcharatrawee, Guadalupe Garcia-Tsao. (2006) Patients’ experiences related to anti-viral treatment for hepatitis C. Patient Education and Counseling 62:1, 148-155
CrossRef490
William A. Bower, David H. Culver, Delivette Castor, Yingfeng Wu, V. Nicole James, HaoQiang Zheng, Scott Hammer, Wendi L. Kuhnert, Ian T. Williams, Beth P. Bell, David Vlahov, Charlene S. Dezzutti. (2006) Changes in Hepatitis C Virus (HCV) Viral Load and Interferon-?? Levels in HIV/HCV-Coinfected Patients Treated With Highly Active Antiretroviral Therapy. JAIDS Journal of Acquired Immune Deficiency Syndromes 42:3, 293-297
CrossRef491
L. Castera, A. Constant, P-H. Bernard, V. de Ledinghen, P. Couzigou. (2006) Lifestyle changes and beliefs regarding disease severity in patients with chronic hepatitis C. Journal of Viral Hepatitis 13:7, 482-488
CrossRef492
A. Chris Krueger, Darold L. Madigan, Wen W. Jiang, Warren M. Kati, Dachun Liu, Yaya Liu, Clarence J. Maring, Sherie Masse, Keith F. McDaniel, Tim Middleton, Hongmei Mo, Akhteruzzaman Molla, Debra Montgomery, John K. Pratt, Todd W. Rockway, Rong Zhang, Dale J. Kempf. (2006) Inhibitors of HCV NS5B polymerase: Synthesis and structure–activity relationships of N-alkyl-4-hydroxyquinolon-3-yl-benzothiadiazine sulfamides. Bioorganic & Medicinal Chemistry Letters 16:13, 3367-3370
CrossRef493
Maria Alice S. Zarife, Luciano K. Silva, Maria Betânia S. Silva, Gisele B. Lopes, Maurício L. Barreto, Maria da Glória Teixeira, Inês Dourado, Mitermayer G. Reis. (2006) Prevalence of hepatitis C virus infection in north-eastern Brazil: a population-based study. Transactions of the Royal Society of Tropical Medicine and Hygiene 100:7, 663-668
CrossRef494
Kiminori Uka, Fumitaka Suzuki, Norio Akuta, Hitomi Sezaki, Yoshiyuki Suzuki, Tetsuya Hosaka, Takashi Someya, Masahiro Kobayashi, Satoshi Saitoh, Yasuji Arase, Kenji Ikeda, Hiromitsu Kumada. (2006) Efficacy of interferon monotherapy in young adult patients with chronic hepatitis C virus infection. Journal of Gastroenterology 41:5, 470-475
CrossRef495
B. H. McGovern, A. Wurcel, A. Y. Kim, J. S. zur Wiesch, I. Bica, M. T. Zaman, J. Timm, B. D. Walker, G. M. Lauer. (2006) Acute Hepatitis C Virus Infection in Incarcerated Injection Drug Users. Clinical Infectious Diseases 42:12, 1663-1670
CrossRef496
Alessandro Antonelli, Clodoveo Ferri, Poupak Fallahi, Silvia Martina Ferrari, Alessandra Ghinoi, Mario Rotondi, Ele Ferrannini. (2006) Thyroid Disorders in Chronic Hepatitis C Virus Infection. Thyroid 16:6, 563-572
CrossRef497
Davide Gibellini, Federica Gardini, Francesca Vitone, Pasqua Schiavone, Giuliano Furlini, Maria Carla Re. (2006) Simultaneous detection of HCV and HIV-1 by SYBR Green real time multiplex RT-PCR technique in plasma samples. Molecular and Cellular Probes 20:3-4, 223-229
CrossRef498
Ann Danoff, Oona Khan, David W. Wan, Lainie Hurst, Daniel Cohen, Craig T. Tenner, Edmund J. Bini. (2006) Sexual Dysfunction is Highly Prevalent Among Men with Chronic Hepatitis C Virus Infection and Negatively Impacts Health-Related Quality of Life. The American Journal of Gastroenterology 101:6, 1235-1243
CrossRef499
Ricard V. Solé, Josep Sardanyés, Juana Díez, Antonio Mas. (2006) Information catastrophe in RNA viruses through replication thresholds. Journal of Theoretical Biology 240:3, 353-359
CrossRef500
C. D. Howell, L. S. Jeffers, W. Cassidy, K. R. Reddy, S. Hu, J. S. Lee. (2006) Peginterferon alfa-2a and ribavirin for chronic hepatitis C genotype 1 infections in black patients: safety, tolerability and impact on sustained virologic response. Journal of Viral Hepatitis 13:6, 371-376
CrossRef501
Shiela M. Strauss, David M. Rindskopf, Janetta M. Astone-Twerell, Don C. Des Jarlais, Holly Hagan. (2006) Using latent class analysis to identify patterns of hepatitis C service provision in drug-free treatment programs in the U.S.. Drug and Alcohol Dependence 83:1, 15-24
CrossRef502
G.A.S. Pereira, M.M.A. Stefani, C.M.T. Martelli, M.D. Turchi, E.M.P. Siqueira, M.A.S. Carneiro, R.M.B. Martins. (2006) Human immunodeficiency virus type 1 and hepatitis C virus Co-infection and viral subtypes at an HIV testing center in Brazil. Journal of Medical Virology 78:6, 719-723
CrossRef503
C. C. Crone, G. M. Gabriel, A. DiMartini. (2006) An Overview of Psychiatric Issues in Liver Disease for the Consultation-Liaison Psychiatrist. Psychosomatics 47:3, 188-205
CrossRef504
B. R. Bacon. (2006) Assessing evidence from clinical trials in chronic hepatitis C. Journal of Viral Hepatitis 13:s1, 1-5
CrossRef505
Ariamala Gopalsamy, Mengxiao Shi, Gregory Ciszewski, Kaapjoo Park, John W. Ellingboe, Mark Orlowski, Boris Feld, Anita Y.M. Howe. (2006) Design and synthesis of 2,3,4,9-tetrahydro-1H-carbazole and 1,2,3,4-tetrahydro-cyclopenta[b]indole derivatives as non-nucleoside inhibitors of hepatitis C virus NS5B RNA-dependent RNA polymerase. Bioorganic & Medicinal Chemistry Letters 16:9, 2532-2534
CrossRef506
M. L. Shiffman, S. Saab, S. Feng, M. I. Abecassis, A. G. Tzakis, N. P. Goodrich, D. E. Schaubel. (2006) Liver and Intestine Transplantation in the United States, 1995-2004. American Journal of Transplantation 6:5p2, 1170-1187
CrossRef507
Patrick S Sullivan, Debra L Hanson, Eyasu H Teshale, Linda L Wotring, John T Brooks. (2006) Effect of hepatitis C infection on progression of HIV disease and early response to initial antiretroviral therapy. AIDS 20:8, 1171-1179
CrossRef508
Mindy Goldman, Lindsay Patterson, Anne Long. (2006) Recent Canadian experience with targeted hepatitis C virus lookback. Transfusion 46:5, 690-694
CrossRef509
Akira Matsumori, Toshio Shimada, Nora M. Chapman, Steven M. Tracy, Jay W. Mason. (2006) Myocarditis and Heart Failure Associated With Hepatitis C Virus Infection. Journal of Cardiac Failure 12:4, 293-298
CrossRef510
Xuguang (Grant) Tao, Edward J. Bernacki, Christopher Jankosky, Carolyn Means. (2006) An Assessment of Universal versus Risk-Based Hepatitis C Virus Testing of Source Patients Postexposure to Blood and Body Fluids Among Healthcare Workers. Journal of Occupational and Environmental Medicine 48:5, 470-477
CrossRef511
C. P. Desmond, S. K. Roberts, F. Dudley, J. Mitchell, C. Day, S. Nguyen, S. Pianko. (2006) Sustained virological response rates and durability of the response to interferon-based therapies in hepatitis C patients treated in the clinical setting. Journal of Viral Hepatitis 13:5, 311-315
CrossRef512
C. O'Brien. (2006) Issues in designing and interpreting clinical trials of treatments for chronic hepatitis C. Journal of Viral Hepatitis 13:s1, 6-14
CrossRef513
Gil Weitzman, Ira Jacobson. (2006) Peginterferon α-2b in the treatment of hepatitis C. Future Virology 1:3, 279-292
CrossRef514
Patrick Gerner, Stefan Wirth, Philip Wintermeyer, Alexander Walz, Andreas Jenke. (2006) Prevalence of hepatitis C virus infection in children admitted to an urban hospital. Journal of Infection 52:4, 305-308
CrossRef515
Stevan A. Gonzalez, Ruei-Che Liu, Brian R. Edlin, Ira M. Jacobson, Andrew H. Talal. (2006) HIV/Hepatitis C Virus-Coinfected Patients With Normal Alanine Aminotransferase Levels. JAIDS Journal of Acquired Immune Deficiency Syndromes 41:5, 582-589
CrossRef516
Dambadarjaa Davaalkham, Toshiyuki Ojima, Pagvajav Nymadawa, Ritei Uehara, Makoto Watanabe, Izumi Oki, Yosikazu Nakamura. (2006) Prevalence and risk factors for hepatitis C virus infection in Mongolian children: Findings from a nationwide survey. Journal of Medical Virology 78:4, 466-472
CrossRef517
Gregory M. Asnis, Richard De La Garza. (2006) Interferon-Induced Depression in Chronic Hepatitis C: A Review of Its Prevalence, Risk Factors, Biology, and Treatment Approaches. Journal of Clinical Gastroenterology 40:4, 322-335
CrossRef518
Maribel Rodr??guez-Torres, Carlos F. R??os-Bedoya, Jos?? Rodr??guez-Orengo, Alberto Fern??ndez-Carbia, Acisclo M. Marxuach-Cu??tara, Abimael L??pez-Torres, Rosa Salgado-Mercado, Norbert Br??u. (2006) Progression to Cirrhosis in Latinos With Chronic Hepatitis C: Differences in Puerto Ricans With and Without Human Immunodeficiency Virus Coinfection and Along Gender. Journal of Clinical Gastroenterology 40:4, 358-366
CrossRef519
N. Brau, E. J. Bini, S. Currie, H. Shen, W. N. Schmidt, P. D. King, S. B. Ho, R. C. Cheung, K.-Q. Hu, B. S. Anand, F. R. Simon, A. Aytaman, D. P. Johnson, J. A. Awad, J. Ahmad, C. L. Mendenhall, M. C. Pedrosa, R. H. Moseley, C. H. Hagedorn, B. Waters, K.-M. Chang, T. R. Morgan, S. J. Rossi, L. J. Jeffers, T. L. Wright, . (2006) Black patients with chronic hepatitis C have a lower sustained viral response rate than non-Blacks with genotype 1, but the same with genotypes 2/3, and this is not explained by more frequent dose reductions of interferon and ribavirin*. Journal of Viral Hepatitis 13:4, 242-249
CrossRef520
P. FABRIS, G. TOSITTI, M. T. GIORDANI, V. BALDO, A. GRASSO, E. PIGNATTARI, S. CANTON, S. ROSSATO, A. FLOREANI. (2006) Assessing patients' understanding of hepatitis C virus infection and its impact on their lifestyle. Alimentary Pharmacology and Therapeutics 23:8, 1161-1170
CrossRef521
Dawn A. Fishbein, Yungtai Lo, Dale Netski, David L. Thomas, Robert S. Klein. (2006) Predictors of Hepatitis C Virus RNA Levels in a Prospective Cohort Study of Drug Users. JAIDS Journal of Acquired Immune Deficiency Syndromes 41:4, 471-476
CrossRef522
Francois H. T. Duong, Verena Christen, Magdalena Filipowicz, Markus H. Heim. (2006) S-adenosylmethionine and betaine correct hepatitis C virus induced inhibition of interferon signaling in vitro. Hepatology 43:4, 796-806
CrossRef523
Wulf O. Bocher, Marcus Schuchmann, Ralph Link, Heribert Hillenbrand, Fareed Rahman, Martin Sprinzl, Jonas Mudter, Hanns F. Lohr, Peter R. Galle. (2006) Consensus interferon and ribavirin for patients with chronic hepatitis C and failure of previous interferon-alpha therapy. Liver International 26:3, 319-325
CrossRef524
S. Chainuvati, S. K. Khalid, S. Kancir, M. Shea, J. Edwards, M. Sernyak, S. Wongcharatrawee, G. Garcia-Tsao. (2006) Comparison of hepatitis C treatment patterns in patients with and without psychiatric and/or substance use disorders+. Journal of Viral Hepatitis 13:4, 235-241
CrossRef525
Lei Yu, Dana A. Sloane, Chuanfa Guo, Charles D. Howell. (2006) Risk Factors for Primary Hepatocellular Carcinoma in Black and White Americans in 2000. Clinical Gastroenterology and Hepatology 4:3, 355-360
CrossRef526
Yoichi Hiasa, Jason T. Blackard, Wenyu Lin, Yoshitaka Kamegaya, Norio Horiike, Morikazu Onji, Emmett V. Schmidt, Raymond T. Chung. (2006) Cell-based models of sustained, interferon-sensitive hepatitis C virus genotype 1 replication. Journal of Virological Methods 132:1-2, 195-203
CrossRef527
Christina S. Meade. (2006) Sexual risk behavior among persons dually diagnosed with severe mental illness and substance use disorder. Journal of Substance Abuse Treatment 30:2, 147-157
CrossRef528
B. R. Edlin, M. R. Carden. (2006) Injection Drug Users: The Overlooked Core of the Hepatitis C Epidemic. Clinical Infectious Diseases 42:5, 673-676
CrossRef529
Steffanie A. Strathdee, Thomas L. Patterson. (2006) Behavioral Interventions for HIV-Positive and HCV-Positive Drug users. AIDS and Behavior 10:2, 115-130
CrossRef530
Jeffrey S. Glenn. (2006) Molecular Virology of the Hepatitis C Virus: Implication for Novel Therapies. Infectious Disease Clinics of North America 20:1, 81-98
CrossRef531
Sangik Oh, Nezam H. Afdhal. (2006) Antiviral Therapy for Treatment Naïve Patients with Hepatitis C Virus. Infectious Disease Clinics of North America 20:1, 99-113
CrossRef532
M. Rios, M. Diago, P. Rivera, C. Tuset, R. Cors, V. Garcia, P. Carbonel, C. Gonzalez. (2006) Epidemiological, biological and histological characterization of patients with indeterminate third-generation recombinant immunoblot assay antibody results for hepatitis C virus. Journal of Viral Hepatitis 13:3, 177-181
CrossRef533
Navarro, Victor J., Senior, John R., . (2006) Drug-Related Hepatotoxicity. New England Journal of Medicine 354:7, 731-739
Full Text534
R. Lepe, J. E. Layden-Almer, T. J. Layden, S. Cotler. (2006) Ethnic differences in the presentation of chronic hepatitis C. Journal of Viral Hepatitis 13:2, 116-120
CrossRef535
Keyur Patel, Suzanne Norris, Lauralynn Lebeck, Anne Feng, Michael Clare, Stephen Pianko, Bernard Portmann, Lawrence M. Blatt, James Koziol, Andrew Conrad, John G. McHutchison. (2006) HLA class I allelic diversity and progression of fibrosis in patients with chronic hepatitis C. Hepatology 43:2, 241-249
CrossRef536
C. Bradley Hare, Jonathan A. Morris, Alice Chu, Vincent Gotz, Jacqueline J. Loveland, David Hodes, Winslow Klaskala. (2006) Comparison of characteristics of treated and non-treated patients with Hepatitis C infection. Pharmacoepidemiology and Drug Safety 15:2, 71-76
CrossRef537
Jason T. Blackard, Florence Komurian-Pradel, Magali Perret, Mireille Sodoyer, Laura Smeaton, J. Benjamin St. Clair, Stacey Chapman, Lynn E. Taylor, Glaucia Paranhos-Baccalà, Raymond T. Chung. (2006) Intrahepatic cytokine expression is downregulated during HCV/HIV co-infection. Journal of Medical Virology 78:2, 202-207
CrossRef538
Paul D. Berk. (2006) An editor's look-back. Hepatology 43:S1, S13-S30
CrossRef539
(2006) Understanding the RNA-Specificity of HCV RdRp: Implications for Anti-HCV Drug Discovery. Bulletin of the Korean Chemical Society 27:1, 59-64
CrossRef540
Blai Dalmau Obrador, Montserrat Gil Prades, Mercedes Vergara G??mez, Jordi Puig Domingo, Rosa Bella Cueto, Montserrat Ru??, Jordi Real, Pere Mas Guiteras. (2006) A predictive index for the diagnosis of cirrhosis in hepatitis C based on clinical, laboratory, and ultrasound findings. European Journal of Gastroenterology & Hepatology 18:1, 57-62
CrossRef541
B. L. Pearlman. (2006) Hepatitis C Virus Infection in African Americans. Clinical Infectious Diseases 42:1, 82-91
CrossRef542
M.G. LaPorte, T.A. Lessen, L. Leister, D. Cebzanov, E. Amparo, C. Faust, D. Ortlip, T.R. Bailey, T.J. Nitz, S.K. Chunduru, D.C. Young, C.J. Burns. (2006) Tetrahydrobenzothiophene inhibitors of hepatitis C virus NS5B polymerase. Bioorganic & Medicinal Chemistry Letters 16:1, 100-103
CrossRef543
Maryann Mugo, Ravina Matta, L Romayne Kurukulasuriya, James R. Sowers. (2006) Association of Hepatitis C Virus Infection and Diabetes Mellitus. The Endocrinologist 16:1, 41-48
CrossRef544
Ariamala Gopalsamy, Alexis Aplasca, Gregory Ciszewski, Kaapjoo Park, John W. Ellingboe, Mark Orlowski, Boris Feld, Anita Y.M. Howe. (2006) Design and synthesis of 3,4-dihydro-1H-[1]-benzothieno[2,3-c]pyran and 3,4-dihydro-1H-pyrano[3,4-b]benzofuran derivatives as non-nucleoside inhibitors of HCV NS5B RNA dependent RNA polymerase. Bioorganic & Medicinal Chemistry Letters 16:2, 457-460
CrossRef545
E. Albanis, S. L. Friedman. (2006) Antifibrotic Agents for Liver Disease. American Journal of Transplantation 6:1, 12-19
CrossRef546
Keith Nemergut, Edward C. Littlewood. 2006. Liver Diseases. , 151-201.
CrossRef547
K Abe, K Suzuki. (2006) Recent trends in transmission routes of HCV. Kanzo 47:2, 98-104
CrossRef548
Janetta M. Astone-Twerell, Shiela M. Strauss, Holly Hagan, Don C. Des Jarlais. (2006) Drug treatment programs' HCV service delivery to their HCV positive clients*. Addiction Research & Theory 14:3, 289-302
CrossRef549
Lilia López, Patricia López, Antonio Arago, Ismael Rodríguez, Jorge López, Edgar Lima, Juan Insagaray, Nilo Bentancor. (2005) Risk factors for hepatitis B and C in multi-transfused patients in Uruguay. Journal of Clinical Virology 34, S69-S74
CrossRef550
Stephanie A. Santos, Nickolas Kontorinis, Douglas T. Dieterich. (2005) Management of chronic Hepatitis C virus in patients with HIV. Current Treatment Options in Gastroenterology 8:6, 433-441
CrossRef551
Jin-Won Youn, Su-Hyung Park, Dimitri Lavillette, Francois-Loic Cosset, Se-Hwan Yang, Chang Geun Lee, Hyun-Tak Jin, Chang-Min Kim, Mohamed Tarek M. Shata, Dong-Hun Lee, Wolfram Pfahler, Alfred M. Prince, Young Chul Sung. (2005) Sustained E2 antibody response correlates with reduced peak viremia after hepatitis C virus infection in the chimpanzee. Hepatology 42:6, 1429-1436
CrossRef552
K. P. High, E.-L. Marcus, R. Tur-Kaspa. (2005) Chronic Hepatitis C Virus Infection in Older Adults. Clinical Infectious Diseases 41:11, 1606-1612
CrossRef553
José M. Ballester, René A. Rivero, Rinaldo Villaescusa, Julio C. Merlín, Ada A. Arce, Dunia Castillo, Rosa M. Lam, Adalberto Ballester, Miguel Almaguer, Silvia M. Melians, José L. Aparicio. (2005) Hepatitis C virus antibodies and other markers ofblood-transfusion-transmitted infection in multi-transfused Cuban patients. Journal of Clinical Virology 34, S39-S46
CrossRef554
David C. Metz, Nimish Vakil, Emmet B. Keeffe, Gary R. Lichtenstein. (2005) Advances in Gastrointestinal Pharmacotherapy. Clinical Gastroenterology and Hepatology 3:12, 1167-1179
CrossRef555
Michie Hisada, Nilanjan Chatterjee, Zeynep Kalaylioglu, Robert J. Battjes, James J. Goedert. (2005) Hepatitis C virus load and survival among injection drug users in the United States. Hepatology 42:6, 1446-1452
CrossRef556
Arun Swaminath, Deanna L. Oliver, Andrew C. McNeil, Tarek I. Hassanein. (2005) The influence of hiv coinfection on the natural history of hcv infection. Current Hepatitis Reports 4:4, 131-137
CrossRef557
Ann R. Thomas, William E. Keene, Paul R. Cieslak. (2005) Seroprevalence of hepatitis B and C in juvenile detention entrants, Oregon, 1994–1996. Journal of Adolescent Health 37:5, 410-413
CrossRef558
Jennifer E. Layden-Almer, Scott J. Cotler, Thomas J. Layden. (2005) HCV viral kinetics. Current Hepatitis Reports 4:4, 158-161
CrossRef559
Gary Rischitelli, Michael Lasarev, Linda McCauley. (2005) Career Risk of Hepatitis C Virus Infection Among U.S. Emergency Medical and Public Safety Workers. Journal of Occupational and Environmental Medicine 47:11, 1174-1181
CrossRef560
A. J. SANYAL. (2005) Review article: non-alcoholic fatty liver disease and hepatitis C - risk factors and clinical implications. Alimentary Pharmacology and Therapeutics 22:s2, 48-51
CrossRef561
Jean Delwaide, Refaat El Saouda, Christiane G??rard, Jacques Bela??che. (2005) Hepatitis C infection: eligibility for antiviral therapies. European Journal of Gastroenterology & Hepatology 17:11, 1185-1189
CrossRef562
Jamie Berkes, Scott J. Cotler. (2005) Global epidemiology of hcv infection. Current Hepatitis Reports 4:4, 125-130
CrossRef563
Jason Hunt, Joseph Hagan, James Nobles, Christian Wold, Mary Fazekas-May, Jill Gilbert, Paul L. Friedlander. (2005) Outcome Analysis of Patients with Squamous Cell Carcinoma of the Head and Neck and Hepatitis C Virus. The Laryngoscope 115:10, 1882-1886
CrossRef564
William Perry, Meghan D Carlson, Fatma Barakat, Robin C Hilsabeck, Dawn M Schiehser, Christopher Mathews, Tarek I Hassanein. (2005) Neuropsychological test performance in patients co-infected with hepatitis C virus and HIV. AIDS 19:Suppl 3, S79-S84
CrossRef565
Adeline M Nyamathi, Ashley Christiani, Folasade Windokun, Tonia Jones, Aaron Strehlow, Steve Shoptaw. (2005) Hepatitis C virus infection, substance use and mental illness among homeless youth: a review. AIDS 19:Suppl 3, S34-S40
CrossRef566
Ramsey C. Cheung, Sue Currie, Hui Shen, Samuel B. Ho, Edmund J. Bini, Bhupinderjit S. Anand, Norbert Brau, Teresa L. Wright, . (2005) Chronic Hepatitis C in Latinos: Natural History, Treatment Eligibility, Acceptance, and Outcomes. The American Journal of Gastroenterology 100:10, 2186-2193
CrossRef567
Jean L Richardson, Marek Nowicki, Kathleen Danley, Eileen M Martin, Mardge H Cohen, Raul Gonzalez, Jasmin Vassileva, Alexandra M Levine. (2005) Neuropsychological functioning in a cohort of HIV- and hepatitis C virus-infected women. AIDS 19:15, 1659-1667
CrossRef568
Mark L Willenbring. (2005) Integrating care for patients with infectious, psychiatric, and substance use disorders: concepts and approaches. AIDS 19:Suppl 3, S227-S237
CrossRef569
Mark S Sulkowski, David L Thomas. (2005) Perspectives on HIV/hepatitis C virus co-infection, illicit drug use and mental illness. AIDS 19:Suppl 3, S8-S12
CrossRef570
Vanessa V Thompson, Kathleen E Ragland, Christopher S Hall, Maureen Morgan, David R Bangsberg. (2005) Provider assessment of eligibility for hepatitis C treatment in HIV-infected homeless and marginally housed persons. AIDS 19:Suppl 3, S208-S214
CrossRef571
Kevin X. Chen, F. George Njoroge, Andrew Prongay, John Pichardo, Vincent Madison, Viyyoor Girijavallabhan. (2005) Synthesis and biological activity of macrocyclic inhibitors of hepatitis C virus (HCV) NS3 protease. Bioorganic & Medicinal Chemistry Letters 15:20, 4475-4478
CrossRef572
Cindy M Weinbaum, Keith M Sabin, Scott S Santibanez. (2005) Hepatitis B, hepatitis C, and HIV in correctional populations: a review of epidemiology and prevention. AIDS 19:Suppl 3, S41-S46
CrossRef573
Glenn J Wagner, Gery W Ryan. (2005) Hepatitis C virus treatment decision-making in the context of HIV co-infection: the role of medical, behavioral and mental health factors in assessing treatment readiness. AIDS 19:Suppl 3, S190-S198
CrossRef574
A. CHANG, K. SKOLE, M. GAUTAM, J. SCHMUTZ, M. BLACK, R. THOMAS, B. HORWITZ, F. K. FRIEDENBERG. (2005) The impact of past alcohol use on treatment response rates in patients with chronic hepatitis C. Alimentary Pharmacology and Therapeutics 22:8, 701-706
CrossRef575
Janus P Ong, Rochelle Collantes, Angela Pitts, Lisa Martin, Michael Sheridan, Zobair M Younossi. (2005) High Rates of Uninsured Among HCV-Positive Individuals. Journal of Clinical Gastroenterology 39:9, 826-830
CrossRef576
Lisa I Backus, Derek Boothroyd, Lawrence R Deyton. (2005) HIV, hepatitis C and HIV/hepatitis C virus co-infection in vulnerable populations. AIDS 19:Suppl 3, S13-S19
CrossRef577
Harlan Wright, Philip Alex, Thuan Nguyen, Teddy Bader, Ahmet Gurakar, Anthony Sebastian, Liberty Gonzales, Gemma Wallis, Mark Naylor, Igor Dozmorov, Michael Centola, Bakr Nour. (2005) Multiplex Cytokine Profiling of Initial Therapeutic Response in Patients with Chronic Hepatitis C Virus Infection. Digestive Diseases and Sciences 50:10, 1793-1803
CrossRef578
W. Lee Hand, Yvonne Vasquez. (2005) Risk Factors for Hepatitis C on the Texas-Mexico Border. The American Journal of Gastroenterology 100:10, 2180-2185
CrossRef579
Tomasz Laskus, Marek Radkowski, Debra M Adair, Jeffrey Wilkinson, Adrienne C Scheck, Jorge Rakela. (2005) Emerging evidence of hepatitis C virus neuroinvasion. AIDS 19:Suppl 3, S140-S144
CrossRef580
Joseph L Goulet, Shawn L Fultz, Kathleen A McGinnis, Amy C Justice. (2005) Relative prevalence of comorbidities and treatment contraindications in HIV-mono-infected and HIV/HCV-co-infected veterans. AIDS 19:Suppl 3, S99-S105
CrossRef581
C. M.A. Geppert. (2005) Ethical Challenges in the Care of Persons With Hepatitis C Infection: A Pilot Study to Enhance Informed Consent With Veterans. Psychosomatics 46:5, 392-401
CrossRef582
Haizhen Zhu, David R. Nelson, James M. Crawford, Chen Liu. (2005) Defective Jak-Stat Activation in Hepatoma Cells Is Associated with Hepatitis C Viral IFN-α Resistance. Journal of Interferon & Cytokine Research 25:9, 528-539
CrossRef583
Colin W Shepard, Lyn Finelli, Miriam J Alter. (2005) Global epidemiology of hepatitis C virus infection. The Lancet Infectious Diseases 5:9, 558-567
CrossRef584
S. P. Savvas, J. Koskinas, C. Sinani, A. Hadziyannis, F. Spanou, S. J. Hadziyannis. (2005) Changes in epidemiological patterns of HCV infection and their impact on liver disease over the last 20 years in Greece. Journal of Viral Hepatitis 12:5, 551-557
CrossRef585
Abdalla E. A. Hassan, Peiyuan Wang, Tamara McBrayer, Philip Tharnish, Lieven Stuyver, Michael J. Otto, Kyoichi A. Watanabe, Raymond F. Schinazi. (2005) Synthesis and Anti-Hcv Activity of N 9 , 5′-Cyclo-3-(β-D-Ribofuranosyl)-8-Azapurin-2-One Derivatives. Nucleosides, Nucleotides and Nucleic Acids 24:10-12, 1531-1542
CrossRef586
Chanelle J. Howe, Crystal M. Fuller, Danielle C. Ompad, Sandro Galea, Beryl Koblin, David Thomas, David Vlahov. (2005) Association of sex, hygiene and drug equipment sharing with hepatitis C virus infection among non-injecting drug users in New York City. Drug and Alcohol Dependence 79:3, 389-395
CrossRef587
Patricia Santiago-Munoz, Scott Roberts, Jeanne Sheffield, Barbara McElwee, George D. Wendel. (2005) Prevalence of hepatitis B and C in pregnant women who are infected with human immunodeficiency virus. American Journal of Obstetrics and Gynecology 193:3, 1270-1273
CrossRef588
James C. Barton, Ronald T. Acton, Fitzroy W. Dawkins, Paul C. Adams, Laura Lovato, Cathie Leiendecker-Foster, Christine E. McLaren, David M. Reboussin, Mark R. Speechley, Victor R. Gordeuk, Gordon D. McLaren, Phyliss Sholinsky, Emily L. Harris. (2005) Initial Screening Transferrin Saturation Values, Serum Ferritin Concentrations, and HFE Genotypes in Whites and Blacks in the Hemochromatosis and Iron Overload Screening Study. Genetic Testing 9:3, 231-241
CrossRef589
Bonnie Kolor. (2005) Patient Education and Treatment Strategies Implemented at a Pharmacist-Managed Hepatitis C Virus Clinic. Pharmacotherapy 25:9, 1230-1241
CrossRef590
Greta Szabo, Guy W. Neff. (2005) Viral hepatitis in minorities. Current Hepatitis Reports 4:3, 92-96
CrossRef591
Daryl T.-Y. Lau, Bruce A. Luxon, Shu-Yuan Xiao, Michael R. Beard, Stanley M. Lemon. (2005) Intrahepatic gene expression profiles and alpha-smooth muscle actin patterns in hepatitis C virus induced fibrosis. Hepatology 42:2, 273-281
CrossRef592
Gregory T. Everson, James Trotter, Lisa Forman, Marcelo Kugelmas, Arthur Halprin, Barbara Fey, Catherine Ray. (2005) Treatment of advanced hepatitis C with a low accelerating dosage regimen of antiviral therapy. Hepatology 42:2, 255-262
CrossRef593
A. Rauch, M. Martin, R. Weber, B. Hirschel, P. E. Tarr, H. C. Bucher, P. Vernazza, E. Bernasconi, A. S. Zinkernagel, J. Evison, H. Furrer, . (2005) Unsafe Sex and Increased Incidence of Hepatitis C Virus Infection among HIV-Infected Men Who Have Sex with Men: The Swiss HIV Cohort Study. Clinical Infectious Diseases 41:3, 395-402
CrossRef594
Harinath Sheela, Srinivas Seela, Cary Caldwell, James L Boyer, Dhanpat Jain. (2005) Liver Biopsy. Journal of Clinical Gastroenterology 39:7, 603-610
CrossRef595
W. Ray Kim, Gregory J. Gores, Joanne T. Benson, Terry M. Therneau, L. Joseph Melton. (2005) Mortality and Hospital Utilization for Hepatocellular Carcinoma in the United States. Gastroenterology 129:2, 486-493
CrossRef596
Edmund J. Bini, Norbert Brau, Sue Currie, Hui Shen, Bhupinderjit S. Anand, Ke-Qin Hu, Lennox Jeffers, Samuel B. Ho, David Johnson, Warren N. Schmidt, Paul King, Ramsey Cheung, Timothy R. Morgan, Joseph Awad, Marcos Pedrosa, Kyong-Mi Chang, Ayse Aytaman, Franz Simon, Curt Hagedorn, Richard Moseley, Jawad Ahmad, Charles Mendenhall, Bradford Waters, Doris Strader, Anna W. Sasaki, Stephen Rossi, Teresa L. Wright. (2005) Prospective Multicenter Study of Eligibility for Antiviral Therapy Among 4,084 U.S. Veterans with Chronic Hepatitis C Virus Infection. The American Journal of Gastroenterology 100:8, 1772-1779
CrossRef597
Mahmoud A. Abdallah, Mohamed Y. Ghozzi, Hoda A. Monib, Aisha M. Hafez, Kim M. Hiatt, Bruce R. Smoller, Thomas D. Horn. (2005) Necrolytic acral erythema: A cutaneous sign of hepatitis C virus infection. Journal of the American Academy of Dermatology 53:2, 247-251
CrossRef598
Thierry Bizollon, Pierre Pradat, Jean-Yves Mabrut, Michelle Chevallier, Mustapha Adham, Sylvie Radenne, Jean-Christophe Souquet, Christian Ducerf, Jacques Baulieux, Fabien Zoulim, Christian Trepo. (2005) Benefit of Sustained Virological Response to Combination Therapy on Graft Survival of Liver Transplanted Patients with Recurrent Chronic Hepatitis C. American Journal of Transplantation 5:8, 1909-1913
CrossRef599
James A. Morrill, Melissa Shrestha, Richard W. Grant. (2005) Barriers to the Treatment of Hepatitis C. Patient, Provider, and System Factors. Journal of General Internal Medicine 20:8, 754-758
CrossRef600
Flor H Pujol, Marisol Devesa. (2005) Genotypic Variability of Hepatitis Viruses Associated With Chronic Infection and the Development of Hepatocellular Carcinoma. Journal of Clinical Gastroenterology 39:7, 611-618
CrossRef601
Rena K. Fox, Sue L. Currie, Jennifer Evans, Teresa L. Wright, Leslie Tobler, Bruce Phelps, Michael P. Busch, Kimberly A. Page‐Shafer. (2005) Hepatitis C Virus Infection among Prisoners in the California State Correctional System. Clinical Infectious Diseases 41:2, 177-186
CrossRef602
B. Conway, J. Grebely, H. Tossonian, D. Lefebvre, S. Vlaming de. (2005) A Systematic Approach to the Treatment of HIV and Hepatitis C Virus Infection in the Inner City: A Canadian Perspective. Clinical Infectious Diseases 41:Supplement 1, S73-S78
CrossRef603
B. McGovern, J. Fiore, A. Wurcel, P. Taglienti, M. Bradley, S. Galvin, G. Libone, J. Ramsey, V. Molinaro-Gudas, S. Drewniak, C. Amick, A. Andalkar, H. Scheft, I. Bica. (2005) Delivering Therapy for Hepatitis C Virus Infection to Incarcerated HIV-Seropositive Patients. Clinical Infectious Diseases 41:Supplement 1, S56-S62
CrossRef604
Baoguang Wang, G.B. Schreiber, S.A. Glynn, Steven Kleinman, D.J. Wright, E.L. Murphy, M.P. Busch, . (2005) Does prevalence of transfusion-transmissible viral infection reflect corresponding incidence in United States blood donors?. Transfusion 45:7, 1089-1096
CrossRef605
E. M. Tedaldi, L. Chen, N. Markowitz, L. Kelly, D. Abrams, . (2005) Effect of IL-2 on hepatitis C virus RNA levels in patients co-infected with human immunodeficiency virus receiving HAART. Journal of Viral Hepatitis 12:4, 414-420
CrossRef606
Filippo Ansaldi, Bianca Bruzzone, Stefania Salmaso, Maria Cristina Rota, Paolo Durando, Roberto Gasparini, Giancarlo Icardi. (2005) Different seroprevalence and molecular epidemiology patterns of hepatitis C virus infection in Italy. Journal of Medical Virology 76:3, 327-332
CrossRef607
D. B. Strader. (2005) Coinfection with HIV and Hepatitis C Virus in Injection Drug Users and Minority Populations. Clinical Infectious Diseases 41:Supplement 1, S7-S13
CrossRef608
TAKASHI ISHIKAWA, YASUSHI FUKUSHIMA, YUJIRO SHIOBARA, TSUYOSHI KISHIMOTO, SAKIKO TANNO, IKUO SHOJI, TETSURO SUZUKI, TAMANO MATSUI, YASUSHI SHIMADA, TAKAAKI OHYAMA, RYOZO NAGAI, TATSUO MIYAMURA. (2005) Outbreak of hepatitis C virus infection in an outpatient clinic. Journal of Gastroenterology and Hepatology 20:7, 1087-1093
CrossRef609
Christina S. Meade, Kathleen J. Sikkema. (2005) HIV risk behavior among adults with severe mental illness: A systematic review. Clinical Psychology Review 25:4, 433-457
CrossRef610
Srikanta Dash, Ramesh Prabhu, Sidhartha Hazari, Frank Bastian, Robert Garry, Weiping Zou, Salima Haque, Virendra Joshi, Fredric G. Regenstein, Swan N. Thung. (2005) Interferons alpha, beta, gamma each inhibit hepatitis C virus replication at the level of internal ribosome entry site-mediated translation.. Liver International 25:3, 580-594
CrossRef611
Sandeep K. Rajan, Byron M. Espina, Howard A. Liebman. (2005) Hepatitis C virus-related thrombocytopenia: clinical and laboratory characteristics compared with chronic immune thrombocytopenic purpura. British Journal of Haematology 129:6, 818-824
CrossRef612
Fadia T Shaya, Winslow Klaskala, C Daniel Mullins. (2005) Review of cost–effectiveness studies of pegylated therapies for hepatitis C. Expert Review of Pharmacoeconomics & Outcomes Research 5:3, 339-351
CrossRef613
James L. Williams, Henry H Cagle, Carol J. Christensen, Leslie K. Fox-Leyva, Brian J. McMahon. (2005) Results of a hepatitis C general transfusion lookback program for patients who received blood products before July 1992. Transfusion 45:6, 1020-1026
CrossRef614
Uwe Siebert, Gaby Sroczynski, Jürgen Wasem, Wolfgang Greiner, Ulrike Ravens-Sieberer, Pamela Aidelsburger, Bärbel M. Kurth, Monika Bullinger, J.-Matthias Schulenburg, John B. Wong, Siegbert Rossol. (2005) Using competence network collaboration and decision-analytic modeling to assess the cost-effectiveness of interferon α-2b plus ribavirin as initial treatment of chronic hepatitis C in Germany. The European Journal of Health Economics 6:2, 112-123
CrossRef615
M. RAMOS-CASALS, L.-J. JARA, F. MEDINA, J. ROSAS, J. CALVO-ALEN, J. MANA, J.-M. ANAYA, J. FONT, . (2005) Systemic autoimmune diseases co-existing with chronic hepatitis C virus infection (the HISPAMEC Registry): patterns of clinical and immunological expression in 180 cases. Journal of Internal Medicine 257:6, 549-557
CrossRef616
Anastasia M. Rivkin, Sweta Chawla. (2005) Epoetin alfa for the Treatment of Combination Therapy–Induced Hemolytic Anemia in Patients Infected with Hepatitis C Virus. Pharmacotherapy 25:6, 862-875
CrossRef617
Efsevia Albanis, Scott L. Friedman. (2005) Antifibrotic targets and therapy in HCV. Current Hepatitis Reports 4:2, 61-67
CrossRef618
Maria Mastropasqua, Larissa Braga, Masayuki Kanematsu, Georgeta Vaidean, Roshan Shrestha, Polytimi Leonardou, Zeynep Firat, John T. Woosley, Richard C. Semelka. (2005) Hepatic nodules in liver transplantation candidates: MR imaging and underlying hepatic disease. Magnetic Resonance Imaging 23:4, 557-562
CrossRef619
Mark S Sulkowski. (2005) Therapy Insight: management of hepatitis C in patients coinfected with HIV. Nature Clinical Practice Gastroenterology & Hepatology 2:5, 223-231
CrossRef620
Zobair M. Younossi, Arthur C. McCullough, David S. Barnes, Anthony Post, Janus P. Ong, Robert O’shea, Lisa M. Martin, Diane Bringman, Denise Farmer, Gavin Levinthal, Kevin D. Mullen, William D. Carey, Anthony S. Tavill, Roy Ferguson, Terry Gramlich. (2005) Pegylated Interferon α-2b, Ribavirin and Amantadine for Chronic Hepatitis C. Digestive Diseases and Sciences 50:5, 970-975
CrossRef621
Maureen Cormier. (2005) The Role of Hepatitis C Support Groups. Gastroenterology Nursing 28, S4-S9
CrossRef622
Gaspare Maria Pendino, Andrea Mariano, Pasquale Surace, Carmelo Antonio Caserta, Maria Teresa Fiorillo, Angela Amante, Stefania Bruno, Carmelo Mangano, Irene Polito, Fulvia Amato, Rodolfo Cotichini, Tommaso Stroffolini, Alfonso Mele, . (2005) Prevalence and etiology of altered liver tests: A population-based survey in a Mediterranean town. Hepatology 41:5, 1151-1159
CrossRef623
Edmund J. Bini, John McGready. (2005) Prevalence of gallbladder disease among persons with hepatitis C virus infection in the United States. Hepatology 41:5, 1029-1036
CrossRef624
Shengyuan Luo, William Cassidy, Lennox Jeffers, K. Rajender Reddy, Christine Bruno, Charles D. Howell. (2005) Interferon-Stimulated Gene Expression in Black and White Hepatitis C Patients During Peginterferon Alfa-2a Combination Therapy. Clinical Gastroenterology and Hepatology 3:5, 499-506
CrossRef625
Catherine A. Fleming, Sheila Tumilty, Jessica E. Murray, David Nunes. (2005) Challenges in the Treatment of Patients Coinfected with HIV and Hepatitis C Virus: Need for Team Care. Clinical Infectious Diseases 40:s5, S349-S354
CrossRef626
Alain H. Litwin, Irene Soloway, Marc N. Gourevitch. (2005) Integrating Services for Injection Drug Users Infected with Hepatitis C Virus with Methadone Maintenance Treatment: Challenges and Opportunities. Clinical Infectious Diseases 40:s5, S339-S345
CrossRef627
Beth A. Plunkett, William A. Grobman. (2005) Routine hepatitis C virus screening in pregnancy: A cost-effectiveness analysis. American Journal of Obstetrics and Gynecology 192:4, 1153-1161
CrossRef628
Suzanne Bergman, Neil Accortt, Alan Turner, Jeffery Glaze. (2005) Hepatitis C infection is acquired pre-ESRD. American Journal of Kidney Diseases 45:4, 684-689
CrossRef629
Wenyu Lin, Won Hyeok Choe, Yoichi Hiasa, Yoshitaka Kamegaya, Jason T. Blackard, Emmett V. Schmidt, Raymond T. Chung. (2005) Hepatitis C virus expression suppresses interferon signaling by degrading STAT1. Gastroenterology 128:4, 1034-1041
CrossRef630
Robert G. Gish, Nezam H. Afdhal, Douglas T. Dieterich, K. Rajender Reddy. (2005) Management of hepatitis C virus in special populations: Patient and treatment considerations. Clinical Gastroenterology and Hepatology 3:4, 311-318
CrossRef631
Benigno Rodriguez, David A. Bobak. (2005) Management of hepatitis C in HIV-infected patients. Current Infectious Disease Reports 7:2, 91-102
CrossRef632
RAKESH KUMAR, SUDHEER KUMAR, BARJESH CHANDER SHARMA, JAGDEEP SINGH, SHIV K SARIN. (2005) Antiviral therapy in advanced chronic liver disease due to hepatitis C virus infection: Pilot study. Journal of Gastroenterology and Hepatology 20:4, 527-535
CrossRef633
Michael P. Busch, Kimberly A. Page Shafer. (2005) Editorial Commentary: Acute‐Phase Hepatitis C Virus Infection: Implications for Research, Diagnosis, and Treatment. Clinical Infectious Diseases 40:7, 959-961
CrossRef634
Peiyuan Wang, Laurent Hollecker, Krzysztof W. Pankiewicz, Steven E. Patterson, Tony Whitaker, Tamara R. McBrayer, Phillip M. Tharnish, Lieven J. Stuyver, Raymond F. Schinazi, Michael J. Otto, Kyoichi A. Watanabe. (2005) SYNTHESIS OF N 3 ,5′-CYCLO-4-(β-D-RIBOFURANOSYL)- VIC -TRIAZOLO[4,5- b ]PYRIDIN-5-ONE AND ITS 3′-DEOXYSUGAR ANALOGUE AS POTENTIAL ANTI-HEPATITIS C VIRUS AGENTS. Nucleosides, Nucleotides and Nucleic Acids 24:5-7, 957-960
CrossRef635
Andrea L. Cox, Dale M. Netski, Timothy Mosbruger, Susan G. Sherman, Steffanie Strathdee, Danielle Ompad, David Vlahov, David Chien, Venkatakrishna Shyamala, Stuart C. Ray, David L. Thomas. (2005) Prospective Evaluation of Community‐Acquired Acute‐Phase Hepatitis C Virus Infection. Clinical Infectious Diseases 40:7, 951-958
CrossRef636
Byoung-Kwon Chun, Peiyuan Wang, Abdalla Hassan, Jinfa Du, Phillip M. Tharnish, Lieven J. Stuyver, Michael J. Otto, Raymond F. Schinazi, Kyoichi A. Watanabe. (2005) Synthesis of 5′,9-anhydro-3-(β-d-ribofuranosyl)xanthine, and 3,5′-anhydro-xanthosine as potential anti-hepatitis C virus agents. Tetrahedron Letters 46:16, 2825-2827
CrossRef637
Abdalla E. A. Hassan, Peiyuan Wang, Tamara R. McBrayer, Phillip M. Tharnish, Lieven J. Stuyver, Raymond F. Schinazi, Michael J. Otto, Kyoichi A. Watanabe. (2005) SYNTHESIS AND ANTI-HEPATITIS C VIRUS ACTIVITY OF NUCLEOSIDE DERIVATIVES OF N 3 ,5′-ANHYDRO-4-(β-D-RIBOFURANOSYL)-8-AZAPURIN-2-ONES. Nucleosides, Nucleotides and Nucleic Acids 24:5-7, 961-964
CrossRef638
Adeel A Butt. (2005) Hepatitis C virus infection: the new global epidemic. Expert Review of Anti-infective Therapy 3:2, 241-249
CrossRef639
Clark C. Kulig, Thomas P. Beresford. (2005) Hepatitis C in Alcohol Dependence. Journal of Addictive Diseases 24:2, 77-89
CrossRef640
Michael K. Chapko, Kevin L. Sloan, John W. Davison, D. Robert Dufour, Daniel D. Bankson, Michael Rigsby, Jason A. Dominitz, . (2005) Cost Effectiveness of Testing Strategies for Chronic Hepatitis C. The American Journal of Gastroenterology 100:3, 607-615
CrossRef641
Samuel Daniel. (2005) Chronic Hepatitis C Treatment Patterns in African American Patients: An Update. The American Journal of Gastroenterology 100:3, 716-722
CrossRef642
John K. Pratt, Pamela Donner, Keith F. McDaniel, Clarence J. Maring, Warren M. Kati, Hongmei Mo, Tim Middleton, Yaya Liu, Teresa Ng, Qinghua Xie, Rong Zhang, Debra Montgomery, Akhteruzzaman Molla, Dale J. Kempf, William Kohlbrenner. (2005) Inhibitors of HCV NS5B polymerase: synthesis and structure–activity relationships of N-1-heteroalkyl-4-hydroxyquinolon-3-yl-benzothiadiazines. Bioorganic & Medicinal Chemistry Letters 15:6, 1577-1582
CrossRef643
Joseph A. Knight. (2005) Liver Function Tests. Journal of Infusion Nursing 28:2, 108-117
CrossRef644
George N. Ioannou, Noel S. Weiss, Edward J. Boyko, Steven E. Kahn, Sum P. Lee. (2005) Contribution of metabolic factors to alanine aminotransferase activity in persons with other causes of liver disease. Gastroenterology 128:3, 627-635
CrossRef645
Jess F. Armor, Javid Fazili, Nagib Toubia, William Kern, Rammurti Kamble, Mohamed A. Kharfan-Dabaja. (2005) Remission of natural-killer cell lymphoma of the liver with anti-hepatitis C therapy. American Journal of Hematology 78:3, 212-215
CrossRef646
J. P. Gisbert, L. Garcia-Buey, J. M. Pajares, R. Moreno-Otero. (2005) Systematic review: regression of lymphoproliferative disorders after treatment for hepatitis C infection. Alimentary Pharmacology and Therapeutics 21:6, 653-662
CrossRef647
Paul H. Hayashi, Adrian M. Di Bisceglie. (2005) The progression of hepatitis B– and C–infections to chronic liver disease and hepatocellular carcinoma: epidemiology and pathogenesis. Medical Clinics of North America 89:2, 371-389
CrossRef648
Muhammad Aslam, Junaid Aslam, Braxton D Mitchell, Kashif M Munir. (2005) Association Between Smallpox Vaccination and Hepatitis C Antibody Positive Serology in Pakistani Volunteers. Journal of Clinical Gastroenterology 39:3, 243-246
CrossRef649
Yasser H. Shaib, Hashem B. El-Serag, Jessica A. Davila, Robert Morgan, Katherine A. McGlynn. (2005) Risk factors of intrahepatic cholangiocarcinoma in the United States: A case-control study. Gastroenterology 128:3, 620-626
CrossRef650
L. M. Mofenson, J. Oleske, L. Serchuck, R. Van Dyke, C. Wilfert. (2005) Treating Opportunistic Infections among HIV-Exposed and Infected Children: Recommendations from CDC, the National Institutes of Health, and the Infectious Diseases Society of America. Clinical Infectious Diseases 40:Supplement 1, S1-S84
CrossRef651
Richard K. Sterling, Robert S. Brown, Charlotte M. Hofmann, Velimir A. Luketic, R. Todd Stravitz, Arun J. Sanyal, Melissa J. Contos, A. Scott Mills, Vernon Smith, Mitchell L. Shiffman. (2005) The Spectrum of Chronic Hepatitis C Virus Infection in the Virginia Correctional System: Development of a Strategy for the Evaluation and Treatment of Inmates with HCV. The American Journal of Gastroenterology 100:2, 313-321
CrossRef652
Shiela M. Strauss, Janetta M. Astone, Don C. Des Jarlais, Holly Hagan. (2005) Integrating Hepatitis C Services into Existing HIV Services: The Experiences of a Sample of U.S. Drug Treatment Units. AIDS Patient Care and STDs 19:2, 78-88
CrossRef653
Thierry Bizollon, Mustapha Adham, Pierre Pradat, Michelle Chevallier, Christian Ducerf, Jacques Baulieux, Fabian Zoulim, Christian Trepo. (2005) Triple Antiviral Therapy with Amantadine for IFN-Ribavirin Nonresponders with Recurrent Posttransplantation Hepatitis C. Transplantation 79:3, 325-329
CrossRef654
S. Tavakoli-Tabasi, P. Rowan, M. Abdul-Latif, M. E. Kunik, H. B. El-Serag. (2005) Utility of a depression score to predict candidacy for hepatitis C virus therapy in veterans: a prospective longitudinal study. Alimentary Pharmacology and Therapeutics 21:3, 235-242
CrossRef655
Yili Ding, Jean-Luc Girardet, Zhi Hong, Vicky C.H. Lai, Haoyun An, Yung-hyo Koh, Stephanie Z. Shaw, Weidong Zhong. (2005) Synthesis of 9-(2-β-C-methyl-β-d-ribofuranosyl)-6-substituted purine derivatives as inhibitors of HCV RNA replication. Bioorganic & Medicinal Chemistry Letters 15:3, 709-713
CrossRef656
B. J. Thomson, R. G. Finch. (2005) Hepatitis C virus infection. Clinical Microbiology and Infection 11:2, 86-94
CrossRef657
A. A. Butt, M. Wagener, A. O. Shakil, J. Ahmad. (2005) Reasons for non-treatment of hepatitis C in veterans in care. Journal of Viral Hepatitis 12:1, 81-85
CrossRef658
K JEROME. (2005) The road to new antiviral therapies. Clinical and Applied Immunology Reviews 5:1, 65-76
CrossRef659
Marek Radkowski, Juan F. Gallegos-Orozco, Joanna Jablonska, Thomas V. Colby, Bozena Walewska-Zielecka, Joanna Kubicka, Jeffrey Wilkinson, Debra Adair, Jorge Rakela, Tomasz Laskus. (2005) Persistence of hepatitis C virus in patients successfully treated for chronic hepatitis C. Hepatology 41:1, 106-114
CrossRef660
Shiela M. Strauss, Janetta M. Astone, Corrine Munoz-Plaza, Holly Hagan, Don Des Jarlais. (2005) Residential Substance User Treatment Programs as Venues for HCV Pharmacological Treatment: Client and Staff Perspectives. Substance Use & Misuse 40:12, 1811-1829
CrossRef661
R. Moreno-Otero. (2005) Therapeutic modalities in hepatitis C: challenges and development. Journal of Viral Hepatitis 12:1, 10-19
CrossRef662
Uwe Siebert, Gaby Sroczynski, . (2005) Effectiveness and cost-effectiveness of initial combination therapy with interferon/peginterferon plus ribavirin in patients with chronic hepatitis C in Germany: A health technology assessment commissioned by the German Federal Ministry of Health and Social Security. International Journal of Technology Assessment in Health Care 21:01,
CrossRef663
Curtis D. Holt, Drew J. Winston. 2005. Infections After Liver Transplantation. , 963-994.
CrossRef664
James F. Calvert, Paula C. Goldenberg, Cathy Schock. (2005) Chronic Hepatitis C Infection in a Rural Medicaid HMO. The Journal of Rural Health 21:1, 74-78
CrossRef665
Xavier Forns, Eva Mart
CrossRef666
Matthias Schroeter, Bernhard Zoellner, Susanne Polywka, Rainer Laufs, Heinz-Hubert Feucht. (2005) Prolonged Time until Seroconversion among Hemodialysis Patients: The Need for HCV PCR. Intervirology 48:4, 213-215
CrossRef667
R Todd Fredrick, Tarek I Hassanein. (2005) Role of Growth Factors in the Treatment of Patients With HIV/HCV Coinfection and Patients With Recurrent Hepatitis C Following Liver Transplantation. Journal of Clinical Gastroenterology 39:Supp 1, S14-S22
CrossRef668
Winifred L. Boal, Thomas Hales, Clara Sue Ross. (2005) Blood-Borne Pathogens among Firefighters andEmergency Medical Technicians. Prehospital Emergency Care 9:2, 236-247
CrossRef669
M. Mazen Jamal, Zainab Saadi, Timothy R. Morgan. (2005) Alcohol and Hepatitis C. Digestive Diseases 23:3-4, 285-296
CrossRef670
Girish Subba Rao, Jean Pappas Molleston. (2005) Children with hepatitis C. Current Gastroenterology Reports 7:1, 37-44
CrossRef671
Keizo Yoshida, Oyetunde Alagbe, Xiaohong Wang, Bobbi Woolwine, Marie Thornbury, Charles L. Raison, Andrew H. Miller. (2005) Promoter Polymorphisms of the Interferon-α Receptor Gene and Development of Interferon-Induced Depressive Symptoms in Patients with Chronic Hepatitis C: Preliminary Findings. Neuropsychobiology 52:2, 55-61
CrossRef672
Markus Backmund, Kirsten Meyer, Claudia Henkel, Jens Reimer, Martin Wächtler, Christian G. Schütz. (2005) Risk Factors and Predictors of Human Immunodeficiency Virus Infection among Injection Drug Users. European Addiction Research 11:3, 138-144
CrossRef673
Albert Y. Lin, Nathalie Brophy, George A. Fisher, Sam So, Christopher Biggs, Torunn I. Yock, Lee Levitt. (2005) Phase II study of thalidomide in patients with unresectable hepatocellular carcinoma. Cancer 103:1, 119-125
CrossRef674
Jordan J. Feld, T. Jake Liang. (2005) HCV persistence: Cure is still a four letter word. Hepatology 41:1, 23-25
CrossRef675
Curtis L Cooper. (2005) Therapies for HIV and viral hepatitis coinfection. Expert Review of Anti-infective Therapy 3:1, 81-89
CrossRef676
C. Renou, P. Halfon. (2005) High-Risk Behavior and Sexual Transmission of Hepatitis C. The American Journal of Gastroenterology 100:1, 246-247
CrossRef677
A. Restrepo, T. C. Johnson, D. Widjaja, L. Yarmus, K. Meyer, D. J. Clain, H. C. Bodenheimer, A. D. Min. (2005) The rate of treatment of chronic hepatitis C in patients co-infected with HIV in an urban medical centre. Journal of Viral Hepatitis 12:1, 86-90
CrossRef678
Jason A. Dominitz, Edward J. Boyko, Thomas D. Koepsell, Patrick J. Heagerty, Charles Maynard, Jennifer L. Sporleder, . (2005) Elevated prevalence of hepatitis C infection in users of United States veterans medical centers. Hepatology 41:1, 88-96
CrossRef679
Fabio Lugoboni, GianLuca Quaglio, Benedetta Pajusco, Paolo Civitelli, Luisa Romanò, Carlo Bossi, Irene Spilimbergo, Paolo Mezzelani. (2004) Immunogenicity, reactogenicity and adherence to a combined hepatitis A and B vaccine in illicit drug users. Addiction 99:12, 1560-1564
CrossRef680
M E COCCIA, F CAMMILLI, L GINOCCHIONI, F RIZZELLO. (2004) Role of Infection in In Vitro Fertilization Treatment. Annals of the New York Academy of Sciences 1034:1, 219-235
CrossRef681
Jeffrey D. Browning, Lidia S. Szczepaniak, Robert Dobbins, Pamela Nuremberg, Jay D. Horton, Jonathan C. Cohen, Scott M. Grundy, Helen H. Hobbs. (2004) Prevalence of hepatic steatosis in an urban population in the United States: Impact of ethnicity. Hepatology 40:6, 1387-1395
CrossRef682
Yih-Ing Hser, Lillian Gelberg, Valerie Hoffman, Christine E. Grella, William McCarthy, M. Douglas Anglin. (2004) Health Conditions Among Aging Narcotics Addicts: Medical Examination Results. Journal of Behavioral Medicine 27:6, 607-622
CrossRef683
James Nobles, Christian Wold, Mary Fazekas-May, Jill Gilbert, Paul L. Friedlander. (2004) Prevalence and Epidemiology of Hepatitis C Virus in Patients with Squamous Cell Carcinoma of the Head and Neck. The Laryngoscope 114:12, 2119-2122
CrossRef684
Eric J. Lawitz, Matthew J. Hepburn, Thomas J. Casey. (2004) A Pilot Study of Interleukin-11 in Subjects with Chronic Hepatitis C and Advanced Liver Disease Nonresponsive to Antiviral Therapy. The American Journal of Gastroenterology 99:12, 2359-2364
CrossRef685
Gary M. Feldman, Frank Sorvillo, Barbara Cole, William A. Lawrence, Rebecca Mares. (2004) Seroprevalence of hepatitis C among a juvenile detention population. Journal of Adolescent Health 35:6, 505-508
CrossRef686
Victoria H. Coleman, Michael L. Power, Stanley Zinberg, Jay Schulkin. (2004) Contemporary Clinical Issues in Outpatient Obstetrics and Gynecology: Findings of the Collaborative Ambulatory Research Network, 2001–2004: Part I. Obstetrical & Gynecological Survey 59:11, 780-786
CrossRef687
YASUHIRO SATOH, KEISUKE HINO, TAKANOBU KATO, MASASHI MIZOKAMI, SATOYOSHI YAMASHITA, HIROKI NAKAMURA, KIWAMU OKITA. (2004) Molecular epidemiologic analysis of hepatitis C virus infection in injecting drug users with acute hepatitis C in Japan. Journal of Gastroenterology and Hepatology 19:11, 1305-1311
CrossRef688
Emanuele Durante-Mangoni, Patrizia Iardino, Marianna Resse, Giuseppe Cesaro, Antonello Sica, Bartolomeo Farzati, Giuseppe Ruggiero, Luigi E. Adinolfi. (2004) Silent Celiac Disease in Chronic Hepatitis C. Journal of Clinical Gastroenterology 38:10, 901-905
CrossRef689
Holger Hinrichsen, Yves Benhamou, Heiner Wedemeyer, Markus Reiser, Roel E. Sentjens, José L. Calleja, Xavier Forns, Andreas Erhardt, Jens Crönlein, Ricardo L. Chaves, Chan-Loi Yong, Gerhard Nehmiz, Gerhard G. Steinmann. (2004) Short-term antiviral efficacy of BILN 2061, a hepatitis C virus serine protease inhibitor, in hepatitis C genotype 1 patients. Gastroenterology 127:5, 1347-1355
CrossRef690
S. Akhtar, M. Younus, S. Adil, S. H. Jafri, F. Hassan. (2004) Hepatitis C virus infection in asymptomatic male volunteer blood donors in Karachi, Pakistan. Journal of Viral Hepatitis 11:6, 527-535
CrossRef691
Doris B. Strader. (2004) Hepatitis C virus among african-american persons. Current Hepatitis Reports 3:4, 129-135
CrossRef692
Giovanna Fattovich, Tommaso Stroffolini, Irene Zagni, Francesco Donato. (2004) Hepatocellular carcinoma in cirrhosis: Incidence and risk factors. Gastroenterology 127:5, S35-S50
CrossRef693
Jiaren Sun, Kui Li, Mohamed Tarek Shata, Teh-sheng Chan. (2004) The immunologic basis for hepatitis C infection. Current Opinion in Gastroenterology 20:6, 598-602
CrossRef694
S. Saab, D. Cho, D. V. K. Quon, A. B. Ibrahim, P. Dong, V. Marder, L. Logan. (2004) Same day outpatient transjugular liver biopsies in haemophilia. Haemophilia 10:6, 727-731
CrossRef695
Charlene S. Dezzutti, Jacquie Astemborski, David L. Thomas, James H. Marshall, Thania Cabrera, Michael Purdy, David Vlahov, Richard S. Garfein. (2004) Prevalence of cryoglobulinemia in hepatitis C virus (HCV) positive patients with and without human immunodeficiency virus (HIV) coinfection. Journal of Clinical Virology 31:3, 210-214
CrossRef696
James E. Nelson, Kris V. Kowdley. (2004) Iron and hepatitis C. Current Hepatitis Reports 3:4, 140-147
CrossRef697
Geraldine M. McQuillan, Deanna Kruszon-Moran, Benny J. Kottiri, Lester R. Curtin, Jacqueline W. Lucas, Raynard S. Kington. (2004) Racial and Ethnic Differences in the Seroprevalence of 6 Infectious Diseases in the United States: Data From NHANES III, 1988–1994. American Journal of Public Health 94:11, 1952-1958
CrossRef698
Dawn A Fishbein, Yungtai Lo, John F Reinus, Marc N Gourevitch, Robert S Klein. (2004) Factors Associated With Successful Referral For Clinical Care of Drug Users With Chronic Hepatitis C Who Have or Are At Risk For HIV Infection. JAIDS Journal of Acquired Immune Deficiency Syndromes 37:3, 1367-1375
CrossRef699
Jian-Qiu Han, Greggory Wroblewski, Zan Xu, Robert H. Silverman, David J. Barton. (2004) Sensitivity of Hepatitis C Virus RNA to the Antiviral Enzyme Ribonuclease L Is Determined by a Subset of Efficient Cleavage Sites. Journal of Interferon & Cytokine Research 24:11, 664-676
CrossRef700
Frank A. Parke, John D. Reveille. (2004) Anti-tumor necrosis factor agents for rheumatoid arthritis in the setting of chronic hepatitis C infection. Arthritis & Rheumatism 51:5, 800-804
CrossRef701
Naglaa H. Shoukry, Andrew G. Cawthon, Christopher M. Walker. (2004) CELL-MEDIATED IMMUNITY AND THE OUTCOME OF HEPATITIS C VIRUS INFECTION. Annual Review of Microbiology 58:1, 391-424
CrossRef702
Barbara A. Piasecki, James D. Lewis, K. Rajender Reddy, Scarlett L. Bellamy, Steven B. Porter, Robert M. Weinrieb, Donald D. Stieritz, Kyong-Mi Chang. (2004) Influence of alcohol use, race, and viral coinfections on spontaneous HCV clearance in a US veteran population. Hepatology 40:4, 892-899
CrossRef703
Emil Chuang, Alfred Del Vecchio, Steve Smolinski, Xiao-Yu Song, Robert T. Sarisky. (2004) Biomedicines to reduce inflammation but not viral load in chronic HCV – what's the sense?. Trends in Biotechnology 22:10, 517-523
CrossRef704
Aymin Delgado-Borrego, Maureen M. Jonas. (2004) Treatment options for hepatitis C infection in children. Current Treatment Options in Gastroenterology 7:5, 373-379
CrossRef705
J. J. Goedert, D. L. Brown, K. Hoots, K. E. Sherman. (2004) Human immunodeficiency and hepatitis virus infections and their associated conditions and treatments among people with haemophilia. Haemophilia 10:s4, 205-210
CrossRef706
Lorna M. Dove. (2004) A general approach to the management of chronic hepatitis C. Gastroenterology Clinics of North America 33:3, 463-477
CrossRef707
Sangik Oh, Nezam H. Afdhal. (2004) Antiviral therapy for treatment naı̈ve patients with hepatitis C virus. Gastroenterology Clinics of North America 33:3, 497-511
CrossRef708
Lawrence Ouellet, Dezheng Huo, Susan L Bailey. (2004) HIV Risk Practices Among Needle Exchange Users and Nonusers in Chicago. JAIDS Journal of Acquired Immune Deficiency Syndromes 37:1, 1187-1196
CrossRef709
Amrit K. Grewal, M. Beatriz Lopes, Carl L. Berg, Audrey K. Bennett, Venâncio A.F. Alves, Joel M. Trugman. (2004) Recurrent demyelinating myelitis associated with hepatitis C viral infection. Journal of the Neurological Sciences 224:1-2, 101-106
CrossRef710
Tomasz Laskus, Jeffrey Wilkinson, Juan F. Gallegos-Orozco, Marek Radkowski, Debra M. Adair, Marek Nowicki, Eva Operskalski, Zelma Buskell, Leonard B. Seeff, Hugo Vargas, Jorge Rakela. (2004) Analysis of hepatitis C virus quasispecies transmission and evolution in patients infected through blood transfusion. Gastroenterology 127:3, 764-776
CrossRef711
SIDHARTHA HAZARI, SUBRAT KUMAR PANDA, SIDDHARTH DATTA GUPTA, YOGESH BATRA, RAJBIR SINGH, SUBRAT KUMAR ACHARYA. (2004) Treatment of hepatitis C virus infection in patients of northern India. Journal of Gastroenterology and Hepatology 19:9, 1058-1065
CrossRef712
G. Campisi, S. Fedele, L. Lo Russo, O. Di Fede, P. Arico, A. Craxi, M. D. Mignogna. (2004) HCV infection and oral lichen planus: a weak association when HCV is endemic. Journal of Viral Hepatitis 11:5, 465-470
CrossRef713
Juan I. Arenas, Hugo E. Vargas. (2004) Hepatitis C virus antiviral therapy in patients with cirrhosis. Gastroenterology Clinics of North America 33:3, 549-562
CrossRef714
D. Theodore, M. W. Fried, D. E. Kleiner, B. L. Kroner, J. J. Goedert, M. E. Eyster, S. P. Faust, K. E. Sherman, C. M. Kessler, C. Francis, L. M. Aledort. (2004) Liver biopsy in patients with inherited disorders of coagulation and chronic hepatitis C. Haemophilia 10:5, 413-421
CrossRef715
Angelo G. Coppola, Pietor C. Karakousis, David C. Metz, Mae F. Go, M Mhokashi, Colin W. Howden, Jean-Pierre Raufman, Virender K. Sharma. (2004) Hepatitis C Knowledge among Primary Care Residents: Is Our Teaching Adequate for the Times?. The American Journal of Gastroenterology 99:9, 1720-1725
CrossRef716
Zou, Shimian, Dodd, Roger Y., Stramer, Susan L., Strong, D. Michael, . (2004) Probability of Viremia with HBV, HCV, HIV, and HTLV among Tissue Donors in the United States. New England Journal of Medicine 351:8, 751-759
Full Text717
Eric A. Engels, Nilanjan Chatterjee, James R. Cerhan, Scott Davis, Wendy Cozen, Richard K. Severson, Denise Whitby, Joanne S. Colt, Patricia Hartge. (2004) Hepatitis C virus infection and non-hodgkin lymphoma: Results of the NCI-seer multi-center case-control study. International Journal of Cancer 111:1, 76-80
CrossRef718
Eva Negri, D'Anna Little, Mauro Boiocchi, Carlo La Vecchia, Silvia Franceschi. (2004) B-cell non-Hodgkin's lymphoma and hepatitis C virus infection: A systematic review. International Journal of Cancer 111:1, 1-8
CrossRef719
Nicolas Jabbour, Singh Gagandeep, Rodrigo Mateo, Linda Sher, Earl Strum, John Donovan, Jeffrey Kahn, Christian G. Peyre, Randy Henderson, Tse-Ling Fong, Rick Selby, Yuri Genyk. (2004) Live Donor Liver Transplantation Without Blood Products. Annals of Surgery 240:2, 350-357
CrossRef720
Bruno Galperim, Hugo Cheinquer, Airton Stein, André Fonseca, Vagner Lunge, Nilo Ikuta. (2004) Intranasal cocaine use does not appear to be an independent risk factor for HCV infection. Addiction 99:8, 973-977
CrossRef721
Eric J Gowans, Kathryn L Jones, Mandvi Bharadwaj, David C Jackson. (2004) Prospects for dendritic cell vaccination in persistent infection with hepatitis C virus. Journal of Clinical Virology 30:4, 283-290
CrossRef722
Dana L. Bruden, Brian J. McMahon, Thomas W. Hennessy, Carol J. Christensen, Chriss E. Homan, James L. Williams, Daniel G. Sullivan, David R. Gretch, Henry H. Cagle, Lisa R. Bulkow. (2004) Estimating the Date of Hepatitis C Virus Infection from Patient Interviews and Antibody Tests on Stored Sera. The American Journal of Gastroenterology 99:8, 1517-1522
CrossRef723
Thomas Schussler, Catherine Staffeld-Coit, James Eason, Satheesh Nair. (2004) Severe Hepatitis C Infection in a Renal Transplant Recipient Following Hepatitis C Genotype Mismatch Transplant. American Journal of Transplantation 4:8, 1375-1378
CrossRef724
M.Lamine Mbow, Robert T. Sarisky. (2004) What is disrupting IFN-α's antiviral activity?. Trends in Biotechnology 22:8, 395-399
CrossRef725
Michael Gossop, Duncan Stewart, John Marsden, Tara Kidd, John Strang. (2004) Changes in route of drug administration among continuing heroin users: Outcomes 1 year after intake to treatment. Addictive Behaviors 29:6, 1085-1094
CrossRef726
Uzma Siddiqui, Elizabeth H Weinshel, Edmund J Bini. (2004) Prevalence and Predictors of Herbal Medication Use in Veterans with Chronic Hepatitis C. Journal of Clinical Gastroenterology 38:7, 605-610
CrossRef727
Arthur Y. Kim, Raymond T. Chung. (2004) HIV and hepatitis C virus coinfection update. Current Hepatitis Reports 3:3, 83-90
CrossRef728
S. D. Sullivan, D. M. Jensen, D. E. Bernstein, T. I. Hassanein, G. R. Foster, S. S. Lee, H. Cheinquer, A. Craxi, Graham Cooksley, W. Klaskala, K. Pettit, K. K. Patel, J. Green. (2004) Cost-Effectiveness of Combination Peginterferon alpha-2a and Ribavirin Compared With Interferon alpha-2b and Ribavirin in Patients With Chronic Hepatitis C. The American Journal of Gastroenterology 99:8, 1490-1496
CrossRef729
Ariamala Gopalsamy, Kitae Lim, John W Ellingboe, Girija Krishnamurthy, Mark Orlowski, Boris Feld, Marja van Zeijl, Anita Y.M Howe. (2004) Identification of [(naphthalene-1-carbonyl)-amino]-acetic acid derivatives as nonnucleoside inhibitors of HCV NS5B RNA dependent RNA polymerase. Bioorganic & Medicinal Chemistry Letters 14:16, 4221-4224
CrossRef730
Rajesh N. Keswani, Aijaz Ahmed, Emmet B. Keeffe. (2004) Older age and liver transplantation: A review. Liver Transplantation 10:8, 957-967
CrossRef731
Frederick L. Altice, R. Douglas Bruce. (2004) Hepatitis C virus infection in United States correctional institutions. Current Hepatitis Reports 3:3, 112-118
CrossRef732
J. Harder, E. Walter, B. Riecken, C. Ihling, T. M. Bauer. (2004) Hepatitis C virus infection in intravenous drug users. Clinical Microbiology and Infection 10:8, 768-770
CrossRef733
Adeel A. Butt, Shawn L. Fultz, C. Kent Kwoh, David Kelley, Melissa Skanderson, Amy C. Justice. (2004) Risk of diabetes in HIV infected veterans pre- and post-HAART and the role of HCV coinfection. Hepatology 40:1, 115-119
CrossRef734
J Ghosn, S Pierre-Francois, V Thibault, C Duvivier, R Tubiana, A Simon, MA Valantin, S Dominguez, E Caumes, C Katlama. (2004) Acute hepatitis C in HIV-infected men who have sex with men. HIV Medicine 5:4, 303-306
CrossRef735
V. Sypsa, G. Touloumi, N. C. Tassopoulos, I. Ketikoglou, I. Vafiadis, G. Hatzis, D. Tsantoulas, E. Akriviadis, J. Delladetsima, M. Demonakou, A. Hatzakis. (2004) Reconstructing and predicting the hepatitis C virus epidemic in Greece: increasing trends of cirrhosis and hepatocellular carcinoma despite the decline in incidence of HCV infection. Journal of Viral Hepatitis 11:4, 366-374
CrossRef736
Paul J Rowan, Shahriar Tabasi, Mariam Abdul-latif, Mark E Kunik, Hashem B El-Serag. (2004) Psychosocial Factors Are the Most Common Contraindications for Antiviral Therapy at Initial Evaluation in Veterans With Chronic Hepatitis C. Journal of Clinical Gastroenterology 38:6, 530-534
CrossRef737
Andrea E. Reid, Maria Resnick, YuChiao Chang, Nathan Buerstatte, Joel S. Weissman. (2004) Disparity in use of orthotopic liver transplantation among blacks and whites. Liver Transplantation 10:7, 834-841
CrossRef738
R. Dawn Comstock, Sue Mallonee, Jan L. Fox, Ronald L. Moolenaar, Tara M. Vogt, Joseph F. Perz, Beth P. Bell, James M. Crutcher. (2004) A Large Nosocomial Outbreak of Hepatitis C and Hepatitis B Among Patients Receiving Pain Remediation Treatments • . Infection Control and Hospital Epidemiology 25:7, 576-583
CrossRef739
Renato Talamini, Maurizio Montella, Marina Crovatto, Luigino Dal Maso, Anna Crispo, Eva Negri, Michele Spina, Antonio Pinto, Antonino Carbone, Silvia Franceschi. (2004) Non-Hodgkin's lymphoma and hepatitis C virus: A case-control study from northern and southern Italy. International Journal of Cancer 110:3, 380-385
CrossRef740
Kester Crosse, Onuora G. Umeadi, Frank A. Anania, Jacqueline Laurin, John Papadimitriou, Cinthia Drachenberg, Charles D. Howell. (2004) Racial differences in liver inflammation and fibrosis related to chronic hepatitis C. Clinical Gastroenterology and Hepatology 2:6, 463-468
CrossRef741
Anne F. Celona, Mimi C. Yu, Manish Prakash, Timothy Kuo, Maurizio Bonacini. (2004) Hepatitis C in a Los Ageles public hepatitis clinic: demographic and biochemical differences associated with race-ethnicity. Clinical Gastroenterology and Hepatology 2:6, 459-462
CrossRef742
P. Wilfredo Canchis, Stevan A. Gonzalez, M. Isabel Fiel, Luis Chiriboga, Herman Yee, Brian R. Edlin, Ira M. Jacobson, Andrew H. Talal. (2004) Hepatocyte proliferation in chronic hepatitis C: correlation with degree of liver disease and serum alpha-fetoprotein. Liver International 24:3, 198-203
CrossRef743
L. A. M. Bashawri, N. A. Fawaz, M. S. Ahmad, A. A. Qadi, W. Y. Almawi. (2004) Prevalence of seromarkers of HBV and HCV among blood donors in eastern Saudi Arabia, 1998-2001. Clinical and Laboratory Haematology 26:3, 225-228
CrossRef744
Saverio Stranges, Jo L. Freudenheim, Paola Muti, Eduardo Farinaro, Marcia Russell, Thomas H. Nochajski, Maurizio Trevisan. (2004) Differential Effects of Alcohol Drinking Pattern on Liver Enzymes in Men and Women. Alcoholism: Clinical and Experimental Research 28:6, 949-956
CrossRef745
Lennox J. Jeffers, William Cassidy, Charles D. Howell, Sylvia Hu, K. Rajender Reddy. (2004) Peginterferon alfa-2a (40 kd) and ribavirin for black American patients with chronic HCV genotype 1. Hepatology 39:6, 1702-1708
CrossRef746
Richard K. Sterling, R.Todd Stravitz, Velimir A. Luketic, Arun J. Sanyal, Melissa J. Contos, A.Scott Mills, Mitchell L. Shiffman. (2004) A comparison of the spectrum of chronic hepatitis C virus between Caucasians and African Americans. Clinical Gastroenterology and Hepatology 2:6, 469-473
CrossRef747
Muir, Andrew J., Bornstein, Jeffrey D., Killenberg, Paul G., . (2004) Peginterferon Alfa-2b and Ribavirin for the Treatment of Chronic Hepatitis C in Blacks and Non-Hispanic Whites. New England Journal of Medicine 350:22, 2265-2271
Full Text748
N. Brau. (2004) Epoetin alfa treatment for acute anaemia during interferon plus ribavirin combination therapy for chronic hepatitis C. Journal of Viral Hepatitis 11:3, 191-197
CrossRef749
Richard K. Sterling, Charlotte M. Hofmann, Velimir A. Luketic, Arun J. Sanyal, Melissa J. Contos, A. Scott Mills, Mitchell L. Shiffman. (2004) Treatment of Chronic Hepatitis C Virus in the Virginia Department of Corrections: Can Compliance Overcome Racial Differences to Response?. The American Journal of Gastroenterology 99:5, 866-872
CrossRef750
George N. Ioannou, Jason A. Dominitz, Noel S. Weiss, Patrick J. Heagerty, Kris V. Kowdley. (2004) The effect of alcohol consumption on the prevalence of iron overload, iron deficiency, and iron deficiency anemia. Gastroenterology 126:5, 1293-1301
CrossRef751
Ke-Qin Hu, Namgyal L. Kyulo, Nelson Lim, Brijie Elhazin, Donald J. Hillebrand, Tracy Bock. (2004) Clinical Significance of Elevated Alpha-Fetoprotein (AFP) in Patients with Chronic Hepatitis C, but not Hepatocellular Carcinoma. The American Journal of Gastroenterology 99:5, 860-865
CrossRef752
Edward P. Armstrong, Scott L. Charland. (2004) Burden of illness of hepatitis C from a managed care organization perspective. Current Medical Research and Opinion 20:5, 671-679
CrossRef753
Robert J. Fontana, Ziad Kronfol. (2004) The patient's perspective in hepatitis C. Hepatology 39:4, 903-905
CrossRef754
Norbert Bräu, Maribel Rodriguez-Torres, Dale Prokupek, Maurizio Bonacini, Carol A. Giffen, Jeffery J. Smith, Kevin R. Frost, Jay R. Kostman. (2004) Treatment of chronic hepatitis C in HIV/HCV-coinfection with interferon α-2b+ full-course vs. 16-week delayed ribavirin. Hepatology 39:4, 989-998
CrossRef755
Jacqueline O’Leary, Raymond T Chung. (2004) New antiviral therapies for hepatitis C. Expert Review of Anti-infective Therapy 2:2, 235-243
CrossRef756
Mark S. Sulkowski, Franco Felizarta, Cheryl Smith, Jidah Slim, Ruth Berggren, Russell Goodman, Lisa Ball, Mandana Khalili, Douglas T. Dieterich. (2004) Daily Versus Thrice-Weekly Interferon Alfa-2b Plus Ribavirin for the Treatment of Chronic Hepatitis C in HIV-Infected Persons: A Multicenter Randomized Controlled Trial. JAIDS Journal of Acquired Immune Deficiency Syndromes 35:5, 464-472
CrossRef757
Anita M Loughlin, Robert Schwartz, Steffanie A Strathdee. (2004) Prevalence and correlates of HCV infection among methadone maintenance attendees: implications for HCV treatment. International Journal of Drug Policy 15:2, 93-101
CrossRef758
Zdravko P. Vassilev, Shiela M. Strauss, Janetta M. Astone, Don C. Jarlais. (2004) Injection drug users and the provision of hepatitis C-related services in a nationwide sample of drug treatment programs. The Journal of Behavioral Health Services & Research 31:2, 208-216
CrossRef759
Brian R. Edlin. (2004) Hepatitis C prevention and treatment for substance users in the United States: acknowledging the elephant in the living room. International Journal of Drug Policy 15:2, 81-91
CrossRef760
Karen E. Mark, Robert A. Gunn. (2004) Gonorrhea Surveillance. Sexually Transmitted Diseases 31:4, 215-220
CrossRef761
Doris B. Strader, Teresa Wright, David L. Thomas, Leonard B. Seeff. (2004) Diagnosis, management, and treatment of hepatitis C. Hepatology 39:4, 1147-1171
CrossRef762
Brian L. Pearlman. (2004) Hepatitis C Infection: A Clinical Review. Southern Medical Journal 97:4, 365-373
CrossRef763
Gianluca Quaglio, Benedetta Pajusco, Paolo Civitelli, Sabrina Migliozzi, Don C. Des Jarlais, Luisa Romanò, Alessandro Lechi, Paolo Mezzelani, Fabio Lugoboni. (2004) Immunogenicity, reactogenicity and adherence with hepatitis A vaccination among drug users. Drug and Alcohol Dependence 74:1, 85-88
CrossRef764
M KURIYAN, J CARSON. (2004) Blood transfusion risks in the intensive care unit. Critical Care Clinics 20:2, 237-253
CrossRef765
Kevin L. Sloan, Kristy A. Straits-Tr??ster, Jason A. Dominitz, Daniel R. Kivlahan. (2004) Hepatitis C Tested Prevalence and Comorbidities Among Veterans in the US Northwest. Journal of Clinical Gastroenterology 38:3, 279-284
CrossRef766
Robert G. Gish. (2004) Treating hepatitis C: the state of the art. Gastroenterology Clinics of North America 33:1, 1-9
CrossRef767
Aluisio Cotrim Segurado, Patrícia Braga, Arnaldo Etzel, Maria Regina Alves Cardoso. (2004) Hepatitis C Virus Coinfection in a Cohort of HIV-Infected Individuals from Santos, Brazil: Seroprevalence and Associated Factors. AIDS Patient Care and STDs 18:3, 135-143
CrossRef768
Mark Evans, Angela L. Stotts, Susan Graham, Joy Schmitz, John Grabowski. (2004) Hepatitis C Knowledge Assessment and Counseling Within the Context of Substance Abuse Treatment. Addictive Disorders & Their Treatment 3:1, 18-26
CrossRef769
Thomas R. OʼBrien, Gregory Kirk, Mingdong Zhang. (2004) Hepatocellular Carcinoma. The Cancer Journal 10:2, 67-73
CrossRef770
Robert J Fontana, Gregory T Everson, Sony Tuteja, Hugo E Vargas, Mitchell L Shiffman. (2004) Controversies in the management of hepatitis C patients with advanced fibrosis and cirrhosis. Clinical Gastroenterology and Hepatology 2:3, 183-197
CrossRef771
Shiela M Strauss, Janetta M Astone, Don Des Jarlais, Holly Hagan. (2004) A comparison of HCV antibody testing in drug-free and methadone maintenance treatment programs in the United States. Drug and Alcohol Dependence 73:3, 227-236
CrossRef772
Catherine A. Fleming, Demian Christiansen, David Nunes, Timothy Heeren, David Thornton, C. Robert Horsburgh, Jr., Margaret James Koziel, Camilla Graham, Donald E. Craven. (2004) Health‐Related Quality of Life of Patients with HIV Disease: Impact of Hepatitis C Coinfection. Clinical Infectious Diseases 38:4, 572-578
CrossRef773
Andrew H. Talal, M. Tarek Shata, Marianthi Markatou, Gary Dorante, Amy Chadburn, Robert Koch, Avidan U. Neumann, Ruy M. Ribeiro, Alan S. Perelson. (2004) Virus Dynamics and Immune Responses During Treatment in Patients Coinfected With Hepatitis C and HIV. JAIDS Journal of Acquired Immune Deficiency Syndromes 35:2, 103-113
CrossRef774
Joseph Ahn, Steven Flamm. (2004) Peginterferon-α2b and ribavirin. Expert Review of Anti-infective Therapy 2:1, 17-25
CrossRef775
Brian J. McMahon, Thomas W. Hennessy, Carol Christensen, Dana Bruden, Daniel G. Sullivan, Chriss Homan, Heike Deubner, Michael G. Bruce, Stephen Livingston, James Williams, David R. Gretch. (2004) Epidemiology and risk factors for hepatitis C in Alaska Natives. Hepatology 39:2, 325-332
CrossRef776
Javier P Gisbert, Luisa García-Buey, Reyes Arranz, Carlos Blas, Inmaculada Pinilla, Sam Khorrami, Agustín Acevedo, María J Borque, José M Pajares, José M Fernández-Rañada, Ricardo Moreno-Otero. (2004) The prevalence of hepatitis C virus infection in patients with non-Hodgkin's lymphoma. European Journal of Gastroenterology & Hepatology 16:2, 135-138
CrossRef777
Amedeo Lonardo, Luigi E. Adinolfi, Paola Loria, Nicola Carulli, Giuseppe Ruggiero, Christopher P. Day. (2004) Steatosis and hepatitis C virus: Mechanisms and significance for hepatic and extrahepatic disease. Gastroenterology 126:2, 586-597
CrossRef778
Sirenda Vong, Beth P. Bell. (2004) Chronic liver disease mortality in the United States, 1990-1998. Hepatology 39:2, 476-483
CrossRef779
N.K. Sana ., I. Hossin ., E.M. Haque ., Ranajit Kumar Shaha .. (2004) Identification, Purification and Characterization of Lipase from Germinating Oil Seeds (Brassica napus L.). Pakistan Journal of Biological Sciences 7:2, 246-252
CrossRef780
Mohamed A. Metwally, Claudia O. Zein, Nizar N. Zein. (2004) Clinical Significance of Hepatic Iron Deposition and Serum Iron Values in Patients with Chronic Hepatitis C Infection. The American Journal of Gastroenterology 99:2, 286-291
CrossRef781
Andre C. Lyra, Sunil Ramrakhiani, Bruce R. Bacon, Adrian M. Di Bisceglie. (2004) Infection with Hepatitis C Virus Genotype 4 in the United States. Journal of Clinical Gastroenterology 38:1, 68-71
CrossRef782
Jaquelyn Fleckenstein. (2004) Chronic hepatitis C in african americans and other minority groups. Current Gastroenterology Reports 6:1, 66-70
CrossRef783
Andrea D. Branch. 2004. Hepatitis C. , 323-334.
CrossRef784
Daniel Morgensztern, Manuel Rosado, Orlando Silva, Edgardo Santos, Sakher Abdullah, Mark Goodman, Kara Hamilton-Nelson, Joseph Rosenblatt, Izidore Lossos. (2004) Prevalence of Hepatitis C Infection in Patients with Non-Hodgkin's Lymphoma in South Florida and Review of the Literature. Leukemia & Lymphoma 45:12, 2459-2464
CrossRef785
Susan E Chan, Jonathan M Schwartz, Hugo R Rosen. (2004) Treatment of Hepatitis C in Solid Organ Transplantation. Drugs 64:5, 489-498
CrossRef786
MICHAEL J. TAYLOR, SCOTT L. LETENDRE, BRIAN C. SCHWEINSBURG, OMAR M. ALHASSOON, GREGORY G. BROWN, ASSAWIN GONGVATANA, IGOR GRANT, THE HNRC. (2004) Hepatitis C virus infection is associated with reduced white matter N-acetylaspartate in abstinent methamphetamine users. Journal of the International Neuropsychological Society 10:01,
CrossRef787
D. A. Marshall, S. H. Kleinman, J. B. Wong, J. P. AuBuchon, D. T. Grima, N. A. Kulin, M. C. Weinstein. (2004) Cost-effectiveness of nucleic acid test screening of volunteer blood donations for hepatitis B, hepatitis C and human immunodeficiency virus in the United States. Vox Sanguinis 86:1, 28-40
CrossRef788
MICHINORI KOHARA, KAZUAKI INOUE. (2004) 'Virus and Interferon' Mechanism of persistence in HCV infection.. Uirusu 54:2, 197-204
CrossRef789
S. Engler, C. Flechtenmacher, K. H. Wiedemann, R. Gugler, W. Stremmel, B. Kallinowski. (2004) Interferon alfa2a induction therapy in combination with ribavirin and amantadine for the treatment of naive patients with chronic HCV infection. Journal of Viral Hepatitis 11:1, 60-68
CrossRef790
Jasmina Simonovic-Babic, Dragan Delic, Neda Svirtlih, Marija Djordjevic. (2004) Elevated aminotransferase levels: Diagnostic approach. Medicinski pregled 57:9-10, 429-433
CrossRef791
Thierry Poynard, Man-Fung Yuen, Vlad Ratzin, Ching Lung Lai. (2003) Viral hepatitis C. The Lancet 362:9401, 2095-2100
CrossRef792
Markus Reiser, Peter Buggisch, Johannes Grossmann, Karsten Koop, Karsten Wursthorn, Wolff Schmiegel. (2003) First-line therapy with daily versus thrice-weekly interferon alfa-2b plus ribavirin for chronic hepatitis C. European Journal of Gastroenterology & Hepatology 15:12, 1299-1304
CrossRef793
James M. McMahon, Stephanie Tortu. (2003) A Potential Hidden Source of Hepatitis C Infection Among Noninjecting Drug Users. Journal of Psychoactive Drugs 35:4, 455-460
CrossRef794
Erzsébet Szabó, Gabor Lotz, Csilla Páska, András Kiss, Zsuzsa Schaff. (2003) Viral hepatitis: New data on hepatitis C infection. Pathology & Oncology Research 9:4, 215-221
CrossRef795
Javier P Gisbert, Luisa Garcı́a-Buey, José Marı́a Pajares, Ricardo Moreno-Otero. (2003) Prevalence of hepatitis C virus infection in B-cell non-Hodgkin’s lymphoma: systematic review and meta-analysis. Gastroenterology 125:6, 1723-1732
CrossRef796
Hilla Knobler, Taiba Zhornicky, Alex Sandler, Nurit Haran, Yafa Ashur, Ami Schattner. (2003) Tumor necrosis factor-alpha-induced insulin resistance may mediate the hepatitis C virus-diabetes association. The American Journal of Gastroenterology 98:12, 2751-2756
CrossRef797
Sandrine Loubière, Michel Rotily, Jean-Paul Moatti. (2003) PREVENTION COULD BE LESS COST-EFFECTIVE THAN CURE: THE CASE OF HEPATITIS C SCREENING POLICIES IN FRANCE. International Journal of Technology Assessment in Health Care 19:04,
CrossRef798
Michelle M. Lipman, Scott J. Cotler. (2003) Antiviral therapy for hepatitis C. Current Treatment Options in Gastroenterology 6:6, 445-453
CrossRef799
Aijaz Ahmed, Emmet B. Keeffe. (2003) Upodate on chronic hepatitis C. Comprehensive Therapy 29:4, 224-232
CrossRef800
Gwendolyn P. Hammer, Timothy A. Kellogg, Willi C. McFarland, Ernest Wong, Brian Louie, Ian Williams, James Dilley, Kimberly Page-Shafer, Jeffrey D. Klausner. (2003) Low Incidence and Prevalence of Hepatitis C Virus Infection Among Sexually Active Non-Intravenous Drug-Using Adults, San Francisco, 1997–2000. Sexually Transmitted Diseases 30:12, 919-924
CrossRef801
Simon A Brown, Louis M Aledort, Christine A Lee. (2003) Molecular challenges and viral diseases. Haemophilia 9:6, 727-737
CrossRef802
R. Perez, M. Jimenez, J. Crespo, M. Diago, J. Enriquez, P. Vaquero, R. Sola, J. L. Olcoz, M. Romero, J. Salmeron, Ma I. Blanco, Ma Ona, S. Melon, L. Rodrigo, . (2003) Comparative study of the efficacy of an induction dose of interferon-alpha2b with ribavirin compared with standard combined treatment in naive patients with chronic hepatitis C. Journal of Viral Hepatitis 10:6, 437-445
CrossRef803
B Balkau, M Vernay, L Mhamdi, M Novak, D Arondel, S Vol, J Tichet, E Eschwège. (2003) The incidence and persistence of the NCEP (National Cholesterol Education Program) metabolic syndrome. The French D.E.S.I.R. study. Diabetes & Metabolism 29:5, 526-532
CrossRef804
James C Barton, Ronald T Acton, Charles A Rivers, Luigi F Bertoli, Terri Gelbart, Carol West, Ernest Beutler. (2003) Genotypic and phenotypic heterogeneity of African Americans with primary iron overload. Blood Cells, Molecules, and Diseases 31:3, 310-319
CrossRef805
Javier P Gisbert, Luisa Garcı́a-Buey, José Marı́a Pajares, Ricardo Moreno-Otero. (2003) Prevalence of hepatitis C virus infection in porphyria cutanea tarda: systematic review and meta-analysis. Journal of Hepatology 39:4, 620-627
CrossRef806
Eva A. Operskalski, James W. Mosley, Leslie H. Tobler, Eberhard W. Fiebig, Marek J. Nowicki, Larry T. Mimms, James Gallarda, Bruce H. Phelps, Michael P. Busch. (2003) HCV viral load in anti-HCV-reactive donors and infectivity for their recipients. Transfusion 43:10, 1433-1441
CrossRef807
Susan Zickmund, Masahiro Masuda, Laura Ippolito, Douglas R. LaBrecque. (2003) "They Treated Me Like a Leper". Stigmatization and the Quality of Life of Patients with Hepatitis C. Journal of General Internal Medicine 18:10, 835-844
CrossRef808
Michael Gossop, Nadine Browne, Duncan Stewart, John Marsden. (2003) Alcohol use outcomes and heavy drinking at 4–5 years among a treatment sample of drug misusers. Journal of Substance Abuse Treatment 25:3, 135-143
CrossRef809
Catherine M Meyers, Leonard B Seeff, Catherine O Stehman-Breen, Jay H Hoofnagle. (2003) Hepatitis C and renal disease: an update 1 1Summary of a workshop held October 21 to 22, 2002, in the Lister Hill Auditorium, The National Institutes of Health, Bethesda, MD.. American Journal of Kidney Diseases 42:4, 631-657
CrossRef810
Richard Njouom, Christophe Pasquier, Ahidjo Ayouba, Antoine Gessain, Alain Froment, Jermie Mfoupouendoun, Regis Pouillot, Martine Dubois, Karine Sandres-Saun
CrossRef811
Roderick REMOROZA, George Y WU. (2003) Extrahepatic manifestations of chronic hepatitis C. Chinese Journal of Digestive Diseases 4:3, 93-99
CrossRef812
Cheryl L. Day, Nilufer P. Seth, Michaela Lucas, Heiner Appel, Laurent Gauthier, Georg M. Lauer, Gregory K. Robbins, Zbigniew M. Szczepiorkowski, Deborah R. Casson, Raymond T. Chung, Shannon Bell, Gillian Harcourt, Bruce D. Walker, Paul Klenerman, Kai W. Wucherpfennig. (2003) Ex vivo analysis of human memory CD4 T cells specific for hepatitis C virus using MHC class II tetramers. Journal of Clinical Investigation 112:6, 831-842
CrossRef813
G. L. Quaglio, F. Lugoboni, B. Pajusco, M. Sarti, G. Talamini, , P. Mezzelani, D. C. Des Jarlais. (2003) Hepatitis C virus infection: prevalence, predictor variables and prevention opportunities among drug users in Italy. Journal of Viral Hepatitis 10:5, 394-400
CrossRef814
Edmund J. Bini. (2003) Hepatitis C in veterans. Current Hepatitis Reports 2:3, 108-115
CrossRef815
Adrian M. Bisceglie, Andre C. Lyra, Myron Schwartz, Rajender K. Reddy, Paul Martin, Gregory Gores, Anna S. F. Lok, Khozema B. Hussain, Robert Gish, David H. Thiel, Zobair Younossi, Myron Tong, Tarek Hassanein, Luis Balart, Jacquelyn Fleckenstein, Stephen Flamm, Andres Blei, Alex S. Befeler, . (2003) Hepatitis C-related hepatocellular carcinoma in the United States: influence of ethnic status. The American Journal of Gastroenterology 98:9, 2060-2063
CrossRef816
Jennifer M. Loftis, Peter Hauser. (2003) Hepatitis C in patients with psychiatric disease and substance abuse: Screening strategies and comanagement models of care. Current Hepatitis Reports 2:3, 93-100
CrossRef817
Corina Hartman, Drora Berkowitz, Nurit Rimon, Raanan Shamir. (2003) The Effect of Early Treatment in Children with Chronic Hepatitis. Journal of Pediatric Gastroenterology and Nutrition 37:3, 252-257
CrossRef818
Yuan Li, Ting Zhang, Steven D. Douglas, Jian-Ping Lai, Wei-Dong Xiao, David E. Pleasure, Wen-Zhe Ho. (2003) Morphine Enhances Hepatitis C Virus (HCV) Replicon Expression. The American Journal of Pathology 163:3, 1167-1175
CrossRef819
Jonathan C Anderson, Josephine Simonetti, Dennis G Fisher, James Williams, Yasuhiro Yamamura, Nayra Rodriguez, Daniel G Sullivan, David R Gretch, Brian McMahon, Kandace J Williams. (2003) Comparison of different HCV viral load and genotyping assays. Journal of Clinical Virology 28:1, 27-37
CrossRef820
Ming Chang, Ocean Williams, John Mittler, Adrian Quintanilla, Robert L. Carithers, James Perkins, Lawrence Corey, David R. Gretch. (2003) Dynamics of Hepatitis C Virus Replication in Human Liver. The American Journal of Pathology 163:2, 433-444
CrossRef821
Ramsey C. Cheung, Frank Hsieh, Yajie Wang, John B. Pollard. (2003) The Impact of Hepatitis C Status on Postoperative Outcome. Anesthesia & Analgesia 97:2, 550-554
CrossRef822
M.Mazen Jamal, Timothy R Morgan. (2003) Liver disease in alcohol and hepatitis C. Best Practice & Research Clinical Gastroenterology 17:4, 649-662
CrossRef823
Robert A. Yoho, Leonard L. Cruz, Reza Mazaheri, Andrea T. Cruz. (2003) Hepatitis C: A Review. Plastic and Reconstructive Surgery 112:2, 597-605
CrossRef824
Mitchell Kaplan, Samer Gawrieh, Scott J Cotler, Donald M Jensen. (2003) Neutralizing antibodies in hepatitis c virus infection: a review of immunological and clinical characteristics. Gastroenterology 125:2, 597-604
CrossRef825
Gianluca Quaglio, Fabio Lugoboni, Benedetta Pajusco, Maddalena Sarti, Giorgio Talamini, Alessandro Lechi, Paolo Mezzelani, Don C. Des Jarlais. (2003) Factors Associated with Hepatitis C Virus Infection in Injection and Noninjection Drug Users in Italy. Clinical Infectious Diseases 37:1, 33-40
CrossRef826
Beryl A. Koblin, Stephanie H. Factor, Yingfeng Wu, David Vlahov. (2003) Hepatitis C virus infection among noninjecting drug users in New York City. Journal of Medical Virology 70:3, 387-390
CrossRef827
Matthias Schröter, Heinz-Hubert Feucht, Bernhard Zöllner, Peter Schäfer, Rainer Laufs. (2003) Multiple infections with different HCV genotypes: prevalence and clinical impact. Journal of Clinical Virology 27:2, 200-204
CrossRef828
J.Tilman Gerlach, Helmut M Diepolder, Reinhart Zachoval, Norbert H Gruener, Maria-Christina Jung, Axel Ulsenheimer, Winfried W Schraut, C.albrecht Schirren, M Waechtler, M Backmund, Gerd R Pape. (2003) Acute hepatitis C: high rate of both spontaneous and treatment-induced viral clearance1 1The Bundesministerium für Bildung und Forschung and the European Union, as sponsors of the study, had no role in study design, data collection, analysis, or interpretation or in the writing and the decision to submit the report for publication.. Gastroenterology 125:1, 80-88
CrossRef829
Lynne Strasfeld, Yungtai Lo, Dale Netski, David L. Thomas, Robert S. Klein. (2003) The Association of Hepatitis C Prevalence, Activity, and Genotype With HIV Infection in a Cohort of New York City Drug Users. JAIDS Journal of Acquired Immune Deficiency Syndromes 33:3, 356-364
CrossRef830
Ramachandra S. Hosmane. 2003. Antiviral Agents. .
CrossRef831
B. Wang, G.B. Schreiber, S.A. Glynn, C.C. Nass, J.W. Smith, M.J. Higgins, S.T. Hutching, D.J. Wright, R.L. McEntire, E.L. Murphy for the Retrovirus Epidemiology Don. (2003) Prevalence of transfusion-transmissible viral infections in first-time US blood donors by donation site. Transfusion 43:6, 705-712
CrossRef832
Ellen M. Tedaldi, Katherine Huppler Hullsiek, Carlos D. Malvestutto, Roberto C. Arduino, Evelyn J. Fisher, Paul J. Gaglio, Elizabeth R. Jenny‐Avital, Joseph P. McGowan, George Perez, . (2003) Prevalence and Characteristics of Hepatitis C Virus Coinfection in a Human Immunodeficiency Virus Clinical Trials Group: The Terry Beirn Community Programs for Clinical Research on AIDS. Clinical Infectious Diseases 36:10, 1313-1317
CrossRef833
Andrea A. Howard, Robert S. Klein, Ellie E. Schoenbaum. (2003) Association of Hepatitis C Infection and Antiretroviral Use with Diabetes Mellitus in Drug Users. Clinical Infectious Diseases 36:10, 1318-1323
CrossRef834
F Fred Poordad, Tram Tran, Paul Martin. (2003) Developments in hepatitis C therapy during 2000 – 2002. Expert Opinion on Emerging Drugs 8:1, 9-25
CrossRef835
Graham R Foster. (2003) Pegylated interferon with ribavirin therapy for chronic infection with the hepatitis C virus. Expert Opinion on Pharmacotherapy 4:5, 685-691
CrossRef836
Zobair M. Younossi, Kevin D. Mullen, Sandra Hodnick, David S. Barnes, William D. Carey, Arthur C. McCullough, Kirk Easley, Terry Gramlich, Belinda Yen Liebermann. (2003) Triple Combination of Interferon Alpha-2b, Ribavirin, and Amantadine for Treatment of Chronic Hepatitis C. Journal of Clinical Gastroenterology 36:5, 427-430
CrossRef837
Maurizio Montella, Anna Crispo, Maria Grimaldi, Vincenzo Tridente, Mario Fusco. (2003) Assessment of iatrogenic transmission of HCV in southern italy: Was the cause the salk polio vaccination?. Journal of Medical Virology 70:1, 49-50
CrossRef838
Victor J. Navarro, Thomas E. St. Louis, Beth P. Bell. (2003) Identification of Patients with Hepatitis C Virus Infection in New Haven County Primary Care Practices. Journal of Clinical Gastroenterology 36:5, 431-435
CrossRef839
ROBERT A. GUNN, PAULA J. MURRAY, CAROLYN H. BRENNAN, DAVID B. CALLAHAN, MIRIAM J. ALTER, HAROLD S. MARGOLIS. (2003) Evaluation of Screening Criteria to Identify Persons With Hepatitis C Virus Infection Among Sexually Transmitted Disease Clinic Clients. Sexually Transmitted Diseases 30:4, 340-344
CrossRef840
Michael Gossop, John Marsden, Duncan Stewart, Tara Kidd. (2003) The National Treatment Outcome Research Study (NTORS): 4-5 year follow-up results. Addiction 98:3, 291-303
CrossRef841
R. San Miguel, J. Mar, J. M. Cabases, F. GuilleN-Grima, M. Buti. (2003) Cost-effectiveness analysis of therapeutic strategies for patients with chronic hepatitis C previously not responding to interferon. Alimentary Pharmacology and Therapeutics 17:6, 765-773
CrossRef842
CATHERINE CRONE, GEOFFREY M. GABRIEL. (2003) Comprehensive Review of Hepatitis C for Psychiatrists: Risks, Screening, Diagnosis, Treatment, and Interferon-Based Therapy Complications. Journal of Psychiatric Practice 9:2, 93-110
CrossRef843
Gary L. Davis. (2003) Treatment of chronic hepatitis C: Improved combination therapy. Current Hepatitis Reports 2:1, 40-46
CrossRef844
G. D'Souza, R. Arafat, L. Hwang, C. Cunningham, S. Shah, K. Reynolds. (2003) Cross-sectional survey of the extent and indicators of hepatitis C virus infection in Houston Department of Health and Human Services' sexually transmitted disease clinics. Journal of Viral Hepatitis 10:2, 134-140
CrossRef845
KEYUR PATEL, ADRIANNE LAJOIE, SHANON HEATON, STEPHEN PIANKO, CYNTHIA A BEHLING, DAVID BYLUND, PAULJ POCKROS, LAWRENCE M BLATT, ANDREW CONRAD, JOHN G MCHUTCHISON. (2003) Clinical use of hyaluronic acid as a predictor of fibrosis change in hepatitis C. Journal of Gastroenterology and Hepatology 18:3, 253-257
CrossRef846
Gerard Krause, Mary Jo Trepka, Robert S. Whisenhunt, Dolly Katz, Omana Nainan, Steven T. Wiersma, Richard S. Hopkins. (2003) Nosocomial Transmission of Hepatitis C Virus Associated With the Use of Multidose Saline Vials • . Infection Control and Hospital Epidemiology 24:2, 122-127
CrossRef847
Jayaprakash Sreenarasimhaiah, Andrés Jaramillo, Jeffrey Crippin, Mauricio Lisker-Melman, William C Chapman, T Mohanakumar. (2003) Lack of optimal T-cell reactivity against the hepatitis C virus is associated with the development of fibrosis/cirrhosis during chronic hepatitis. Human Immunology 64:2, 224-230
CrossRef848
Gregory J Dore, Matthew Law, Margaret MacDonald, John M Kaldor. (2003) Epidemiology of hepatitis C virus infection in Australia. Journal of Clinical Virology 26:2, 171-184
CrossRef849
Ellen M. Tedaldi, Rose K. Baker, Anne C. Moorman, Carlos F. Alzola, Jack Furhrer, Robert E. McCabe, Kathleen C. Wood, Scott D. Holmberg, . (2003) Influence of Coinfection with Hepatitis C Virus on Morbidity and Mortality Due to Human Immunodeficiency Virus Infection in the Era of Highly Active Antiretroviral Therapy. Clinical Infectious Diseases 36:3, 363-367
CrossRef850
BARBARA ROMANOWSKI, JUTTA PREIKSAITIS, PATRICIA CAMPBELL, JAYNE FENTON. (2003) Hepatitis C Seroprevalence and Risk Behaviors in Patients Attending Sexually Transmitted Disease Clinics. Sexually Transmitted Diseases 30:1, 33-38
CrossRef851
Tommy Yen, Emmet B. Keeffe, Aijaz Ahmed. (2003) The Epidemiology of Hepatitis C Virus Infection. Journal of Clinical Gastroenterology 36:1, 47-53
CrossRef852
Youyin Choy, Lisa Gittens-Williams, Joseph Apuzzio, Joan Skurnick, Carl Zollicoffer, Peter G. McGovern. (2003) Risk Factors for Hepatitis C Infection Among Sexually Transmitted Disease-Infected, Inner City Obstetric Patients. Infectious Diseases in Obstetrics & Gynecology 11:4, 191-198
CrossRef853
Jens Rasenack, Stefan Zeuzem, S. Victor Feinman, E. Jenny Heathcote, Michael Manns, Eric M. Yoshida, Mark G. Swain, Edward Gane, Moises Diago, Dennis A. Revicki, Amy Lin, Neil Wintfeld, Jesse Green. (2003) Peginterferon ??-2a (40kD) [Pegasys??] Improves HR-QOL Outcomes Compared with Unmodified Interferon ??-2a [Roferon??-A]. PharmacoEconomics 21:5, 341-349
CrossRef854
Todd E. Dantzler, Eric J. Lawitz. (2003) Treatment of chronic hepatitis C in nonresponders to previous therapy. Current Gastroenterology Reports 5:1, 78-85
CrossRef855
Richard K. Sterling, Melissa J. Contos, Arun J. Sanyal, Velimir A. Luketic, R. Todd Stravitz, Mary S. Wilson, A. Scott Mills, Mitchell L. Shiffman. (2003) The Clinical Spectrum of Hepatitis C Virus in HIV Coinfection. JAIDS Journal of Acquired Immune Deficiency Syndromes 32:1, 30-37
CrossRef856
Oluwatoyin M. Falusi, Joseph Pulvirenti, Julia Sarazine, Priya Shastri, Cheri Gail, Robert Glowacki. (2003) HIV-Infected Inpatients in the HAART Era: How Do Hepatitis C Virus CoInfected Patients Differ?. AIDS Patient Care and STDs 17:1, 13-16
CrossRef857
Charles H. Cha, Leyo Ruo, Yuman Fong, William R. Jarnagin, Jinru Shia, Leslie H. Blumgart, Ronald P. DeMatteo. (2003) Resection of Hepatocellular Carcinoma in Patients Otherwise Eligible for Transplantation. Transactions of the ... Meeting of the American Surgical Association 121, 9-17
CrossRef858
S. J. Cotler, J. E. Layden, A. U. Neumann, D. M. Jensen. (2003) First phase hepatitis c viral kinetics in previous nonresponders patients. Journal of Viral Hepatitis 10:1, 43-49
CrossRef859
P. J. Pockros, R. Reindollar, J. McHutchinson, R. Reddy, T. Wright, D.G. Boyd, L.B. Wilkes. (2003) The safety and tolerability of daily infergen plus ribavirin in the treatment of naiive chronic hepatitis C patients. Journal of Viral Hepatitis 10:1, 55-60
CrossRef860
Jose Azocar, Olga P Clavijo, Edmond J Yunis. (2003) MHC class II genes in HCV viral clearance of hepatitis C infected Hispanic patients. Human Immunology 64:1, 99-102
CrossRef861
Catherine A. Fleming, Donald E. Craven, David Thornton, Sheila Tumilty, David Nunes. (2003) Hepatitis C Virus and Human Immunodeficiency Virus Coinfection in an Urban Population: Low Eligibility for Interferon Treatment. Clinical Infectious Diseases 36:1, 97-100
CrossRef862
Philip Jacobs, Ying Chu Ng, Tania Stafinski, Roger Dodd, Bryce Larke, Winnie Wong. (2003) Labour Force Participation Among Individuals with Hepatitis C in the US. PharmacoEconomics 21:8, 565-572
CrossRef863
Chloe L Thio, Eric C Seaberg, Richard Skolasky, John Phair, Barbara Visscher, Alvaro Muñoz, David L Thomas. (2002) HIV-1, hepatitis B virus, and risk of liver-related mortality in the Multicenter Cohort Study (MACS). The Lancet 360:9349, 1921-1926
CrossRef864
Hugo E. Vargas, Jorge Rakela. (2002) Impact of hepatitis B and hepatitis C on solid organ transplantation. Current Opinion in Organ Transplantation 7:4, 325-331
CrossRef865
Jean Fleming. (2002) Current Treatments for Hepatitis. Journal of Infusion Nursing 25:6, 379-382
CrossRef866
W. Ray Kim. (2002) The burden of hepatitis C in the United States. Hepatology 36:S1, S30-S34
CrossRef867
Leonard B. Seeff. (2002) Natural history of chronic hepatitis C. Hepatology 36:S1, S35-S46
CrossRef868
M.A. Balogun, M.E. Ramsay, L.M. Hesketh, N. Andrews, K.P. Osborne, N.J. Gay, P. Morgan-Capner. (2002) The Prevalence of Hepatitis C in England and Wales. Journal of Infection 45:4, 219-226
CrossRef869
Leonard B. Seeff, Jay H. Hoofnagle. (2002) National institutes of health consensus development conference: Management of hepatitis C: 2002. Hepatology 36:S1, S1-S2
CrossRef870
Mark S. Sulkowski. (2002) Hepatitis C virus infection in HIV-infected patients. Current Hepatitis Reports 1:1, 16-22
CrossRef871
M. T. Shata, D. D. Anthony, N. L. Carlson, L. Andrus, B. Brotman, N. Tricoche, P. McCormack, A. Prince. (2002) Characterization of the immune response against hepatitis C infection in recovered, and chronically infected chimpanzees. Journal of Viral Hepatitis 9:6, 400-410
CrossRef872
Juan D Ruiz, Fred Molitor, Julie A Plagenhoef. (2002) Trends in hepatitis C and HIV infection among inmates entering prisons in California, 1994 versus 1999. AIDS 16:16, 2236-2238
CrossRef873
Jay H. Hoofnagle. (2002) Course and outcome of hepatitis C. Hepatology 36:S1, S21-S29
CrossRef874
Miriam J. Alter. (2002) Prevention of spread of hepatitis C. Hepatology 36:S1, S93-S98
CrossRef875
Farzana Kapadia, David Vlahov, Don C. Des Jarlais, Steffanie A. Strathdee, Lawrence Ouellet, Peter Kerndt, Edward V. Morse E, Ian Williams, Richard S. Garfein. (2002) Does Bleach Disinfection of Syringes Protect Against Hepatitis C Infection Among Young Adult Injection Drug Users?. Epidemiology 13:6, 738-741
CrossRef876
Geetanjali Chander, Mark S. Sulkowski, Mollie W. Jenckes, Michael S. Torbenson, H. Franklin Herlong, Eric B. Bass, Kelly A. Gebo. (2002) Treatment of chronic hepatitis C: A systematic review. Hepatology 36:S1, S135-S144
CrossRef877
Maureen M. Jonas. (2002) Children with hepatitis C. Hepatology 36:S1, S173-S178
CrossRef878
Doris B. Strader. (2002) Understudied populations with hepatitis C. Hepatology 36:S1, S226-S236
CrossRef879
Alfredo Alberti, Silvia Boccato, Alessandro Vario, Luisa Benvegnù. (2002) Therapy of acute hepatitis C. Hepatology 36:S1, S195-S200
CrossRef880
W. Ray Kim. (2002) Global epidemiology and burden of hepatitis C. Microbes and Infection 4:12, 1219-1225
CrossRef881
Khalid S.A. Khabar, Stephen J. Polyak. (2002) Hepatitis C Virus-Host Interactions: The NS5A Protein and the Interferon/Chemokine Systems. Journal of Interferon & Cytokine Research 22:10, 1005-1012
CrossRef882
Claudia O Zein, Nizar N Zein. (2002) Advances in therapy for hepatitis C infection. Microbes and Infection 4:12, 1237-1246
CrossRef883
Danielle C. Ompad, Crystal M. Fuller, David Vlahov, David Thomas, Steffanie A. Strathdee. (2002) Lack of Behavior Change after Disclosure of Hepatitis C Virus Infection among Young Injection Drug Users in Baltimore, Maryland. Clinical Infectious Diseases 35:7, 783-788
CrossRef884
Cassandra L. Lehman, Ramsey C. Cheung. (2002) Depression, anxiety, post-traumatic stress, and alcohol-related problems among veterans with chronic hepatitis C. The American Journal of Gastroenterology 97:10, 2640-2646
CrossRef885
Adeel A. Butt. (2002) Hepatitis C Information on the World Wide Web. Clinical Infectious Diseases 35:6, 754-759
CrossRef886
Ding-You Li, Kathleen B. Schwarz. (2002) Immunopathogenesis of Chronic Hepatitis C Virus Infection. Journal of Pediatric Gastroenterology and Nutrition 35:3, 260-267
CrossRef887
R. San Miguel, F. Guillen, J. M. Cabases, M. Buti. (2002) Meta-analysis: combination therapy with interferon-alpha 2a/2b and ribavirin for patients with chronic hepatitis C previously non-responsive to interferon. Alimentary Pharmacology and Therapeutics 16:9, 1611-1621
CrossRef888
Manal M. Hassan, Adam Frome, Yehuda Z. Patt, Hashem B. El-Serag. (2002) Rising Prevalence of Hepatitis C Virus Infection Among Patients Recently Diagnosed With Hepatocellular Carcinoma in the United States. Journal of Clinical Gastroenterology 35:3, 266-269
CrossRef889
Brent D Lemberg, Thomas A Shaw-Stiffel. (2002) Hepatic disease in injection drug users. Infectious Disease Clinics of North America 16:3, 667-679
CrossRef890
Norbert Brau, Edmund J. Bini, Azra Shahidi, Ayse Aytaman, Peiying Xiao, Saray Stancic, Robert Eng, Sheldon T. Brown, Fiorenzo Paronetto. (2002) Prevalence of hepatitis C and coinfection with HIV among United States veterans in the New York city metropolitan area1. The American Journal of Gastroenterology 97:8, 2071-2078
CrossRef891
Norman Gitlin. (2002) Manifestation of sarcoidosis during interferon and ribavirin therapy for chronic hepatitis C: a report of two cases. European Journal of Gastroenterology & Hepatology 14:8, 883-885
CrossRef892
Claudio Velati, Luisa Romano, Lorella Baruffi, Marco Pappalettera, Vittorio Carreri, Alessandro R. Zanetti. (2002) Residual risk of transfusion-transmitted HCV and HIV infections by antibody-screened blood in Italy. Transfusion 42:8, 989-993
CrossRef893
Josiane Pillonel, Syria Laperche, Christine Saura, Jean-Claude Desenclos, Anne-Marie Courouce, . (2002) Trends in residual risk of transfusion-transmitted viral infections in France between 1992 and 2000. Transfusion 42:8, 980-988
CrossRef894
Hisayuki Hamada, Hiroshi Yatsuhashi, Koji Yano, Manabu Daikoku, Kokichi Arisawa, Osami Inoue, Michiaki Koga, Keisuke Nakata, Katsumi Eguchi, Michitami Yano. (2002) Impact of aging on the development of hepatocellular carcinoma in patients with posttransfusion chronic hepatitis C. Cancer 95:2, 331-339
CrossRef895
W. Kurt Roth, Marijke Weber, Sylvia Buhr, Christian Drosten, Wolfgang Weichert, Walid Sireis, Doris Hedges, Erhard Seifried. (2002) Yield of HCV and HIV-1 NAT after screening of 3.6 million blood donations in central Europe. Transfusion 42:7, 862-868
CrossRef896
Diana L Sylvestre. (2002) Treating hepatitis C in methadone maintenance patients: an interim analysis. Drug and Alcohol Dependence 67:2, 117-123
CrossRef897
Kathleen B. Schwarz, William Balistreri. (2002) Viral Hepatitis. Journal of Pediatric Gastroenterology and Nutrition 35, S29-S32
CrossRef898
Rosa Di Stefano, Tommaso Stroffolini, Donatella Ferraro, Antonella Usticano, Lilli Mario Valenza, Luigi Montalbano, Giuseppina Pomara, Antonio Crax
CrossRef899
Mark R. Wallace, Braden R. Hale, Gregory C. Utz, Patrick E. Olson, Kenneth C. Earhart, Scott A. Thornton, Kenneth C. Hyams. (2002) Endemic Infectious Diseases of Afghanistan. Clinical Infectious Diseases 34:S5, S171-S207
CrossRef900
Sumathi Sivapalasingam, Sharp F. Malak, John F. Sullivan, Jonathan Lorch, Kent A. Sepkowitz. (2002) High Prevalence of Hepatitis C Infection Among Patients Receiving Hemodialysis at an Urban Dialysis Center • . Infection Control and Hospital Epidemiology 23:6, 319-324
CrossRef901
K. Rajender Reddy, Marlene W. Modi, Simon Pedder. (2002) Use of peginterferon alfa-2a (40 KD) (Pegasys®) for the treatment of hepatitis C. Advanced Drug Delivery Reviews 54:4, 571-586
CrossRef902
Barbara A. Piasecki, K. Rajender Reddy, Kyong-Mi Chang. (2002) Acute hepatitis C: To treat or not to treat?. Hepatology 35:6, 1538-1540
CrossRef903
M. R. Kraus, A. Schafer, H. Faller, H. Csef, M. Scheurlen. (2002) Paroxetine for the treatment of interferon-alpha-induced depression in chronic hepatitis C. Alimentary Pharmacology and Therapeutics 16:6, 1091-1099
CrossRef904
Amy W. Poret, Ronald J. Ozminkowski, Ron Goetzel, Jaime E. Pew, Jean Balent. (2002) Cost Burden of Illness for Hepatitis C Patients with Employer-Sponsored Health Insurance. Disease Management 5:2, 95-107
CrossRef905
Douglas T. Dieterich. (2002) Treatment of Hepatitis C and Anemia in Human Immunodeficiency Virus–Infected Patients. The Journal of Infectious Diseases 185:s2, S128-S137
CrossRef906
Jeanne M. Clark, Frederick L. Brancati, Anna Mae Diehl. (2002) Nonalcoholic fatty liver disease. Gastroenterology 122:6, 1649-1657
CrossRef907
Angulo, Paul, . (2002) Nonalcoholic Fatty Liver Disease. New England Journal of Medicine 346:16, 1221-1231
Full Text908
B. R. Burnham. (2002) RE: "PREVALENCE AND INCIDENCE OF HEPATITIS C VIRUS INFECTION IN THE US MILITARY: A SERO-EPIDEMIOLOGIC SURVEY OF 21,000 TROOPS". American Journal of Epidemiology 155:8, 778-a-779
CrossRef909
Kimberly A. Page-Shafer, Barbara Cahoon-Young, Jeffrey D. Klausner, Scott Morrow, Fred Molitor, Juan Ruiz, Willi McFarland. (2002) Hepatitis C Virus Infection in Young, Low-Income Women: The Role of Sexually Transmitted Infection as a Potential Cofactor for HCV Infection. American Journal of Public Health 92:4, 670-676
CrossRef910
Stephen Pianko, John G. McHutchison, Stuart C. Gordon, Shanon Heaton, Zachary D. Goodman, Keyur Patel, Cherise M. Cortese, Elizabeth M. Brunt, Bruce R. Bacon, Lawrence M. Blatt. (2002) Hepatic Iron Concentration Does Not Influence Response to Therapy with Interferon Plus Ribavirin in Chronic HCV Infection. Journal of Interferon & Cytokine Research 22:4, 483-489
CrossRef911
Ramsey C. Cheung, Aspasia K. Hanson, Kalyani Maganti, Emmet B. Keeffe, Suzanne M. Matsui. (2002) Viral Hepatitis and Other Infectious Diseases in a Homeless Population. Journal of Clinical Gastroenterology 34:4, 476-480
CrossRef912
Kathleen Iosue. (2002) Chronic Hepatitis C: Latest Treatment Options. The Nurse Practitioner 27:4, 32-33
CrossRef913
Shruti H Mehta, Andrea Cox, Donald R Hoover, Xiao-Hong Wang, Qing Mao, Stuart Ray, Steffanie A Strathdee, David Vlahov, David L Thomas. (2002) Protection against persistence of hepatitis C. The Lancet 359:9316, 1478-1483
CrossRef914
Paul J Pockros. (2002) Developments in the treatment of chronic hepatitis C. Expert Opinion on Investigational Drugs 11:4, 515-528
CrossRef915
K. E. Sherman, S. D. Rouster, R. T. Chung, N. Rajicic. (2002) Hepatitis C Virus Prevalence among Patients Infected with Human Immunodeficiency Virus: A Cross-Sectional Analysis of the US Adult AIDS Clinical Trials Group. Clinical Infectious Diseases 34:6, 831-837
CrossRef916
Thomas Hales, Winifred L. Boal, Clara Sue Ross. (2002) Hepatitis C Virus Infection Among Public Safety Workers. Journal of Occupational and Environmental Medicine 44:3, 221-222
CrossRef917
M. I. Memon, M. A. Memon. (2002) Hepatitis C: an epidemiological review. Journal of Viral Hepatitis 9:2, 84-100
CrossRef918
G. R. Foster. (2002) Management of chronic hepatitis C - time for a change?. Journal of Viral Hepatitis 9:2, 82-83
CrossRef919
Giovanni Lodi, Cristina Bez, Stephen R. Porter, Crispian Scully, Joel B. Epstein. (2002) Infectious hepatitis C, hepatitis G, and TT virus: review and implications for dentists. Special Care in Dentistry 22:2, 53-58
CrossRef920
Brenda Fredericksen, Giridhar R. Akkaraju, Eileen Foy, Chunfu Wang, Jill Pflugheber, Zhijian J. Chen, Michael Gale. (2002) Activation of the Interferon- β Promoter During Hepatitis C Virus RNA Replication. Viral Immunology 15:1, 29-40
CrossRef921
Sami L. Khella, Nizar Souayah. (2002) Hepatitis C: A Review of its Neurologic Complications. The Neurologist 8:2, 101-106
CrossRef922
Xiao-Song He, Harry B. Greenberg. (2002) CD8 + T-Cell Response Against Hepatitis C Virus. Viral Immunology 15:1, 121-131
CrossRef923
Andrew H. Talal, P. Wilfredo Canchis, Ira M. Jacobson. (2002) The HCV and HIV coinfected patient: What have we learned about pathophysiology?. Current Gastroenterology Reports 4:1, 15-22
CrossRef924
Adeline M. Nyamathi, Elizabeth L. Dixon, Wendie Robbins, Cynthia Smith, Dorothy Wiley, Barbara Leake, Douglas Longshore, Lillian Gelberg. (2002) Risk Factors for Hepatitis C Virus Infection Among Homeless Adults. Journal of General Internal Medicine 17:2, 134-143
CrossRef925
NANCY WY LEUNG. (2002) Management of viral hepatitis C. Journal of Gastroenterology and Hepatology 17, S146-S154
CrossRef926
Sue C. Eng, Kris V. Kowdley. (2002) DOES EARLY TREATMENT OF ACUTE HEPATITIS C VIRUS INFECTION WITH INTERFERON ALFA-2B PREVENT THE DEVELOPMENT OF CHRONIC HEPATITIS?. Evidence-Based Gastroenterology 3:1, 9-11
CrossRef927
R. Jake Jacobs, Raymond S. Koff, Allen S. Meyerhoff. (2002) The cost-effectiveness of vaccinating chronic hepatitis C patients against hepatitis A1. The American Journal of Gastroenterology 97:2, 427-434
CrossRef928
M. Gossop, J. Marsden, D. Stewart, S. Treacy. (2002) Reduced injection risk and sexual risk behaviours after drug misuse treatment: Results from the National Treatment Outcome Research Study. AIDS Care 14:1, 77-93
CrossRef929
Mayte Pérez-Olmeda, Pilar Ríos, Marina Núñez, Javier García-Samaniego, Miriam Romero, Vincent Soriano. (2002) Virological characteristics of hepatitis C virus infection in HIV-infected individuals with chronic hepatitis C: implications for treatment. AIDS 16:3, 493-495
CrossRef930
Xiping Zhao, Zhen-Ya Tang, Bettina Klumpp, Guido Wolff-Vorbeck, Heidi Barth, Shoshana Levy, Fritz von Weizsäcker, Hubert E. Blum, Thomas F. Baumert. (2002) Primary hepatocytes of Tupaia belangeri as a potential model for hepatitis C virus infection. Journal of Clinical Investigation 109:2, 221-232
CrossRef931
Ramazan Idilman, H
CrossRef932
Markus Sagmeister, Eberhard L. Renner, Beat Mullhaupt, John B. Wong. (2002) Simulation of hepatitis C based on a mandatory reporting system. European Journal of Gastroenterology & Hepatology 14:1, 25-34
CrossRef933
Karen R. Jacobson, Karen Murray, Aglaia Zellos, Kathleen B. Schwarz. (2002) An Analysis of Published Trials of Interferon Monotherapy in Children With Chronic Hepatitis C. Journal of Pediatric Gastroenterology and Nutrition 34:1, 52-58
CrossRef934
A. Okayama, S. O. Stuver, E. Tabor, N. Tachibana, M. Kohara, N. E. Mueller, H. Tsubouchi. (2002) Incident hepatitis C virus infection in a community-based population in Japan. Journal of Viral Hepatitis 9:1, 43-51
CrossRef935
Anthony J Freeman, George Marinos, Rosemary A Ffrench, Andrew R Lloyd. (2001) Immunopathogenesis of hepatitis C virus infection. Immunology and Cell Biology 79:6, 515-536
CrossRef936
Andrew Rosenblum, Larry Nuttbrock, Hunter L. McQuistion, Stephen Magura, Herman Joseph. (2001) Hepatitis C and Substance Use in a Sample of Homeless People in New York City. Journal of Addictive Diseases 20:4, 17-27
CrossRef937
Scott J. Cotler, K. Rajender Reddy, Jon McCone, Darin L. Wolfe, Anguo Liu, Teresa R. Craft, Mary W. Ferris, Andrew J. Conrad, Jeff Albrecht, Mary Morrissey, Daniel R. Ganger, Howard Rosenblate, Lawrence M. Blatt, Donald M. Jensen, Milton W. Taylor. (2001) An Analysis of Acute Changes in Interleukin-6 Levels After Treatment of Hepatitis C with Consensus Interferon. Journal of Interferon & Cytokine Research 21:12, 1011-1019
CrossRef938
Marlene Modi, Nancy Martin, Jenny E Heathcote, Keith Nieforth, Stefan Zeuzem. (2001) Peginterferon alfa-2a (40 kDa) monotherapy: a novel agent for chronic hepatitis C therapy. Expert Opinion on Investigational Drugs 10:12, 2201-2213
CrossRef939
John M. O???Brien, Katarzyna E. Kruzel, Michael G. Wandell, Ilia V. Vinogradov, John N. Sheagren, Allan P. Frank. (2001) Detection of Hepatitis C Antibody With At-Home Collection Kits Using an Innovative Laboratory Algorithm. Infectious Diseases in Clinical Practice 10:9, 474-480
CrossRef940
CrossRef941
Thomas F. Zuck, Paul D. Cumming, Edward L. Wallace. (2001) Computer-assisted audiovisual health history self-interviewing Results of the pilot study of the Hoxworth Quality Donor System. Transfusion 41:12, 1469-1474
CrossRef942
Tram T. Tran, Paul Martin. (2001) Chronic hepatitis C. Current Treatment Options in Gastroenterology 4:6, 503-510
CrossRef943
Jaeckel, Elmar, Cornberg, Markus, Wedemeyer, Heiner, Santantonio, Teresa, Mayer, Julika, Zankel, Myrga, Pastore, Giuseppe, Dietrich, Manfred, Trautwein, Christian, Manns, Michael P., . (2001) Treatment of Acute Hepatitis C with Interferon Alfa-2b. New England Journal of Medicine 345:20, 1452-1457
Full Text944
Hoofnagle, Jay H., . (2001) Therapy for Acute Hepatitis C. New England Journal of Medicine 345:20, 1495-1497
Full Text945
VINCENZO PURO, GABRIELLA CARLI, PAOLA SCOGNAMIGLIO, ROLANDO PORCASI, GIUSEPPE IPPOLITO, . (2001) Risk of HIV and Other Blood-Borne Infections in the Cardiac Setting. Annals of the New York Academy of Sciences 946:1, 291-309
CrossRef946
Rafael Rodrı́guez-Rosado, Mayte Pérez-Olmeda, Javier Garcı́a-Samaniego, Vincente Soriano. (2001) Management of hepatitis C in HIV-infected persons. Antiviral Research 52:2, 189-198
CrossRef947
Francis Yao, Norah Terrault. (2001) Hepatitis C and hepatocellular carcinoma. Current Treatment Options in Oncology 2:6, 473-483
CrossRef948
&NA;. (2001) Is pegylated interferon-?? plus ribavirin set to become the standard therapy for patients with hepatitis C?. Drugs & Therapy Perspectives 17:22, 5-8
CrossRef949
Milan Dodig, Anthony S. Tavill. (2001) Hepatitis C and Human Immunodeficiency Virus Coinfections. Journal of Clinical Gastroenterology 33:5, 367-374
CrossRef950
J. G. McHutchison, J. A. Shad, S. C. Gordon, T. R. Morgan, M.-H. Ling, J.-J. Garaud, J. K. Albrecht, J. L. Dienstag. (2001) Predicting response to initial therapy with interferon plus ribavirin in chronic hepatitis C using serum HCV RNA results during therapy. Journal of Viral Hepatitis 8:6, 414-420
CrossRef951
Katherine A. McGlynn, Lilian Tsao, Ann W. Hsing, Susan S. Devesa, Joseph F. Fraumeni. (2001) International trends and patterns of primary liver cancer. International Journal of Cancer 94:2, 290-296
CrossRef952
M. Hirayama, T. Maruyama, H. Mitsui, H. Maekawa, H. Yamada, N. Hashimoto, K. Koike, S. Kimura, K. Yasuda, S. Iino, J. Green. (2001) IgG1 anti-P2 as a marker of response to interferon in patients with chronic hepatitis C. Clinical and Experimental Immunology 126:1, 92-100
CrossRef953
Maurizio Montella, Anna Crispo, Giovanna de Bellis, Francesco Izzo, Ferdinando Frigeri, Domenico Ronga, Orlando Spada, Vincenzo Mettivier, M. Tamburini1, Oreste Cuomo. (2001) HCV and cancer: a case-control study in a high-endemic area. Liver International 21:5, 335-341
CrossRef954
N. Irani-Hakime, H. Tamim, H. Samaha, W.Y. Almawi. (2001) Prevalence of antibodies against hepatitis C virus among blood donors in Lebanon, 1997-2000. Clinical and Laboratory Haematology 23:5, 317-323
CrossRef955
Claudia O. Zein, Haitham Abu-Lebdeh, Nizar N. Zein. (2001) Spontaneous clearance of chronic hepatitis C during pregnancy. The American Journal of Gastroenterology 96:10, 3044-3045
CrossRef956
S. P. Yovtcheva. (2001) Psychiatric Comorbidity Among Hepatitis C-Positive Patients. Psychosomatics 42:5, 411-415
CrossRef957
Chien-An Sun, Hui-Chi Chen, Sheng-Nan Lu, Chien-Jen Chen, Chih-Feng Lu, San-Lin You, Szu-Heng Lin. (2001) Persistent hyperendemicity of hepatitis C virus infection in Taiwan: The important role of iatrogenic risk factors. Journal of Medical Virology 65:1, 30-34
CrossRef958
Michael P Manns, John G McHutchison, Stuart C Gordon, Vinod K Rustgi, Mitchell Shiffman, Robert Reindollar, Zachary D Goodman, Kenneth Koury, Mei-Hsiu Ling, Janice K Albrecht. (2001) Peginterferon alfa-2b plus ribavirin compared with interferon alfa-2b plus ribavirin for initial treatment of chronic hepatitis C: a randomised trial. The Lancet 358:9286, 958-965
CrossRef959
E. Beth Devine, Kris V. Kowdley, David L. Veenstra, Sean D. Sullivan. (2001) Management Strategies for Ribavirin-Induced Hemolytic Anemia in the Treatment of Hepatitis C: Clinical and Economic Implications. Value in Health 4:5, 376-384
CrossRef960
José Martínez-Raga, E. Jane Marshall, Francis Keaney, David Best, David Ball, John Strang. (2001) Hepatitis B and C in alcohol-dependent patients admitted to a UK alcohol inpatient treatment unit. Addiction Biology 6:4, 363-372
CrossRef961
SCOTT D. RHODES, RALPH J. DICLEMENTE, LELAND J. YEE, KENNETH C. HERGENRATHER. (2001) Factors Associated With Testing for Hepatitis C in an Internet-Recruited Sample of Men Who Have Sex With Men. Sexually Transmitted Diseases 28:9, 515-520
CrossRef962
Marek Radkowski, Lian-Fu Wang, Hugo Vargas, Jeffrey Wilkinson, Jorge Rakela, Tomasz Laskus. (2001) CHANGES IN HEPATITIS C VIRUS POPULATION IN SERUM AND PERIPHERAL BLOOD MONONUCLEAR CELLS IN CHRONICALLY INFECTED PATIENTS RECEIVING LIVER GRAFT FROM INFECTED DONORS. Transplantation 72:5, 833-838
CrossRef963
T. M. Shehab, S. S. Sonnad, A. S. F. Lok. (2001) Management of hepatitis C patients by primary care physicians in the USA: results of a national survey. Journal of Viral Hepatitis 8:5, 377-383
CrossRef964
Sagoe-Moses, Charles, , Pearson, Richard D., Perry, Jane, Jagger, Janine, . (2001) Risks to Health Care Workers in Developing Countries. New England Journal of Medicine 345:7, 538-541
Full Text965
C. S. Graham, L. R. Baden, E. Yu, J. M. Mrus, J. Carnie, T. Heeren, M. J. Koziel. (2001) Influence of Human Immunodeficiency Virus Infection on the Course of Hepatitis C Virus Infection: A Meta‐Analysis. Clinical Infectious Diseases 33:4, 562-569
CrossRef966
John McHutchison, Keyur Patel. (2001) Peginterferon alpha-2b: a new approach to improving response in hepatitis C patients. Expert Opinion on Pharmacotherapy 2:8, 1307-1315
CrossRef967
G. Gallucci. (2001) Treatment Contracts for Patients With Hepatitis C, Psychiatric Illness, and Substance Abuse. Psychosomatics 42:4, 353-355
CrossRef968
Davis, Gary L., , Rodrigue, James R., . (2001) Treatment of Chronic Hepatitis C in Active Drug Users. New England Journal of Medicine 345:3, 215-217
Full Text969
Lauer, Georg M., Walker, Bruce D., . (2001) Hepatitis C Virus Infection. New England Journal of Medicine 345:1, 41-52
Full Text970
Arie Regev, Eugene R. Schiff. (2001) LIVER DISEASE IN THE ELDERLY. Gastroenterology Clinics of North America 30:2, 547-563
CrossRef971
David J. Weber, William A. Rutala. (2001) The Emerging Nosocomial Pathogens Cryptosporidium, Escherichia coli O157:H7, Helicobacter pylori , and Hepatitis C: Epidemiology, Environmental Survival, Efficacy of Disinfection, and Control Measures • . Infection Control and Hospital Epidemiology 22:5, 306-315
CrossRef972
Lorna E. Thorpe, Susan L. Bailey, DeZheng Huo, Edgar R. Monterroso, Lawrence J. Ouellet. (2001) Injection-Related Risk Behaviors in Young Urban and Suburban Injection Drug Users in Chicago (1997–1999). Journal of Acquired Immune Deficiency Syndromes 27:1, 71-78
CrossRef973
Giuliano Ramadori, Volker Meier. (2001) Hepatitis C virus infection: 10 years after the discovery of the virus. European Journal of Gastroenterology & Hepatology 13:5, 465-471
CrossRef974
Flavia Bortolotti, Raffaele Iorio, Massimo Resti, Gabriella Verucchi, Raffaella Giacchino, Angela Vegnente, Pietro Vajro, Maria Grazia Marazzi, Matilde Marcellini, Cristiana Barbera, Giovanna Zuin, Lucia Zancan, Giuseppe Maggiore. (2001) An Epidemiological Survey of Hepatitis C Virus Infection in Italian Children in the Decade 1990–1999. Journal of Pediatric Gastroenterology and Nutrition 32:5, 562-566
CrossRef975
Jagdeep Obhrai, Yoshio Hall, B. S. Anand. (2001) Assessment of Fatigue and Psychologic Disturbances in Patients with Hepatitis C Virus Infection. Journal of Clinical Gastroenterology 32:5, 413-417
CrossRef976
Umaprasanna S. Karnam, Ignacia Jaca, K. Rajender Reddy. (2001) Peginterferon is here to stay12. The American Journal of Gastroenterology 96:5, 1637-1638
CrossRef977
Stefan Zeuzem. (2001) What is (cost) effective in patients with chronic hepatitis C virus infection?. European Journal of Gastroenterology & Hepatology 13:5, 473-476
CrossRef978
Lorna E. Thorpe, Susan L. Bailey, DeZheng Huo, Edgar R. Monterroso, Lawrence J. Ouellet. (2001) Injection-Related Risk Behaviors in Young Urban and Suburban Injection Drug Users in Chicago (1997–1999). JAIDS Journal of Acquired Immune Deficiency Syndromes 27:1, 71-78
CrossRef979
Sabino Riestra, Eloy Fern??ndez, Pilar Leiva, Sara Garc??a, Guillermo Ocio, Luis Rodrigo. (2001) Prevalence of hepatitis C virus infection in the general population of northern Spain. European Journal of Gastroenterology & Hepatology 13:5, 477-481
CrossRef980
Mark J. Upfal, Paul Naylor, Milton M. Mutchnick. (2001) Hepatitis C Screening and Prevalence Among Urban Public Safety Workers. Journal of Occupational and Environmental Medicine 43:4, 402-411
CrossRef981
Brian W Dymock. (2001) Emerging therapies for hepatitis C virus infection. Expert Opinion on Emerging Drugs 6:1, 13-42
CrossRef982
(2001) Risk of infection from needle reuse at a phlebotomy center. American Journal of Public Health 91:4, 636-638
CrossRef983
Makoto Ohashi, Fumihiko Kanai, Keisuke Tateishi, Hiroyoshi Taniguchi, Paola A. Marignani, Yoko Yoshida, Yasushi Shiratori, Hirofumi Hamada, Masao Omata. (2001) Target Gene Therapy for α-Fetoprotein-Producing Hepatocellular Carcinoma by E1B55k-Attenuated Adenovirus. Biochemical and Biophysical Research Communications 282:2, 529-535
CrossRef984
Michael E. de Vera, Gregory A. Smallwood, Kathia Rosado, Laurel Davis, Enrique Martinez, Shobha Sharma, Andrei C. Stieber, Thomas G. Heffron. (2001) INTERFERON-?? AND RIBAVIRIN FOR THE TREATMENT OF RECURRENT HEPATITIS C AFTER LIVER TRANSPLANTATION1. Transplantation 71:5, 678-686
CrossRef985
ROBERT W. HALEY, R. PAUL FISCHER. (2001) Commercial Tattooing as a Potentially Important Source of Hepatitis C Infection. Medicine 80:2, 134-151
CrossRef986
J. Michael Soucie, Lisa C. Richardson, Bruce Lee Evatt, Jeanne V. Linden, Bruce M. Ewenstein, Sidney F. Stein, Cindy Leissinger, Marilyn Manco-Johnson, Charles L. Sexauer, . (2001) Risk factors for infection with HBV and HCV in a largecohort of hemophiliac males. Transfusion 41:3, 338-343
CrossRef987
ROBERT A. GUNN, PAULA J. MURRAY, MARTA L. ACKERS, WILLIAM G. M. HARDISON, HAROLD S. MARGOLIS. (2001) Screening for Chronic Hepatitis B and C Virus Infections in an Urban Sexually Transmitted Disease Clinic. Sex Transm Dis 28:3, 166-170
CrossRef988
Otto S. Lin, Emmet B. Keeffe. (2001) C
URRENT TREATMENT STRATEGIES FOR CHRONIC HEPATITIS BAND C. Annual Review of Medicine 52:1, 29-49
CrossRef989
H. Kuper, H.-O. Adami, D. Trichopoulos. (2001) Infections as a major preventable cause of human cancer. Journal of Internal Medicine 249:S741, 61-74
CrossRef990
Kenneth M Shermock, Mary E Temple, Zobair M Younossi. (2001) A pharmacoeconomic appraisal of therapies for hepatitis B and C. Expert Opinion on Pharmacotherapy 2:2, 205-211
CrossRef991
Filippo Ansaldi, Francesco Torre, Bianca Marisa Bruzzone, Antonino Picciotto, Pietro Crovari, Giancarlo Icardi. (2001) Evaluation of a new hepatitis C virus sequencing assay as a routine method for genotyping. Journal of Medical Virology 63:1, 17-21
CrossRef992
(2001) Factors associated with prevalent hepatitis C: differences among young adult injection drug users in lower and upper Manhattan, New York City. American Journal of Public Health 91:1, 23-30
CrossRef993
JOHN NOELL, PAUL ROHDE, LINDA OCHS, PAUL YOVANOFF, MIRIAM J. ALTER, SCOTT SCHMID, JANICE BULLARD, CAROLYN BLACK. (2001) Incidence and Prevalence of Chlamydia, Herpes, and Viral Hepatitis in a Homeless Adolescent Population. Sexually Transmitted Diseases 28:1, 4-10
CrossRef994
Mary L. Chavez. (2001) Treatment of Hepatitis C with Milk Thistle?. Journal of Herbal Pharmacotherapy 1:3, 79-90
CrossRef995
Jane Collier, Roger Chapman. (2001) Combination Therapy with Interferon-?? and Ribavirin for Hepatitis C. BioDrugs 15:4, 225-238
CrossRef996
Ke-Qin Hu, John M. Vierling, Allan G. Redeker. (2001) Viral, host and interferon-related factors modulating the effect of interferon therapy for hepatitis C virus infection. Journal of Viral Hepatitis 8:1, 1-18
CrossRef997
Raymond S. Koff. (2001) Disease Management Programs for Hepatitis C. Disease Management and Health Outcomes 9:8, 431-439
CrossRef998
(2001) Lack of awareness of hepatitis C risk among persons who received blood transfusions before 1990. American Journal of Public Health 91:1, 47-48
CrossRef999
Schafer, Daniel F., Sorrell, Michael F., . (2000) Conquering Hepatitis C, Step by Step. New England Journal of Medicine 343:23, 1723-1724
Full Text1000
IAN M. ZITRON, MARIUS LAURINAITIS, LIHUA QU, ANN L. SILVERMAN, STUART C. GORDON. (2000) Immunological Responses in Patients Who Have Spontaneously Eradicated Hepatitis C Virus Infection. Viral Immunology 13:4, 521-531
CrossRef1001
Travis W. Waldrep, Kimberly K. Summers, Philippe A. Chiliade. (2000) Coinfection with HIV and HCV: More Questions than Answers?. Pharmacotherapy 20:12, 1499-1507
CrossRef1002
Mindy Goldman, Gwendoline Spurll. (2000) Hepatitis C lookback. Current Opinion in Hematology 7:6, 392-396
CrossRef1003
Sandra Cerda, MD, Norris M. Keating, MD, Salah Elderiny, MD, Michael J. O'Brien, MD, Andrew P. Keaveny, MD, David P. Nunes, MD, Nezam H. Afdhal, MD. (2000) An Assessment of Digital Image Analysis to Measure Fibrosis in Liver Biopsy Specimens of Patients With Chronic Hepatitis C. American Journal of Clinical Pathology 114:5, 712-718
CrossRef1004
Stefano Bellentani, Lucia Miglioli, Flora Masutti, Gioconda Saccoccio, Claudio Tiribelli. (2000) Epidemiology of hepatitis C virus infection in Italy: the slowly unraveling mystery. Microbes and Infection 2:14, 1757-1763
CrossRef1005
K. Meijer, W. M. Smid, J. Van Der Meer. (2000) Treatment of chronic hepatitis C in haemophilia patients. Haemophilia 6:6, 605-613
CrossRef1006
S Florman. (2000) Hepatitis C: the real danger to surgeons. Current Surgery 57:5, 414-420
CrossRef1007
Marguerite Jackson, Leland S. Rickman, Gina Pugliese. (2000) Emerging Infectious Diseases. American Journal of Nursing 100:10, 66-71
CrossRef1008
David H. Culver, Miriam J. Alter, Robert J. Mullan, Harold S. Margolis. (2000) Evaluation of the effectiveness of targeted lookback for HCV infection in the United States-interim results. Transfusion 40:10, 1176-1181
CrossRef1009
(2000) Estimating future hepatitis C morbidity, mortality, and costs in the United States. American Journal of Public Health 90:10, 1562-1569
CrossRef1010
M. R. Kraus. (2000) Emotional State, Coping Styles, and Somatic Variables in Patients With Chronic Hepatitis C. Psychosomatics 41:5, 377-384
CrossRef1011
Blaženka Grahovac, Jasna Bingulac-Popović, Boris Vucelić, Irena Hrstić, Rajko Ostojić, Vesna Dražić, Melita Balija, Damir Grgičević. (2000) Hypervariable Region 1 of Hepatitis C Virus Genome and Response to Interferon Therapy. Clinical Chemistry and Laboratory Medicine 38:9, 905-910
CrossRef1012
Dalsu Baris, Shelia Hoar Zahm. (2000) Epidemiology of lymphomas. Current Opinion in Oncology 12:5, 383-394
CrossRef1013
Daniel A. Carrasco, Catherine Newman, Stephen K. Tyring. (2000) Treatment of viral hepatitis. Dermatologic Therapy 13:3, 318-325
CrossRef1014
Sanjay Ramrakhiani, Bruce R. Bacon. (2000) HEPATOLOGY IN THE NEW MILLENNIUM. Medical Clinics of North America 84:5, 1085-1105
CrossRef1015
Zeuzem. (2000) Treatment of chronic hepatitis C virus infection in patients with cirrhosis. Journal of Viral Hepatitis 7:5, 327-334
CrossRef1016
Gyongyi Szabo, Eliezer Katz, Herbert L. Bonkovsky. (2000) Management of recurrent hepatitis C after liver transplantation: a concise review. The American Journal of Gastroenterology 95:9, 2164-2170
CrossRef1017
Catherine Petruff Cheney, Sanjiv Chopra, Camilla Graham. (2000) HEPATITIS C. Infectious Disease Clinics of North America 14:3, 633-667
CrossRef1018
John B. Wong, Thierry Poynard, Mei-Hsiu Ling, Janice K. Albrecht, Stephen G. Pauker, . (2000) Cost-effectiveness of 24 or 48 weeks of interferon alpha-2b alone or with ribavirin as initial treatment of chronic hepatitis c. The American Journal of Gastroenterology 95:6, 1524-1530
CrossRef1019
Claude McFarlane, Anthony N. Passannante. (2000) Transmission of viral disease in the operating room setting. Current Opinion in Anaesthesiology 13:3, 355-358
CrossRef1020
J.G. Heckmann, J. Galeoto, C.J.G. Lang, B. Neundörfer. (2000) Neurology at the Frontier. Journal of the Neurological Sciences 176:1, 75-76
CrossRef1021
Paul Desmond. (2000) Where does treatment fit into the strategy to control hepatitis C?. Journal of Gastroenterology and Hepatology 15:5 (Suppl.), E123-E125
CrossRef1022
Jia-Horng Kao, Ding-Shinn Chen. (2000) Transmission of hepatitis C virus in Asia: past and present perspectives. Journal of Gastroenterology and Hepatology 15:5 (Suppl.), E91-E96
CrossRef1023
Hamid Ghodse, George A. Ricaurte. (2000) Hepatitis C: bad news for substance misusers. Current Opinion in Psychiatry 13:3, 281-283
CrossRef1024
Damien Mallat, Eugene Schiff. (2000) Viral hepatitis. Current Opinion in Gastroenterology 16:3, 255-261
CrossRef1025
Christie A. Holland, M A Yong, Anna Barbara Moscicki, Stephen J. Durako, Linda Levin, Craig M. Wilson. (2000) Seroprevalence and Risk Factors of Hepatitis B, Hepatitis C, and Human Cytomegalovirus Among HIV-Infected and High-Risk Uninfected Adolescents. Sexually Transmitted Diseases 27:5, 296-303
CrossRef1026
John M Kaldor, Gregory J Dore, Patricia Kl Correll. (2000) Public health challenges in hepatitis C virus infection. Journal of Gastroenterology and Hepatology 15:5 (Suppl.), E83-E90
CrossRef1027
Pratt, Daniel S., Kaplan, Marshall M., . (2000) Evaluation of Abnormal Liver-Enzyme Results in Asymptomatic Patients. New England Journal of Medicine 342:17, 1266-1271
Full Text1028
P Pradat, C Trépo. (2000) HCV: epidemiology, modes of transmission and prevention of spread. Best Practice & Research Clinical Gastroenterology 14:2, 201-210
CrossRef1029
George Webster, Eleanor Barnes, David Brown, Geoffrey Dusheiko. (2000) HCV genotypes—role in pathogenesis of disease and response to therapy. Best Practice & Research Clinical Gastroenterology 14:2, 229-240
CrossRef1030
Steedman A. Sarbah, Zobair M. Younossi. (2000) Hepatitis C. Journal of Clinical Gastroenterology 30:2, 125-143
CrossRef1031
David L. Thomas. (2000) Hepatitis C epidemiology: Injecting new tools in the field. Hepatology 31:3, 790-791
CrossRef1032
Gregory L. Armstrong, Miriam J. Alter, Geraldine M. McQuillan, Harold S. Margolis. (2000) The past incidence of hepatitis C virus infection: Implications for the future burden of chronic liver disease in the United States. Hepatology 31:3, 777-782
CrossRef1033
Gary L. Davis. (2000) Current therapy for chronic hepatitis C. Gastroenterology 118:2, S104-S114
CrossRef1034
Kenneth R. Hirsch, Teresa L. Wright. (2000) ?Silent killer? or benign disease? The dilemma of hepatitis C virus outcomes. Hepatology 31:2, 536-537
CrossRef1035
Jay Epstein. (2000) Hepatitis C virus lookback: emerging science and public policy. Transfusion 40:1, 3-5
CrossRef1036
(1999) Prevalence of Hepatitis C Virus Infection in the United States. New England Journal of Medicine 341:27, 2093-2095
Full Text1037
Marcelo A. Costa, Eugene R. Schiff. (1999) Hepatitis C. Current Treatment Options in Gastroenterology 2:6, 481-489
CrossRef1038
Roberts. (1999) The economic aspects of hepatitis C - implications for haemophilia. Haemophilia 5:6, 402-409
CrossRef1039
Jonas, Maureen M., . (1999) Hepatitis C Infection in Children. New England Journal of Medicine 341:12, 912-913
Full Text
- Letters
