Original Article
Ehrlichia ewingii, a Newly Recognized Agent of Human Ehrlichiosis
N Engl J Med 1999; 341:148-155July 15, 1999
- Abstract
Background
Human ehrlichiosis is a recently recognized tick-borne infection. Four species infect humans: Ehrlichia chaffeensis, E. sennetsu, E. canis, and the agent of human granulocytic ehrlichiosis.
Methods
We tested peripheral-blood leukocytes from 413 patients with possible ehrlichiosis by broad-range and species-specific polymerase-chain-reaction (PCR) assays for ehrlichia. The species present were identified by species-specific PCR assays and nucleotide sequencing of the gene encoding ehrlichia 16S ribosomal RNA. Western blot analysis was used to study serologic responses.
Results
In four patients, ehrlichia DNA was detected in leukocytes by a broad-range PCR assay, but not by assays specific for E. chaffeensis or the agent of human granulocytic ehrlichiosis. The nucleotide sequences of these PCR products matched that of E. ewingii, an agent previously reported as a cause of granulocytic ehrlichiosis in dogs. These four patients, all from Missouri, presented between May and August 1996, 1997, or 1998 with fever, headache, and thrombocytopenia, with or without leukopenia. All had been exposed to ticks, and three were receiving immunosuppressive therapy. Serum samples obtained from three of these patients during convalescence contained antibodies that reacted with E. chaffeensis and E. canis antigens in a pattern different from that of humans with E. chaffeensis infection but similar to that of a dog experimentally infected with E. ewingii. Morulae were identified in neutrophils from two patients. All four patients were successfully treated with doxycycline.
Conclusions
These findings provide evidence of E. ewingii infection in humans. The associated disease may be clinically indistinguishable from infection caused by E. chaffeensis or the agent of human granulocytic ehrlichiosis.
Media in This Article
Figure 3
Western Blot Analysis of Serum Samples for Reactivity with Ehrlichia chaffeensis and E. canis Antigens.Figure 1
Detection of Morulae in Specimens from Patient 4.Article Activity
- Article
Human ehrlichioses are recently recognized tick-borne zoonotic infections.1 Worldwide, four species of ehrlichia have been identified as pathogens in humans. In the United States, Ehrlichia chaffeensis causes human monocytic ehrlichiosis,2,3 and a species closely related to E. equi and E. phagocytophila causes human granulocytic ehrlichiosis.4,5 E. sennetsu causes a mononucleosis-like illness in Japan and Malaysia.6 Asymptomatic infection with E. canis has been reported in one patient in Venezuela.7 The zoonotic nature of the human ehrlichioses is supported by reports of natural infections with the same ehrlichia species in dogs, deer, horses, and rodents.8-10
Human monocytic ehrlichiosis is endemic in Missouri, where 142 cases were reported from 1989 through 1997.11 By comparison, 742 cases of this disease were reported from 1986 through 1997 in the entire United States.12 Since 1994, when infection with the agent of human granulocytic ehrlichiosis was first reported,4 our laboratory at Washington University Medical Center has used polymerase-chain-reaction (PCR) assays for rapid confirmation of cases of acute ehrlichiosis. We used a broad-range PCR assay designed to detect all known species of ehrlichia to test all blood samples obtained from 1994 through 1998 from patients suspected of having ehrlichiosis. Unexpectedly, PCR products from four patients had sequences that matched those of E. ewingii, an agent previously reported as a cause of granulocytic ehrlichiosis in dogs. This report describes the clinical and laboratory characteristics of E. ewingii infection and the methods used to identify the infection in these four patients.
Methods
Specimens
EDTA-treated blood samples were collected from 413 patients with possible ehrlichiosis during the period from 1994 through 1998. Leukocytes were separated by sedimentation with dextran (molecular weight, 500,000; T500, Amersham Pharmacia Biotech, Piscataway, N.J.), and alkaline lysates were prepared as previously described.13 DNA from 300 μl of each sample was extracted with a QIAamp blood kit (Qiagen, Valencia, Calif.) and resuspended in 70 μl of 10 mM TRIS–EDTA buffer.
PCR Assays
Four diagnostic PCR assays targeting the 16S ribosomal RNA (rRNA) gene were used: a broad-range assay designed to amplify all known ehrlichia species and assays specific for E. chaffeensis, E. ewingii, and the agent of human granulocytic ehrlichiosis. The following primers were used: ECA and HE3 for the broad-range assay,14,15 HE1 and HE3 for the E. chaffeensis assay,14 EHR 521 and EHR 747 for the assay for the agent of human granulocytic ehrlichiosis,16 and EWI and HE3 for the E. ewingii assay.17 For each patient, PCR assays were performed on lysates containing DNA from 105 leukocytes. Reactions were performed in 100-μl samples with a DNA thermal cycler (model 480, Perkin-Elmer Cetus, Norwalk, Conn.). Final concentrations of reaction mixtures and cycling protocols for the broad-range assay, the E. chaffeensis–specific assay, and the E. ewingii–specific assay were based on modifications of a previously published procedure.15
For the broad-range assay, the reaction mixture contained 10 mM TRIS (pH 9.2), 75 mM potassium chloride, 1.5 mM magnesium chloride, 200 μM 2'-deoxyadenosine triphosphate, 200 μM deoxycytidine triphosphate, 200 μM deoxyguanosine triphosphate, 200 μM deoxythymidine triphosphate, 15 percent glycerol, 40 pmol of each primer, and 2.5 U of Taq polymerase. Amplification was then carried out with 3 cycles at 94°C for 1 minute, 55°C for 2 minutes, and 70°C for 1.5 minutes followed by 37 cycles at 88°C for 1 minute, 52°C for 2 minutes, and 70°C for 1.5 minutes.
For the E. chaffeensis–specific assay and the E. ewingii–specific assay, the reaction mixture consisted of 10 mM TRIS–hydrochloric acid (pH 8.8), 75 mM potassium chloride, 1.5 mM magnesium chloride, 200 μM 2'-deoxyadenosine triphosphate, 200 μM deoxycytidine triphosphate, 200 μM deoxyguanosine triphosphate, 200 μM deoxythymidine triphosphate, 50 pmol of each primer, 5 percent formamide, and 2.5 U of Taq polymerase. Amplification was then performed according to the same protocol as that used for the broad-range assay, except that the initial phase consisted of five cycles at 94°C for 1 minute, 60°C for 2 minutes, and 70°C for 1.5 minutes. For the assay for the agent of human granulocytic ehrlichiosis, we used a final reaction mixture and cycling conditions described by Pancholi et al.16
Nucleotide Sequencing
Amplicons from the broad-range PCR assay for ehrlichia were sequenced by adding 125 ng of purified amplicon and 3.2 pmol of primer to a dye-terminator cycle-sequencing reaction (Perkin-Elmer Applied Biosystems, Foster City, Calif.) with AmpliTaq FS DNA polymerase. Extension products were analyzed in an automated DNA sequencer (model 373A, Applied Biosystems). Sequence data derived from reactions initiated by at least two primers for each PCR product were processed with the Factura program (Applied Biosystems) and aligned with known sequences from GenBank and with other experimental sequences.
Two other methods were used to sequence large portions of the 16S rRNA gene. At Washington University School of Medicine, a 1360-bp product of a nested PCR assay amplified from blood samples from two of the four patients with samples positive for E. ewingii (Patients 3 and 4 in Table 1Table 1
Clinical Characteristics of the Four Patients with Ehrlichia ewingii Infection.) was sequenced with the use of 8F and 1448R as outside primers and 15F and 1442R as inside primers.17 At the Centers for Disease Control and Prevention (CDC), amplification of 16S rDNA from samples of whole blood was performed according to the method of Anderson et al.3 with two exceptions: primer EC12A (5'TGATCCTGGCTCAGAACGAACG) was substituted for EC12, and the PCR product was sequenced directly. For Patient 3, a 2-μl sample of the reaction mixture was used as a template in a heminested PCR with primers EC12A and EC11.3 The product was cloned into the TA cloning vector pGEM-T (Promega, Madison, Wis.) and sequenced with a dRhodamine kit (Perkin-Elmer) and an automated sequencer (model 377, Applied Biosystems).Serologic Analysis
Serum and plasma samples obtained from the patients during the acute and convalescent phases were evaluated at the CDC with an indirect immunofluorescence assay for IgG antibodies reactive with E. chaffeensis. 18 End-point titers were recorded as the reciprocal of the highest dilution exhibiting specific fluorescence.
Serum samples from Patients 1, 2, 3, and 4 and from two dogs belonging to Patient 3 and one dog experimentally infected with E. ewingii were tested by Western blot analysis with preparations of E. chaffeensis and E. canis that were free of host cells (chromatography-purified) as antigen, as previously described19 but with the following modification. The assay membranes were incubated with the human or canine serum at a 1:1000 dilution and then with a preparation of peroxidase-conjugated, affinity-purified antihuman IgG, IgM, and IgA (Kirkegaard & Perry Laboratories, Gaithersburg, Md.) or with antidog IgG at 1:2000, followed by bathing in developing and stop solutions.
Results
Patients
From 1994 through 1998, samples from 413 patients with possible ehrlichiosis were tested by PCR. A total of 60 samples (15 percent) were positive for an ehrlichia species: 56 for E. chaffeensis and 4 for E. ewingii. All four patients with E. ewingii were male, lived in Missouri, and presented with a febrile illness between May and August 1996, 1997, or 1998. They ranged in age from 11 to 65 years, and all reported having been exposed to ticks before their illness (Table 1). Three of the four patients were receiving immunosuppressive therapy for underlying conditions. All four had fever and headache, prompting lumbar puncture in three. All four patients had thrombocytopenia (<150,000 platelets per cubic millimeter), and two had leukopenia (<4500 white cells per cubic millimeter). All four patients responded to treatment with doxycycline.
Clinical data for all four patients are summarized in Table 1. Patients 1 and 4 are described in detail below.
Patient 1 was an 11-year-old boy from southern Missouri who had received a kidney graft from a living related donor at 27 months of age. In May 1996, fever, headache, nasal congestion, myalgia, and a stiff neck developed. The patient had a pet dog and had been exposed to ticks on multiple occasions during the month preceding his illness. Physical examination revealed acute illness with mild cervical, axillary, and inguinal lymphadenopathy. The white-cell count was 4500 per cubic millimeter, the hemoglobin level was 9.7 g per deciliter (6.0 mmol per liter), the platelet count was 105,000 per cubic millimeter, and the creatinine level was 1.3 mg per deciliter (115 μmol per liter; previous base-line value during regular follow-up after transplantation, 1.0 mg per deciliter [88.4 μmol per liter]). Routine bacterial cultures of blood and PCR assays of blood were negative for cytomegalovirus and Epstein–Barr virus. The boy was treated with intravenous vancomycin, ceftazidime, and doxycycline. A blood sample obtained on the day of admission was negative for E. chaffeensis on a PCR assay. No morulae were seen on a peripheral-blood smear obtained on the third hospital day. Doxycycline treatment was discontinued after five days.
One week after discharge from the hospital, the boy's condition had improved. A broad-range PCR assay of the blood sample initially tested for E. chaffeensis subsequently tested positive for ehrlichia, and treatment with doxycycline was resumed and continued for 10 days. A serum specimen obtained during convalescence and tested by an indirect immunofluorescence assay contained antibodies reactive with E. chaffeensis at a titer of at least 2048. No antibodies to the agent of human granulocytic ehrlichiosis or rickettsia species were detected.
Patient 4 was a 65-year-old man with a history of chronic obstructive pulmonary disease and hypertension. In August 1998, a respiratory tract infection developed and was treated with amoxicillin and 60 mg of prednisone per day, with subsequent tapering of the dose. Twelve days later a severe frontal headache developed. The patient had regular contact with a dog and had hiked in the woods and removed a tick from his left shoulder several days before the onset of symptoms. On examination, his temperature was 39.3°C and his pulse rate was 100 beats per minute. His neck was supple, and breath sounds on the right were decreased. The liver and spleen were not palpable, and there was no lymphadenopathy. The white-cell count was 6800 per cubic millimeter, with 79 percent neutrophils, 9 percent lymphocytes, 9 percent monocytes, 1 percent eosinophils, and 2 percent basophils; the hemoglobin level was 9.4 g per deciliter (5.8 mmol per liter), and the platelet count was 54,000 per cubic millimeter.
A lumbar puncture revealed an opening pressure of 20 cm of water. The cerebrospinal fluid contained 774 white cells per cubic millimeter, with 95 percent neutrophils, and was initially reported to contain intracellular gram-negative coccobacilli. Ceftriaxone therapy was begun. Subsequently, examination of the peripheral-blood smear revealed morulae in approximately 50 percent of neutrophils and in a few eosinophils (Figure 1AFigure 1
Detection of Morulae in Specimens from Patient 4.), and on reinspection the cerebrospinal fluid smear was found to contain morulae in neutrophils (Figure 1B). Treatment with doxycycline was begun for possible ehrlichiosis. The broad-range ehrlichia PCR assay revealed ehrlichia DNA in blood and cerebrospinal fluid, and serologic studies indicated that seroconversion to E. chaffeensis had taken place (Table 1). The patient received a two-week course of doxycycline and had an uneventful recovery.Molecular Testing of Specimens
PCR analyses of specimens from Patients 1, 2, 3, and 4 yielded positive results on the broad-range PCR assay and negative results on the assays specific for E. chaffeensis and the agent of human granulocytic ehrlichiosis.
Sequencing of PCR Products
To identify the organism responsible for the positive results on the broad-range PCR test for the four patients, the products of this assay were sequenced. Sequences from all four patients were identical: all differed at 12 nucleotide positions from the known sequence of E. chaffeensis (GenBank accession number, M73222) but matched the known sequence of the 16S rRNA gene of E. ewingii (GenBank accession number, U96436) (Table 2Table 2
Nucleotide Sequences of the PCR Products from 4 Patients with Ehrlichia ewingii Infection and 12 with E. chaffeensis Infection.). In addition, the four sequences contained a 2-bp insert not present in the E. chaffeensis sequence. All these differences were within a 28-bp segment from positions 54 through 81 of the E. ewingii 16S rRNA gene. Sequences from 12 patients in whom E. chaffeensis infection had been diagnosed on the basis of positive results with E. chaffeensis–specific PCR were identical to one another and to the sequence of E. chaffeensis. Sequencing of the 16S rRNA Gene
Partial and nearly full-length 16S rRNA gene sequences were obtained from blood specimens from Patients 3 and 4. A 750-bp segment from the 5' end of the 16S gene from Patient 3 and 951-bp and 1284-bp segments from Patient 4 were amplified and sequenced. All the sequences were identical to the corresponding 16S rRNA sequence of E. ewingii.
PCR Assay for E. ewingii
To confirm the presence of E. ewingii, a PCR assay specific for E. ewingii was performed on the product of the broad-range PCR assay from Patient 1 (for whom no blood specimen was available) and on blood samples from Patients 2, 3, and 4, as well as on blood samples from 12 of the 56 patients with PCR-confirmed E. chaffeensis infection. Positive results were obtained only in specimens from Patients 1, 2, 3, and 4 (Figure 2AFigure 2
Ethidium Bromide–Stained Gels of Products of PCR Assays for Ehrlichia., Figure 2B, Figure 2C, and Figure 2D). E. ewingii DNA was also detected in blood samples from two dogs owned by Patient 3. Neither dog was ill at the time the blood samples were obtained.Serologic Studies
Serum samples from Patients 1, 3, and 4 contained IgG antibody that reacted with E. chaffeensis at titers of at least 2048, 256, and 4096, respectively, on an indirect immunofluorescence assay. Western blot analysis of samples obtained from these three patients during convalescence, with the use of E. chaffeensis and E. canis as antigens, revealed patterns indicative of infection with E. ewingii: the samples reacted with antigens of at least 40 kd but not with the 28-kd major antigen of E. chaffeensis or the 30-kd major antigen of E. canis 19-21 (Figure 3Figure 3
Western Blot Analysis of Serum Samples for Reactivity with Ehrlichia chaffeensis and E. canis Antigens.). A serum sample from one of the two dogs belonging to Patient 3 and from the dog experimentally infected with E. ewingii showed the same pattern. The serum sample from the other dog belonging to Patient 3 had a pattern suggestive of infection with multiple ehrlichia species: it showed reactivity with high-molecular-weight antigens as well as with the 28-kd and 30-kd antigens of E. chaffeensis and E. canis, respectively. Serum samples from two patients with E. chaffeensis were strongly reactive to the 28-kd and 30-kd antigens, indicating infection with either E. chaffeensis or E. canis (Figure 3).Discussion
Using evidence obtained from molecular and serologic testing, we confirmed that E. ewingii caused disease in four patients from Missouri, an area where E. chaffeensis infection is also endemic. Findings that supported the diagnosis of E. ewingii infection included the detection of E. ewingii DNA sequences in the patients' blood specimens, serologic responses similar to those of dogs infected with E. ewingii, and the presence of morulae in granulocytes from two of the patients, both of whom were negative on PCR assays for the agent of human granulocytic ehrlichiosis. The finding of morulae in these patients' granulocytes parallels the finding of morulae in the granulocytes of dogs infected with E. ewingii and is in contrast to the presence of morulae in mononuclear cells in patients infected with the closely related E. chaffeensis. The four patients, all of whom were male and had a recent history of exposure to ticks, presented with an illness indistinguishable from the other human ehrlichioses recognized in the United States. Indeed, on the basis of the clinical features, ehrlichial infection was included in the initial differential diagnoses.
The observation that three of these patients were immunocompromised raises the question whether E. ewingii infection is symptomatic primarily in such patients. Nonetheless, the fourth patient had moderate disease despite an apparently normal immune system. All four patients had dramatic responses to treatment with doxycycline, as is seen in cases of infection caused by E. chaffeensis or the agent of human granulocytic ehrlichiosis.1,4,5
Canine granulocytic ehrlichiosis was first described in a dog from Arkansas in 1971,22 and subsequently in dogs from several other states, including Missouri.23 E. ewingii was identified as an etiologic agent of this syndrome in 1992.24 Since then, canine infection with E. ewingii has been reported in Oklahoma, North Carolina, and Virginia.8,24,25 E. ewingii is one member of a group of closely related species that also includes E. chaffeensis, E. muris, E. canis, and Cowdria ruminantium. Members of this group exhibit antigenic similarities and closely related 16S rRNA gene sequences (≥98 percent homology between E. ewingii and E. chaffeensis and between E. ewingii and E. canis).24 In dogs, E. ewingii infection is usually milder than E. canis infection and responds to treatment with tetracycline.23
In experiments in dogs, E. ewingii infection has been transmitted by the Lone Star tick (Amblyomma americanum),26 the tick that also transmits E. chaffeensis. 27 All four of our patients had been exposed to ticks and had had contact with dogs shortly before the onset of symptoms. Dogs belonging to one of the patients had serologic and molecular evidence of asymptomatic E. ewingii infection, suggesting that dogs may act as a reservoir for this agent. Human and canine infections with identical ehrlichia species have also been described in Minnesota, Wisconsin, and Sweden, where the agent of human granulocytic ehrlichiosis has been implicated as a cause of both human and canine granulocytic ehrlichiosis.28,29
We do not know whether E. ewingii infection in humans is a new phenomenon or merely a newly recognized phenomenon. As illustrated by the cases of Patients 1, 3, and 4, E. ewingii and E. chaffeensis are antigenically related and stimulate the production of cross-reacting antibodies, as measured by indirect immunofluorescence assay.19 Differences between E. ewingii infection and E. chaffeensis infection in the pattern of serologic reactivity were apparent on Western blot analyses: in specimens from the patients and from dogs infected with E. ewingii, there was no reactivity to the 28-kd antigen of E. chaffeensis or to the 30-kd antigen of E. ewingii. This pattern suggests that the cross-reactivity observed on the indirect immunofluorescence assay is due to other antigens, such as those of higher molecular weight that were seen on the Western blots. Since the indirect immunofluorescence assay is the most widely used serologic method for detecting antibodies to ehrlichia, the use of this method could lead to erroneous identification of E. ewingii infection as E. chaffeensis infection.
Since E. ewingii has not been cultivated, laboratory confirmation of infection currently requires molecular techniques. Because of the variation between E. ewingii and E. chaffeensis in the 16S rRNA gene segment corresponding to the binding region of published E. chaffeensis primers,14 PCR testing with E. chaffeensis 16S rRNA primers would fail to detect E. ewingii. Thus, it is possible that some previously reported cases of ehrlichiosis with a serologic response to E. canis or E. chaffeensis antigens but negative results on PCR assay for E. chaffeensis may have been due to E. ewingii. 30 Human infection with E. ewingii is also suggested by the report of a patient from Missouri who had granulocytic ehrlichiosis and positive results on a broad-range PCR assay but negative results on a E. chaffeensis–specific assay.31
On the basis of our findings, E. ewingii should be added to the list of ehrlichia pathogens of humans. In our laboratory, E. ewingii accounted for 7 percent of all specimens that were positive for ehrlichia. Further study is required to refine this estimate and to define more precisely the magnitude, geographic distribution, ecologic features, and clinical manifestations of E. ewingii infection in humans.
Supported by a grant from the National Institutes of Health (RO1 AI409343, to Dr. Rikihisa).
We are indebted to Janet Watt and Magda Dwidar, M.D., for technical assistance; to S.L. Stockham, D.V.M., for E. ewingii–infected canine blood for use as a positive control; to Thomas Steinberg, M.D., for assistance with the photography of patient specimens; and to Barbara Hartman for assistance in the preparation of the manuscript.
Source Information
From the Edward Mallinckrodt Department of Pediatrics (R.S.B., M.A., S.P.H., M.G.-K., G.A.S.) and the Department of Medicine (A.M.L., N.S.), Washington University School of Medicine, St. Louis; St. Louis Children's Hospital, St. Louis (R.S.B., M.A., S.P.H., M.G.-K., G.A.S.); the Centers for Disease Control and Prevention, Atlanta (C.D.P., J.W.S.); the Department of Veterinary Biosciences, College of Veterinary Medicine, Ohio State University, Columbus (Y.R., A.U.); and St. John's Mercy Medical Center, St. Louis (F.A.M.).
Address reprint requests to Dr. Storch at the Department of Pediatrics, Division of Infectious Diseases, St. Louis Children's Hospital, 1 Children's Pl., St. Louis, MO 63110, or at storch@a1.kids. wustl.edu.
- References
References
1
Dumler JS ,Bakken JS . Ehrlichial diseases of humans: emerging tick-borne infections. Clin Infect Dis 1995;20:1102-1110
CrossRef | Web of Science | Medline2
Maeda K ,Markowitz N ,Hawley RC ,Ristic M ,Cox D ,McDade JE . Human infection with Ehrlichia canis, a leukocytic rickettsia. N Engl J Med 1987;316:853-856
Full Text | Web of Science | Medline3
Anderson BE ,Dawson JE ,Jones DC ,Wilson KH . Ehrlichia chaffeensis, a new species associated with human ehrlichiosis. J Clin Microbiol 1991;29:2838-2842
Web of Science | Medline4
Bakken JS ,Dumler JS ,Chen SM ,Eckman MR ,Van Etta LL ,Walker DH . Human granulocytic ehrlichiosis in the upper midwest United States: a new species emerging? JAMA 1994;272:212-218
CrossRef | Web of Science | Medline5
Chen SM ,Dumler JS ,Bakken JS ,Walker DH . Identification of a granulocytotropic Ehrlichia species as the etiologic agent of human disease. J Clin Microbiol 1994;32:589-595
Web of Science | Medline6
Misao T ,Kobayashi Y . Studies on infectious mononucleosis: isolationof etiologic agent from blood, bone marrow, and lymph node of a patient with infectious mononucleosis by using mice. Tokyo Iji Shinshi 1954;71:683-6867
Perez M ,Rikihisa Y ,Wen B . Ehrlichia canis-like agent isolated from a man in Venezuela: antigenic and genetic characterization. J Clin Microbiol 1996;34:2133-2139
Web of Science | Medline8
Dawson JE ,Biggie KL ,Warner CK , et al. Polymerase chain reaction evidence of Ehrlichia chaffeensis, an etiologic agent of human ehrlichiosis, in dogs from southeast Virginia. Am J Vet Res 1996;57:1175-1179
Web of Science | Medline9
Lockhart JM ,Davidson WR ,Stallknecht DE ,Dawson JE ,Howerth EW . Isolation of Ehrlichia chaffeensis from wild white-tailed deer (Odocoileus virginianus) confirms their role as natural reservoir hosts. J Clin Microbiol 1997;35:1681-1686
Web of Science | Medline10
Telford SR III ,Dawson JE ,Katavolos P ,Warner CK ,Kolbert CP ,Persing DH . Perpetuation of the agent of human granulocytic ehrlichiosis in a deer tick-rodent cycle. Proc Natl Acad Sci U S A 1996;93:6209-6214
CrossRef | Web of Science | Medline11
Hardin LE ,Satalowich FT . Tick-borne disease summary -- 1997. Mo Epidemiol 1998;20:6-912
McQuiston JH, Paddock CD, Holman RC, Childs JE. Human ehrlichioses in the United States. Emerg Infect Dis (in press).
13
Roberts TC ,Buller RS ,Gaudreault-Keener M , et al. Effects of storage temperature and time on qualitative and quantitative detection of cytomegalovirus in blood specimens by shell vial culture and PCR. J Clin Microbiol 1997;35:2224-2228
Web of Science | Medline14
Anderson BE ,Sumner JW ,Dawson JE , et al. Detection of the etiologic agent of human ehrlichiosis by polymerase chain reaction. J Clin Microbiol 1992;30:775-780
Web of Science | Medline15
Standaert SM ,Dawson JE ,Schaffner W , et al. Ehrlichiosis in a golf-oriented retirement community. N Engl J Med 1995;333:420-425
Full Text | Web of Science | Medline16
Pancholi P ,Kolbert CP ,Mitchell PD , et al. Ixodes dammini as a potential vector of human granulocytic ehrlichiosis. J Infect Dis 1995;172:1007-1012
CrossRef | Web of Science | Medline17
Warner CK, Dawson JE. Genus- and species-level identification of Ehrlichia species by PCR and sequencing. In: Persing DH, ed. PCR protocols for emerging infectious diseases: a supplement to Diagnostic Molecular Microbiology: Principles and Applications. Washington, D.C.: ASM Press, 1996:100-5.
18
Dawson JE ,Rikihisa Y ,Ewing SA ,Fishbein DB . Serologic diagnosis of human ehrlichiosis using two Ehrlichia canis isolates. J Infect Dis 1991;163:564-567
CrossRef | Web of Science | Medline19
Rikihisa Y ,Ewing SA ,Fox JC ,Siregar AG ,Pasaribu FH ,Malole MB . Analyses of Ehrlichia canis and a canine granulocytic Ehrlichia infection. J Clin Microbiol 1992;30:143-148
Web of Science | Medline20
Ohashi N ,Unver A ,Zhi N ,Rikihisa Y . Cloning and characterization of multigenes encoding the immunodominant 30-kilodalton major outer membrane proteins of Ehrlichia canis and application of the recombinant protein for serodiagnosis. J Clin Microbiol 1998;36:2671-2680
Web of Science | Medline21
Reddy GR ,Sulsona CR ,Barbet AF ,Mahan SM ,Burridge MJ ,Alleman AR . Molecular characterization of a 28 kDa surface antigen gene family of the tribe Ehrlichiae. Biochem Biophys Res Commun 1998;247:636-643
CrossRef | Web of Science | Medline22
Ewing SA ,Roberson WR ,Buckner RG ,Hayat CS . A new strain of Ehrlichia canis. J Am Vet Med Assoc 1971;159:1771-1774
Web of Science | Medline23
Stockham SL ,Schmidt DA ,Curtis KS ,Schauf BG ,Tyler JW ,Simpson ST . Evaluation of granulocytic ehrlichiosis in dogs of Missouri, including serologic status to Ehrlichia canis, Ehrlichia equi and Borrelia burgdorferi. Am J Vet Res 1992;53:63-68
Web of Science | Medline24
Anderson BE ,Greene CE ,Jones DC ,Dawson JE . Ehrlichia ewingii sp. nov., the etiologic agent of canine granulocytic ehrlichiosis. Int J Syst Bacteriol 1992;42:299-302
CrossRef | Medline25
Breitschwerdt EB ,Hegarty BC ,Hancock SI . Sequential evaluation of dogs naturally infected with Ehrlichia canis, Ehrlichia chaffeensis, Ehrlichia equi, Ehrlichia ewingii, or Bartonella vinsonii. J Clin Microbiol 1998;36:2645-2651
Web of Science | Medline26
Anziani OS ,Ewing SA ,Barker RW . Experimental transmission of a granulocytic form of the tribe Ehrlichieae by Dermacentor variabilis and Amblyomma americanum to dogs. Am J Vet Res 1990;51:929-931
Web of Science | Medline27
Anderson BE ,Sims KG ,Olson JG , et al. Amblyomma americanum: a potential vector of human ehrlichiosis. Am J Trop Med Hyg 1993;49:239-244
Web of Science | Medline28
Greig B ,Asanovich KM ,Armstrong PJ ,Dumler JS . Geographic, clinical, serologic, and molecular evidence of granulocytic ehrlichiosis, a likely zoonotic disease, in Minnesota and Wisconsin dogs. J Clin Microbiol 1996;34:44-48
Web of Science | Medline29
Johansson KE ,Pettersson B ,Uhlen M ,Gunnarsson A ,Malmqvist M ,Olsson E . Identification of the causative agent of granulocytic ehrlichiosis in Swedish dogs and horses by direct solid phase sequencing of PCR products from the 16S rRNA gene. Res Vet Sci 1995;58:109-112
CrossRef | Web of Science | Medline30
Everett ED ,Evans KA ,Henry RB ,McDonald G . Human ehrlichiosis in adults after tick exposure: diagnosis using polymerase chain reaction. Ann Intern Med 1994;120:730-735
Web of Science | Medline31
Ratnasamy N ,Everett ED ,Roland WE ,McDonald G ,Caldwell CW . Central nervous system manifestations of human ehrlichiosis. Clin Infect Dis 1996;23:314-319
CrossRef | Web of Science | Medline
- Citing Articles (99)
Citing Articles
1
Seraphine N. Esemu, Lucy M. Ndip, Roland N. Ndip. (2011) Ehrlichia species, probable emerging human pathogens in sub-Saharan Africa: environmental exacerbation. Reviews on Environmental Health---
CrossRef2
Jere W. McBride, David H. Walker. (2011) Molecular and cellular pathobiology of Ehrlichia infection: targets for new therapeutics and immunomodulation strategies. Expert Reviews in Molecular Medicine 13,
CrossRef3
Vera Rar, Irina Golovljova. (2011) Anaplasma, Ehrlichia, and “Candidatus Neoehrlichia” bacteria: Pathogenicity, biodiversity, and molecular genetic characteristics, a review. Infection, Genetics and Evolution
CrossRef4
Pritt, Bobbi S., Sloan, Lynne M., Johnson, Diep K. Hoang, Munderloh, Ulrike G., Paskewitz, Susan M., McElroy, Kristina M., McFadden, Jevon D., Binnicker, Matthew J., Neitzel, David F., Liu, Gongping, Nicholson, William L., Nelson, Curtis M., Franson, Joni J., Martin, Scott A., Cunningham, Scott A., Steward, Christopher R., Bogumill, Kay, Bjorgaard, Mary E., Davis, Jeffrey P., McQuiston, Jennifer H., Warshauer, David M., Wilhelm, Mark P., Patel, Robin, Trivedi, Vipul A., Eremeeva, Marina E., . (2011) Emergence of a New Pathogenic Ehrlichia Species, Wisconsin and Minnesota, 2009. New England Journal of Medicine 365:5, 422-429
Full Text5
L.E. Romero, A.I. Meneses, L. Salazar, M. Jiménez, J.J. Romero, D.M. Aguiar, M.B. Labruna, G. Dolz. (2011) First isolation and molecular characterization of Ehrlichia canis in Costa Rica, Central America. Research in Veterinary Science 91:1, 95-97
CrossRef6
G. Subramanian, O. Mediannikov, E. Angelakis, C. Socolovschi, G. Kaplanski, L. Martzolff, D. Raoult. (2011) Diplorickettsia massiliensis as a human pathogen. European Journal of Clinical Microbiology & Infectious Diseases
CrossRef7
Michael J. Yabsley, Dustin S. Adams, Thomas P. O’Connor, Ramaswamy Chandrashekar, Susan E. Little. (2011) Experimental primary and secondary infections of domestic dogs with Ehrlichia ewingii. Veterinary Microbiology 150:3-4, 315-321
CrossRef8
Yasuko Rikihisa. (2011) Diagnosis of canine monocytic ehrlichiosis: Development of advanced techniques to combat a global disease. The Veterinary Journal 187:3, 285-286
CrossRef9
Kotaro MATSUMOTO, Toshihiko TAKEUCHI, Naoaki YOKOYAMA, Yoshito KATAGIRI, Mamoru OOSHIRO, Satoshi ZAKIMI, Fumihiko KAWAMORI, Norio OHASHI, Hisashi INOKUMA. (2011) Detection of the New Ehrlichia Species Closely Related to Ehrlichia ewingii from Haemaphysalis longicornis in Yonaguni Island, Okinawa, Japan. Journal of Veterinary Medical Science 73:11, 1485-1488
CrossRef10
Mária Nováková, Bronislava Víchová. (2010) Granulocytic anaplasmosis — emerging tick-borne disease of humans and animals. Biologia 65:6, 925-931
CrossRef11
Susan E. Little, Thomas P. O’Connor, Julie Hempstead, Jill Saucier, Mason V. Reichard, Katrina Meinkoth, James H. Meinkoth, Blaine Andrews, Steve Ullom, Sidney A. Ewing, Ramaswamy Chandrashekar. (2010) Ehrlichia ewingii infection and exposure rates in dogs from the southcentral United States. Veterinary Parasitology 172:3-4, 355-360
CrossRef12
Linda J. Salinas, Ronald A. Greenfield, Susan E. Little, Gene W. Voskuhl. (2010) Tickborne Infections in the Southern United States. The American Journal of the Medical Sciences 340:3, 194-201
CrossRef13
Jere W McBride, David H Walker. (2010) Progress and obstacles in vaccine development for the ehrlichioses. Expert Review of Vaccines 9:9, 1071-1082
CrossRef14
Sara B. Cohen, Michael J. Yabsley, James D. Freye, Brett G. Dunlap, Meghan E. Rowland, Junjun Huang, John R. Dunn, Timothy F. Jones, Abelardo C. Moncayo. (2010) Prevalence of Ehrlichia chaffeensis and Ehrlichia ewingii in Ticks from Tennessee. Vector-Borne and Zoonotic Diseases 10:5, 435-440
CrossRef15
Ju Jiang, Tamasin Yarina, Melissa K. Miller, Ellen Y. Stromdahl, Allen L. Richards. (2010) Molecular Detection of Rickettsia amblyommii in Amblyomma americanum Parasitizing Humans. Vector-Borne and Zoonotic Diseases 10:4, 329-340
CrossRef16
Yasuko Rikihisa. (2010) Anaplasma phagocytophilum and Ehrlichia chaffeensis: subversive manipulators of host cells. Nature Reviews Microbiology 8:5, 328-339
CrossRef17
William L. Nicholson, Kelly E. Allen, Jennifer H. McQuiston, Edward B. Breitschwerdt, Susan E. Little. (2010) The increasing recognition of rickettsial pathogens in dogs and people. Trends in Parasitology 26:4, 205-212
CrossRef18
J. Stephen Dumler, Didier Raoult. 2010. Ehrlichia and Anaplasma. .
CrossRef19
Nahed Ismail, Karen C. Bloch, Jere W. McBride. (2010) Human Ehrlichiosis and Anaplasmosis. Clinics in Laboratory Medicine 30:1, 261-292
CrossRef20
Stephanie R. Heise, M. S. Elshahed, S. E. Little. (2010) Bacterial Diversity in Amblyomma americanum (Acari: Ixodidae) with a Focus on Members of the Genus Rickettsia. Journal of Medical Entomology 47:2, 258-268
CrossRef21
Zerai Woldehiwet. (2010) The natural history of Anaplasma phagocytophilum. Veterinary Parasitology 167:2-4, 108-122
CrossRef22
Lucy M. Ndip, Roland N. Ndip, Seraphine N. Esemu, David H. Walker, Jere W. McBride. (2010) Predominance of Ehrlichia chaffeensis in Rhipicephalus sanguineus ticks from kennel-confined dogs in Limbe, Cameroon. Experimental and Applied Acarology 50:2, 163-168
CrossRef23
B. Doudier, J. Olano, P. Parola, P. Brouqui. (2010) Factors contributing to emergence of Ehrlichia and Anaplasma spp. as human pathogens. Veterinary Parasitology 167:2-4, 149-154
CrossRef24
Durland Fish, James E. Childs. (2009) Community-Based Prevention of Lyme Disease and Other Tick-Borne Diseases Through Topical Application of Acaricide to White-Tailed Deer: Background and Rationale. Vector-Borne and Zoonotic Diseases 9:4, 357-364
CrossRef25
Rachael J Thomas, J Stephen Dumler, Jason A Carlyon. (2009) Current management of human granulocytic anaplasmosis, human monocytic ehrlichiosis and Ehrlichia ewingii ehrlichiosis. Expert Review of Anti-infective Therapy 7:6, 709-722
CrossRef26
Jerome Goddard, Andrea S. Varela-Stokes. (2009) Role of the lone star tick, Amblyomma americanum (L.), in human and animal diseases. Veterinary Parasitology 160:1-2, 1-12
CrossRef27
Ai Takano, Shuji Ando, Toshio Kishimoto, Hiromi Fujita, Teruki Kadosaka, Yoshiki Nitta, Hiroki Kawabata, Haruo Watanabe. (2009) Presence of a novel Ehrlichia sp. in Ixodes granulatus found in Okinawa, Japan. Microbiology and Immunology 53:2, 101-106
CrossRef28
Stephen K. Chapes, Roman R. Ganta. (2008) Defining the immune response to Ehrlichia species using murine models. Veterinary Parasitology 158:4, 344-359
CrossRef29
David H. Walker, Christopher D. Paddock, J. Stephen Dumler. (2008) Emerging and Re-emerging Tick-Transmitted Rickettsial and Ehrlichial Infections. Medical Clinics of North America 92:6, 1345-1361
CrossRef30
Vera A. Rar, Natalya N. Livanova, Victor V. Panov, Irina V. Kozlova, Natalya M. Pukhovskaya, Nelya P. Vysochina, Sergey E. Tkachev, Leonid I. Ivanov. (2008) Prevalence of Anaplasma and Ehrlichia species in Ixodes persulcatus ticks and small mammals from different regions of the Asian part of Russia. International Journal of Medical Microbiology 298, 222-230
CrossRef31
Johan S. Bakken, Stephen Dumler. (2008) Human Granulocytic Anaplasmosis. Infectious Disease Clinics of North America 22:3, 433-448
CrossRef32
Amanda D. Loftis, Michael L. Levin, J. Paul Spurlock. (2008) Two USA Ehrlichia spp. cause febrile illness in goats. Veterinary Microbiology 130:3-4, 398-402
CrossRef33
Michael J. Yabsley, Staci M. Murphy, M. Page Luttrell, Susan E. Little, Robert F. Massung, David E. Stallknecht, Lisa A. Conti, Carina G.M. Blackmore, Lance A. Durden. (2008) Experimental and Field Studies on the Suitability of Raccoons ( Procyon lotor ) as Hosts for Tick-Borne Pathogens. Vector-Borne and Zoonotic Diseases 8:4, 491-504
CrossRef34
Edwin J. Masters, Chelsea N. Grigery, Reid W. Masters. (2008) STARI, or Masters Disease: Lone Star Tick–Vectored Lyme-like Illness. Infectious Disease Clinics of North America 22:2, 361-376
CrossRef35
Jianli Dong, Juan P. Olano, Jere W. McBride, David H. Walker. (2008) Emerging Pathogens: Challenges and Successes of Molecular Diagnostics. The Journal of Molecular Diagnostics 10:3, 185-197
CrossRef36
Qingming Xiong, Weichao Bao, Yan Ge, Yasuko Rikihisa. (2008) Ehrlichia ewingii Infection Delays Spontaneous Neutrophil Apoptosis through Stabilization of Mitochondria. The Journal of Infectious Diseases 197:8, 1110-1118
CrossRef37
Brian J. Hamburg, Gregory A. Storch, Scott T. Micek, Marin H. Kollef. (2008) The Importance of Early Treatment With Doxycycline in Human Ehrlichiosis. Medicine 87:2, 53-60
CrossRef38
Pedro Paulo Vissotto de Paiva Diniz, Denise Saretta Schwartz, Helio Silva Autran de Morais, Edward Bealmear Breitschwerdt. (2007) Surveillance for Zoonotic Vector-Borne Infections Using Sick Dogs from Southeastern Brazil. Vector-Borne and Zoonotic Diseases 7:4, 689-698
CrossRef39
J. S. Dumler, J. E. Madigan, N. Pusterla, J. S. Bakken. (2007) Ehrlichioses in Humans: Epidemiology, Clinical Presentation, Diagnosis, and Treatment. Clinical Infectious Diseases 45:Supplement 1, S45-S51
CrossRef40
Lucy M. Ndip, Roland N. Ndip, Veronica E. Ndive, Jane A. Awuh, David H. Walker, Jere W. McBride. (2007) Ehrlichia Species in Rhipicephalus sanguineus Ticks in Cameroon. Vector-Borne and Zoonotic Diseases 7:2, 221-227
CrossRef41
L. D. Thomas, I. Hongo, K. C. Bloch, Y.-W. Tang, S. Dummer. (2007) Human Ehrlichiosis in Transplant Recipients. American Journal of Transplantation 7:6, 1641-1647
CrossRef42
Andrea S. Varela-Stokes. (2007) Transmission of Bacterial Agents from Lone Star Ticks to White-Tailed Deer. Journal of Medical Entomology 44:3, 478-483
CrossRef43
Hisashi Inokuma. 2007. Vectors and Reservoir Hosts of Anaplasmataceae. , 199-212.
CrossRef44
Juan P. Olano. 2007. I Human Ehrlichioses. , 213-222.
CrossRef45
Philippe Brouqui, Kotaro Matsumoto. 2007. Bacteriology and Phylogeny of Anaplasmataceae. , 179-198.
CrossRef46
C. N. Kotton. (2007) Zoonoses in Solid-Organ and Hematopoietic Stem Cell Transplant Recipients. Clinical Infectious Diseases 44:6, 857-866
CrossRef47
Malathi Raghavan, Nita Glickman, George Moore, Richard Caldanaro, Hugh Lewis, Larry Glickman. (2007) Prevalence of And Risk Factors for Canine Tick Infestation in The United States, 2002–2004. Vector-Borne and Zoonotic Diseases 7:1, 65-75
CrossRef48
M.A. Assi, J.D.C. Yao, R.C. Walker. (2007) Lyme disease followed by human granulocytic anaplasmosis in a kidney transplant recipient. Transplant Infectious Disease 9:1, 66-72
CrossRef49
Xue-jie Yu, Jere W. McBride, David H. Walker. (2007) Restriction and expansion of Ehrlichia strain diversity. Veterinary Parasitology 143:3-4, 337-346
CrossRef50
Tonya R. Mixson, Scott R. Campbell, James S. Gill, Howard S. Ginsberg, Mason V. Reichard, Terry L. Schulze, Gregory A. Dasch. (2006) Prevalence of Ehrlichia , Borrelia , and Rickettsial Agents in Amblyomma americanum (Acari: Ixodidae) Collected from Nine States. Journal of Medical Entomology 43:6, 1261-1268
CrossRef51
Vijayakrishna Singu, Lalitha Peddireddi, Kamesh R. Sirigireddy, Chuanmin Cheng, Ulrike Munderloh, Roman R. Ganta. (2006) Unique macrophage and tick cell-specific protein expression from the p28/p30-outer membrane protein multigene locus in Ehrlichia chaffeensis and Ehrlichia canis. Cellular Microbiology 8:9, 1475-1487
CrossRef52
Rosangela Zacarias Machado, José Maurício B. Duarte, Ana Silvia Dagnone, Matias Pablo J. Szabó. (2006) Detection of Ehrlichia chaffeensis in Brazilian marsh deer (Blastocerus dichotomus). Veterinary Parasitology 139:1-3, 262-266
CrossRef53
Igen Hongo, Karen C. Bloch. (2006) Ehrlichia infection of the central nervous system. Current Treatment Options in Neurology 8:3, 179-184
CrossRef54
Milomir Djokic, Petar Curcic, Darko Nozic, Branislav Lako, Vesna Begovic, Radmila Rajic-Dimitrijevic, Dejan Hristovic. (2006) Human ehrlichiosis. Vojnosanitetski pregled 63:4, 403-408
CrossRef55
Constance A. Bell, Robin Patel. (2005) A real-time combined polymerase chain reaction assay for the rapid detection and differentiation of Anaplasma phagocytophilum, Ehrlichia chaffeensis, and Ehrlichia ewingii. Diagnostic Microbiology and Infectious Disease 53:4, 301-306
CrossRef56
L.M. Ndip, R.N. Ndip, S.N. Esemu, V.L. Dickmu, E.B. Fokam, D.H. Walker, J.W. McBride. (2005) Ehrlichial infection in Cameroonian canines by Ehrlichia canis and Ehrlichia ewingii. Veterinary Microbiology 111:1-2, 59-66
CrossRef57
C. Kuyler Doyle, Marcelo B. Labruna, Edward B. Breitschwerdt, Yi-Wei Tang, Richard E. Corstvet, Barbara C. Hegarty, Karen C. Bloch, Ping Li, David H. Walker, Jere W. McBride. (2005) Detection of Medically Important Ehrlichia by Quantitative Multicolor TaqMan Real-Time Polymerase Chain Reaction of the dsb Gene. The Journal of Molecular Diagnostics 7:4, 504-510
CrossRef58
S. Harrus, G. Baneth. (2005) Drivers for the emergence and re-emergence of vector-borne protozoal and bacterial diseases. International Journal for Parasitology 35:11-12, 1309-1318
CrossRef59
José Antonio Oteo, Philippe Brouqui. (2005) Ehrlichiosis y anaplasmosis humana. Enfermedades Infecciosas y Microbiología Clínica 23:6, 375-380
CrossRef60
Kamesh R. Sirigireddy, Roman R. Ganta. (2005) Multiplex Detection of Ehrlichia and Anaplasma Species Pathogens in Peripheral Blood by Real-Time Reverse Transcriptase-Polymerase Chain Reaction. The Journal of Molecular Diagnostics 7:2, 308-316
CrossRef61
Jarrett R. Amsden, Scott Warmack, Paul O. Gubbins. (2005) Tick-Borne Bacterial, Rickettsial, Spirochetal, and Protozoal Infectious Diseases in the United States: A Comprehensive Review. Pharmacotherapy 25:2, 191-210
CrossRef62
Steven C Buckingham. (2005) Tick-Borne Infections in Children. Pediatric Drugs 7:3, 163-176
CrossRef63
Michael J. Yabsley, Terry M. Norton, Malcolm R. Powell, William R. Davidson. (2004) MOLECULAR AND SEROLOGIC EVIDENCE OF TICK-BORNE EHRLICHIAE IN THREE SPECIES OF LEMURS FROM ST. CATHERINES ISLAND, GEORGIA, USA. Journal of Zoo and Wildlife Medicine 35:4, 503-509
CrossRef64
Rebecca L. Seaman, Stephen A. Kania, Barbara C. Hegarty, Alfred M. Legendre, Edward B. Breitschwerdt. (2004) Comparison of results for serologic testing and a polymerase chain reaction assay to determine the prevalence of stray dogs in eastern Tennessee seropositive to Ehrlichia canis. American Journal of Veterinary Research 65:9, 1200-1203
CrossRef65
A. S. Varela, V. A. Moore, S. E. Little. (2004) Disease Agents in Amblyomma americanum from Northeastern Georgia. Journal of Medical Entomology 41:4, 753-759
CrossRef66
J Stephen Dumler, Philippe Brouqui. (2004) Molecular diagnosis of human granulocytic anaplasmosis. Expert Review of Molecular Diagnostics 4:4, 559-569
CrossRef67
Jennifer H. McQuiston, Candace L. McCall, William L. Nicholson. (2003) Ehrlichiosis and related infections. Journal of the American Veterinary Medical Association 223:12, 1750-1756
CrossRef68
MAURIZIO RUSCIO, MARINA CINCO. (2003) Human Granulocytic Ehrlichiosis in Italy. Annals of the New York Academy of Sciences 990:1, 350-352
CrossRef69
STACY L. GARDNER, ROBERT C. HOLMAN, JOHN W. KREBS, RUTH BERKELMAN, JAMES E. CHILDS. (2003) National Surveillance for the Human Ehrlichioses in the United States, 1997-2001, and Proposed Methods for Evaluation of Data Quality. Annals of the New York Academy of Sciences 990:1, 80-89
CrossRef70
Robert A. Goodman, Eleanor C. Hawkins, Natasha J. Olby, Carol B. Grindem, Barbara Hegarty, Edward B. Breitschwerdt. (2003) Molecular identification of Ehrlichia ewingii infection in dogs: 15 cases (1997-2001). Journal of the American Veterinary Medical Association 222:8, 1102-1107
CrossRef71
James E. Childs, Christopher D. Paddock. (2003) T
HE ASCENDANCY OF AMBLYOMMA AMERICANUM AS A VECTOR OF PATHOGENS AFFECTING HUMANS IN THE UNITED STATES *. Annual Review of Entomology 48:1, 307-337
CrossRef72
William E. Roland. 2003. Ehrlichiosis. , 76-77.
CrossRef73
Maria E. Aguero-Rosenfeld. (2002) Diagnosis of Human Granulocytic Ehrlichiosis: State of the Art. Vector-Borne and Zoonotic Diseases 2:4, 233-239
CrossRef74
Daryl J. Kelly, Allen L. Richards, Joseph Temenak, Daniel Strickman, Gregory A. Dasch. (2002) The Past and Present Threat of Rickettsial Diseases to Military Medicine and International Public Health. Clinical Infectious Diseases 34:S4, S145-S169
CrossRef75
Allison M. Liddell, John W. Sumner, Christopher D. Paddock, Yasuko Rikihisa, Ahmet Unver, Richard S. Buller, Gregory A. Storch. (2002) Reinfection with Ehrlichia chaffeensis in a Liver Transplant Recipient. Clinical Infectious Diseases 34:12, 1644-1647
CrossRef76
M.D. Vannorsdall, S. Thomas, R.P. Smith, R. Zimmerman, R. Christman, J.P. Vella, M.D. Vannorsdall, S. Thomas, R.P. Smith, R. Zimmerman, R. Christman, J.P. Vella. (2002) Human granulocytic ehrlichiosis in a renal allograft recipient: review of the clinical spectrum of disease in solid organ transplant patients. Transplant Infectious Disease 4:2, 97-101
CrossRef77
John G. Steiert, Felicia Gilfoy. (2002) Infection Rates of Amblyomma americanum and Dermacentor variabilis by Ehrlichia chaffeensis and Ehrlichia ewingii in Southwest Missouri. Vector-Borne and Zoonotic Diseases 2:2, 53-60
CrossRef78
Didier Raoult, Andras Lakos, Florence Fenollar, Jean Beytout, Philippe Brouqui, Pierre‐Edouard Fournier. (2002) Spotless Rickettsiosis Caused by Rickettsia slovaca and Associated with Dermacentor Ticks. Clinical Infectious Diseases 34:10, 1331-1336
CrossRef79
Syed Ali Zaidi, Carol Singer. (2002) Gastrointestinal and Hepatic Manifestations of Tickborne Diseases in the United States. Clinical Infectious Diseases 34:9, 1206-1212
CrossRef80
Quentin Q. Fang, Tonya R. Mixson, Minerva Hughes, Brandy Dunham, Jody Sapp. (2002) Prevalence of the Agent of Human Granulocytic Ehrlichiosis in Ixodes scapularis (Acari: Ixodidae) in the Coastal Southeastern United States. Journal of Medical Entomology 39:2, 251-255
CrossRef81
Juan P Olano, David H Walker. (2002) Human ehrlichioses. Medical Clinics of North America 86:2, 375-392
CrossRef82
Cabot, Richard C.Scully, Robert E., Mark, Eugene J., McNeely, William F., Shepard, Jo-Anne O., Ebeling, Sally H.Ellender, Stacey M.Peters, Christine C., Yawetz, Sigal, Mark, Eugene J., . (2001) Case 37-2001. New England Journal of Medicine 345:22, 1627-1634
Full Text83
Christopher D. Paddock, Scott M. Folk, G. Merrill Shore, Linda J. Machado, Mark M. Huycke, Leonard N. Slater, Allison M. Liddell, Richard S. Buller, Gregory A. Storch, Thomas P. Monson, David Rimland, John W. Sumner, Joseph Singleton, Karen C. Bloch, Yi‐Wei Tang, Steven M. Standaert, James E. Childs. (2001) Infections with Ehrlichia chaffeensis and Ehrlichia ewingii in Persons Coinfected with Human Immunodeficiency Virus. Clinical Infectious Diseases 33:9, 1586-1594
CrossRef84
Charles Thompson, Andrew Spielman, Peter J. Krause. (2001) Coinfecting Deer‐Associated Zoonoses: Lyme Disease, Babesiosis, and Ehrlichiosis. Clinical Infectious Diseases 33:5, 676-685
CrossRef85
Jiraporn Suksawat, Yu Xuejie, Susan I. Hancock, Barbara C. Hegarty, Parnchitt Nilkumhang, Edward B. Breitschwerdt. (2001) Serologic and Molecular Evidence of Coinfection with Multiple Vector-Borne Pathogens in Dogs from Thailand. Journal of Veterinary Internal Medicine 15:5, 453-462
CrossRef86
Stanka Lotrič‐Furlan, Miroslav Petrovec, Tatjana Avsic‐Zupanc, William L. Nicholson, John W. Sumner, James E. Childs, Franc Strle. (2001) Prospective Assessment of the Etiology of Acute Febrile Illness after a Tick Bite in Slovenia. Clinical Infectious Diseases 33:4, 503-510
CrossRef87
James A. Comer, Christopher D. Paddock, James E. Childs. (2001) Urban Zoonoses Caused by Bartonella , Coxiella , Ehrlichia , and Rickettsia Species. Vector-Borne and Zoonotic Diseases 1:2, 91-118
CrossRef88
Candace L. McCall, Aaron T. Curns, Lisa D. Rotz, Joseph A. Singleton, Tracee A. Treadwell, James A. Comer, William L. Nicholson, James G. Olson, James E. Childs. (2001) Fort Chaffee Revisited: The Epidemiology of Tick-Borne Rickettsial and Ehrlichial Diseases at a Natural Focus. Vector-Borne and Zoonotic Diseases 1:2, 119-127
CrossRef89
Joshua Schiffman, Mohammad Haq, Fortunato Procopio, Edwin N. Forman. (2001) Ehrlichiosis Infection in a 5-Year-Old Boy With Neutropenia, Anemia, Thrombocytopenia, and Hepatosplenomegaly. Journal of Pediatric Hematology/Oncology 23:5, 324-327
CrossRef90
Geoffrey A. Weinberg. (2001) LABORATORY DIAGNOSIS OF EHRLICHIOSIS AND BABESIOSIS. The Pediatric Infectious Disease Journal 20:4, 435-437
CrossRef91
J Stephen Dumler, David H Walker. (2001) Tick-borne ehrlichioses. The Lancet Infectious Diseases 1, 21-28
CrossRef92
P. Parola, D. Raoult. (2001) Ticks and Tickborne Bacterial Diseases in Humans: An Emerging Infectious Threat. Clinical Infectious Diseases 32:6, 897-928
CrossRef93
J. Trofe, K.S. Reddy, R.J. Stratta, S.D. Flax, K.T. Somerville, R.R. Alloway, M.F. Egidi, M.H. Shokouh-Amiri, A.O. Gaber. (2001) Human granulocytic ehrlichiosis in pancreas transplant recipients. Transplant Infectious Disease 3:1, 34-39
CrossRef94
Edgar A. Sotomayor, Vsevolod L. Popov, Hui-Min Feng, David H. Walker, Juan P. Olano. (2001) Animal Model of Fatal Human Monocytotropic Ehrlichiosis. The American Journal of Pathology 158:2, 757-769
CrossRef95
P. Parola, D. Raoult. (2001) Tick-borne bacterial diseases emerging in Europe. Clinical Microbiology and Infection 7:2, 80-83
CrossRef96
Sigurður Skarpheðinsson, Per Søgaar. (2001) Seroprevalence of Human Granulocytic Ehrlichiosis in High-risk Groups in Denmark. Scandinavian Journal of Infectious Diseases 33:3, 206-210
CrossRef97
Don B. McKechnie, Kimetha S. Slater, James E. Childs, Robert F. Massung, Christopher D. Paddock. (2000) Survival of Ehrlichia chaffeensis in refrigerated, ADSOL-treated RBCs. Transfusion 40:9, 1041-1047
CrossRef98
J.H. McQuiston, J.E. Childs, M.E. Chamberland, E. Tabor, . (2000) Transmission of tick-borne agents of disease by blood transfusion: a review of known and potential risks in the United States. Transfusion 40:3, 274-284
CrossRef99
Goodman, Jesse L., . (1999) Ehrlichiosis — Ticks, Dogs, and Doxycycline. New England Journal of Medicine 341:3, 195-197
Full Text
