Original Article
Quantifying Residual HIV-1 Replication in Patients Receiving Combination Antiretroviral Therapy
N Engl J Med 1999; 340:1605-1613May 27, 1999
- Abstract
Background
In patients infected with human immunodeficiency virus type 1 (HIV-1), combination antiretroviral therapy can result in sustained suppression of plasma levels of the virus. However, replication-competent virus can still be recovered from latently infected resting memory CD4 lymphocytes; this finding raises serious doubts about whether antiviral treatment can eradicate HIV-1.
Methods
We looked for evidence of residual HIV-1 replication in eight patients who began treatment soon after infection and in whom plasma levels of HIV-1 RNA were undetectable after two to three years of antiretroviral therapy. We examined whether there had been changes over time in HIV-1 proviral sequences in peripheral-blood mononuclear cells, which would indicate residual viral replication. We also performed in situ hybridization studies on tissues from one patient to identify cells actively expressing HIV-1 RNA. We estimated the rate of decrease of latent, replication-competent HIV-1 in resting CD4 lymphocytes on the basis of the decrease in the numbers of proviral sequences identified during primary infection and direct sequential measurements of the size of the latent reservoir.
Results
Six of the eight patients had no significant variations in proviral sequences during treatment. However, in two patients there was sequence evolution but no evidence of drug-resistant viral genotypes. In one patient, extensive in situ studies provided additional evidence of persistent viral replication in lymphoid tissues. Using two independent approaches, we estimated that the half-life of the latent, replication-competent virus in resting CD4 lymphocytes was approximately six months.
Conclusions
These findings suggest that combination antiretroviral regimens suppress HIV-1 replication in some but not all patients. Given the half-life of latently infected CD4 lymphocytes of about six months, it may require many years of effective antiretroviral treatment to eliminate this reservoir of HIV-1.
Media in This Article
Figure 3
In Situ Hybridization Studies of Tissue from an Untreated Patient with HIV Infection (Panels A, B, and C) and Patient 5 (Panels D through I).Figure 2
Phylogenetic Tree Depicting HIV-1 env Sequences Found in the Eight Patients.Article Activity
- Article
Better understanding of the dynamics of the replication of human immunodeficiency virus type 1 (HIV-1) in vivo1-4 has provided an important rationale for early and aggressive treatment of this infection. The advent of combination antiretroviral therapy has made it possible to suppress the replication of HIV-1 in infected persons to such an extent that the virus becomes undetectable in the plasma for more than two years.4-6 For the first time in the history of this epidemic, the eradication of HIV-1 from an infected person is a real scientific objective.4,7 However, a major obstacle to the elimination of HIV-1 became apparent when latent, replication-competent virus was found within resting memory CD4 lymphocytes,8 which have a long life span.9-11
In addition, this latent reservoir of HIV-1 is established early in infection and persists after two years of seemingly effective combination antiretroviral therapy,12,13 even when treatment is initiated during the primary phase of infection.14 But the true size of the latent reservoir cannot be properly assessed unless it is known whether viral replication has been completely stopped by the drug regimen. In other words, unrecognized residual replication of HIV-1 would result in an overestimation of the size of the latent reservoir. We therefore undertook a study to look for evidence of ongoing HIV-1 replication as well as a decrease in the size of the latent reservoir in a select group of patients who began treatment early and in whom the HIV-1 RNA had been completely undetectable in plasma for approximately two to three years during combination therapy with three or four drugs.
Methods
Patients
Eight men ranging in age from 30 to 37 years were chosen for the study (Figure 1Figure 1
Changes in Plasma Viral Load and CD4 Lymphocyte Count during Combination Antiretroviral Therapy in the Eight Men.) from over 100 subjects enrolled in our clinical trials, because they had had complete suppression of HIV-1 in plasma while being fully compliant with the prescribed antiretroviral therapy. At base line they had a mean CD4 lymphocyte count of 533 per cubic millimeter and an average plasma viral load of 174,000 RNA copies per milliliter. The level of HIV-1 in plasma was measured by a commercial reverse-transcriptase–polymerase-chain-reaction (PCR) assay (Amplicor Ultrasensitive HIV-1 Monitor assay, Roche Molecular Diagnostic Systems, Branchburg, N.J.), which has a limit of detection of 50 HIV-1 RNA copies per milliliter of plasma. All patients were enrolled in treatment protocols within the first 90 days after acute infection. The antiviral regimens consisted of zidovudine (600 mg per day) and lamivudine (300 mg per day), along with either ritonavir (1200 mg per day) or indinavir (2400 mg per day) or with both ritonavir (800 or 1200 mg per day) and saquinavir (1200 mg per day). As shown in Figure 1, each patient had a steep decline in plasma HIV-1 RNA levels during treatment; levels below 50 RNA copies per milliliter were quickly reached and then sustained for 20 to 35 months of therapy. After month 5, plasma viremia was not detected in any of the patients. As compared with base-line values, there was an average increase in the mean CD4 lymphocyte count of approximately 300 cells per cubic millimeter for the last four measurements.Amplification, Sequencing, and Sequence Analysis
DNA was extracted from peripheral-blood mononuclear cells as previously described.15 Single molecules of the provirus were amplified after limiting-dilution analysis and sequenced directly with an automated sequencer (Prism 377, Applied Biosystems, Foster City, Calif.) to avoid errors introduced by the amplification of DNA in vitro.15 The region amplified in gp120 spanned the V3, V4, and V5 hypervariable domains. The outer env primer sequences, with their positions in HIV-1 clone NL4-3 indicated in parentheses, were V3a 5'CCAATTCCCATACATTATTG3' (nucleotide 6848) for the forward primer and V3i 5'GCGTTATTGACGCTGCGCCCAT3' (nucleotide 7823) for the reverse primer, and the respective inner primers were V3e 5'GTACAATGTACACATGGAAT3' (nucleotide 6947) and V3h 5'AATTCACTTCTCCAATTGTC3' (nucleotide 7662). The outer primers for protease and reverse transcriptase were PRouter 5'GAGCAGACCAGAGCCAACAGCCCA3' (nucleotide 2139) for the forward primer and RTouter 5'GCCCCTGCTTCTGTATTTCTGC3' (nucleotide 3549) for the reverse primer, respectively, and the inner primers were PRinner 5'GAAGCAGGAGCCGATAGACAAGG3' (nucleotide 2211) and RTinner 5'GTGGTACTACTTCTGTTAGTGC3' (nucleotide 3432), respectively. Each round of PCR consisted of 30 cycles, with the first 5 cycles at 94°C for one minute, 52°C for one minute, and 72°C for one minute, followed by 25 cycles at 94°C for one minute, 55°C for one minute, and 72°C for one minute.
All DNA extractions and amplification reactions were carried out with appropriate negative controls in parallel to detect contamination at each step of the procedure. Nucleotide sequences were aligned with use of the Clustal V program.16 Pairwise distances among sequences were estimated by the DNADIST program in the PHYLIP package.17 Phylogenetic analysis of the nucleotide sequences was carried out with use of the neighbor-joining method.18 Bootstrap analysis was also performed on 1000 replicates to evaluate the reliability of the neighbor-joining results (PHYLIP programs SEQBOOT and CONSENSE).
Quantitative Viral Culture
The virus was cultured after quantitative limiting-dilution analysis according to the method of Finzi et al.13 in CD4-enriched peripheral-blood mononuclear cells that had been depleted of CD8 lymphocytes with the use of immunomagnetic beads (Dynal, Lake Success, N.Y.). Cells were serially diluted (up to six replicates for each inoculum size) and plated in medium containing phytohemagglutinin (2 μg per milliliter) and interleukin-2 (10 U per milliliter) with gamma-irradiated allogeneic (donor) CD4 peripheral-blood mononuclear cells in a concentration that was 2 to 10 times the concentration of CD4 cells in the patient. The culture supernatant was replaced the next day by medium containing only interleukin-2. On day 2, CD8-depleted, phytohemagglutinin-stimulated blasts from an HIV-1–seronegative donor were added. Thereafter, half of the medium was changed every three to four days and fresh CD8-depleted, stimulated blasts were added weekly until day 28. The serial-culture supernatant was then examined for HIV-1 by measuring the p24 antigen concentration with use of an enzyme immunoassay (Abbott Laboratories, Abbott Park, Ill.). The infectious titer of latent, replication-competent virus was then determined according to the maximum-likelihood method.4 The sensitivity of the assay was limited by the number of cells available for multiple replicate cultures.
Tissue Collection and Processing and in Situ Hybridization
We obtained multiple biopsy samples from Patient 5 to look for cells actively expressing HIV-1 RNA. The tissue samples were fixed in 10 percent buffered formalin for approximately 24 hours and then embedded in paraffin with use of an automated tissue processor under heat and vacuum pressure. Tissue sections were processed and examined by in situ hybridization, as described previously.19
Statistical Analysis
We used least-squares analysis to estimate the best-fit slope for each patient so as to determine the exponential rate of decrease in the numbers of replication-competent HIV-1 within resting memory CD4 lymphocytes and of parental proviral sequences identified during the primary infection. We calculated the average and standard error of the slopes, using data points from month 8 to month 28 of therapy. For the estimates of the half-lives of the virus, we used the 95 percent confidence intervals, which we calculated as the mean values ±2 SE for the average slopes.
Results
Residual HIV-1 Replication
Four sequential samples of peripheral-blood mononuclear cells were obtained from each patient and examined to determine whether there were changes in the DNA sequences, which would indicate ongoing replication of HIV-1. A total of 414 amplicons (10 to 21 fragments per sample of peripheral-blood mononuclear cells; 42 to 64 fragments per patient) that ranged from 612 to 669 bp in length were obtained at the limits of the serial-dilution PCR. These nucleotide sequences, deposited in GenBank (accession numbers AF093912 to AF094325), were matched with available sequences in the Los Alamos Database with use of the Clustal V program.16 When analyzed phylogenetically by the neighbor-joining method,18 sequences from each patient formed a tight cluster within clade B (Figure 2Figure 2
Phylogenetic Tree Depicting HIV-1 env Sequences Found in the Eight Patients.) and were distinct from those of control subjects or other patients (data not shown). Thus, there is no indication that the sequences examined were the result of contamination during PCR amplification.As described previously,20,21 viral sequences obtained during or shortly after primary HIV-1 infection (time 1) were extremely homogeneous (Figure 2). Four patients (Patients 3, 4, 6, and 7) had no sequence variation at the initial time point; in no patient did the sequence differ by more than two mutations from the predominant form. The mean variation within samples for the eight patients at time 1 was 0.03 percent, with the highest degree of variation (0.14 percent) found in Patient 8. In three patients (Patients 2, 3, and 7), there were no appreciable increases in the degree of sequence variation (differing by no more than two mutations from the parental sequence). Greater divergence was found in samples obtained at subsequent points from the other patients. However, in Patients 1, 4, and 6, the more divergent sequences were the results of hypermutations, typically a cluster of mutations in which A had been substituted for G (Figure 2). Since hypermutations are believed to be the product of a single replication cycle,22,23 they cannot be regarded as evidence of gradual sequence evolution. Thus, there was no genetic evidence to indicate continued replication of HIV-1 in these three patients.
On the other hand, substantial sequence divergence, exclusive of hypermutated forms, was found in Patients 5 and 8 (Figure 2). Up to 16 and 25 nucleotide substitutions were found in Patients 5 and 8, respectively. Such diversity is possible only through continued viral replication. However, most of the variation had occurred by the time of the second analysis (at months 16 and 9, respectively), suggesting that much of the replication of residual virus may have occurred during the early phase of treatment. We also extensively sequenced proviruses from various tissues from Patient 5. Divergent proviral sequences similar to those found in peripheral-blood mononuclear cells were identified in the lymph node and tonsil but not in the sigmoid colon or rectum 15 months after treatment began (data not shown).
To determine whether the residual replication in Patients 5 and 8 was due to the emergence of drug-resistant HIV-1, we looked for genotypic evidence of drug-resistant virus in the DNA from peripheral-blood mononuclear cells obtained at the fourth measurement in each patient (months 29 and 18, respectively). Again, we used limiting-dilution PCR to amplify the relevant regions of the protease and reverse transcriptase genes. Twelve of 16 protease clones and 11 to 12 reverse transcriptase clones were obtained from each patient for nucleotide sequencing. All sequences encode for wild-type amino acids at protease or reverse transcriptase residues that are involved in conferring resistance to ritonavir, indinavir, saquinavir, zidovudine, and lamivudine (GenBank accession numbers AF097943 to AF097992). Thus, the residual replication of HIV-1 does not appear to be under any appreciable selective pressure exerted by the antiretroviral agents. This conclusion, in turn, implies that the virus might be replicating within a small compartment free from the influence of the antiretroviral agents. This compartment could be a specific anatomical location or diffusely scattered cell populations that are not reached or affected by the antiretroviral agents for pharmacokinetic reasons or because of aberrant drug metabolism by the cells.
Next, we studied tissue samples and body fluids from Patient 5 to confirm the presence of residual HIV-1 replication as well as to search for anatomical sites where the virus continued to be expressed. Biopsies of the rectum, sigmoid colon, and descending colon were performed at months 12 and 15 of treatment. In addition, semen samples were obtained during months 13 and 15, and a sample of cerebrospinal fluid was obtained during month 15. A cervical-lymph-node biopsy was also performed during month 15, and tonsillar biopsies during months 15 and 20. HIV-1 RNA was undetectable (<50 RNA copies per milliliter) in the seminal or cerebrospinal fluid. A total of 175 tissue sections from the lymph node, tonsil, and gastrointestinal tract were processed and examined by in situ hybridization as described previously.19
In contrast to the findings in lymphoid tissues from an untreated patient with HIV infection (Figure 3AFigure 3
In Situ Hybridization Studies of Tissue from an Untreated Patient with HIV Infection (Panels A, B, and C) and Patient 5 (Panels D through I)., 3B, and 3C), in 162 tissue sections from Patient 5, there was a complete absence of cells expressing viral RNA in the network of follicular dendritic cells in germinal centers (Figure 3D, 3E, and 3F). The lymphoid architecture was also largely intact. However, in 13 tissue sections (6 lymph-node sections, 5 tonsillar sections, and 2 gastrointestinal sections), 19 cells expressing viral RNA were identified (Figure 3G, 3H, and 3I). Morphologically, every RNA-positive cell resembled a lymphocyte; the grain count generated from the isotope-labeled probes ranged from 15 to 60 per cell (insets in Figure 3G and Figure 3H), which is markedly lower than typical grain counts in untreated patients.19 Interestingly, many of the RNA-positive lymphocytes were found in lymphoid sinuses, suggesting that they might be in transit.No evidence of viral trapping in follicular dendritic cells was found, even in the sections containing RNA-positive cells. Taken together, these results not only confirm the presence of ongoing HIV-1 replication in Patient 5, but also demonstrate that this residual activity was occurring in the lymphocyte population usually affected and in the expected anatomical sites.
Changes in the Latent Virus
The genetic data also allowed us to measure the decrease in the level of the parental virus (the dominant form at time 1, or form 1) in peripheral-blood mononuclear cells during treatment. At each of the three subsequent times the sequences were analyzed, the fraction of sequences identical to form 1 was determined for each patient. In addition, at each time, the number of copies of proviral DNA in peripheral-blood mononuclear cells was determined by quantitative PCR-based assays.24 These two sets of results allowed us to calculate the absolute number of form 1 at each point in time. Figure 4AFigure 4
Changes in the Levels of the Parental Proviral Sequence in Peripheral-Blood Mononuclear Cells (Panel A) and in the Numbers of Latent, Replication-Competent HIV-1 (Panel B) during Antiretroviral Therapy in the Eight Patients. shows that in every patient there was a gradual loss of the parental sequence, with a mean half-life of 6.4 months (95 percent confidence interval, 4.9 to 8.9 months). Why is this half-life important? Although much of the proviral DNA does not yield infectious HIV-1, it is primarily harbored within resting memory CD4 lymphocytes, the same cell population in which latent, replication-competent HIV-1 is found.8 Thus, the decrease in levels of the parental proviral DNA provides an indirect assessment of the turnover rate of the latent virus.The decrease in the numbers of latent, replication-competent HIV-1 was also measured directly with use of a limiting-dilution culture technique based on the method initially described by Finzi et al.13 As shown in Figure 4B, Patients 1 and 3 had no detectable replication-competent virus in cultures of up to 10 million to 50 million CD4 lymphocytes. In the other six patients, there was a gradual decrease in the levels of latent, replication-competent HIV-1, with a mean half-life of 6.2 months (95 percent confidence interval, 5.3 to 7.5 months). This turnover rate is remarkably close to that determined by the indirect method and to the average life span of resting memory CD4 lymphocytes.9-11
Discussion
We studied eight patients who had had undetectable levels of HIV-1 RNA in plasma for up to 35 months during potent combination antiretroviral therapy. There was no evolution of the viral sequence during treatment in six of these patients. This finding suggests that treatment decreased the rate of replication of HIV-1 to an undetectable level. Two patients, however, did have sequence changes. It could be argued that the new sequences resulted from the selection of variant viruses not found initially. But such a possibility is unlikely for two reasons. First, the variant forms were not detected among the large number of independent HIV-1 clones examined at the beginning of treatment. Second, the extent of the sequence differences (up to 16 and 25 substitutions in fragments of approximately 650 bp) would be unusual during primary infection.20,21 Thus, we believe that the sequence changes are more likely due to ongoing residual replication, albeit at an exceedingly low level. This conclusion is supported by evidence of continued expression of viral RNA in lymphoid tissues, detected by in situ hybridization, in one patient. Almost certainly, most patients treated in the usual clinical setting would have greater degrees of residual viral activity, since they typically do not have the sustained suppression of plasma viremia seen in our highly selected study subjects. The continued replication of HIV-1 in two patients seems to be due to the presence of drug-sensitive viruses within lymphoid tissues. We are unable, however, to explain why drug-sensitive HIV-1 is capable of replicating at low levels during treatment with three or four drugs. But it is essential to the therapeutic effort that the answer, be it pharmacokinetic or cellular in nature, be obtained promptly.
That there is unrecognized residual replication of HIV-1 in some patients despite apparently effective combination therapy is both good and bad news. On the one hand, this finding tells us that the extent of the persistence of a latent reservoir of virus8,12-14 may be overestimated, because there is unrecognized replenishment of the pool by active viral replication. But, on the other hand, it is sobering to realize that the so-called highly active antiretroviral therapy is actually not always active enough. As we strive to eradicate HIV-1 infection or induce a remission,7 we must focus on the possibility of further intensifying antiretroviral treatment, even though current therapies are already toxic, costly, and complex.
What does our estimate of the half-life of latent, replication-competent HIV-1 imply about the duration of effective treatment that is required to eliminate this pool? The size of the latent reservoir ranges from 10,000 to 1 million cells7,8 (Figure 4B). Therefore, as a crude estimate, it will take 14 to 20 half-lives for the pool to decrease to a size of less than 1. If the half-life is 6 months, roughly 7 to 10 years of continuous, truly effective therapy will be necessary to eliminate this reservoir. It will be difficult to maintain treatment for such a long time; thus, we must find ways to facilitate a decrease in the size of the pool of latent virus.
Supported by grants from the National Institutes of Health (AI40387 and AI41534), the General Clinical Research Center of Rockefeller University (MO1-RR00102), the Department of Energy, the Bristol-Myers Squibb Foundation, the German Ministry of Education and Research (BMBF 01-K1-9469), the Korber Foundation, the Belotsky Foundation, and the Irene Diamond Fund.
We are indebted to the patients for their participation; to Abbott, Merck, Roche, and Glaxo Wellcome for sponsoring the clinical studies; to M. Yaman and M.R. Chaudhry for performing lymph-node and tonsillar biopsies; to R. Kost, O. Ford, and R. Schluger for clinical assistance; to G. Großschupff and B. Raschdorff for technical help; and to J. Moore and R. Connor for their critical reading of the manuscript.
Source Information
From the Aaron Diamond AIDS Research Center, Rockefeller University, New York (L.Z., B.R., Y.H., M.V., S.L., A.T., M.M., D.D.H.); Bernhard-Nocht-Institut fur Tropenmedizin, Hamburg, Germany (K.T.-R., P.R.); and the Theoretical Division, Los Alamos National Laboratory, Los Alamos, N.M. (A.S.P., B.T.K.).
Address reprint requests to Dr. Ho at the Aaron Diamond AIDS Research Center, 455 First Ave., New York, NY 10016, or at dho@adarc.org.
Other authors were Yong Guo, M.Sc., Margarita Duran, M.Sc., Arlene Hurley, R.N., John Tsay, B.Sc., Yu-Ching Huang, B.Sc., and Chia-Ching Wang, B.Sc. (Aaron Diamond AIDS Research Center, Rockefeller University, New York).
- References
References
1
Wei X ,Ghosh SK ,Taylor ME , et al. Viral dynamics in human immunodeficiency virus type 1 infection. Nature 1995;373:117-122
CrossRef | Web of Science | Medline2
Ho DD ,Neumann AU ,Perelson AS ,Chen W ,Leonard JM ,Markowitz M . Rapid turnover of plasma virions and CD4 lymphocytes in HIV-1 infection. Nature 1995;373:123-126
CrossRef | Web of Science | Medline3
Perelson AS, Neumann AU, Markowitz M, Leonard JM, Ho DD. HIV-1 dynamics in vivo: virion clearance rate, infected cell life-span, and viral generation time. Science 1996;271:1582-6.
4
Perelson AS ,Essunger P ,Cao Y , et al. Decay characteristics of HIV-1 infected compartments during combination therapy. Nature 1997;387:188-191
CrossRef | Web of Science | Medline5
Hammer SM ,Squires KE ,Hughes MD , et al. A controlled trial of two nucleoside analogues plus indinavir in persons with human immunodeficiency virus infection and CD4 cell counts of 200 per cubic millimeter or less. N Engl J Med 1997;337:725-733
Full Text | Web of Science | Medline6
Gulick RM ,Mellors JW ,Havlir D , et al. Treatment with indinavir, zidovudine, and lamivudine in adults with human immunodeficiency virus infection and prior antiretroviral therapy. N Engl J Med 1997;337:734-739
Full Text | Web of Science | Medline7
Ho DD . Toward HIV eradication or remission: the tasks ahead. Science 1998;280:1866-1867
CrossRef | Web of Science | Medline8
Chun T-W ,Carruth L ,Finzi D , et al. Quantification of latent tissue reservoirs and total body viral load in HIV-1 infection. Nature 1997;387:183-188
CrossRef | Web of Science | Medline9
Michie CA ,McLean A ,Alcock C ,Beverley PC . Lifespan of human lymphocyte subsets defined by CD45 isoforms. Nature 1992;360:264-265
CrossRef | Web of Science | Medline10
Tough DF ,Sprent J . Turnover of naïve- and memory-phenotype T cells. J Exp Med 1994;179:1127-1135
CrossRef | Web of Science | Medline11
Mohri H ,Bonhoeffer S ,Monard S ,Perelson AS ,Ho DD . Rapid turnover of T lymphocytes in SIV-infected rhesus macaques. Science 1998;279:1223-1227
CrossRef | Web of Science | Medline12
Wong JK ,Hezareh M ,Gunthard HF , et al. Recovery of replication-competent HIV despite prolonged suppression of plasma viremia. Science 1997;278:1291-1295
CrossRef | Web of Science | Medline13
Finzi D ,Hermankova M ,Pierson T , et al. Identification of a reservoir for HIV-1 in patients on highly active antiretroviral therapy. Science 1997;278:1295-1300
CrossRef | Web of Science | Medline14
Chun T-W ,Engel D ,Berrey MM ,Shea T ,Corey L ,Fauci AS . Early establishment of a pool of latently infected, resting CD4+ T cells during primary HIV-1 infection. Proc Natl Acad Sci U S A 1998;95:8869-8873
CrossRef | Web of Science | Medline15
Simmonds P ,Balfe P ,Peutherer JF ,Ludlam CA ,Bishop JO ,Brown AJ . Human immunodeficiency virus-infected individuals contain provirus in small numbers of peripheral mononuclear cells and at low copy numbers. J Virol 1990;64:864-872
Web of Science | Medline16
Higgins DG ,Thompson JD ,Gibson TJ . Using CLUSTAL for multiple sequence alignments. Methods Enzymol 1996;266:383-402
CrossRef | Web of Science | Medline17
Felsenstein J . Phylogenies from molecular sequences: inference and reliability. Ann Rev Genet 1988;22:521-565
CrossRef | Web of Science | Medline18
Saitou N ,Nei M . The neighbor-joining method: a new method for reconstructing phylogenetic trees. Mol Biol Evol 1987;4:406-425
Web of Science | Medline19
Tenner-Racz K ,Stellbrink HJ ,van Lunzen J , et al. The unenlarged lymph nodes of HIV-1 infected, asymptomatic patients with high CD4 T cell counts are sites for virus replication and CD4 T cell proliferation: the impact of highly active antiretroviral therapy. J Exp Med 1998;187:949-959
CrossRef | Web of Science | Medline20
Zhang LQ ,MacKenzie P ,Cleland A ,Holmes EC ,Brown AJ ,Simmonds P . Selection for specific sequences in the external envelope protein of human immunodeficiency virus type 1 upon primary infection. J Virol 1993;67:3345-3356
Web of Science | Medline21
Zhu T ,Mo H ,Wang N , et al. Genotypic and phenotypic characterization of HIV-1 patients with primary infection. Science 1993;261:1179-1181
CrossRef | Web of Science | Medline22
Vartanian JP ,Meyerhans A ,Sala M ,Wain-Hobson S . G→A hypermutation of the human immunodeficiency virus type 1 genome: evidence for dCTP pool imbalance during reverse transcription. Proc Natl Acad Sci U S A 1994;91:3092-3096
CrossRef | Web of Science | Medline23
Martinez MA ,Vartanian JP ,Wain-Hobson S . Hypermutagenesis of RNA using human immunodeficiency virus type 1 reverse transcriptase and biased dNTP concentrations. Proc Natl Acad Sci U S A 1994;91:11787-11791
CrossRef | Web of Science | Medline24
Vesanen M ,Stevens CE ,Taylor PE ,Rubinstein P ,Saksela K . Stability in controlling viral replication identifies long-term nonprogressors as a distinct subgroup among human immunodeficiency virus type 1-infected persons. J Virol 1996;70:9035-9040
Web of Science | Medline
- Citing Articles (292)
Citing Articles
1
Horrick Sharma, Xiaolin Cheng, John K. Buolamwini. (2012) Homology Model-Guided 3D-QSAR Studies of HIV-1 Integrase Inhibitors. Journal of Chemical Information and Modeling120118133219004
CrossRef2
Ingrid A Beck, Minyoung Jang, Jennifer McKernan, Marta Bull, Thor A Wagner, Sharon Huang, Lin-Ye Song, Sharon Nachman, Paul Krogstad, Susan Eshleman, Andrew Wiznia, Lisa Marie Frenkel. (2011) Monitoring of HIV-1 DNA Load and Drug Resistance in Peripheral Blood Mononuclear Cells during Suppressive Antiretroviral Therapy does not Predict Virologic Failure. AIDS Research and Human Retroviruses111115031133002
CrossRef3
Hao Yin, Yuhao Zhang, Xin Zhou, Huanzhang Zhu. (2011) Histonedeacetylase inhibitor Oxamflatin increase HIV-1 transcription by inducing histone modification in latently infected cells. Molecular Biology Reports 38:8, 5071-5078
CrossRef4
A. Biyi. (2011) Une radiothérapie interne contre l’infection au VIH, la dernière pièce du puzzle ?. Médecine Nucléaire 35:10, 545-552
CrossRef5
S. Palmer, L. Josefsson, J. M. Coffin. (2011) HIV reservoirs and the possibility of a cure for HIV infection. Journal of Internal Medicineno-no
CrossRef6
Chenlei Leng, Hua Liang, Neil Martinson. (2011) Parametric variable selection in generalized partially linear models with an application to assess condom use by HIV-infected patients. Statistics in Medicine 30:16, 2015-2027
CrossRef7
Monamorn Precharattana, Arthorn Nokkeaw, Wannapong Triampo, Darapond Triampo, Yongwimon Lenbury. (2011) Stochastic cellular automata model and Monte Carlo simulations of CD4+ T cell dynamics with a proposed alternative leukapheresis treatment for HIV/AIDS. Computers in Biology and Medicine 41:7, 546-558
CrossRef8
P. Corbeau, J. Reynes. (2011) Immune reconstitution under antiretroviral therapy: the new challenge in HIV-1 infection. Blood 117:21, 5582-5590
CrossRef9
David M. Margolis. (2011) Eradication Therapies for HIV Infection: Time to Begin Again. AIDS Research and Human Retroviruses 27:4, 347-353
CrossRef10
Valentina Cambiano, Andrew N Phillips. (2011) Modelling the impact of treatment with individual antiretrovirals. Current Opinion in HIV and AIDS 6:2, 124-130
CrossRef11
Horrick Sharma, Shivaputra Patil, Tino W. Sanchez, Nouri Neamati, Raymond F. Schinazi, John K. Buolamwini. (2011) Synthesis, biological evaluation and 3D-QSAR studies of 3-keto salicylic acid chalcones and related amides as novel HIV-1 integrase inhibitors. Bioorganic & Medicinal Chemistry 19:6, 2030-2045
CrossRef12
Susan Moir, Tae-Wook Chun, Anthony S. Fauci. (2011) Pathogenic Mechanisms of HIV Disease *. Annual Review of Pathology: Mechanisms of Disease 6:1, 223-248
CrossRef13
Lucy A McNamara, Kathleen L Collins. (2011) Hematopoietic stem/precursor cells as HIV reservoirs. Current Opinion in HIV and AIDS 6:1, 43-48
CrossRef14
Thomas Cherrier, Mikael Elias, Alicia Jeudy, Guillaume Gotthard, Valentin Le Douce, Houda Hallay, Patrick Masson, Andrea Janossy, Ermanno Candolfi, Olivier Rohr, Eric Chabrière, Christian Schwartz. (2011) Human-Phosphate-Binding-Protein inhibits HIV-1 gene transcription and replication. Virology Journal 8:1, 352
CrossRef15
Viviane D Lima, David R Bangsberg, P Richard Harrigan, Steven G Deeks, Benita Yip, Robert S Hogg, Julio S G Montaner. (2010) Risk of Viral Failure Declines With Duration of Suppression on Highly Active Antiretroviral Therapy Irrespective of Adherence Level. JAIDS Journal of Acquired Immune Deficiency Syndromes 55:4, 460-465
CrossRef16
Anil Sorathiya, Andrea Bracciali, Pietro Liò. (2010) An integrated modelling approach for R5–X4 mutation and HAART therapy assessment. Swarm Intelligence 4:4, 319-340
CrossRef17
Tae-Wook Chun, J Shawn Justement, Danielle Murray, Claire W Hallahan, Janine Maenza, Ann C Collier, Prameet M Sheth, Rupert Kaul, Mario Ostrowski, Susan Moir, Colin Kovacs, Anthony S Fauci. (2010) Rebound of plasma viremia following cessation of antiretroviral therapy despite profoundly low levels of HIV reservoir: implications for eradication. AIDS 24:18, 2803-2808
CrossRef18
Haitao Chu, Stephen J. Gange, Xiuhong Li, Donald R. Hoover, Chenglong Liu, Joan S. Chmiel, Lisa P. Jacobson. (2010) The Effect of HAART on HIV RNA Trajectory Among Treatment-naïve Men and Women. Epidemiology 21:Supplement, S25-S34
CrossRef19
B. Taiwo, C. Hicks, J. Eron. (2010) Unmet therapeutic needs in the new era of combination antiretroviral therapy for HIV-1. Journal of Antimicrobial Chemotherapy 65:6, 1100-1107
CrossRef20
L. Rong, H. Dahari, R. M. Ribeiro, A. S. Perelson. (2010) Rapid Emergence of Protease Inhibitor Resistance in Hepatitis C Virus. Science Translational Medicine 2:30, 30ra32-30ra32
CrossRef21
Parveen Reshi, Iqbal M. Lone. (2010) Human immunodeficiency virus and pregnancy. Archives of Gynecology and Obstetrics 281:5, 781-792
CrossRef22
P. Loke, D. Favre, P. W. Hunt, J. M. Leung, B. Kanwar, J. N. Martin, S. G. Deeks, J. M. McCune. (2010) Correlating cellular and molecular signatures of mucosal immunity that distinguish HIV controllers from noncontrollers. Blood 115:15, e20-e32
CrossRef23
Lucinda Aguirre-Cruz, Klintsy J. Torres, Helgi Jung-Cook, Carlos Fortuny, Eder Sánchez, Antonio Soda-Mehry, Julio Sotelo, Gustavo Reyes-Terán. (2010) Short Communication: Preferential Concentration of Hydroxychloroquine in Adenoid Tissue of HIV-Infected Subjects. AIDS Research and Human Retroviruses 26:3, 339-342
CrossRef24
Christian L Althaus, Rob J De Boer. (2010) Intracellular transactivation of HIV can account for the decelerating decay of virus load during drug therapy. Molecular Systems Biology 6,
CrossRef25
Scott M. Hammer, Heather Ribaudo, Roland Bassett, John W. Mellors, Lisa M. Demeter, Robert W. Coombs, Judith Currier, Gene D. Morse, John G. Gerber, Ana I. Martinez, William Spreen, Margaret A. Fischl, Kathleen E. Squires. (2010) A Randomized, Placebo-Controlled Trial of Abacavir Intensification in HIV-1–Infected Adults With Virologic Suppression on a Protease Inhibitor–Containing Regimen. HIV Clinical Trials 11:6, 312-324
CrossRef26
Antonio Valentin, Matthew Morrow, Richard H. Poirier, Karen Aleman, Richard Little, Robert Yarchoan, George N. Pavlakis. (2010) Identification of a Potential Pharmacological Sanctuary for HIV Type 1 in a Fraction of CD4 + Primary Cells. AIDS Research and Human Retroviruses 26:1, 79-88
CrossRef27
Libin Rong, Alan S. Perelson. (2009) Modeling HIV persistence, the latent reservoir, and viral blips. Journal of Theoretical Biology 260:2, 308-331
CrossRef28
Nicolas Chomont, Mohamed El-Far, Petronela Ancuta, Lydie Trautmann, Francesco A Procopio, Bader Yassine-Diab, Geneviève Boucher, Mohamed-Rachid Boulassel, Georges Ghattas, Jason M Brenchley, Timothy W Schacker, Brenna J Hill, Daniel C Douek, Jean-Pierre Routy, Elias K Haddad, Rafick-Pierre Sékaly. (2009) HIV reservoir size and persistence are driven by T cell survival and homeostatic proliferation. Nature Medicine 15:8, 893-900
CrossRef29
Jerrome K. Percus, Ora E. Percus, Michele Di Mascio. (2009) The amplitudes of viral blips in HIV-1 infected patients treated with antiretroviral therapy are power-law distributed. Journal of Theoretical Biology 257:3, 454-459
CrossRef30
Steven Yukl, Satish Pillai, Peilin Li, Karen Chang, William Pasutti, Chris Ahlgren, Diane Havlir, Matthew Strain, Huldrych Günthard, Douglas Richman, Andrew P. Rice, Eric Daar, Susan Little, Joseph K. Wong. (2009) Latently-infected CD4+ T cells are enriched for HIV-1 Tat variants with impaired transactivation activity. Virology 387:1, 98-108
CrossRef31
Hans S L M Nottet, Sabine J van Dijk, Ewout B Fanoy, Irma W Goedegebuure, Dorien de Jong, Nienke Vrisekoop, Debbie van Baarle, Valerie Boltz, Sarah Palmer, Jan C C Borleffs, Charles A B Boucher. (2009) HIV-1 Can Persist in Aged Memory CD4+ T Lymphocytes With Minimal Signs of Evolution After 8.3 Years of Effective Highly Active Antiretroviral Therapy. JAIDS Journal of Acquired Immune Deficiency Syndromes 50:4, 345-353
CrossRef32
D. D. Richman, D. M. Margolis, M. Delaney, W. C. Greene, D. Hazuda, R. J. Pomerantz. (2009) The Challenge of Finding a Cure for HIV Infection. Science 323:5919, 1304-1307
CrossRef33
Hui Zhang. (2009) Reversal of HIV-1 latency with anti-microRNA inhibitors. The International Journal of Biochemistry & Cell Biology 41:3, 451-454
CrossRef34
A. Marconi, M. Balestrieri, G. Comastri, F. R. Pulvirenti, W. Gennari, S. Tagliazucchi, M. Pecorari, V. Borghi, D. Marri, M. Zazzi. (2009) Evaluation of the Abbott Real-Time HIV-1 quantitative assay with dried blood spot specimens. Clinical Microbiology and Infection 15:1, 93-97
CrossRef35
B. Joos, M. Fischer, H. Kuster, S. K. Pillai, J. K. Wong, J. Boni, B. Hirschel, R. Weber, A. Trkola, H. F. Gunthard, . (2008) HIV rebounds from latently infected cells, rather than from continuing low-level replication. Proceedings of the National Academy of Sciences 105:43, 16725-16730
CrossRef36
Lin Shen, Robert F. Siliciano. (2008) Viral reservoirs, residual viremia, and the potential of highly active antiretroviral therapy to eradicate HIV infection. Journal of Allergy and Clinical Immunology 122:1, 22-28
CrossRef37
Nancy M Archin, Joseph J Eron, Sarah Palmer, Anne Hartmann-Duff, Jeffery A Martinson, Ann Wiegand, Nicholas Bandarenko, John L Schmitz, Ronald J Bosch, Alan L Landay, John M Coffin, David M Margolis. (2008) Valproic acid without intensified antiviral therapy has limited impact on persistent HIV infection of resting CD4+ T cells. AIDS 22:10, 1131-1135
CrossRef38
Ard van Sighem, Shuangjie Zhang, Peter Reiss, Luuk Gras, Marchina van der Ende, Frank Kroon, Jan Prins, Frank de Wolf. (2008) Immunologic, Virologic, and Clinical Consequences of Episodes of Transient Viremia During Suppressive Combination Antiretroviral Therapy. JAIDS Journal of Acquired Immune Deficiency Syndromes 48:1, 104-108
CrossRef39
Hui Zhang. (2008) Role of miRNA in HIV-1 latency. Future HIV Therapy 2:3, 281-290
CrossRef40
S. Palmer, F. Maldarelli, A. Wiegand, B. Bernstein, G. J. Hanna, S. C. Brun, D. J. Kempf, J. W. Mellors, J. M. Coffin, M. S. King. (2008) Low-level viremia persists for at least 7 years in patients on suppressive antiretroviral therapy. Proceedings of the National Academy of Sciences 105:10, 3879-3884
CrossRef41
Tae‐Wook Chun, David C. Nickle, Jesse S. Justement, Jennifer H. Meyers, Gregg Roby, Claire W. Hallahan, Shyam Kottilil, Susan Moir, JoAnn M. Mican, James I. Mullins, Douglas J. Ward, Joseph A. Kovacs, Peter J. Mannon, Anthony S. Fauci. (2008) Persistence of HIV in Gut‐Associated Lymphoid Tissue despite Long‐Term Antiretroviral Therapy. The Journal of Infectious Diseases 197:5, 714-720
CrossRef42
Sharon R Lewin, John M Murray, Ajantha Solomon, Fiona Wightman, Paul U Cameron, Damian J Purcell, John J Zaunders, Pat Grey, Mark Bloch, Don Smith, David A Cooper, Anthony D Kelleher. (2008) Virologic Determinants of Success After Structured Treatment Interruptions of Antiretrovirals in Acute HIV-1 Infection. JAIDS Journal of Acquired Immune Deficiency Syndromes 47:2, 140-147
CrossRef43
Cristina Cellerai, Susan J Little, Sabine Kinloch-de Loes. (2008) Treatment of acute HIV-1 infection: are we getting there?. Current Opinion in HIV and AIDS 3:1, 67-74
CrossRef44
S. Saleh, A. Solomon, F. Wightman, M. Xhilaga, P. U. Cameron, S. R. Lewin. (2007) CCR7 ligands CCL19 and CCL21 increase permissiveness of resting memory CD4+ T cells to HIV-1 infection: a novel model of HIV-1 latency. Blood 110:13, 4161-4164
CrossRef45
Jialing Huang, Fengxiang Wang, Elias Argyris, Keyang Chen, Zhihui Liang, Heng Tian, Wenlin Huang, Kathleen Squires, Gwen Verlinghieri, Hui Zhang. (2007) Cellular microRNAs contribute to HIV-1 latency in resting primary CD4+ T lymphocytes. Nature Medicine 13:10, 1241-1247
CrossRef46
John M Murray, Sean Emery, Anthony D Kelleher, Matthew Law, Joshua Chen, Daria J Hazuda, Bach-Yen T Nguyen, Hedy Teppler, David A Cooper. (2007) Antiretroviral therapy with the integrase inhibitor raltegravir alters decay kinetics of HIV, significantly reducing the second phase. AIDS 21:17, 2315-2321
CrossRef47
O. Krakovska, L. M. Wahl. (2007) Drug-Sparing Regimens for HIV Combination Therapy: Benefits Predicted for “Drug Coasting”. Bulletin of Mathematical Biology 69:8, 2627-2647
CrossRef48
Gonzalo Bello, Concepción Casado, Virginia Sandonis, Tamara Alvaro-Cifuentes, Caio A. Rodrigues dos Santos, Soledad García, Carmen Rodríguez, Jorge del Romero, José H. Pilotto, Beatriz Grinsztejn, Valdilea G. Veloso, Mariza G. Morgado, Cecilio López-Galíndez. (2007) Plasma Viral Load Threshold for Sustaining Intrahost HIV Type 1 Evolution. AIDS Research and Human Retroviruses 23:10, 1242-1250
CrossRef49
Bernd Kupfer, Bertfried Matz, Martin P. Däumer, Fabienne Roden, Jürgen K. Rockstroh, Nazifa Qurishi, Ulrich Spengler, Rolf Kaiser. (2007) Frequent detection of cell-associated HIV-1 RNA in patients with plasma viral load <50 copies/ml. Journal of Medical Virology 79:10, 1440-1445
CrossRef50
Libin Rong, Zhilan Feng, Alan S. Perelson. (2007) Emergence of HIV-1 Drug Resistance During Antiretroviral Treatment. Bulletin of Mathematical Biology 69:6, 2027-2060
CrossRef51
Laura E Jones, Alan S Perelson. (2007) Transient Viremia, Plasma Viral Load, and Reservoir Replenishment in HIV-Infected Patients on Antiretroviral Therapy. JAIDS Journal of Acquired Immune Deficiency Syndromes 45:5, 483-493
CrossRef52
Libin Rong, Michael A. Gilchrist, Zhilan Feng, Alan S. Perelson. (2007) Modeling within-host HIV-1 dynamics and the evolution of drug resistance: Trade-offs between viral enzyme function and drug susceptibility. Journal of Theoretical Biology 247:4, 804-818
CrossRef53
Loredana Sarmati, Saverio Giuseppe Parisi, Emanuele Nicastri, Gabriella d'Ettorre, Carolina Andreoni, Luca Dori, Francesca Gatti, Marco Montano, Anna Rita Buonomini, Caterina Boldrin, Giorgio Palù, Vincenzo Vullo, Massimo Andreoni. (2007) Cellular HIV-1 DNA quantitation in patients during simplification therapy with protease inhibitor-sparing regimens. Journal of Medical Virology 79:7, 880-886
CrossRef54
Houria Hendel Chavez, Tu-Anh Tran, Bamory Dembele, Nadine Nasreddine, Olivier Lambotte, Brigitte Gubler, Emilie le N??vot, Jean-Fran??ois Delfraissy, Yassine Taoufik. (2007) Lack of Evidence for Prolonged Double-Long Terminal Repeat Episomal HIV DNA Stability In Vivo. JAIDS Journal of Acquired Immune Deficiency Syndromes 45:2, 247-249
CrossRef55
Luuk Gras, Anouk M Kesselring, James T Griffin, Ard I van Sighem, Christophe Fraser, Azra C Ghani, Frank Miedema, Peter Reiss, Joep M A Lange, Frank de Wolf. (2007) CD4 Cell Counts of 800 Cells/mm3 or Greater After 7 Years of Highly Active Antiretroviral Therapy Are Feasible in Most Patients Starting With 350 Cells/mm3 or Greater. JAIDS Journal of Acquired Immune Deficiency Syndromes 45:2, 183-192
CrossRef56
Ombretta Turriziani, Mauro Bucci, Armando Stano, Carolina Scagnolari, Francesca Bellomi, Caterina Fimiani, Ivano Mezzaroma, Gabriella D??Ettorre, Andrea Brogi, Vincenzo Vullo, Guido Antonelli. (2007) Genotypic Resistance of Archived and Circulating Viral Strains in the Blood of Treated HIV-Infected Individuals. JAIDS Journal of Acquired Immune Deficiency Syndromes 44:5, 518-524
CrossRef57
Kristina Allers, Stefanie A Knoepfel, Pia Rauch, Hauke Walter, Milos Opravil, Marek Fischer, Huldrych F G??nthard, Karin J Metzner. (2007) Persistence of Lamivudine-Sensitive HIV-1 Quasispecies in the Presence of Lamivudine In Vitro and In Vivo. JAIDS Journal of Acquired Immune Deficiency Syndromes 44:4, 377-385
CrossRef58
Nicola M. Zetola, Christopher D. Pilcher. (2007) Diagnosis and Management of Acute HIV Infection. Infectious Disease Clinics of North America 21:1, 19-48
CrossRef59
Christopher Polk, Kirk M. Chan-Tack, Angela M. Kopack, Anthony Amoroso. (2007) Induction Therapy with Enfuvirtide-Based Highly Active Antiretroviral Therapy in A Patient with Acute HIV-1 Infection. AIDS Patient Care and STDs 21:2, 75-77
CrossRef60
Yefei Han, Megan Wind-Rotolo, Hung-Chih Yang, Janet D. Siliciano, Robert F. Siliciano. (2007) Experimental approaches to the study of HIV-1 latency. Nature Reviews Microbiology 5:2, 95-106
CrossRef61
Javier Martinez-Picado, Lily Wai Yan Tam. (2007) Risk of selecting resistance mutations during treatment interruption. Current Opinion in HIV and AIDS 2:1, 6-13
CrossRef62
Lidia Ruiz, Roger Paredes, Guadalupe Gómez, Joan Romeu, Pere Domingo, Nuria Pérez-Alvarez, Giuseppe Tambussi, Josep Maria Llibre, Javier Martínez-Picado, Francesc Vidal, Carmina R Fumaz, Bonaventura Clotet. (2007) Antiretroviral therapy interruption guided by CD4 cell counts and plasma HIV-1 RNA levels in chronically HIV-1-infected patients. AIDS 21:2, 169-178
CrossRef63
K MANAVI. (2006) A review on infection with human immunodeficiency virus. Best Practice & Research Clinical Obstetrics & Gynaecology 20:6, 923-940
CrossRef64
Lydie Trautmann, Loury Janbazian, Nicolas Chomont, Elias A Said, Sylvain Gimmig, Benoit Bessette, Mohamed-Rachid Boulassel, Eric Delwart, Homero Sepulveda, Robert S Balderas, Jean-Pierre Routy, Elias K Haddad, Rafick-Pierre Sekaly. (2006) Upregulation of PD-1 expression on HIV-specific CD8+ T cells leads to reversible immune dysfunction. Nature Medicine 12:10, 1198-1202
CrossRef65
Julio SG Montaner, Robert Hogg, Evan Wood, Thomas Kerr, Mark Tyndall, Adrian R Levy, P Richard Harrigan. (2006) The case for expanding access to highly active antiretroviral therapy to curb the growth of the HIV epidemic. The Lancet 368:9534, 531-536
CrossRef66
Hsi-Hsun Lin, Yi-Li Shih, Yung-Ching Liu, Susan Shin-Jung Lee, Chun-Kai Huang, Ya-Lei Chen, Chuen Chin, Chung-Hsu Lai, Hung-Chin Tsai, Yi-Chi Guo, Linqi Zhang. (2006) An Epidemic of HIV Type I CRF07_BC Infection Among Injection Drug Users in Taiwan. JAIDS Journal of Acquired Immune Deficiency Syndromes 42:2, 248-255
CrossRef67
Karin J Metzner. (2006) Persistence of drug-resistant HIV-1 and possible implications for antiretroviral therapy. Future Virology 1:3, 377-391
CrossRef68
P LASSERRE, J MOATTI, A SOUBEYRAN. (2006) Early initiation of highly active antiretroviral therapies for AIDS: Dynamic choice with endogenous and exogenous learning. Journal of Health Economics 25:3, 579-598
CrossRef69
Li Huang, Phong Ho, Kuo-Hsiung Lee, Chin-Ho Chen. (2006) Synthesis and anti-HIV activity of bi-functional betulinic acid derivatives. Bioorganic & Medicinal Chemistry 14:7, 2279-2289
CrossRef70
Sarah E. Holte, Ann J. Melvin, James I. Mullins, Nicole H. Tobin, Lisa M. Frenkel. (2006) Density-Dependent Decay in HIV-1 Dynamics. JAIDS Journal of Acquired Immune Deficiency Syndromes 41:3, 266-276
CrossRef71
Stefano Rusconi, Ottavia Vigano. (2006) New HIV protease inhibitors for drug-resistant viruses. Therapy 3:1, 79-88
CrossRef72
Kelly M. Cheney, Raman Kumar, Adrian Purins, Linda Mundy, Wendy Ferguson, David Shaw, Christopher J. Burrell, Peng LI. (2006) HIV Type 1 Persistence in CD4¯/CD8¯ Double Negative T Cells from Patients on Antiretroviral Therapy. AIDS Research and Human Retroviruses 22:1, 66-75
CrossRef73
Christine M Haggerty, Eleanor Pitt, Robert F Siliciano. (2006) The latent reservoir for HIV-1 in resting CD4+ T cells and other viral reservoirs during chronic infection: insights from treatment and treatment-interruption trials. Current Opinion in HIV and AIDS 1:1, 62-68
CrossRef74
Saleta Sierra, Bernd Kupfer, Rolf Kaiser. (2005) Basics of the virology of HIV-1 and its replication. Journal of Clinical Virology 34:4, 233-244
CrossRef75
Nienke Vrisekoop, Sanjay U.C. Sankatsing, Christine A. Jansen, Marijke Th. L. Roos, Sigrid A. Otto, Hanneke Schuitemaker, Joep M.A. Lange, Jan M. Prins, Frank Miedema. (2005) Short Communication: No Detrimental Immunological Effects of Mycophenolate Mofetil and HAART in Treatment-Naive Acute and Chronic HIV-1-Infected Patients. AIDS Research and Human Retroviruses 21:12, 991-996
CrossRef76
Pierre Delobel, Karine Sandres-Sauné, Michelle Cazabat, Fatima-Ezzahra LʼFaqihi, Christian Aquilina, Martine Obadia, Christophe Pasquier, Bruno Marchou, Patrice Massip, Jacques Izopet. (2005) Persistence of distinct HIV-1 populations in blood monocytes and naive and memory CD4 T cells during prolonged suppressive HAART. AIDS 19:16, 1739-1750
CrossRef77
Lucia Palmisano, Marina Giuliano, Emanuele Nicastri, Maria Franca Pirillo, Mauro Andreotti, Clementina M Galluzzo, Raffaella Bucciardini, Vincenzo Fragola, Massimo Andreoni, Stefano Vella. (2005) Residual viraemia in subjects with chronic HIV infection and viral load < 50 copies/ml: the impact of highly active antiretroviral therapy. AIDS 19:16, 1843-1847
CrossRef78
Rosario C. Mata, Pompeyo Viciana, Arístides De Alarcón, Luis F. López-Cortés, Josefa Gómez-Vera, Mónica Trastoy, José M. Cisneros. (2005) Discontinuation of Antiretroviral Therapy in Patients with Chronic HIV Infection: Clinical, Virologic, and Immunologic Consequences. AIDS Patient Care and STDs 19:9, 550-562
CrossRef79
Valérie Martinez, Anne-Geneviève Marcelin, Jean-Pierre Morini, Jean Deleuze, Anne Krivine, Isabelle Gorin, Sabine Yerly, Luc Perrin, Gilles Peytavin, Vincent Calvez, Nicolas Dupin. (2005) HIV-1 intermittent viraemia in patients treated by non-nucleoside reverse transcriptase inhibitor-based regimen. AIDS 19:10, 1065-1069
CrossRef80
Francesca Vitone, Davide Gibellini, Pasqua Schiavone, Maria Carla Re. (2005) Quantitative DNA proviral detection in HIV-1 patients treated with antiretroviral therapy. Journal of Clinical Virology 33:3, 194-200
CrossRef81
B Gazzard, . (2005) British HIV Association (BHIVA) guidelines for the treatment of HIV-infected adults with antiretroviral therapy (2005). HIV Medicine 6:S2, 1-61
CrossRef82
Evan Wood, Robert S Hogg, P Richard Harrigan, Julio SG Montaner. (2005) When to initiate antiretroviral therapy in HIV-1-infected adults: a review for clinicians and patients. The Lancet Infectious Diseases 5:7, 407-414
CrossRef83
Jeffrey M. Jacobson. (2005) Immune-based therapies: An adjunct to antiretroviral treatment. Current HIV/AIDS Reports 2:2, 90-97
CrossRef84
Janet L. Macpherson, Maureen P. Boyd, Allison J. Arndt, Alison V. Todd, Gregory C. Fanning, Julie A. Ely, Fiona Elliott, Alison Knop, Mitch Raponi, John Murray, Wayne Gerlach, Lun-Quan Sun, Ronald Penny, Geoff P. Symonds, Andrew Carr, David A. Cooper. (2005) Long-term survival and concomitant gene expression of ribozyme-transduced CD4+ T-lymphocytes in HIV-infected patients. The Journal of Gene Medicine 7:5, 552-564
CrossRef85
Janice Clements, Ming Li, Lucio Gama, Brandon Bullock, Lucy Carruth, Joseph Mankowski, M Zink. (2005) The central nervous system is a viral reservoir in simian immunodeficiency virus–infected macaques on combined antiretroviral therapy: A model for human immunodeficiency virus patients on highly active antiretroviral theraby. Journal of NeuroVirology 11:2, 180-189
CrossRef86
J. Montaner, M. Harris, R. Hogg. (2005) Structured Treatment Interruptions: A Risky Business. Clinical Infectious Diseases 40:4, 601-603
CrossRef87
Elise D Riley, David R Bangsberg, David Guzman, Sharon Perry, Andrew R Moss. (2005) Antiretroviral Therapy, Hepatitis C Virus, and AIDS Mortality Among San Francisco??s Homeless and Marginally Housed. JAIDS Journal of Acquired Immune Deficiency Syndromes 38:2, 191-195
CrossRef88
Heidi H. Kong, Sarah A. Myers. (2005) Cutaneous effects of highly active antiretroviral therapy in HIV-infected patients. Dermatologic Therapy 18:1, 58-66
CrossRef89
J.M. Miró Meda, L. Zamora Talló, M. Tuset Creus, O. Sued, E. López Suñé, J.L. Blanco Arévalo, F. García Alcaide, E. Martínez Chamorro, J. Mallolas Masferrer, J.M. Gatell Artigas. (2004) Infección por el VIH: tratamiento antirretrovírico de la infección por el VIH en adultos. Medicine - Programa de Formación Médica Continuada Acreditado 9:23, 1461-1480
CrossRef90
Anna Rosa Garbuglia, Silvia Calcaterra, Gianpiero D'Offizi, Simone Topino, Pasquale Narciso, Flavia Lillo, Enrico Girardi, Maria Rosaria Capobianchi. (2004) HIV-1 DNA burden dynamics in CD4 T cells and monocytes in patients undergoing a transient therapy interruption. Journal of Medical Virology 74:3, 373-381
CrossRef91
Angelos E Hatzakis, Giota Touloumi, Nikos Pantazis, Cleo G Anastassopoulou, Olga Katsarou, Anastasia Karafoulidou, James J Goedert, Leondios G Kostrikis. (2004) Cellular HIV-1 DNA load predicts HIV-RNA rebound and the outcome of highly active antiretroviral therapy. AIDS 18:17, 2261-2267
CrossRef92
Sanjay U C Sankatsing, Suzanne Jurriaans, Peter van Swieten, Frank van Leth, Marion Cornelissen, Frank Miedema, Joep M A Lange, Hanneke Schuitemaker, Jan M Prins. (2004) Highly active antiretroviral therapy with or without mycophenolate mofetil in treatment-naive HIV-1 patients. AIDS 18:14, 1925-1931
CrossRef93
Nathalie Daniel, Bénédicte Charmeteau, Sophie Grabar, Gilles Pialoux, Dominique Salmon, Nelly Bonilla, Marion Dupuis, Christelle Troadec, Willy Rozenbaum, Hanne Gahéry-Ségard, Jean-Gérard Guillet, Muriel Andrieu. (2004) Use of Well-Defined HIV-Derived Epitopes to Evaluate CD4 + and CD8 + T Cell Responses in Patients with Chronic HIV-1 Infection Treated with HAART. AIDS Research and Human Retroviruses 20:8, 827-835
CrossRef94
Mercedes Bermejo, Sonsoles S
nchez-Palomino, Luis Us
CrossRef95
Hetty Blaak, Patrick H. M. Boers, Martin Schutten, Marchina E. van der Endeñ, Albert D. M. E. Osterhaus. (2004) HIV-2-Infected Individuals With Undetectable Plasma Viremia Carry Replication-Competent Virus in Peripheral Blood Lymphocytes. JAIDS Journal of Acquired Immune Deficiency Syndromes 36:3, 777-782
CrossRef96
Nonia Pariente, Mar
CrossRef97
S. Kassutto, E. S. Rosenberg. (2004) Primary HIV Type 1 Infection. Clinical Infectious Diseases 38:10, 1447-1453
CrossRef98
Olivier Lambotte, Marie-Laure Chaix, Brigitte Gubler, Nadine Nasreddine, Christine Wallon, C??cile Goujard, Christine Rouzioux, Yassine Taoufik, Jean-Fran??ois Delfraissy. (2004) The lymphocyte HIV reservoir in patients on long-term HAART is a memory of virus evolution. AIDS 18:8, 1147-1158
CrossRef99
Christophe Bénard, Fatima Zouhiri, Marie Normand-Bayle, Michèle Danet, Didier Desmaële, Hervé Leh, Jean-François Mouscadet, Gladys Mbemba, Claire-Marie Thomas, Sabine Bonnenfant, Marc Le Bret, Jean d'Angelo. (2004) Linker-modified quinoline derivatives targeting HIV-1 integrase: synthesis and biological activity. Bioorganic & Medicinal Chemistry Letters 14:10, 2473-2476
CrossRef100
Andrew M. Tershakovec, Ian Frank, Daniel Rader. (2004) HIV-related lipodystrophy and related factors. Atherosclerosis 174:1, 1-10
CrossRef101
Loyda Ylisastigui, Nancie M Archin, Ginger Lehrman, Ronald J Bosch, David M Margolis. (2004) Coaxing HIV-1 from resting CD4 T cells. AIDS 18:8, 1101-1108
CrossRef102
Lisa M. Frenkel, Nicole H. Tobin. (2004) Understanding HIV-1 Drug Resistance. Therapeutic Drug Monitoring 26:2, 116-121
CrossRef103
Christopher D. Pilcher, Joseph J. Eron, Shannon Galvin, Cynthia Gay, Myron S. Cohen. (2004) Acute HIV revisited: new opportunities for treatment and prevention. Journal of Clinical Investigation 113:7, 937-945
CrossRef104
D. N. Levy, G. M. Aldrovandi, O. Kutsch, G. M. Shaw. (2004) From the Cover: Dynamics of HIV-1 recombination in its natural target cells. Proceedings of the National Academy of Sciences 101:12, 4204-4209
CrossRef105
R. Pat Bucy. (2004) Viral and cellular dynamics in HIV disease. Current HIV/AIDS Reports 1:1, 40-46
CrossRef106
José Miguel Benito, Mariola López, Sara Lozano, Pilar Martinez, Juan González-Lahoz, Vincent Soriano. (2004) CD38 Expression on CD8 T Lymphocytes as a Marker of Residual Virus Replication in Chronically HIV-Infected Patients Receiving Antiretroviral Therapy. AIDS Research and Human Retroviruses 20:2, 227-233
CrossRef107
Sanjay U C Sankatsing, Patrick G Hoggard, Alwin D R Huitema, Rolf W Sparidans, Stephen Kewn, Kristel M L Crommentuyn, Joep M A Lange, Jos H Beijnen, David J Back, Jan M Prins. (2004) Effect of Mycophenolate Mofetil on the Pharmacokinetics of Antiretroviral Drugs and on Intracellular Nucleoside Triphosphate Pools. Clinical Pharmacokinetics 43:12, 823-832
CrossRef108
Jennifer Handforth, Mike Sharland. (2004) Triple Nucleoside Reverse Transcriptase Inhibitor Therapy in??Children. Pediatric Drugs 6:3, 147-159
CrossRef109
Bharat Ramratnam, Ruy Ribeiro, Tian He, Chris Chung, Viviana Simon, Jeroen Vanderhoeven, Arlene Hurley, Linqi Zhang, Alan S. Perelson, David D. Ho, Martin Markowitz. (2004) Intensification of Antiretroviral Therapy Accelerates the Decay of the HIV-1 Latent Reservoir and Decreases, But Does Not Eliminate, Ongoing Virus Replication. JAIDS Journal of Acquired Immune Deficiency Syndromes 35:1, 33-37
CrossRef110
Antonio Cosma, Rashmi Nagaraj, Silja Bühler, Jorma Hinkula, Dirk H. Busch, Gerd Sutter, Frank D. Goebel, Volker Erfle. (2003) Therapeutic vaccination with MVA-HIV-1 nef elicits Nef-specific T-helper cell responses in chronically HIV-1 infected individuals. Vaccine 22:1, 21-29
CrossRef111
Steve W Cole, Margaret E Kemeny, John L Fahey, Jerome A Zack, Bruce D Naliboff. (2003) Psychological risk factors for HIV pathogenesis: mediation by the autonomic nervous system. Biological Psychiatry 54:12, 1444-1456
CrossRef112
Viviana Simon, David D. Ho. (2003) HIV-1 dynamics in vivo: implications for therapy. Nature Reviews Microbiology 1:3, 181-190
CrossRef113
Sunil Shaunak, Ian Teo. (2003) Monitoring HIV disease with new and clinically useful surrogate markers. Current Opinion in Infectious Diseases 16:6, 581-586
CrossRef114
Antonello Giovannetti, Marina Pierdominici, Marco Marziali, Francesca Mazzetta, Elisabetta Caprini, Giandomenico Russo, Roberto Bugarini, Maria Livia Bernardi, Ivano Mezzaroma, Fernando Aiuti. (2003) Persistently Biased T-Cell Receptor Repertoires in HIV-1-Infected Combination Antiretroviral Therapy???Treated Patients Despite Sustained Suppression of Viral Replication. JAIDS Journal of Acquired Immune Deficiency Syndromes 34:2, 140-154
CrossRef115
(2003) British HIV Association (BHIVA) guidelines for the treatment of HIV-infected adults with antiretroviral therapy. HIV Medicine 4:S1, 1-41
CrossRef116
Xiuqiong Bi, Hiroyuki Gatanaga, Setsuko Ida, Kiyoto Tsuchiya, Saori Matsuoka-Aizawa, Satoshi Kimura, Shinichi Oka. (2003) Emergence of Protease Inhibitor Resistance???Associated Mutations in Plasma HIV-1 Precedes That in Proviruses of Peripheral Blood Mononuclear Cells by More Than a Year. JAIDS Journal of Acquired Immune Deficiency Syndromes 34:1, 1-6
CrossRef117
R. Y. Chen, A. O. Westfall, M. J. Mugavero, G. A. Cloud, J. L. Raper, A. G. Chatham, E. P. Acosta, K. H. Taylor, J. Carter, M. S. Saag. (2003) Duration of Highly Active Antiretroviral Therapy Regimens. Clinical Infectious Diseases 37:5, 714-722
CrossRef118
Waimar Tun, David D Celentano, David Vlahov, Steffanie A Strathdee. (2003) Attitudes toward HIV treatments influence unsafe sexual and injection practices among injecting drug users. AIDS 17:13, 1953-1962
CrossRef119
Neal Padte, Leslie Rowe, Arlene Hurley, Viviana Simon, Martin Markowitz. (2003) Sustained viremia during highly active antiretroviral therapy with accelerated proviral DNA decay in the setting of infection with syphilis. AIDS 17:14, 2142-2143
CrossRef120
Harry Michelmore, Sarangapany Jeganathan, Derek Chan, Marijka Batterham. (2003) Sustained HIV-1 Suppression in Treatment-Naive Patients Undergoing 4- to 3-Drug Induction Maintenance Therapy (INDUMAIN). JAIDS Journal of Acquired Immune Deficiency Syndromes 33:4, 543-544
CrossRef121
David C Nickle, Daniel Shriner, John E Mittler, Lisa M Frenkel, James I Mullins. (2003) Importance and detection of virus reservoirs and compartments of HIV infection. Current Opinion in Microbiology 6:4, 410-416
CrossRef122
Jörg Schüpbach, Jürg Böni, Leslie R. Bisset, Zuzana Tomasik, Marek Fischer, Huldrych F. Günthard, Bruno Ledergerber, Milos Opravil. (2003) HIV-1 p24 Antigen Is a Significant Inverse Correlate of CD4 T-Cell Change in Patients With Suppressed Viremia Under Long-Term Antiretroviral Therapy. JAIDS Journal of Acquired Immune Deficiency Syndromes 33:3, 292-299
CrossRef123
Jim A Turpin. (2003) The next generation of HIV/AIDS drugs: novel and developmental antiHIV drugs and targets. Expert Review of Anti-infective Therapy 1:1, 97-128
CrossRef124
M. Ortega, J.M. Eiros, C. Labayru, B. Hernández, G. Bou, R.Ortiz de Lejarazu. (2003) Factors associated with the evolution of the viral load in individuals with HIV infection. International Journal of Antimicrobial Agents 21:5, 478-483
CrossRef125
Margaret Chesney. (2003) Adherence to HAART Regimens. AIDS Patient Care and STDs 17:4, 169-177
CrossRef126
John Morlese, Ian A Teo, Ji-won Choi, Brian Gazzard, Sunil Shaunak. (2003) Identification of two mutually exclusive groups after long-term monitoring of HIV DNA 2-LTR circle copy number in patients on HAART. AIDS 17:5, 679-683
CrossRef127
Nguyen Duc Tuan, Wolfgang Gutleben, Karin Scherer, Heribert Stoiber, Barbara Falkensammer, Manfred P. Dierich, Andreas Zemann. (2003) Simultaneous separation of fifteen approved protease and reverse transcriptase inhibitors for human immunodeficiency virus therapy by capillary electrophoresis. ELECTROPHORESIS 24:4, 662-670
CrossRef128
Steven G Deeks, Robert M Grant, Terri Wrin, Ellen E Paxinos, Teri Liegler, Rebecca Hoh, Jeff N Martin, Christos J Petropoulos. (2003) Persistence of drug-resistant HIV-1 after a structured treatment interruption and its impact on treatment response. AIDS 17:3, 361-370
CrossRef129
P. BRAZILLE, N. DEREUDDRE-BOSQUET, C. LEPORT, P. CLAYETTE, O. BOYER, J.-L. VILDE, D. DORMONT, O. BENVENISTE. (2003) Decreases in plasma TNF-alpha level and IFN-gamma mRNA level in peripheral blood mononuclear cells (PBMC) and an increase in IL-2 mRNA level in PBMC are associated with effective highly active antiretroviral therapy in HIV-infected patients. Clinical and Experimental Immunology 131:2, 304-311
CrossRef130
Olivier Lambotte, Kumaran Deiva, Marc Tardieu. (2003) HIV-1 Persistence, Viral Reservoir, and the Central Nervous System in the HAART Era. Brain Pathology 13:1, 95-103
CrossRef131
TL Katzenstein, H Ullum, BT Roge, J Wandall, E Dickmeiss, T Barrington, P Skinhoj, J Gerstoft. (2003) Virological and immunological profiles among patients with undetectable viral load followed prospectively for 24 months. HIV Medicine 4:1, 53-61
CrossRef132
Roger Paredes, Bonaventura Clotet. (2003) New antiretroviral drugs and approaches to HIV treatment. AIDS 17:Supplement 4, S85-S96
CrossRef133
Julianna Lisziewicz, Andrea Foli, Mark Wainberg, Franco Lori. (2003) Hydroxyurea in the Treatment of HIV Infection. Drug Safety 26:9, 605-624
CrossRef134
Cleo G. Anastassopoulou, Dimitrios Paraskevis, Vassiliki-Anastasia Sypsa, Stella-Eugenie Chryssou, Anastasia Antoniadou, Helen Giamarelou, Angelos Hatzakis. (2003) Genetic Evolution of Human Immunodeficiency Virus Type 1 in Two Spouses Responding Successfully to Highly Active Antiretroviral Therapy. AIDS Research and Human Retroviruses 19:1, 65-71
CrossRef135
Joseph Kulkosky, Roger J. Pomerantz. (2002) Approaching Eradication of Highly Active Antiretroviral Therapy–Persistent Human Immunodeficiency Virus Type 1 Reservoirs with Immune Activation Therapy. Clinical Infectious Diseases 35:12, 1520-1526
CrossRef136
Carmen Muñoz-Almagro, Claudia Fortuny, Teresa Juncosa, Maria T. Garcia-Fructuoso, A. Gonzalez-Cuevas, C. Latorre. (2002) Absence of Detectable HIV-1 Provirus DNA After Early Highly Active Antiretroviral Therapy in Children Infected by Vertical Transmission. JAIDS Journal of Acquired Immune Deficiency Syndromes 31:4, 450-452
CrossRef137
Miguel E Quiñones-Mateu, Eric J Arts. (2002) Fitness of drug resistant HIV-1: methodology and clinical implications. Drug Resistance Updates 5:6, 224-233
CrossRef138
Olivier Lambotte, Audrey Demoustier, Marie Ghislaine de Goër, Christine Wallon, Jacques Gasnault, Cécile Goujard, Jean François Delfraissy, Yassine Taoufik. (2002) Persistence of replication-competent HIV in both memory and naive CD4 T cell subsets in patients on prolonged and effective HAART. AIDS 16:16, 2151-2157
CrossRef139
Audrey Demoustier, Brigitte Gubler, Olivier Lambotte, Marie-Ghislaine de Goër, Christine Wallon, Cécile Goujard, Jean-François Delfraissy, Yassine Taoufik. (2002) In patients on prolonged HAART, a significant pool of HIV infected CD4 T cells are HIV-specific. AIDS 16:13, 1749-1754
CrossRef140
Gilbert Greub, Alessandro Cozzi-Lepri, Bruno Ledergerber, Schlomo Staszewski, Luc Perrin, Veronica Miller, Patrick Francioli, Hansjakob Furrer, Manuel Battegay, Pietro Vernazza, Enos Bernasconi, Huldrych F Günthard, Bernard Hirschel, Andrew N Phillips, Amalio Telenti. (2002) Intermittent and sustained low-level HIV viral rebound in patients receiving potent antiretroviral therapy. AIDS 16:14, 1967-1969
CrossRef141
Ray Y. Chen, Andrew O. Westfall, James L. Raper, Gretchen A. Cloud, Ashlee K. Chatham, Edward P. Acosta, Sissi V. Pham, Jerry M. Tolson, Gustavo R. Heudebert, Michael S. Saag. (2002) Immunologic and Virologic Consequences of Temporary Antiretroviral Treatment Interruption in Clinical Practice. AIDS Research and Human Retroviruses 18:13, 909-916
CrossRef142
Raman Kumar, Nick Vandegraaff, Linda Mundy, Christopher J Burrell, Peng Li. (2002) Evaluation of PCR-based methods for the quantitation of integrated HIV-1 DNA. Journal of Virological Methods 105:2, 233-246
CrossRef143
Luis Menéndez-Arias. (2002) Targeting HIV: antiretroviral therapy and development of drug resistance. Trends in Pharmacological Sciences 23:8, 381-388
CrossRef144
Hans-Jürgen Stellbrink, Jan van Lunzen, Michael Westby, Eithne O'Sullivan, Claus Schneider, Axel Adam, Lutwin Weitner, Birger Kuhlmann, Christian Hoffmann, Stefan Fenske, Philipp S. Aries, Olaf Degen, Christian Eggers, Heiko Petersen, Friedrich Haag, Heinz A. Horst, Klaus Dalhoff, Christiane Möcklinghoff, Nick Cammack, Klara Tenner-Racz, Paul Racz. (2002) Effects of interleukin-2 plus highly active antiretroviral therapy on HIV-1 replication and proviral DNA (COSMIC trial). AIDS 16:11, 1479-1487
CrossRef145
Francesca Gennari, Maria Angela Biasolo, Enrico Cancellotti, Antonia Radaelli, Carlo De Giuli Morghen, Irene Bozzoni, Paolo Martino Cereda, Carlo Mengoli, Giorgio Palù, Cristina Parolin. (2002) Additive and antagonist effects of therapeutic gene combinations for suppression of HIV-1 infection. Antiviral Research 55:1, 77-90
CrossRef146
Michael Louie, Martin Markowitz. (2002) Goals and milestones during treatment of HIV-1 infection with antiretroviral therapy: a pathogenesis-based perspective. Antiviral Research 55:1, 15-25
CrossRef147
M Sharland, G Castelli Gattinara di Zub, J Tomas Ramos, S Blanche, DM Gibb. (2002) PENTA guidelines for the use of antiretroviral therapy in paediatric HIV infection. HIV Medicine 3:3, 215-226
CrossRef148
Richard H. Tullis, R. Paul Duffin, Marvin Zech, Julian L. Ambrus. (2002) Affinity Hemodialysis for Antiviral Therapy. I. Removal of HIV-1 from Cell Culture Supernatants, Plasma, and Blood. Therapeutic Apheresis and Dialysis 6:3, 213-220
CrossRef149
Christoph Hess, Thomas Klimkait, Luregn Schlapbach, Veronika Del Zenero, Salima Sadallah, Eliska Horakova, Gianmarco Balestra, Verena Werder, Christoph Schaefer, Manuel Battegay, Jürg-Alfred Schifferli. (2002) Association of a pool of HIV-1 with erythrocytes in vivo: a cohort study. The Lancet 359:9325, 2230-2234
CrossRef150
Liliana Belmonte, Patricia Baré, Gaston R. Picchio, Raul Perez Bianco, Miguel de Tezanos Pinto, Marcelo Corti, María F. Villafañe, María M. E. de Bracco, Beatriz H. Ruibal-Ares. (2002) Decreased recovery of replication-competent HIV-1 from peripheral blood mononuclear cell-derived monocyte/macrophages of HIV-positive patients after 3 years on highly active antiretroviral therapy. AIDS 16:9, 1289-1292
CrossRef151
John A. Bartlett, G. Diego Miralles, Anne D. Sevin, Martha Silberman, Scott K. Pruitt, Janet Ottinger, Victoria Gryszowska, Susan A. Fiscus, R. Pat Bucy. (2002) Addition of Cyclophosphamide to Antiretroviral Therapy Does Not Diminish the Cellular Reservoir in HIV-Infected Persons. AIDS Research and Human Retroviruses 18:8, 535-543
CrossRef152
Seema H. Bajaria, Glenn Webb, Miles Cloyd, Denise Kirschner. (2002) Dynamics of Naive and Memory CD4+ T Lymphocytes in HIV-1 Disease Progression. JAIDS Journal of Acquired Immune Deficiency Syndromes 30:1, 41-58
CrossRef153
Yen-Hung Chow, Duan Yu, Jun-ying Zhang, Yiming Xie, O. Lu-Chen Wei, Christopher Chiu, Mani Foroohar, Otto O. Yang, No-Hee Park, Irvin S.Y. Chen, Shen Pang. (2002) gp120-Independent Infection of CD4− Epithelial Cells and CD4+ T-Cells by HIV-1. JAIDS Journal of Acquired Immune Deficiency Syndromes 30:1, 1-8
CrossRef154
Sharon M. Harrold, Guoji Wang, Deborah K. McMahon, Sharon A. Riddler, John W. Mellors, James T. Becker, Rocky Caldararo, Todd A. Reinhart, Cristian L. Achim, Clayton A. Wiley. (2002) Recovery of Replication-Competent HIV Type 1-Infected Circulating Monocytes from Individuals Receiving Antiretroviral Therapy. AIDS Research and Human Retroviruses 18:6, 427-434
CrossRef155
Lucia Ometto, Davide De Forni, Fiorulla Patiri, Virginie Trouplin, Fabrizio Mammano, Vania Giacomet, Carlo Giaquinto, Daniel Douek, Richard Koup, Anita De Rossi. (2002) Immune reconstitution in HIV-1-infected children on antiretroviral therapy: role of thymic output and viral fitness. AIDS 16:6, 839-849
CrossRef156
S. Kinloch-de Loes, B. Autran. (2002) HIV-1 Therapeutic Vaccines. Journal of Infection 44:3, 152-159
CrossRef157
Marcus Altfeld, Jan van Lunzen, Nicole Frahm, Xu G. Yu, Claus Schneider, Robert L. Eldridge, Margaret E. Feeney, Dirk Meyer-Olson, Hans-Juergen Stellbrink, Bruce D. Walker. (2002) Expansion of pre-existing, lymph node-localized CD8+ T cells during supervised treatment interruptions in chronic HIV-1 infection. Journal of Clinical Investigation 109:6, 837-843
CrossRef158
Robert S. Hogg, Diane Havlir, Veronica Miller, Julio S. G. Montaner. (2002) To stop or not to stop: That is the question, but what is the answer?. AIDS 16:5, 787-789
CrossRef159
Jaap Goudsmit, Johannes A. Bogaards, Suzanne Jurriaans, Hanneke Schuitemaker, Joep M. A. Lange, Roel A. Coutinho, Gerrit Jan Weverling. (2002) Naturally HIV-1 seroconverters with lowest viral load have best prognosis, but in time lose control of viraemia. AIDS 16:5, 791-793
CrossRef160
Mark Dybul. (2002) Structured treatment interruption: Approaches and risks. Current Infectious Disease Reports 4:2, 175-180
CrossRef161
Rieneke M. E. van Praag, Ferdinand W. N. M. Wit, Suzanne Jurriaans, Frank de Wolf, Jan M. Prins, Joep M. A. Lange. (2002) Improved long-term suppression of HIV-1 replication with a triple-class multidrug regimen compared with standard of care antiretroviral therapy. AIDS 16:5, 719-725
CrossRef162
Simona La Seta Catamancio, Stefano Rusconi. (2002) HIV-1 protease inhibitors in development. Expert Opinion on Investigational Drugs 11:3, 387-395
CrossRef163
Gilbert R. Kaufmann, Mark Bloch, Robert Finlayson, John Zaunders, Don Smith, David A. Cooper. (2002) The extent of HIV-1-related immunodeficiency and age predict the long-term CD4 T lymphocyte response to potent antiretroviral therapy. AIDS 16:3, 359-367
CrossRef164
Joel N. Blankson, Deborah Persaud, Robert F. Siliciano. (2002) T
HE CHALLENGE OF VIRAL RESERVOIRS IN HIV-1 INFECTION . Annual Review of Medicine 53:1, 557-593
CrossRef165
Jean-François Gagné, André Désormeaux, Sylvie Perron, Michel J Tremblay, Michel G Bergeron. (2002) Targeted delivery of indinavir to HIV-1 primary reservoirs with immunoliposomes. Biochimica et Biophysica Acta (BBA) - Biomembranes 1558:2, 198-210
CrossRef166
Barbara N Phenix, Andrew D Badley. (2002) Influence of mitochondrial control of apoptosis on the pathogenesis, complications and treatment of HIV infection. Biochimie 84:2-3, 251-264
CrossRef167
R. J. Pomerantz. (2002) Reservoirs of Human Immunodeficiency Virus Type 1: The Main Obstacles to Viral Eradication. Clinical Infectious Diseases 34:1, 91-97
CrossRef168
Victor Appay, Pokrath Hansasuta, Julian Sutton, Rachel D. Schrier, Joseph K. Wong, Manohar Furtado, Diane V. Havlir, Steven M. Wolinsky, Andrew J. McMichael, Douglas D. Richman, Sarah L. Rowland-Jones, Celsa A. Spina. (2002) Persistent HIV-1-specific cellular responses despite prolonged therapeutic viral suppression. AIDS 16:2, 161-170
CrossRef169
Giuseppe Nunnari, Miguel Otero, Geethanjali Dornadula, Michelle Vanella, Hui Zhang, Ian Frank, Roger J. Pomerantz. (2002) Residual HIV-1 disease in seminal cells of HIV-1-infected men on suppressive HAART: latency without on-going cellular infections. AIDS 16:1, 39-45
CrossRef170
Alan S. Perelson. (2002) MODELLING VIRAL AND IMMUNE SYSTEM DYNAMICS. Nature Reviews Immunology 2:1, 28-36
CrossRef171
AK Sharma, GK Khuller. (2001) DNA vaccines: Future strategies and relevance to intracellular pathogens. Immunology and Cell Biology 79:6, 537-546
CrossRef172
Romain Dupont, Laurence Jeanson, Jean-François Mouscadet, Philippe Cotelle. (2001) Synthesis and hiv-1 integrase inhibitory activities of catechol and bis-Catechol derivatives. Bioorganic & Medicinal Chemistry Letters 11:24, 3175-3178
CrossRef173
Elisabetta Riva, Mauro Pistello, Pasquale Narciso, Gianpiero D'Offizi, Patrizia Isola, Vincenzo Galati, Ombretta Turriziani, Valerio Tozzi, Laura Vincenzi, Ferdinando Dianzani, Guido Antonelli. (2001) Decay of HIV Type 1 DNA and Development of Drug-Resistant Mutants in Patients with Primary HIV Type 1 Infection Receiving Highly Active Antiretroviral Therapy. AIDS Research and Human Retroviruses 17:17, 1599-1604
CrossRef174
D. J. S. King, E. -L. Larsson-Sciard. (2001) Clonal evolution of CD8+ T-cell expansions in HIV-infected patients on long-term HAART. Clinical and Experimental Immunology 126:2, 280-286
CrossRef175
Azra C. Ghani, Frank de Wolf, Neil M. Ferguson, Christl A. Donnelly, Roel Coutinho, Frank Miedema, Jaap Goudsmit, Roy M. Anderson. (2001) Surrogate Markers for Disease Progression in Treated HIV Infection. JAIDS Journal of Acquired Immune Deficiency Syndromes 28:3, 226-231
CrossRef176
CHRISTIAN HOFFMANN, HANS JAEGER. (2001) Cardiology and AIDS-HAART and the Consequences. Annals of the New York Academy of Sciences 946:1, 130-144
CrossRef177
Timothy R. Sterling, Richard E. Chaisson, Richard D. Moore. (2001) HIV-1 RNA, CD4 T-lymphocytes, and clinical response to highly active antiretroviral therapy. AIDS 15:17, 2251-2257
CrossRef178
(2001) British HIV Association (BHIVA) guidelines for the treatment of HIV-infected adults with antiretroviral therapy. HIV Medicine 2:4, 276-313
CrossRef179
Secondo Sonza, Suzanne M. Crowe. (2001) Reservoirs for HIV Infection and Their Persistence in the Face of Undetectable Viral Load. AIDS Patient Care and STDs 15:10, 511-518
CrossRef180
Françoise Gondois-Rey, Angelique Biancotto, Marjorie Pion, Agnès-Laurence Chenine, Pablo Gluschankof, Vaclav Horejsi, Catherine Tamalet, Robert Vigne, Ivan Hirsch. (2001) Production of HIV-1 by resting memory T lymphocytes. AIDS 15:15, 1931-1940
CrossRef181
J. Michael Kilby. (2001) Human Immunodeficiency Virus Pathogenesis: Insights from Studies of Lymphoid Cells and Tissues. Clinical Infectious Diseases 33:6, 873-884
CrossRef182
Bruce K. Patterson, Scott McCallister, Malte Schutz, Joan N. Siegel, Keith Shults, Zareefa Flener, Alan Landay. (2001) Persistence of intracellular HIV-1 mRNA correlates with HIV-1-specific immune responses in infected subjects on stable HAART. AIDS 15:13, 1635-1641
CrossRef183
Robert J Essey, Brenda R McDougall, W.Edward Robinson. (2001) Mismatched double-stranded RNA (polyI-polyC12U) is synergistic with multiple anti-HIV drugs and is active against drug-sensitive and drug-resistant HIV-1 in vitro. Antiviral Research 51:3, 189-202
CrossRef184
Esteban Martínez, Mireia Arnedo, Vicente Giner, Cristina Gil, Miguel Caballero, Llòcia Alós, Felipe García, Christopher Holtzer, Josep Mallolas, José M. Miró, Tomás Pumarola, José M. Gatell. (2001) Lymphoid tissue viral burden and duration of viral suppression in plasma. AIDS 15:12, 1477-1482
CrossRef185
A Lafeuillade, C Poggi, S Chadapaud, G Hittinger, H Khiri, P Halfon. (2001) Impact of immune interventions on proviral HIV-1 DNA decay in patients receiving highly active antiretroviral therapy. HIV Medicine 2:3, 189-194
CrossRef186
Roger J. Pomerantz. (2001) Residual HIV-1 infection during antiretroviral therapy: the challenge of viral persistence. AIDS 15:10, 1201-1211
CrossRef187
Lidia Ruiz, Eugenia Negredo, Pere Domingo, Roger Paredes, Esther Francia, Montserrat Balagué, Silvia Gel, Anna Bonjoch, Carmina R. Fumaz, Susan Johnston, Joan Romeu, Joep Lange, Bonaventura Clotet. (2001) Antiretroviral Treatment Simplification With Nevirapine in Protease Inhibitor–Experienced Patients With HIV-Associated Lipodystrophy. Journal of Acquired Immune Deficiency Syndromes 27:3, 229-236
CrossRef188
Lidia Ruiz, Eugenia Negredo, Pere Domingo, Roger Paredes, Esther Francia, Montserrat Balagué, Silvia Gel, Anna Bonjoch, Carmina R. Fumaz, Susan Johnston, Joan Romeu, Joep Lange, Bonaventura Clotet. (2001) Antiretroviral Treatment Simplification With Nevirapine in Protease Inhibitor–Experienced Patients With HIV-Associated Lipodystrophy. JAIDS Journal of Acquired Immune Deficiency Syndromes 27:3, 229-236
CrossRef189
Lidia Ruiz, Guislaine Carcelain, Javier Martínez-Picado, Simon Frost, Silvia Marfil, Roger Paredes, Joan Romeu, Esther Ferrer, Kristina Morales-Lopetegi, Brigitte Autran, Bonaventura Clotet. (2001) HIV dynamics and T-cell immunity after three structured treatment interruptions in chronic HIV-1 infection. AIDS 15:9, F19-F27
CrossRef190
Matthew R. Leibowitz, Ronald T. Mitsuyasu. (2001) Immune reconstitution strategies in HIV. Current Infectious Disease Reports 3:3, 302-308
CrossRef191
R. Pat Bucy. (2001) Viral and cellular dynamics in HIV disease. Current Infectious Disease Reports 3:3, 295-301
CrossRef192
HAROLD BURGER, BARBARA WEISER. (2001) Biology of HIV-1 in Women and Men. Clinical Obstetrics and Gynecology 44:2, 137-143
CrossRef193
Paola Costa, Stefano Rusconi, Domenico Mavilio, Manuela Fogli, Giuseppe Murdaca, Daniela Pende, Maria Cristina Mingari, Massimo Galli, Lorenzo Moretta, Andrea De Maria. (2001) Differential disappearance of inhibitory natural killer cell receptors during HAART and possible impairment of HIV-1-specific CD8 cytotoxic T lymphocytes. AIDS 15:8, 965-974
CrossRef194
Anne Ma Dyrhol-Riise, Pål Voltersvik, Ole G. Berg, Jan Olofsson, Signe Kleivbo, Birgitta Åsjö. (2001) Residual Human Immunodeficiency Virus Type 1 Infection in Lymphoid Tissue during Highly Active Antiretroviral Therapy: Quantitation and Virus Characterization. AIDS Research and Human Retroviruses 17:7, 577-586
CrossRef195
Marina Núñez, Rafael Rodríguez-Rosado, Vincent Soriano. (2001) Intensification of Antiretroviral Therapy. AIDS Research and Human Retroviruses 17:6, 499-506
CrossRef196
Patrick W. Nelson, John E. Mittler, Alan S. Perelson. (2001) Effect of Drug Efficacy and the Eclipse Phase of the Viral Life Cycle on Estimates of HIV Viral Dynamic Parameters. JAIDS Journal of Acquired Immune Deficiency Syndromes 26:5, 405-412
CrossRef197
Patrick W. Nelson, John E. Mittler, Alan S. Perelson. (2001) Effect of Drug Efficacy and the Eclipse Phase of the Viral Life Cycle on Estimates of HIV Viral Dynamic Parameters. Journal of Acquired Immune Deficiency Syndromes 26:5, 405-412
CrossRef198
Jl Turner, Jr Kostman, A Aquino, D Wright, S Szabo, R Bidwell, J Goodgame, A Daigle, E Kelley, F Jensen, C Duffy, D Carlo, Rb Moss. (2001) The effects of an HIV-1 immunogen (Remune) on viral load, CD4 cell counts and HIV-specific immunity in a double-blind, randomized, adjuvant-controlled subset study in HIV infected subjects regardless of concomitant antiviral drugs. HIV Medicine 2:2, 68-77
CrossRef199
Nicole Ngo-Giang-Huong, Christiane Deveau, Isabelle Da Silva, Isabelle Pellegrin, Alain Venet, Martine Harzic, Martine Sinet, Jean-François Delfraissy, Laurence Meyer, Cécile Goujard, Christine Rouzioux. (2001) Proviral HIV-1 DNA in subjects followed since primary HIV-1 infection who suppress plasma viral load after one year of highly active antiretroviral therapy. AIDS 15:6, 665-673
CrossRef200
Kirk D. Miller, Katherine Spooner, Betsey R. Herpin, Diane Rock-Kress, Julia A. Metcalf, Richard T. Davey, Judith Falloon, Joseph A. Kovacs, Michael A. Polis, Robert E. Walker, Henry Masur, H.Clifford Lane. (2001) Immunotherapy of HIV-Infected Patients with Intermittent Interleukin-2: Effects of Cycle Frequency and Cycle Duration on Degree of CD4+ T-Lymphocyte Expansion. Clinical Immunology 99:1, 30-42
CrossRef201
Rhonda G. Kost, Arlene Hurley, Linqi Zhang, Mika Vesanen, Andrew Talal, Scott Furlan, Paul Caldwell, Judy Johnson, Lynn Smiley, David Ho, Martin Markowitz. (2001) Open-Label Phase II Trial of Amprenavir, Abacavir, and Fixed-Dose Zidovudine/Lamivudine in Newly and Chronically HIV-1–Infected Patients. JAIDS Journal of Acquired Immune Deficiency Syndromes 26:4, 332-339
CrossRef202
Rhonda G. Kost, Arlene Hurley, Linqi Zhang, Mika Vesanen, Andrew Talal, Scott Furlan, Paul Caldwell, Judy Johnson, Lynn Smiley, David Ho, Martin Markowitz. (2001) Open-Label Phase II Trial of Amprenavir, Abacavir, and Fixed-Dose Zidovudine/Lamivudine in Newly and Chronically HIV-1–Infected Patients. Journal of Acquired Immune Deficiency Syndromes 26:4, 332-339
CrossRef203
Annika C. Karlsson, Markus Birk, Stefan Lindbäck, Hans Gaines, John E. Mittler, Anders Sönnerborg. (2001) Initiation of Therapy during Primary HIV Type 1 Infection Results in a Continuous Decay of Proviral DNA and a Highly Restricted Viral Evolution. AIDS Research and Human Retroviruses 17:5, 409-416
CrossRef204
Steven G. Deeks. (2001) Nonnucleoside Reverse Transcriptase Inhibitor Resistance. JAIDS Journal of Acquired Immune Deficiency Syndromes 26, S25-S33
CrossRef205
Pablo Tebas, Keith Henry, Robert Nease, Robert Murphy, John Phair, William G. Powderly. (2001) Timing of antiretroviral therapy. Use of Markov modeling and decision analysis to evaluate the long-term implications of therapy. AIDS 15:5, 591-599
CrossRef206
Steven G. Deeks. (2001) Nonnucleoside Reverse Transcriptase Inhibitor Resistance. Journal of Acquired Immune Deficiency SyndromesS25-S33
CrossRef207
Deeks, Steven G., Wrin, Terri, Liegler, Teri, Hoh, Rebecca, Hayden, Matthew, Barbour, Jason D., Hellmann, Nicholas S., Petropoulos, Christos J., McCune, Joseph M., Hellerstein, Marc K., Grant, Robert M., . (2001) Virologic and Immunologic Consequences of Discontinuing Combination Antiretroviral-Drug Therapy in HIV-Infected Patients with Detectable Viremia. New England Journal of Medicine 344:7, 472-480
Full Text208
Yi-Jun Zhang, Linqi Zhang, Tom Ketas, Bette T.M. Korber, John P. Moore. (2001) HIV Type 1 Molecular Clones Able to Use the Bonzo/STRL-33 Coreceptor for Virus Entry. AIDS Research and Human Retroviruses 17:3, 217-227
CrossRef209
Michael S. Saag. (2001) The role of immunotherapy in the treatment of HIV. AIDS 15, S1-S3
CrossRef210
R.J Pomerantz. (2001) Residual HIV-1 RNA in blood plasma of patients taking suppressive highly active antiretroviral therapy. Biomedicine & Pharmacotherapy 55:1, 7-15
CrossRef211
Kendall A. Smith. (2001) Low-dose daily interleukin-2 immunotherapy: accelerating immune restoration and expanding HIV-specific T-cell immunity without toxicity. AIDS 15, S28-S35
CrossRef212
Hans-J??rgen Stellbrink, Jan van Lunzen. (2001) Lymph nodes during antiretroviral therapy. Current Opinion in Infectious Diseases 14:1, 17-22
CrossRef213
Neil M Ferguson, Christophe Fraser, Roy M Anderson. (2001) Viral dynamics and anti-viral pharmacodynamics: rethinking in vitro measures of drug potency. Trends in Pharmacological Sciences 22:2, 97-100
CrossRef214
Mark E. Sharkey, Mario Stevenson. (2001) Two long terminal repeat circles and persistent HIV-1 replication. Current Opinion in Infectious Diseases 14:1, 5-11
CrossRef215
Michael S. Saag. (2001) The impact of highly active antiretroviral therapy on HIV-specific immune function. AIDS 15, S4-S10
CrossRef216
Gilbert R. Kaufmann, John Zaunders, John Murray, Anthony D. Kelleher, Sharon R. Lewin, Ajantha Solomon, Don Smith, David A. Cooper. (2001) Relative Significance of Different Pathways of Immune Reconstitution in HIV Type 1 Infection as Estimated by Mathematical Modeling. AIDS Research and Human Retroviruses 17:2, 147-159
CrossRef217
Andrew H. Talal, Simon Monard, Mika Vesanen, Zhaoyao Zheng, Arlene Hurley, Yunzhen Cao, Fang Fang, Lynn Smiley, Judy Johnson, Rhonda Kost, Martin H. Markowitz. (2001) Virologic and Immunologic Effect of Antiretroviral Therapy on HIV-1 in Gut-Associated Lymphoid Tissue. Journal of Acquired Immune Deficiency Syndromes 26:1, 1-7
CrossRef218
Joseph J. Eron, Pietro Vernazza. (2001) Alternative strategies for anti-HIV treatment. AIDS 15, S161-S169
CrossRef219
Pierre-Marie Girard, Véronique Schneider, Axelle Dehée, Philippe Mariot, Christine Jacomet, Nathalie Delphin, Florence Damond, Guislaine Carcelain, Brigitte Autran, Adrien Gérard Saimot, Jean-Claude Nicolas, Willy Rozenbaum. (2001) Treatment interruption after one year of triple nucleoside analogue therapy for primary HIV infection. AIDS 15:2, 275-277
CrossRef220
Andrew H. Talal, Simon Monard, Mika Vesanen, Zhaoyao Zheng, Arlene Hurley, Yunzhen Cao, Fang Fang, Lynn Smiley, Judy Johnson, Rhonda Kost, Martin H. Markowitz. (2001) Virologic and Immunologic Effect of Antiretroviral Therapy on HIV-1 in Gut-Associated Lymphoid Tissue. JAIDS Journal of Acquired Immune Deficiency Syndromes 26:1, 1-7
CrossRef221
Secondo Sonza, Helen P. Mutimer, Robert Oelrichs, Darren Jardine, Katya Harvey, Amanda Dunne, Damian F. Purcell, Christopher Birch, Suzanne M. Crowe. (2001) Monocytes harbour replication-competent, non-latent HIV-1 in patients on highly active antiretroviral therapy. AIDS 15:1, 17-22
CrossRef222
Alain Lafeuillade, Cécile Poggi, Stéphane Chadapaud, Gilles Hittinger, Martine Chouraqui, Magali Pisapia, Emmanuel Delbeke. (2001) Pilot Study of a Combination of Highly Active Antiretroviral Therapy and Cytokines to Induce HIV-1 Remission. JAIDS Journal of Acquired Immune Deficiency Syndromes 26:1, 44-55
CrossRef223
Monique H. E. Reijers, Gerrit Jan Weverling, Suzanne Jurriaans, Marijke T. L. Roos, Ferdinand W. N. M. Wit, Hugo M. Weigel, Reinier W. Ten Kate, Jan Willem Mulder, Clemens Richter, Hadewich J. M. Ter Hofstede, Herman Sprenger, Richard M. W. Hoetelmans, Hanneke Schuitemaker, Joep M. A. Lange. (2001) The ADAM study continued: maintenance therapy after 50 weeks of induction therapy. AIDS 15:1, 129-131
CrossRef224
Alain Lafeuillade, Cécile Poggi, Stéphane Chadapaud, Gilles Hittinger, Martine Chouraqui, Magali Pisapia, Emmanuel Delbeke. (2001) Pilot Study of a Combination of Highly Active Antiretroviral Therapy and Cytokines to Induce HIV-1 Remission. Journal of Acquired Immune Deficiency Syndromes 26:1, 44-55
CrossRef225
Marianne Burgard, Jacques Izopet, Béatrice Dumon, Catherine Tamalet, Diane Descamps, Annick Ruffault, Astrid Vabret, Gérard Bargues, Mireille Mouroux, Isabelle Pellegrin, Serge Ivanoff, Odile Guisthau, Vincent Calvez, Jean-Marie Seigneurin, Christine Rouzioux. (2000) HIV RNA and HIV DNA in Peripheral Blood Mononuclear Cells Are Consistent Markers for Estimating Viral Load in Patients Undergoing Long-Term Potent Treatment. AIDS Research and Human Retroviruses 16:18, 1939-1947
CrossRef226
François Biron, Bénédicte Ponceau, Damien Bouhour, André Boibieux, Bernard Verrier, Dominique Peyramond. (2000) Long-Term Safety and Antiretroviral Activity of Hydroxyurea and Didanosine in HIV-Infected Patients. JAIDS Journal of Acquired Immune Deficiency Syndromes 25:4, 329-336
CrossRef227
Fran??ois Biron, B??n??dicte Ponceau, Damien Bouhour, Andr?? Boibieux, Bernard Verrier, Dominique Peyramond. (2000) Long-Term Safety and Antiretroviral Activity of Hydroxyurea and Didanosine in HIV-Infected Patients. Journal of Acquired Immune Deficiency Syndromes329-336
CrossRef228
Nicholas A. Kartsonis, Richard T. D'Aquila. (2000) CLINICAL MONITORING OF HIV-1 INFECTION IN THE ERA OF ANTIRETROVIRAL RESISTANCE TESTING. Infectious Disease Clinics of North America 14:4, 879-899
CrossRef229
Salvatore T. Butera. (2000) Therapeutic targeting of human immunodeficiency virus type-1 latency: current clinical realities and future scientific possibilities. Antiviral Research 48:3, 143-176
CrossRef230
Gilbert R. Kaufmann, John J. Zaunders, Philip Cunningham, Anthony D. Kelleher, Pat Grey, Don Smith, Andrew Carr, David A. Cooper. (2000) Rapid restoration of CD4 T cell subsets in subjects receiving antiretroviral therapy during primary HIV-1 infection. AIDS 14:17, 2643-2651
CrossRef231
Isabelle Garrigue, Isabelle Pellegrin, Bruno Hoen, B??atrice Dumon, Martine Harzic, Marie-H??l??ne Schrive, Daniel S??r??ni, Herv?? Fleury. (2000) Cell-associated HIV-1-DNA quantitation after highly active antiretroviral therapy-treated primary infection in patients with persistently undetectable plasma HIV-1 RNA. AIDS 14:18, 2851-2855
CrossRef232
Sabine Yerly, Thomas V. Perneger, Samir Vora, Bernard Hirschel, Luc Perrin. (2000) Decay of cell-associated HIV-1 DNA correlates with residual replication in patients treated during acute HIV-1 infection. AIDS 14:18, 2805-2812
CrossRef233
Karen T. Tashima, Timothy P. Flanigan. (2000) ANTIRETROVIRAL THERAPY IN THE YEAR 2000. Infectious Disease Clinics of North America 14:4, 827-849
CrossRef234
James W. T Cohen Stuart, Mette D Hazebergh, D??rte Hamann, Sigrid A Otto, Jan C. C Borleffs, Frank Miedema, Charles A. B Boucher, Rob J de Boer. (2000) The Dominant Source of CD4+ and CD8+ T-Cell Activation in HIV Infection Is Antigenic Stimulation. Journal of Acquired Immune Deficiency Syndromes203-211
CrossRef235
James W. T Cohen Stuart, Mette D Hazebergh, Dörte Hamann, Sigrid A Otto, Jan C. C Borleffs, Frank Miedema, Charles A. B Boucher, Rob J de Boer. (2000) The Dominant Source of CD4+ and CD8+ T-Cell Activation in HIV Infection Is Antigenic Stimulation. JAIDS Journal of Acquired Immune Deficiency Syndromes 25:3, 203-211
CrossRef236
Julie Bestman-Smith, Andr?? D??sormeaux, Michel J. Tremblay, Michel G. Bergeron. (2000) Targeting cell-free HIV and virally-infected cells with anti-HLA-DR immunoliposomes containing amphotericin B. AIDS 14:16, 2457-2465
CrossRef237
Felipe Garc??a, Hernando Knobel, Maria Antonia Sambeat, Julio Arrizabalaga, Miquel Aranda, Joan Romeu, David Dalmau, Ferran Segura, Juan Luis Gomez-Sirvent, Elena Ferrer, Anna Cruceta, Teresa Gallart, Tomas Pumarola, Jose M Mir??, Jose M Gatell. (2000) Comparison of twice-daily stavudine plus once- or twice-daily didanosine and nevirapine in early stages of HIV infection: the Scan Study. AIDS 14:16, 2485-2494
CrossRef238
Peter L. Anderson, Richard C. Brundage, Lane Bushman, Thomas N. Kakuda, Rory P. Remmel, Courtney V. Fletcher. (2000) Indinavir plasma protein binding in HIV-1-infected adults. AIDS 14:15, 2293-2297
CrossRef239
M Birk, S Aleman, U Visco-Comandini, A Sonnerborg. (2000) Proviral HIV-1 dynamics and evolution in patients receiving efficient long-term antiretroviral combination therapy. HIV Medicine 1:4, 205-211
CrossRef240
Cécile L. Tremblay, Christopher Kollmann, Françoise Giguel, Ting-Chao Chou, Martin S. Hirsch. (2000) Strong in Vitro Synergy Between the Fusion Inhibitor T-20 and the CXCR4 Blocker AMD-3100. JAIDS Journal of Acquired Immune Deficiency Syndromes 25:2, 99-102
CrossRef241
Gilbert R Kaufmann, David A Cooper. (2000) Antiretroviral therapy of HIV-1 infection: established treatment strategies and new therapeutic options. Current Opinion in Microbiology 3:5, 508-514
CrossRef242
Sebastian Bonhoeffer, Michal Rembiszewski, Gabriel M. Ortiz, Douglas F. Nixon. (2000) Risks and benefits of structured antiretroviral drug therapy interruptions in HIV-1 infection. AIDS 14:15, 2313-2322
CrossRef243
Janet D. Siliciano, Robert F. Siliciano. (2000) Latency and viral persistence in HIV-1 infection. Journal of Clinical Investigation 106:7, 823-825
CrossRef244
Linqi Zhang, Chris Chung, Bor-Shen Hu, Tian He, Yong Guo, Alexandria J. Kim, Eva Skulsky, Xia Jin, Arlene Hurley, Bharat Ramratnam, Martin Markowitz, David D. Ho. (2000) Genetic characterization of rebounding HIV-1 after cessation of highly active antiretroviral therapy. Journal of Clinical Investigation 106:7, 839-845
CrossRef245
Homira Behbahani, Alan Landay, Bruce K. Patterson, Paul Jones, John Pottage, Michelle Agnoli, Jan Andersson, Anna-Lena Spetz. (2000) Normalization of Immune Activation in Lymphoid Tissue Following Highly Active Antiretroviral Therapy. Journal of Acquired Immune Deficiency Syndromes150-156
CrossRef246
Homira Behbahani, Alan Landay, Bruce K. Patterson, Paul Jones, John Pottage, Michelle Agnoli, Jan Andersson, Anna-Lena Spetz. (2000) Normalization of Immune Activation in Lymphoid Tissue Following Highly Active Antiretroviral Therapy. JAIDS Journal of Acquired Immune Deficiency Syndromes 25:2, 150-156
CrossRef247
C??cile L. Tremblay, Christopher Kollmann, Fran??oise Giguel, Ting-Chao Chou, Martin S. Hirsch. (2000) Strong in Vitro Synergy Between the Fusion Inhibitor T-20 and the CXCR4 Blocker AMD-3100. Journal of Acquired Immune Deficiency Syndromes99-102
CrossRef248
Richard F. Little, Robert Yarchoan, Wyndham H. Wilson. (2000) Systemic chemotherapy for HIV-associated lymphoma in the era of highly active antiretroviral therapy. Current Opinion in Oncology 12:5, 438-444
CrossRef249
Julie Bestman-Smith, Pierrette Gourde, André Désormeaux, Michel J Tremblay, Michel G Bergeron. (2000) Sterically stabilized liposomes bearing anti-HLA-DR antibodies for targeting the primary cellular reservoirs of HIV-1. Biochimica et Biophysica Acta (BBA) - Biomembranes 1468:1-2, 161-174
CrossRef250
Pierre-Alexandre Bart, G. Paolo Rizzardi, Giuseppe Tambussi, Jean-Philippe Chave, Aude G Chapuis, Cecilia Graziosi, Jean-Marc Corpataux, Nermin Halkic, Jean-Yves Meuwly, Miguel Munoz, Pascal Meylan, William Spreen, Hugh McDade, Sabine Yerly, Luc Perrin, Adriano Lazzarin, Giuseppe Pantaleo. (2000) Immunological and virological responses in HIV-1-infected adults at early stage of established infection treated with highly active antiretroviral therapy. AIDS 14:13, 1887-1897
CrossRef251
Marek Fischer, Huldrych F. Günthard, Milos Opravil, Beda Joos, Werner Huber, Leslie R. Bisset, Peter Ott, Jürg Böni, Rainer Weber, Richard W. Cone. (2000) Residual HIV-RNA Levels Persist for Up to 2.5 Years in Peripheral Blood Mononuclear Cells of Patients on Potent Antiretroviral Therapy. AIDS Research and Human Retroviruses 16:12, 1135-1140
CrossRef252
Caroline J. Chantry, Pamela Morrison, Jeanette Panchula, Carmen Rivera, George Hillyer, Carmen Zorilla, Clemente Diaz. (2000) Effects of Lipolysis or Heat Treatment on HIV-1 Provirus in Breast Milk. JAIDS Journal of Acquired Immune Deficiency Syndromes 24:4, 325-329
CrossRef253
Denise Kirschner, G. F. Webb, Miles Cloyd. (2000) Model of HIV-1 Disease Progression Based on Virus-Induced Lymph Node Homing and Homing-Induced Apoptosis of CD4+ Lymphocytes. JAIDS Journal of Acquired Immune Deficiency Syndromes 24:4, 352-362
CrossRef254
Peter L. Anderson, Saleem E. Noormohamed, Keith Henry, Richard C. Brundage, Henry H. Balfour, Courtney V. Fletcher. (2000) Semen and Serum Pharmacokinetics of Zidovudine and Zidovudine-Glucuronide in Men with HIV-1 Infection. Pharmacotherapy 20:8, 917-922
CrossRef255
Caroline J. Chantry, Pamela Morrison, Jeanette Panchula, Carmen Rivera, George Hillyer, Carmen Zorilla, Clemente Diaz. (2000) Effects of Lipolysis or Heat Treatment on HIV-1 Provirus in Breast Milk. Journal of Acquired Immune Deficiency Syndromes 24:4, 325-329
CrossRef256
Denise Kirschner, G. F. Webb, Miles Cloyd. (2000) Model of HIV-1 Disease Progression Based on Virus-Induced Lymph Node Homing and Homing-Induced Apoptosis of CD4+ Lymphocytes. Journal of Acquired Immune Deficiency Syndromes 24:4, 352-362
CrossRef257
Jan M. Orenstein, Niranjan Bhat, Christian Yoder, Cecil Fox, Michael A. Polis, Julia A. Metcalf, Joseph A. Kovacs, Judith Falloon, Robert E. Walker, Henry Masur, H. Clifford Lane, Richard T. Davey. (2000) Rapid activation of lymph nodes and mononuclear cell HIV expression upon interrupting highly active antiretroviral therapy in patients after prolonged viral suppression. AIDS 14:12, 1709-1715
CrossRef258
J DELFRAISSY, C GOUJARD. (2000) Infection à VIHQuestions pour les années 2000. Annales de l'Institut Pasteur/Actualités 11:3, 99-104
CrossRef259
Andrew K. Sewell, David A. Price, Annette Oxenius, Anthony D. Kelleher, Rodney E. Phillips. (2000) Cytotoxic T Lymphocyte Responses to Human Immunodeficiency Virus: Control and Escape. Stem Cells 18:4, 230-244
CrossRef260
Ronald B. Moss, Erin Webb, Wieslawa K. Giermakowska, Fred C. Jensen, Jay R. Savary, Mark R. Wallace, Dennis J. Carlo. (2000) HIV-1–Specific CD4 Helper Function in Persons With Chronic HIV-1 Infection on Antiviral Drug Therapy as Measured by ELISPOT After Treatment With an Inactivated, gp120-Depleted HIV-1 in Incomplete Freund's Adjuvant. JAIDS Journal of Acquired Immune Deficiency Syndromes 24:3, 264-269
CrossRef261
Ronald B. Moss, Erin Webb, Wieslawa K. Giermakowska, Fred C. Jensen, Jay R. Savary, Mark R. Wallace, Dennis J. Carlo. (2000) HIV-1–Specific CD4 Helper Function in Persons With Chronic HIV-1 Infection on Antiviral Drug Therapy as Measured by ELISPOT After Treatment With an Inactivated, gp120-Depleted HIV-1 in Incomplete Freund's Adjuvant. Journal of Acquired Immune Deficiency Syndromes 24:3, 264-269
CrossRef262
Hiroyu Hatano, Susan Vogel, Christian Yoder, Julia A. Metcalf, Robin Dewar, Richard T. Davey, Michael A. Polis. (2000) Pre-HAART HIV burden approximates post-HAART viral levels following interruption of therapy in patients with sustained viral suppression. AIDS 14:10, 1357-1363
CrossRef263
Keola K. Beale, W.Edward Robinson. (2000) Combinations of reverse transcriptase, protease, and integrase inhibitors can be synergistic in vitro against drug-sensitive and RT inhibitor-resistant molecular clones of HIV-1. Antiviral Research 46:3, 223-232
CrossRef264
Thomas N. Kakuda. (2000) Pharmacology of nucleoside and nucleotide reverse transcriptase inhibitor-induced mitochondrial toxicity. Clinical Therapeutics 22:6, 685-708
CrossRef265
Herbert Kuster, Milos Opravil, Peter Ott, Erika Schlaepfer, Marek Fischer, Huldrych F. Günthard, Ruedi Lüthy, Rainer Weber, Richard W. Cone. (2000) Treatment-Induced Decline of Human Immunodeficiency Virus-1 p24 and HIV-1 RNA in Lymphoid Tissue of Patients with Early Human Immunodeficiency Virus-1 Infection. The American Journal of Pathology 156:6, 1973-1986
CrossRef266
Gilbert R. Kaufmann, Mark Bloch, John J. Zaunders, Don Smith, David A. Cooper. (2000) Long-term immunological response in HIV-1-infected subjects receiving potent antiretroviral therapy. AIDS 14:8, 959-969
CrossRef267
(2000) British HIV Association (BHIVA) guidelines for the treatment of HIV-infected adults with antiretroviral therapy. HIV Medicine 1:2, 76-101
CrossRef268
Theodore Pierson, Justin McArthur, Robert F. Siliciano. (2000) Reservoirs for HIV-1: Mechanisms for Viral Persistence in the Presence of Antiviral Immune Responses and Antiretroviral Therapy. Annual Review of Immunology 18:1, 665-708
CrossRef269
Christophe Fraser, Neil M. Ferguson, Azra C. Ghani, Jan M. Prins, Joep M. A. Lange, Jaap Goudsmit, Roy M. Anderson, Frank de Wolf. (2000) Reduction of the HIV-1-infected T-cell reservoir by immune activation treatment is dose-dependent and restricted by the potency of antiretroviral drugs. AIDS 14:6, 659-669
CrossRef270
Deborah Persaud, Theodore Pierson, Christian Ruff, Diana Finzi, Karen R. Chadwick, Joseph B. Margolick, Andrea Ruff, Nancy Hutton, Stuart Ray, Robert F. Siliciano. (2000) A stable latent reservoir for HIV-1 in resting CD4+ T lymphocytes in infected children. Journal of Clinical Investigation 105:7, 995-1003
CrossRef271
Vernon C. Maino, Maria A. Suni, Susan B. Wormsley, Dennis J. Carlo, M Ark R. Wallace, Ronald B. Moss. (2000) Enhancement of HIV Type 1 Antigen-Specific CD4 + T Cell Memory in Subjects with Chronic HIV Type 1 Infection Receiving an HIV Type 1 Immunogen. AIDS Research and Human Retroviruses 16:6, 539-547
CrossRef272
Oren J. Cohen, Anthony S. Fauci. (2000) Benchmarks for antiretroviral therapy. Journal of Clinical Investigation 105:6, 709-710
CrossRef273
Thomas M. Lampinen, Cathy W. Critchlow, Jane M. Kuypers, Carla S. Hurt, Paul J. Nelson, Stephen E. Hawes, Robert W. Coombs, King K. Holmes, Nancy B. Kiviat. (2000) Association of antiretroviral therapy with detection of HIV-1 RNA and DNA in the anorectal mucosa of homosexual men. AIDS 14:5, F69-F75
CrossRef274
Jonathan B. Angel, Kevin High, Frank Rhame, David Brand, James B. Whitmore, Jan M. Agosti, Mark J. Gilbert, Stanley Deresinski. (2000) Phase III study of granulocyte-macrophage colony-stimulating factor in advanced HIV disease: effect on infections, CD4 cell counts and HIV suppression. AIDS 14:4, 387-395
CrossRef275
Sabine Yerly, Laurent Kaiser, Thomas V. Perneger, Richard W. Cone, Milos Opravil, Jean-Philippe Chave, Hansjakob Furrer, Bernard Hirschel, Luc Perrin. (2000) Time of initiation of antiretroviral therapy: impact on HIV-1 viraemia. AIDS 14:3, 243-249
CrossRef276
O. Lambotte, Y. Taoufik, M. G. de Goër, C. Wallon, C. Goujard, J. F. Delfraissy. (2000) Detection of Infectious HIV in Circulating Monocytes From Patients on Prolonged Highly Active Antiretroviral Therapy. JAIDS Journal of Acquired Immune Deficiency Syndromes 23:2, 114-119
CrossRef277
Ferdinando Dianzani, Guido Antonelli, Fernando Aiuti, Ombretta Turriziani, Elisabetta Riva, Maria R Capobianchi, Franco Pandolfi, Gianpiero D’Offizi, IRHAN Study Group. (2000) The number of HIV DNA-infected mononuclear cells is reduced under HAART plus recombinant IL-2. Antiviral Research 45:2, 95-99
CrossRef278
R.J. Pomerantz. (2000) Residual HIV-1 replication. Biomedicine & Pharmacotherapy 54:1, 13-15
CrossRef279
O. Lambotte, Y. Taoufik, M. G. de Goër, C. Wallon, C. Goujard, J. F. Delfraissy. (2000) Detection of Infectious HIV in Circulating Monocytes From Patients on Prolonged Highly Active Antiretroviral Therapy. Journal of Acquired Immune Deficiency Syndromes 23:2, 114-119
CrossRef280
Stefano Vella, Lucia Palmisano. (2000) HIV eradication revisited. Expert Opinion on Investigational Drugs 9:2, 193-197
CrossRef281
Milos Opravil, Richard W. Cone, Marek Fischer, Pietro L. Vernazza, Stefano Bassetti, Patrizio Lorenzi, Leslie R. Bisset, Peter Ott, Werner Huber, Marlyse C. Knuchel, Malgorzata Roos, Ruedi Lüthy, Rainer Weber. (2000) Effects of Early Antiretroviral Treatment on HIV-1 RNA in Blood and Lymphoid Tissue: A Randomized Trial of Double Versus Triple Therapy. JAIDS Journal of Acquired Immune Deficiency Syndromes 23:1, 17-25
CrossRef282
Steven G. Deeks. (2000) Determinants of Virological Response to Antiretroviral Therapy: Implications for Long‐Term Strategies. Clinical Infectious Diseases 30:s2, S177
CrossRef283
Massimo Andreoni, Saverio G. Parisi, Loredana Sarmati, Emanuele Nicastri, Lucia Ercoli, Giorgio Mancino, Giovanni Sotgiu, Marco Mannazzu, Marco Trevenzoli, Giuseppe Tridente, Ercole Concia, Antonio Aceti. (2000) Cellular proviral HIV-DNA decline and viral isolation in naïve subjects with <5000 copies/ml of HIV-RNA and >500 × 106/l CD4 cells treated with highly active antiretroviral therapy. AIDS 14:1, 23-29
CrossRef284
Milos Opravil, Richard W. Cone, Marek Fischer, Pietro L. Vernazza, Stefano Bassetti, Patrizio Lorenzi, Leslie R. Bisset, Peter Ott, Werner Huber, Marlyse C. Knuchel, Malgorzata Roos, Ruedi Lüthy, Rainer Weber. (2000) Effects of Early Antiretroviral Treatment on HIV-1 RNA in Blood and Lymphoid Tissue: A Randomized Trial of Double Versus Triple Therapy. Journal of Acquired Immune Deficiency Syndromes 23:1, 17-25
CrossRef285
Matthew Bidwell Goetz. (1999) Editorial Response: Discordance between Virological, Immunologic, and Clinical Outcomes of Therapy with Protease Inhibitors among Human Immunodeficiency Virus–Infected Patients. Clinical Infectious Diseases 29:6, 1431-1434
CrossRef286
Mark Holodniy. (1999) Viral load monitoring in HIV Infection. Current Infectious Disease Reports 1:5, 497-503
CrossRef287
Fauci, Anthony S., . (1999) The AIDS Epidemic — Considerations for the 21st Century. New England Journal of Medicine 341:14, 1046-1050
Full Text288
Gabriel M. Ortiz, Douglas F. Nixon, Alexandra Trkola, James Binley, Xia Jin, Sebastian Bonhoeffer, Peter J. Kuebler, Sean M. Donahoe, Marie-Ange Demoitie, William M. Kakimoto, Tom Ketas, Brian Clas, Jonas J. Heymann, Linqi Zhang, Yunzhen Cao, Arlene Hurley, John P. Moore, David D. Ho, Martin Markowitz. (1999) HIV-1–specific immune responses in subjects who temporarily contain virus replication after discontinuation of highly active antiretroviral therapy. Journal of Clinical Investigation 104:6, R13-R18
CrossRef289
Karl-Josef Kallen, Peter Robert Galle, Stefan Rose-John. (1999) New developments in IL-6 dependent biology and therapy: where do we stand and what are the options?. Expert Opinion on Investigational Drugs 8:9, 1327-1349
CrossRef290
Robert F. Siliciano. (1999) Reservoirs for HIV-1. Current Infectious Disease Reports 1:3, 298-304
CrossRef291
Oren J Cohen, Anthony S Fauci. (1999) Transmission of drug-resistant strains of HIV-1: unfortunate, but inevitable. The Lancet 354:9180, 697-698
CrossRef292
Pomerantz, Roger J., . (1999) Residual HIV-1 Disease in the Era of Highly Active Antiretroviral Therapy. New England Journal of Medicine 340:21, 1672-1674
Full Text
