Join the 200th Anniversary Celebration

Original Article

Annexin II and Bleeding in Acute Promyelocytic Leukemia

Jill S. Menell, M.D., Gabriela M. Cesarman, M.D., Andrew T. Jacovina, B.S., Mary Ann McLaughlin, M.D., M.P.H., Emil A. Lev, Ph.D., and Katherine A. Hajjar, M.D.

N Engl J Med 1999; 340:994-1004April 1, 1999

Abstract

Background

Acute promyelocytic leukemia (APL) is associated with a hemorrhagic disorder of unknown cause that responds to treatment with all-trans-retinoic acid.

Methods

We studied a newly described receptor for fibrinolytic proteins, annexin II, in cells from patients with APL or other leukemias. We examined initial rates of in vitro generation of plasmin by tissue plasminogen activator (t-PA) in the presence of APL cells that did or did not have the characteristic translocation of APL, t(15;17). We also determined the effect of all-trans-retinoic acid on the expression of annexin II and the generation of cell-surface plasmin.

Results

The expression of annexin II, as detected by a fluorescein-tagged antibody, was greater on leukemic cells from patients with APL than on other types of leukemic cells (mean fluorescence intensity, 6.9 and 2.9, respectively; P<0.01). The t(15;17)-positive APL cells stimulated the generation of cell-surface, t-PA–dependent plasmin twice as efficiently as the t(15;17)-negative cells. This increase in plasmin was blocked by an anti–annexin II antibody and was induced by transfection of t(15;17)-negative cells with annexin II complementary DNA. The t(15;17)-positive APL cells contained abundant messenger RNA for annexin II, which disappeared through a transcriptional mechanism after treatment with all-trans-retinoic acid.

Conclusions

Abnormally high levels of expression of annexin II on APL cells increase the production of plasmin, a fibrinolytic protein. Overexpression of annexin II may be a mechanism for the hemorrhagic complications of APL.

Media in This Article

Figure 2Steady-State Levels of Annexin II mRNA.
Figure 1Immunofluorescence Staining of APL Cells with Anti–Annexin II Antibodies.
Article

In acute promyelocytic leukemia (APL) there is clonal expansion of immature promyelocytes with a characteristic balanced translocation, t(15;17)(q22–24;q12–21).1,2 This fusion of genetic elements gives rise to a chimeric protein (PML–RARα) derived from genes for a putative transcription factor (PML) on chromosome 15 and the nuclear retinoic acid receptor α (RARα) on chromosome 17.2-4 APL is notable for its response to all-trans-retinoic acid, which induces differentiation, rather than destruction, of the leukemic promyelocytes.5-11 The mechanism of this action is poorly understood.

Another feature of APL is a hemorrhagic diathesis, which is thought to result from disseminated intravascular coagulation, abnormal fibrinolysis, or both.1 Evidence of enhanced thrombin activation supports the mechanism of disseminated intravascular coagulation.12-16 However, plasma levels of the anticoagulant proteins antithrombin III and protein C are usually normal17-19 and platelet survival is normal20 in patients with APL, unlike the findings in patients with disseminated intravascular coagulation.

Plasminogen and its activators, tissue plasminogen activator (t-PA) and urokinase plasminogen activator (u-PA), generate plasmin, a proteolytic enzyme that cleaves fibrinogen and fibrin, thereby dissolving clots.21 Overproduction of this fibrinolytic enzyme can cause abnormal bleeding. The hemorrhagic complications of APL may be due to increased fibrinolysis. Evidence in support of this possibility includes low plasma levels of plasminogen, α2-plasmin inhibitor (the primary plasmin inhibitor), plasminogen-activator inhibitor 1 (an inhibitor of both t-PA and u-PA), and other abnormalities in patients with APL that are consistent with excessive fibrinolysis.12,13,18,22-32

Annexin II is a calcium-regulated, phospholipid-binding protein on endothelial cells, macrophages, and some tumor cells.33 It is a cell-surface receptor for both plasminogen (the inactive precursor of plasmin), and its activator, t-PA.34 Soluble annexin II acts as a t-PA cofactor, increasing the efficiency of plasmin formation by a factor of 60.35

We examined the expression of annexin II on leukemic cells from 14 patients with APL or other leukemias and determined the initial rate of plasmin generation in myeloid leukemic cells that were positive or negative for the t(15;17) translocation. We correlated plasmin activity with the expression of both annexin II protein and messenger RNA (mRNA). All-trans-retinoic acid reversed the excessive annexin II–mediated fibrinolytic activity of leukemic promyelocytes by blocking transcription of the annexin II gene in translocation-positive cells. This effect of the drug may explain the reversal of the bleeding tendency in APL within the first days of treatment with all-trans-retinoic acid.

Methods

Isolation of Leukemic Cells

Surplus peripheral-blood leukocytes or bone marrow samples from 14 patients with leukemia were treated with heparin, coded to maintain the patients' anonymity, and centrifuged with Ficoll–Hypaque (Sigma, St. Louis) at 800×g for 30 minutes. Cells were collected at the interface between the Ficoll–Hypaque and HEPES-buffered saline, washed in RPMI 1640 medium, and resuspended in growth medium.

Cell Culture

NB4 cells, a stable, translocation-positive cell line, were cultured as described elsewhere36; the cells were provided by Dr. M. Lanotte (Hôpital St. Louis, Paris). Human umbilical-vein endothelial cells were propagated as described elsewhere.37 Cells from a patient with acute myeloblastic leukemia (AML) characterized by poorly differentiated myeloblasts (AML-M1) were provided by Dr. S. Rafii (Weill Medical College of Cornell University, New York). APL-1 cells, cloned from a patient with APL, were shown to be t(15;17)-negative by fluorescence in situ hybridization (performed by Dr. M.J. Macera, Long Island College Hospital, Brooklyn, N.Y.) and by a reverse-transcriptase–polymerase-chain-reaction assay (performed by Dr. E. Dmitrovsky, Memorial Sloan-Kettering Cancer Center, New York).38 HL-60 cells derived from a patient with AML were provided by Dr. P. Tempst (Memorial Sloan-Kettering Cancer Center).39,40 All leukemic cells were propagated in RPMI 1640 medium containing 10 percent fetal-calf serum, 2 mM glutamine, penicillin (100 U per milliliter), streptomycin (100 μg per milliliter), and amphotericin B (0.25 μg per milliliter).

Flow Cytometry

Washed cells from 13 patients were incubated with rabbit preimmune or anti–annexin II IgG35 (100 μg per milliliter) for 15 minutes at 4°C, washed three times, incubated with fluorescein isothiocyanate–conjugated goat antirabbit IgG (20 μg per milliliter) for 30 minutes at 4°C, fixed in 2 percent paraformaldehyde for 2 minutes at 21°C, and analyzed on an Epics flow cytometer (Coulter, Miami). With the use of lysates from human umbilical-vein endothelial cells and NB4 cells, the rabbit anti–annexin II IgG and a mouse monoclonal IgG antibody specific for annexin II reacted with the same single band on Western blotting.

Indirect Immunofluorescence Microscopy

Cells were centrifuged onto cytospin slides (134×g) for 6 minutes at 21°C, air dried, and fixed with 3.7 percent formaldehyde for 20 minutes at 21°C. The slides were washed, blocked with 0.1 percent bovine serum albumin and 1 percent normal goat serum in Dulbecco's phosphate-buffered saline for 20 minutes at 21°C, washed again, incubated with polyclonal anti–annexin II IgG or control rabbit preimmune IgG (12 to 24 μg per milliliter) for 1 hour at 21°C, and incubated with fluorescein isothiocyanate–conjugated goat antirabbit IgG (8 μg per milliliter) for 1 hour at 21°C. The slides were then washed five times and counterstained with Evans blue or propidium iodide.

Plasminogen Activation Assay

Cells were preincubated with 100 nM lysine–plasminogen or 200 nM glutamic acid–plasminogen (Immuno, Vienna, Austria) for one hour at 21°C. Then, 10 nM t-PA (Genentech, South San Francisco, Calif.) and the plasmin substrate d-valine-leucine-lysine-7-amino-4-trifluoromethyl coumarin (AFC-81, Enzyme Systems Products, Dublin, Calif.) were mixed and added in the presence or absence of the following inhibitors: amiloride (Sigma), anti-urokinase IgG (no. 3940A, American Diagnostica, Greenwich, Conn.), anti–t-PA IgG (no. 364B, American Diagnostica), anti–annexin II IgG (Oncogene Research Products, Cambridge, Mass.), and anti–annexin I IgG (Zymed, San Francisco). Substrate cleavage was measured in duplicate or triplicate at two-minute intervals (excitation, 400 nm; emission, 505 nm) with 2-nm slit widths in a fluorescence spectrophotometer (model 650-10S, Perkin-Elmer, Norwalk, Conn.) as described elsewhere.35 Anti–annexin I IgG and anti–annexin II IgG were pretreated with carboxypeptidase B–sepharose as described elsewhere.41

Ribonuclease Protection Assay

Bases 51 through 350, encoding the unique “tail” region of annexin II,42 were amplified by the polymerase chain reaction from human annexin II complementary DNA (cDNA)34 with the use of primers 5'AAAGGATCCTGTCTACTGTTCACG3' and 5'AAAGAATTCCCAAAATCACCGTCT3', ligated into pBluescript KS(+) at EcoRI and BamHI restriction sites,43 and propagated in transformed Escherichia coli selected on the basis of its resistance to ampicillin. Plasmids were isolated with the Maxi-Prep kit (Qiagen, Chatsworth, Calif.), linearized with EcoRI, and purified. Radiolabeled probes for annexin II and glyceraldehyde phosphate dehydrogenase (Amersham, Arlington Heights, Ill.) were transcribed with an RNA-transcription kit (Stratagene, La Jolla, Calif.) and the use of [32P]uridine triphosphate and either T3 or T7 RNA polymerases to yield 377-base and 139-base antisense riboprobes with 300-base and 100-base targets, respectively. Hybridizations were carried out with the Direct Protect kit (Ambion, Austin, Tex.). Double-stranded protected RNA fragments were visualized by autoradiography of dried gels (7 M urea, 6 percent polyacrylamide, and TRIS, borate, and EDTA buffer) and analyzed by densitometry or quantitated with a Phosphorimager (Molecular Dynamics, Sunnyvale, Calif.).

Nuclear Run-On Assays

The pBluescript vector containing 300 bases of the annexin II tail sequence and a pBR322 plasmid containing 4.5 kb of a 28S ribosomal RNA sequence (provided by Dr. I. Gonzales, Hahnemann Hospital, Philadelphia) were used to screen radiolabeled transcription products in nuclear run-on assays.44 Plasmids were linearized and applied to nitrocellulose membranes with the use of a vacuum slot-blot apparatus (Hoefer Instruments, San Francisco). Radiolabeled transcripts were purified as described elsewhere44 and hybridized at 65°C for 36 hours.

Transfection of APL-1 Cells

APL-1 cells (2×106 per milliliter) were incubated with 20 μg of Lipofectin per milliliter (Life Technologies, Gaithersburg, Md.) and an annexin II–expression vector, pCMV5-Annexin II (2 μg per milliliter for 24 hours); supplemented with minimal essential medium; and assayed for plasmin at 48 hours.34 The efficiency of transfection was assessed on the basis of the expression of β-galactosidase activity after the introduction of pSV-β-galactosidase (Promega). The empty pCMV5 vector served as the control.

Statistical Analysis

Data were analyzed with Student's two-tailed t-test.

Results

Patients

All six patients with APL had evidence of increased fibrinolysis (low plasma levels of fibrinogen, high plasma levels of fibrin split products, or high plasma levels of d-dimer, alone or in combination) (Table 1Table 1Clinical Findings and Annexin II Expression in 13 Patients with Leukemia.). In the four patients with APL who also had severe thrombocytopenia (platelet count, <20,000 per cubic millimeter), there was overt bleeding, including a life-threatening pulmonary hemorrhage in one case. In Patient 2, who had minimal bleeding at presentation, fibrinogen levels decreased during cytotoxic chemotherapy. This patient required a continuous infusion of aminocaproic acid and heparin. Severe hypofibrinogenemia and an elevated plasma d-dimer level developed in Patient 5, who had APL that was resistant to treatment with all-trans-retinoic acid, and he died from multiorgan failure. (The cells from this patient were tested one week after treatment with all-trans-retinoic acid had been discontinued.) Patient 6 presented with relapsed APL and received arsenic trioxide. A pulmonary hemorrhage and a coagulation disturbance improved during the first week of therapy; similar results have been reported previously.45

Annexin II Expression in APL Cells

Immunofluorescence microscopy was used to detect annexin II in promyelocytes from patients with APL (Figure 1AFigure 1Immunofluorescence Staining of APL Cells with Anti–Annexin II Antibodies., Figure 1B, Figure 1C, Figure 1D, and Figure 1E). The results were strongly positive with t(15;17)-positive leukemic blasts (Figure 1A and Figure 1C), whereas the results were only slightly positive with the t(15;17)-negative cell line, APL-1 (Figure 1E). Staining of (t15;17)-positive APL cells with IgG from the serum of an unimmunized rabbit was negative (Figure 1B). Leukemic blasts from a patient with AML characterized by minimal myeloid differentiation did not react with the anti–annexin II antibody (Figure 1D).

Flow-cytometric studies showed that t(15;17)-positive APL cells from three patients with recent diagnoses and three with relapses had mean fluorescence intensities with anti–annexin II antibodies that were 3.8 to 10.9 times the intensity observed with the control IgG (Table 1). Leukocytes from six of the seven patients with other forms of leukemia expressed lower levels of annexin II. The relative mean fluorescence intensity for APL cells was 6.9, whereas for AML and acute lymphocytic leukemia cells it was 2.9 (P<0.01). One patient with relapsed AML (Patient 13) had a relatively high level of annexin II (mean fluorescence intensity, 5.9). She also had elevated plasma levels of d-dimer, a prolonged prothrombin time, severe thrombocytopenia, and excessive bleeding.

The expression of annexin II on t(15;17)-positive APL cell lines was further evaluated by Western blotting of eluates from cell surfaces.46 With the use of an annexin II–specific monoclonal IgG antibody, annexin II was detected in eluates from umbilical-vein endothelial cells and t(15;17)-positive NB4 cells but not in eluates from t(15;17)-negative cell lines (HL-60, AML-M1, and APL-1) (data not shown).

Generation of Plasmin in APL Cells

Using a fluorogenic assay, we assessed the ability of t(15;17)-positive NB4 cells to activate plasminogen (Table 2Table 2Plasminogen Activation in the Presence of Leukemic Cells.). By itself, t-PA was a weak plasminogen activator, but with t-PA in the presence of NB4 cells, the rate of plasmin generation was increased by a factor of 28. Approximately 45 percent of this increment occurred in the absence of t-PA, whereas about 55 percent was dependent on exogenous t-PA (P<0.001). Without added t-PA, plasminogen activation was inhibited by the u-PA–specific antagonist amiloride and by anti–u-PA antibodies but not by anti–t-PA antibodies. These results suggest that endogenous production of plasmin by NB4 cells is largely due to u-PA and that NB4 cells enhance plasminogen activation by mechanisms that depend on t-PA and by mechanisms that are independent of t-PA.

NB4 cells stimulated t-PA–dependent activation of plasminogen more effectively than equivalent numbers of t(15;17)-negative cells (Table 2). For HL-60, AML-M1, and APL-1 cells, the rates of activation were 58.8, 48.2, and 45.2 percent of the value obtained with NB4 cells (P<0.001), respectively, suggesting that cells with the t(15;17) translocation support plasmin generation much more efficiently than cells without the translocation. Furthermore, in the presence of aminocaproic acid, a lysine analogue that inhibits the binding of plasminogen to annexin II,37 plasmin production by NB4 cells was reduced to 29.2 percent (P<0.001) of the rate in its absence, whereas the formation of plasmin in the soluble phase was not affected. Moreover, a monoclonal anti–annexin II antibody reduced plasmin generation by NB4 cells to 65 percent (P<0.02) of that observed when NB4 cells were incubated with an equivalent concentration of anti–annexin I IgG antibody. These results constitute evidence that annexin II on the surface of leukemic promyelocytes has a key role in the production of plasmin.

For further analysis of the role of annexin II in the activation of plasminogen by t-PA, t(15;17)-negative cells (APL-1), which lack cell-surface annexin II, were transfected with a plasmid containing either the full-length annexin II cDNA or an empty vector.34 APL-1 transfectants stimulated plasmin production 2.7 times as effectively as nontransfected cells (P<0.001) and nearly twice as effectively as cells transfected with the empty vector (P<0.01). These data suggest that the expression of annexin II is directly correlated with the capacity to generate plasmin.

Annexin II mRNA levels were determined with a ribonuclease protection assay. Steady-state mRNA levels in two t(15;17)-negative cell lines, AML-M1 and APL-1, were 11 and 10 percent, respectively, of levels in t(15;17)-positive APL cells (NB4 cells) (Figure 2Figure 2Steady-State Levels of Annexin II mRNA.). HL-60 cells expressed nearly equivalent levels of annexin II mRNA (74 percent), but the protein was not detected on the cell surface in experiments involving ethylene glycol-bis(β-aminoethyl ether)-N,N,N',N'-tetraacetic acid elution.

Effect of All-trans-Retinoic Acid on the Synthesis of Annexin II by NB4 Cells

After five and seven days of treatment of NB4 cells with all-trans-retinoic acid, the rate of plasmin production fell to nearly that observed in t(15;17)-negative cells (61.1 and 67.5 percent, respectively, of the rate in untreated control cells; P<0.001). Similarly, cellular expression of annexin II in cells treated with all-trans-retinoic acid was lower than that in mock-treated controls at 72 hours and was completely absent at 120 hours (Figure 3AFigure 3Expression of Annexin II Protein (Panel A) and Annexin II Messenger RNA (mRNA) (Panel B) in NB4 Cells.).

The effect of all-trans-retinoic acid on annexin II mRNA levels in NB4 cells was evaluated by a ribonuclease protection assay (Figure 3B). Annexin II mRNA levels were reduced within 24 hours after treatment with all-trans-retinoic acid and reached a nadir after 72 hours. The inhibitory effect of all-trans-retinoic acid was evident over a range of concentrations (50 percent inhibitory concentration, <10 nM). For concentrations of 100 nM or more, the rate of inhibition was greater than 85 to 90 percent. Moreover, the expression of annexin II mRNA was diminished after treatment for 48 hours with a stereoisomer of all-trans-retinoic acid, 13-cis-retinoic acid (36 percent of the control value), but not on exposure to two non–retinoid-differentiating agents, phorbol myristate acetate47 and vitamin D3 (87 and 97 percent of the control value, respectively). These data indicate that the expression of annexin II in NB4 cells exhibits a high degree of retinoid-specific sensitivity.

Using nuclear run-on analyses, we assessed the effect of all-trans-retinoic acid on the rate of annexin II gene transcription. In two experiments, the average rate of annexin II transcription was reduced to 70 and 80 percent of the value in vehicle-treated controls after 12 and 24 hours of treatment with all-trans-retinoic acid, respectively. In three experiments, the mean (±SE) rate was reduced to 39±8 percent of the value in controls after 48 hours (P<0.001). Similarly, NB4 cells treated with all-trans-retinoic acid were exposed to dactinomycin (2 μg per milliliter), and steady-state annexin II mRNA levels were estimated with the ribonuclease protection assay. In four separate experiments, no increase in mRNA degradation was observed after three or six hours of treatment with dactinomycin. These data indicate that the inhibition of annexin II expression by all-trans-retinoic acid is transcriptionally mediated and not the result of accelerated degradation of annexin II mRNA.

Discussion

These studies showed that APL cells with the t(15;17) translocation expressed abnormally high levels of cell-surface annexin II. The cells supported rapid rates of plasmin production by t-PA, an effect that was inhibited by anti–annexin II antibodies. Moreover, t(15;17)-negative APL-1 cells that were transfected with annexin II cDNA also exhibited increased t-PA–dependent production of plasmin. These data suggest that overexpression of annexin II increases plasmin production by t(15;17)-positive APL cells, thereby contributing to the hemorrhagic diathesis of APL. Although the presence of the t(15;17) translocation appears to be correlated with overexpression of annexin II, further studies are warranted to verify this finding.

In patients with APL, bleeding usually begins to resolve within five to seven days after the start of treatment with all-trans-retinoic acid, and plasma levels of fibrinogen and α2-plasmin inhibitor return to normal.13 In our series, plasma fibrinogen levels returned to normal within the first week of therapy in two of the three patients with APL who received all-trans-retinoic acid. In vitro treatment of t(15;17)-positive APL cells with all-trans-retinoic acid significantly reduced both the cellular expression of annexin II and plasmin generation over a similar period. Since the half-life of annexin II is approximately 15 hours,48 the observed rate of protein disappearance represents between 5 and 8 annexin II half-lives. This time course is consistent with the time that it took for annexin II mRNA to be reduced by 50 percent in the presence of all-trans-retinoic acid in vitro (12 to 18 hours). Because all-trans-retinoic acid did not stimulate the degradation of annexin II mRNA but did impair its production, we conclude that the inhibitory effect of all-trans-retinoic acid on the expression of annexin II is transcriptionally mediated.

Annexin II is thought to have a thromboregulatory role by enhancing the t-PA–dependent formation of plasmin on the endothelial cell surface.33 Dysregulated expression of annexin II on the surface of circulating APL cells may lead to uncontrolled production of plasmin, thereby shifting the hemostatic balance toward overt bleeding (Figure 4AFigure 4Proposed Mechanism of Hemorrhage in APL. and Figure 4B). Because plasmin formed on cell surfaces appears to be protected from its primary inhibitor, α2-plasmin inhibitor,49 the total fibrinolytic effect of overexpression of annexin II may be clinically significant. Furthermore, because α2-plasmin inhibitor may become depleted in patients with APL,12,13,18,22,24,25 circulating plasmin may go unchecked, further increasing the potential for hemorrhage.

Our in vitro studies of NB4 cells indicate that u-PA, in addition to t-PA, may play a part in the generation of plasmin by APL cells. Urokinase has been reported to be produced by these cells.26,30,32 In the absence of t-PA, approximately two thirds of the base-line plasmin generation by NB4 cells was inhibited by anti–u-PA antibody and by amiloride (a u-PA–specific inhibitor). The presence of u-PA would explain why approximately 30 percent of the plasmin production was insensitive to the plasminogen-binding inhibitor aminocaproic acid (Table 2).

In addition to annexin II, other annexins may regulate the formation of clots. Annexin VIII is expressed in APL cells and is down-regulated by all-trans-retinoic acid,50,51 but it is not known whether this intracellular protein affects the hemostatic balance. Annexin V is expressed on the surface of placental villi cells.52 In the antiphospholipid antibody syndrome, annexin V appears to be displaced by IgG antiphospholipid antibodies. This process may expose membrane phospholipid, resulting in vascular thrombosis in the placenta and fetal wastage. Thus, the annexins may represent a unique group of proteins that regulate hemostasis.

The leukemic promyelocytes from all six patients with APL in our study expressed high levels of annexin II, and all these patients had evidence of accelerated fibrinolysis. Several small studies have suggested that treatment with antifibrinolytic drugs, such as aminocaproic acid and tranexamic acid, may reduce complications due to bleeding in patients with APL, further supporting the role of the fibrinolytic system in the coagulation disturbance.24,53-55 However, several reports of the development of thromboses in patients with APL during treatment with all-trans-retinoic acid suggest that it should be used cautiously.56-58 Our study included two patients with AML of monocytic lineage, one of whom had severe bleeding complications and a high level of expression of annexin II on leukemic monocytes. We have observed annexin II on the surface of monocyte-derived macrophages,59 suggesting that the expression of this protein may not depend solely on the t(15;17) translocation. Nevertheless, the level of annexin II expression by leukemic cells may be a useful factor in deciding whether or not to use antifibrinolytic therapy. Studies currently under way are examining the correlation between the level of annexin II expression and the degree of bleeding and fibrinolytic activity in patients with leukemia.

In summary, a high level of expression of annexin II appears to be a marker of APL and may contribute to bleeding disorders in patients with APL by activating the fibrinolytic system. Treatment with all-trans-retinoic acid down-regulates the production of mRNA for annexin II, which may explain the rapid resolution of coagulopathy in patients receiving retinoid therapy.

Supported by grants from the National Institutes of Health (HL 42493, HL 46403, HL 58981, and HL 03558) and the Robert Steel Foundation for Pediatric Cancer Research.

We are indebted to Drs. R. Warrell, P. Steinherz, A. Aledo, and J. Garvin for assistance in obtaining samples from patients.

Source Information

From the Division of Hematology–Oncology, Departments of Pediatrics (J.S.M., A.T.J., E.A.L., K.A.H.) and Medicine (K.A.H.), Weill Medical College of Cornell University, New York; the Division of Hematology–Oncology, Department of Medicine, Instituto Nacional de la Nutricion Salvador Zubirán, Mexico City, Mexico (G.M.C.); and the Division of Cardiology, Department of Medicine, Mount Sinai Medical Center, New York (M.A.M.).

Address reprint requests to Dr. Menell at Columbia University, College of Physicians and Surgeons, 180 Ft. Washington Ave., HP5, New York, NY 10032, or at .

References

References

  1. 1

    Tallman MS, Kwaan HC. Reassessing the hemostatic disorder associated with acute promyelocytic leukemia. Blood 1992;79:543-553
    Web of Science | Medline

  2. 2

    Grignani F, Fagioli M, Alcalay M, et al. Acute promyelocytic leukemia: from genetics to treatment. Blood 1994;83:10-25
    Web of Science | Medline

  3. 3

    Warrell RP Jr, de The H, Wang Z-Y, Degos L. Acute promyelocytic leukemia. N Engl J Med 1993;329:177-189
    Full Text | Web of Science | Medline

  4. 4

    Grignani F, Ferrucci PF, Testa U, et al. The acute promyelocytic leukemia-specific PML-RARα fusion protein inhibits differentiation and promotes survival of myeloid precursor cells. Cell 1993;74:423-431
    CrossRef | Web of Science | Medline

  5. 5

    Huang M-E, Ye Y-C, Chen S-R, et al. Use of all-trans retinoic acid in the treatment of acute promyelocytic leukemia. Blood 1988;72:567-572
    Web of Science | Medline

  6. 6

    Castaigne S, Chomienne C, Daniel MT, et al. All-trans retinoic acid as a differentiation therapy for acute promyelocytic leukemia. I. Clinical results. Blood 1990;76:1704-1709
    Web of Science | Medline

  7. 7

    Chen ZX, Xue YQ, Zhang R, et al. A clinical and experimental study on all-trans retinoic acid-treated acute promyelocytic leukemia patients. Blood 1991;78:1413-1419
    Web of Science | Medline

  8. 8

    Frankel SR, Eardley A, Heller G, et al. All-trans retinoic acid for acute promyelocytic leukemia: results of the New York Study. Ann Intern Med 1994;120:278-286
    Web of Science | Medline

  9. 9

    Warrell RP Jr, Frankel SR, Miller WH Jr, et al. Differentiation therapy of acute promyelocytic leukemia with tretinoin (all-trans-retinoic acid). N Engl J Med 1991;324:1385-1393
    Full Text | Web of Science | Medline

  10. 10

    Fenaux P, Le Deley MC, Castaigne S, et al. Effect of all transretinoic acid in newly diagnosed acute promyelocytic leukemia: results of a multicenter randomized trial. Blood 1993;82:3241-3249
    Web of Science | Medline

  11. 11

    Wu X, Wang X, Qien X, et al. Four years' experience with the treatment of all-trans retinoic acid in acute promyelocytic leukemia. Am J Hematol 1993;43:183-189
    CrossRef | Web of Science | Medline

  12. 12

    Dombret H, Scrobohaci ML, Ghorra P, et al. Coagulation disorders associated with acute promyelocytic leukemia: corrective effect of all-trans retinoic acid treatment. Leukemia 1993;7:2-9
    Web of Science | Medline

  13. 13

    Dombret H, Scrobohaci ML, Daniel MT, et al. In vivo thrombin and plasmin activities in patients with acute promyelocytic leukemia (APL): effect of all-trans retinoic acid (ATRA) therapy. Leukemia 1995;9:19-24
    Web of Science | Medline

  14. 14

    Bauer KA, Rosenberg RD. Thrombin generation and acute promyelocytic leukemia. Blood 1984;64:791-796
    Web of Science | Medline

  15. 15

    Kario K, Matsuo T, Kodama K, Katayama S, Kobayashi H. Preferential consumption of heparin cofactor II in disseminated intravascular coagulation associated with acute promyelocytic leukemia. Thromb Res 1992;66:435-444
    CrossRef | Web of Science | Medline

  16. 16

    Myers TJ, Rickles RF, Barb C, Cronlund M. Fibrinopeptide A in acute leukemia: relationship of activation of blood coagulation to disease activity. Blood 1981;57:518-525
    Web of Science | Medline

  17. 17

    Aoki N, Moroi M, Matsuda M, Tachiya K. The behavior of alpha 2-plasmin inhibitor in fibrinolytic states. J Clin Invest 1977;60:361-369
    CrossRef | Web of Science | Medline

  18. 18

    Avvisati G, ten Cate JW, Sturk A, Lamping R, Petti MG, Mandelli F. Acquired alpha-2-antiplasmin deficiency in acute promyelocytic leukaemia. Br J Haematol 1988;70:43-48
    CrossRef | Web of Science | Medline

  19. 19

    Bauer KA, Kass BL, Beeler DL, Rosenberg RD. Detection of protein C activation in humans. J Clin Invest 1984;74:2033-2041
    CrossRef | Web of Science | Medline

  20. 20

    Bennett M, Parker AC, Ludlam CA. Platelet and fibrinogen survival in acute promyelocytic leukaemia. BMJ 1976;2:565-565
    CrossRef | Web of Science | Medline

  21. 21

    Hajjar KA. The molecular basis of fibrinolysis. In: Nathan DG, Orkin SH, eds. Nathan and Oski's hematology of infancy and childhood. 5th ed. Philadelphia: W.B. Saunders, 1998:1557-73.

  22. 22

    Ogston D, McAndrew GM, Ogston CM. Fibrinolysis in leukemia. J Clin Pathol 1968;21:136-139
    CrossRef | Web of Science | Medline

  23. 23

    Sterrenberg L, Haak HL, Brommer EJP, Nieuwenhuizen W. Evidence of fibrinogen breakdown by leukocyte enzymes in a patient with acute promyelocytic leukemia. Haemostasis 1985;15:126-133
    Medline

  24. 24

    Schwartz BS, Williams EC, Conlan MG, Mosher DF. Epsilon-aminocaproic acid in the treatment of patients with acute promyelocytic leukemia and acquired alpha-2-plasmin inhibitor deficiency. Ann Intern Med 1986;105:873-877
    Web of Science | Medline

  25. 25

    Imaoka S, Ueda T, Shibata H, et al. Fibrinolysis in patients with acute promyelocytic leukemia and disseminated intravascular coagulation during heparin therapy. Cancer 1986;58:1736-1738
    CrossRef | Web of Science | Medline

  26. 26

    Bennett B, Booth NA, Croll A, Dawson AA. The bleeding disorder in acute promyelocytic leukaemia: fibrinolysis due to u-PA rather than defibrination. Br J Haematol 1989;71:511-517
    CrossRef | Web of Science | Medline

  27. 27

    Sakata Y, Murakami T, Noro A, Mori K, Matsuda M. The specific activity of plasminogen activator inhibitor-1 in disseminated intravascular coagulation with acute promyelocytic leukemia. Blood 1991;77:1949-1957
    Web of Science | Medline

  28. 28

    Francis RB Jr, Seyfert U. Tissue plasminogen activator antigen and activity in disseminated intravascular coagulation: clinicopathologic correlations. J Lab Clin Med 1987;110:541-547
    Medline

  29. 29

    Federici AB, Berkowitz SD, Lattuada A, Mannucci PM. Degradation of von Willebrand factor in patients with acquired clinical conditions in which there is heightened proteolysis. Blood 1993;81:720-725
    Web of Science | Medline

  30. 30

    Tapiovaara H, Matikainen S, Hurme M, Vaheri A. Induction of differentiation of promyelocytic NB4 cells by retinoic acid is associated with rapid increase in urokinase activity subsequently downregulated by production of inhibitors. Blood 1994;83:1883-1891
    Web of Science | Medline

  31. 31

    Federici AB, Falanga A, Lattuada A, Di Rocco N, Barbui T, Mannucci PM. Proteolysis of von Willebrand factor is decreased in acute promyelocytic leukaemia by treatment with all-trans-retinoic acid. Br J Haematol 1996;92:733-739
    CrossRef | Web of Science | Medline

  32. 32

    Tapiovaara H, Alitalo R, Stephens R, Myohanen H, Ruutu T, Vaheri A. Abundant urokinase activity on the surface of mononuclear cells from blood and bone marrow of acute leukemia patients. Blood 1993;82:914-919
    Web of Science | Medline

  33. 33

    Hajjar KA, Menell JS. Annexin II: a novel mediator of cell surface plasmin generation. Ann N Y Acad Sci 1997;811:337-349
    CrossRef | Web of Science | Medline

  34. 34

    Hajjar KA, Jacovina AT, Chacko J. An endothelial cell receptor for plasminogen/tissue plasminogen activator. I. Identity with annexin II. J Biol Chem 1994;269:21191-21197
    Web of Science | Medline

  35. 35

    Cesarman GM, Guevara CA, Hajjar KA. An endothelial cell receptor for plasminogen/tissue plasminogen activator (t-PA). II. Annexin II-mediated enhancement of t-PA-dependent plasminogen activation. J Biol Chem 1994;269:21198-21203
    Web of Science | Medline

  36. 36

    Lanotte M, Martin-Thouvenin V, Najman S, Balerini P, Valensi F, Berger R. NB4, a maturation inducible cell line with t(15;17) marker isolated from a human acute promyelocytic leukemia (M3). Blood 1991;77:1080-1086
    Web of Science | Medline

  37. 37

    Hajjar KA, Harpel PC, Jaffe EA, Nachman RL. Binding of plasminogen to cultured human endothelial cells. J Biol Chem 1986;261:11656-11662
    Web of Science | Medline

  38. 38

    Miller WH Jr, Levine K, DeBlasio A, Frankel SR, Dmitrovsky E, Warrell RP Jr. Detection of minimal residual disease in acute promyelocytic leukemia by a reverse transcription polymerase chain reaction assay for the PML/RAR-α fusion mRNA. Blood 1993;82:1689-1694
    Web of Science | Medline

  39. 39

    Collins SJ, Gallo RC, Gallagher RE. Continuous growth and differentiation of human myeloid leukaemic cells in suspension culture. Nature 1977;270:347-349
    CrossRef | Web of Science | Medline

  40. 40

    Dalton WT Jr, Ahearn MJ, McCredie KB, Freireich EJ, Stass SA, Trujillo JM. HL-60 cell line was derived from a patient with FAB-M2 and not FAB-M3. Blood 1988;71:242-247
    Web of Science | Medline

  41. 41

    Hembrough TA, Li L, Gonias SL. Cell-surface cytokeratin 8 is the major plasminogen receptor on breast cancer cells and is required for the accelerated activation of cell-associated plasminogen by tissue-type plasminogen activator. J Biol Chem 1996;271:25684-25691
    CrossRef | Web of Science | Medline

  42. 42

    Huang K-S, Wallner BP, Mattaliano RJ, et al. Two human 35 kd inhibitors of phospholipase A2 are related to substrates of pp60v-src and of the epidermal growth factor receptor/kinase. Cell 1986;46:191-199
    CrossRef | Web of Science | Medline

  43. 43

    Thompson J, Gillespie D. Molecular hybridization with RNA probes in concentrated solutions of guanidine thiocyanate. Anal Biochem 1987;163:281-291
    CrossRef | Web of Science | Medline

  44. 44

    Greenberg ME, Ziff EB. Stimulation of 3T3 cells induces transcription of the c-fos proto-oncogene. Nature 1984;311:433-438
    CrossRef | Web of Science | Medline

  45. 45

    Shen Z-X, Chen GQ, Ni J-H, et al. Use of arsenic trioxide (As2O3) in the treatment of acute promyelocytic leukemia (APL). II. Clinical efficacy and pharmacokinetics in relapsed patients. Blood 1997;89:3354-3360
    Web of Science | Medline

  46. 46

    Hajjar KA, Guevara CA, Lev E, Dowling K, Chacko J. Interaction of the fibrinolytic receptor, annexin II, with the endothelial cell surface: essential role of endonexin repeat II. J Biol Chem 1996;271:21652-21659
    CrossRef | Web of Science | Medline

  47. 47

    Hu ZB, Ma W, Uphoff CC, Lanotte M, Drexler HG. Modulation of gene expression in the acute promyelocytic leukemia cell line NB4. Leukemia 1993;7:1817-1823
    Web of Science | Medline

  48. 48

    Zokas L, Glenney JR Jr. The calpactin light chain is tightly linked to the cytoskeletal form of calpactin I: studies using monoclonal antibodies to calpactin subunits. J Cell Biol 1987;105:2111-2121
    CrossRef | Web of Science | Medline

  49. 49

    Plow EF, Freaney DE, Plescia J, Miles LA. The plasminogen system and cell surfaces: evidence for plasminogen and urokinase receptors on the same cell types. J Cell Biol 1986;103:2411-2420
    CrossRef | Web of Science | Medline

  50. 50

    Chang K-S, Wang G, Freireich EJ, et al. Specific expression of the annexin VIII gene in acute promyelocytic leukemia. Blood 1992;79:1802-1810
    Web of Science | Medline

  51. 51

    Sarkar A, Yang P, Fan Y-H, et al. Regulation of the expression of annexin VIII in acute promyelocytic leukemia. Blood 1994;84:279-286
    Web of Science | Medline

  52. 52

    Rand JH, Wu X-X, Andree HAM, et al. Pregnancy loss in the antiphospholipid antibody syndrome -- a possible thrombogenic mechanism. N Engl J Med 1997;337:154-160[Erratum, N Engl J Med 1997;337:1327.]
    Full Text | Web of Science | Medline

  53. 53

    Keane TJ, Gorman AM, O'Connell LG, Fennelly JJ. ε-Amino-caproic acid in the management of acute promyelocytic leukaemia. Acta Haematol 1976;56:202-204
    CrossRef | Web of Science | Medline

  54. 54

    Avvisati G, ten Cate JW, Buller HR, Mandelli F. Tranexamic acid for control of haemorrhage in acute promyelocytic leukaemia. Lancet 1989;2:122-124
    CrossRef | Web of Science | Medline

  55. 55

    Sugawara T, Okuda M, Yamaguchi Y, Endo K, Yoshinaga K. Successful treatment with tranexamic acid for severe bleeding in acute promyelocytic leukemia. Acta Haematol 1992;87:109-109
    CrossRef | Web of Science | Medline

  56. 56

    Hashimoto S, Koike T, Tatewaki W, et al. Fatal thromboembolism in acute promyelocytic leukemia during all-trans retinoic acid therapy combined with antifibrinolytic therapy for prophylaxis of hemorrhage. Leukemia 1994;8:1113-1115
    Web of Science | Medline

  57. 57

    Escudier SM, Kantarjian HM, Estey EH. Thrombosis in patients with acute promyelocytic leukemia treated with and without all-trans retinoic acid. Leuk Lymphoma 1996;20:435-439
    CrossRef | Web of Science | Medline

  58. 58

    Runde V, Aul C, Heyll A, Schneider W. All-trans retinoic acid: not only a differentiating agent, but also an inducer of thromboembolic events in patients with M3 leukemia. Blood 1992;79:534-535
    Web of Science | Medline

  59. 59

    Falcone DJ, Borth W, Matthew J, Guevara C, Hajjar KA. Annexin II is a plasminogen receptor on THP-1 macrophages. FASEB J 1995;9:A412-A412 abstract.
    Web of Science

Citing Articles (101)

Citing Articles

  1. 1

    Rajan Kapoor, H. P. Pati, Sanjeev Kumar Gupta, Nitin Gupta. (2012) Acute Promyelocytic Leukemia Presenting as Ischemic Stroke in Young. Indian Journal of Hematology and Blood Transfusion
    CrossRef

  2. 2

    Anja Rosengarth, Hartmut Luecke. 2011. Annexins: Calcium Binding Proteins with Unusual Binding Sites. .
    CrossRef

  3. 3

    P. A. Madureira, A. P. Surette, K. D. Phipps, M. A. S. Taboski, V. A. Miller, D. M. Waisman. (2011) The role of the annexin A2 heterotetramer in vascular fibrinolysis. Blood 118:18, 4789-4797
    CrossRef

  4. 4

    Karen A. Breen, David Grimwade, Beverley J. Hunt. (2011) The pathogenesis and management of the coagulopathy of acute promyelocytic leukaemia. British Journal of Haematologyno-no
    CrossRef

  5. 5

    Fumihiko Namba, Shihomi Ina, Hiroyuki Kitajima, Hiroyuki Yoshio, Kazuya Mimura, Shigeru Saito, Itaru Yanagihara. (2011) Annexin A2 in amniotic fluid: Correlation with histological chorioamnionitis, preterm premature rupture of membranes, and subsequent preterm delivery. Journal of Obstetrics and Gynaecology Researchno-no
    CrossRef

  6. 6

    Hong Xin, Yi Zhang, Huilan Wang, Shuhan Sun. (2011) Alterations of profibrinolytic receptor annexin A2 in pre-eclampsia: A possible role in placental thrombin formation. Thrombosis Research
    CrossRef

  7. 7

    Kinya Ohata, Hirohito Yamazaki, Hidesaku Asakura, Shigeru Shimadoi, Shinji Nakao. (2011) Tamibarotene-induced low-grade reversible intravascular coagulation in a patient with acute promyelocytic leukemia. Thrombosis Research
    CrossRef

  8. 8

    Yanhui Liu, Zhaoyue Wang, Miao Jiang, Lan Dai, Wei Zhang, Depei Wu, Changgeng Ruan. (2011) The expression of annexin II and its role in the fibrinolytic activity in acute promyelocytic leukemia. Leukemia Research 35:7, 879-884
    CrossRef

  9. 9

    Yoshiki Tsuchiya, Yoshifumi Ubara, Tatsuya Suwabe, Junichi Hoshino, Keiichi Sumida, Rikako Hiramatsu, Eiko Hasegawa, Masayuki Yamanouchi, Noriko Hayami, Yuji Marui, Naoki Sawa, Fumi Takemoto, Kenmei Takaichi. (2011) Successful treatment of acute promyelocytic leukemia in a patient on hemodialysis. Clinical and Experimental Nephrology 15:3, 434-437
    CrossRef

  10. 10

    P. A. O'Connell, P. A. Madureira, J. N. Berman, R. S. Liwski, D. M. Waisman. (2011) Regulation of S100A10 by the PML-RAR-  oncoprotein. Blood 117:15, 4095-4105
    CrossRef

  11. 11

    Elle C. Flood, Katherine A. Hajjar. (2011) The annexin A2 system and vascular homeostasis. Vascular Pharmacology 54:3-6, 59-67
    CrossRef

  12. 12

    M. Affer, S. Dao, C. Liu, A. B. Olshen, Q. Mo, A. Viale, C. L. Lambek, T. G. Marr, B. D. Clarkson. (2011) Gene Expression Differences between Enriched Normal and Chronic Myelogenous Leukemia Quiescent Stem/Progenitor Cells and Correlations with Biological Abnormalities. Journal of Oncology 2011, 1-25
    CrossRef

  13. 13

    Eun Sun Yoo. (2011) Recent advances in the diagnosis and management of childhood acute promyelocytic leukemia. Korean Journal of Pediatrics 54:3, 95
    CrossRef

  14. 14

    DJ Perry, C Grove. 2011. Acquired bleeding disorders. , 565-582.
    CrossRef

  15. 15

    Hau C Kwaan, Timothy Huyck. (2010) Thromboembolic and bleeding complications in acute leukemia. Expert Review of Hematology 3:6, 719-730
    CrossRef

  16. 16

    Olga Frankfurt. 2010. Management of Emergencies in Leukemias. , 373-391.
    CrossRef

  17. 17

    Yong Zhang, Guoyu Yu, Yanjie Wang, Jie Zhang, Shuangshuang Wei, Wenhui Lee, Yun Zhang. (2010) A novel annexin A2 protein with platelet aggregation-inhibiting activity from amphibian Bombina maxima skin. Toxicon 56:3, 458-465
    CrossRef

  18. 18

    P. A. O'Connell, A. P. Surette, R. S. Liwski, P. Svenningsson, D. M. Waisman. (2010) S100A10 regulates plasminogen-dependent macrophage invasion. Blood 116:7, 1136-1146
    CrossRef

  19. 19

    J. ZHOU, J. SHI, J. HOU, F. CAO, Y. ZHANG, J. T. RASMUSSEN, C. W. HEEGAARD, G. E. GILBERT. (2010) Phosphatidylserine exposure and procoagulant activity in acute promyelocytic leukemia. Journal of Thrombosis and Haemostasis 8:4, 773-782
    CrossRef

  20. 20

    Sang Bong Han, Jihyang Lim, Yonggoo Kim, Hee-Je Kim, Kyungja Han. (2010) A variant acute promyelocytic leukemia with t(11;17) (q23;q12); ZBTB16-RARA showing typical morphology of classical acute promyelocytic leukemia. The Korean Journal of Hematology 45:2, 133
    CrossRef

  21. 21

    Karen S. Carlson, Maria T. DeSancho. (2010) Hematological Issues in Critically Ill Patients with Cancer. Critical Care Clinics 26:1, 107-132
    CrossRef

  22. 22

    Mami Yamaguchi, Yasuo Kokai, Shin-Ichi Imai, Kumiko Utsumi, Kyoichi Matsumoto, Hirohito Honda, Yuka Mizue, Masako Momma, Tetsu Maeda, Shozo Toyomasu, Yoichi M. Ito, Seijyu Kobayashi, Eri Hashimoto, Toshikazu Saito, Hitoshi Sohma. (2010) Investigation of annexin A5 as a biomarker for Alzheimer's disease using neuronal cell culture and mouse model. Journal of Neuroscience Researchn/a-n/a
    CrossRef

  23. 23

    Tomoe Hayashi, Eriko Morishita, Hiroshi Ohtake, Yoshio Oda, Hidesaku Asakura, Shinji Nakao. (2009) Expression of annexin II in experimental abdominal aortic aneurysms. International Journal of Hematology 90:3, 336-342
    CrossRef

  24. 24

    Z. Romay-Penabad, M. G. Montiel-Manzano, T. Shilagard, E. Papalardo, G. Vargas, A. B. Deora, M. Wang, A. T. Jacovina, E. Garcia-Latorre, E. Reyes-Maldonado, K. A. Hajjar, S. S. Pierangeli. (2009) Annexin A2 is involved in antiphospholipid antibody-mediated pathogenic effects in vitro and in vivo. Blood 114:14, 3074-3083
    CrossRef

  25. 25

    Hongyu Bao, Miao Jiang, Mingqing Zhu, Fei Sheng, Jia Ruan, Changgeng Ruan. (2009) Overexpression of Annexin II affects the proliferation, apoptosis, invasion and production of proangiogenic factors in multiple myeloma. International Journal of Hematology 90:2, 177-185
    CrossRef

  26. 26

    Eytan Stein, Brandon McMahon, Hau Kwaan, Jessica K. Altman, Olga Frankfurt, Martin S. Tallman. (2009) The coagulopathy of acute promyelocytic leukaemia revisited. Best Practice & Research Clinical Haematology 22:1, 153-163
    CrossRef

  27. 27

    Lai-ping Zhong, Lei Zhang, Xiao Yang, Hong-ya Pan, Xiao-jian Zhou, Kui-jie Wei, Dong-xia Ye, Qian Jiang, Wan-tao Chen, Zhi-yuan Zhang. (2009) Comparative proteomic analysis of differentially expressed proteins in an in vitro cellular carcinogenesis model of oral squamous cell carcinoma. PROTEOMICS - CLINICAL APPLICATIONS 3:3, 322-337
    CrossRef

  28. 28

    L ZHONG, K WEI, X YANG, L ZHANG, X ZHOU, H PAN, J LI, W CHEN, Z ZHANG. (2009) Increased expression of Annexin A2 in oral squamous cell carcinoma. Archives of Oral Biology 54:1, 17-25
    CrossRef

  29. 29

    Tomoe Hayashi, Eriko Morishita, Hiroshi Ohtake, Yoshio Oda, Kazuhide Ohta, Masahisa Arahata, Yasuko Kadohira, Mio Maekawa, Yasuo Ontachi, Masahide Yamazaki, Hidesaku Asakura, Akiyoshi Takami, Shinji Nakao. (2008) Expression of annexin II in human atherosclerotic abdominal aortic aneurysms. Thrombosis Research 123:2, 274-280
    CrossRef

  30. 30

    T. Wassenaar, J. Black, B. Kahl, B. Schwartz, W. Longo, D. Mosher, E. Williams. (2008) Acute promyelocytic leukaemia and acquired α-2-plasmin inhibitor deficiency: a retrospective look at the use of epsilon-aminocaproic acid (Amicar) in 30 patients. Hematological Oncology 26:4, 241-246
    CrossRef

  31. 31

    Shigetsugu Takano, Akira Togawa, Hideyuki Yoshitomi, Takashi Shida, Fumio Kimura, Hiroaki Shimizu, Hiroyuki Yoshidome, Masayuki Ohtsuka, Atsushi Kato, Takeshi Tomonaga, Fumio Nomura, Masaru Miyazaki. (2008) Annexin II Overexpression Predicts Rapid Recurrence after Surgery in Pancreatic Cancer Patients Undergoing Gemcitabine-Adjuvant Chemotherapy. Annals of Surgical Oncology 15:11, 3157-3168
    CrossRef

  32. 32

    Antonio Frigeri, Dumitru A. Iacobas, Sanda Iacobas, Grazia Paola Nicchia, Jean Francois Desaphy, Diana Conte Camerino, Maria Svelto, David C. Spray. (2008) Effect of microgravity on gene expression in mouse brain. Experimental Brain Research 191:3, 289-300
    CrossRef

  33. 33

    Yusuke Shiozawa, Aaron M. Havens, Younghun Jung, Anne M. Ziegler, Elisabeth A. Pedersen, Jingcheng Wang, Jianhua Wang, Ganwei Lu, G. David Roodman, Robert D. Loberg, Kenneth J. Pienta, Russell S. Taichman. (2008) Annexin II/Annexin II receptor axis regulates adhesion, migration, homing, and growth of prostate cancer. Journal of Cellular Biochemistry 105:2, 370-380
    CrossRef

  34. 34

    Yi-Jun Qi, Qing-Yu He, Yuan-Fang Ma, Yao-Wu Du, Guang-Chao Liu, Yan-Jie Li, George S.W. Tsao, Sai Ming Ngai, Jen-Fu Chiu. (2008) Proteomic identification of malignant transformation-related proteins in esophageal squamous cell carcinoma. Journal of Cellular Biochemistry 104:5, 1625-1635
    CrossRef

  35. 35

    Mihoko Koseki, Noboru Asada, Hidetaka Uryu, Masami Takeuchi, Hidesaku Asakura, Kosei Matsue. (2007) Successful combined use of tranexamic acid and unfractionated heparin for life-threatening bleeding associated with intravascular coagulation in a patient with chronic myelogenous leukemia in blast crisis. International Journal of Hematology 86:5, 403-406
    CrossRef

  36. 36

    Daniela M. Schulz, Stefan Kalkhof, Andreas Schmidt, Christian Ihling, Christoph Stingl, Karl Mechtler, Olaf Zschörnig, Andrea Sinz. (2007) Annexin A2/P11 interaction: New insights into annexin A2 tetramer structure by chemical crosslinking, high-resolution mass spectrometry, and computational modeling. Proteins: Structure, Function, and Bioinformatics 69:2, 254-269
    CrossRef

  37. 37

    Joseph G. Jurcic, Steven L. Soignet, Peter G. Maslak. (2007) Diagnosis and treatment of acute promyelocytic leukemia. Current Oncology Reports 9:5, 337-344
    CrossRef

  38. 38

    Y. Jung, J. Wang, J. Song, Y. Shiozawa, J. Wang, A. Havens, Z. Wang, Y.-X. Sun, S. G. Emerson, P. H. Krebsbach, R. S. Taichman. (2007) Annexin II expressed by osteoblasts and endothelial cells regulates stem cell adhesion, homing, and engraftment following transplantation. Blood 110:1, 82-90
    CrossRef

  39. 39

    Juan Pablo Rodrigo Tapia, Emma Pena Alonso, Juana M. García-Pedrero, Manuel Florentino Fresno, Carlos Suárez Nieto, Reginald Owen Morgan, María Pilar Fernández. (2007) Expresión de la anexina A2 en los carcinomas epidermoides de cabeza y cuello. Acta Otorrinolaringológica Española 58:6, 257-262
    CrossRef

  40. 40

    Hau C. Kwaan, Brian Vicuna. (2007) Thrombosis and bleeding in cancer patients. Oncology Reviews 1:1, 14-27
    CrossRef

  41. 41

    Elena Ortiz-Zapater, Sandra Peiró, Oriol Roda, Josep M. Corominas, Susana Aguilar, Coral Ampurdanés, Francisco X. Real, Pilar Navarro. (2007) Tissue Plasminogen Activator Induces Pancreatic Cancer Cell Proliferation by a Non-Catalytic Mechanism That Requires Extracellular Signal-Regulated Kinase 1/2 Activation through Epidermal Growth Factor Receptor and Annexin A2. The American Journal of Pathology 170:5, 1573-1584
    CrossRef

  42. 42

    Christian V. Recktenwald, Simone Mendler, Rudolf Lichtenfels, Roland Kellner, Barbara Seliger. (2007) Influence ofKi-ras-driven oncogenic transformation on the protein network of murine fibroblasts. PROTEOMICS 7:3, 385-398
    CrossRef

  43. 43

    Seiji Madoiwa, Tsutomu Someya, Mitsugu Hironaka, Hiroshi Kobayashi, Tsukasa Ohmori, Jun Mimuro, Yukihiko Sugiyama, Tatsuo Morita, Yoshioki Nishimura, Takahisa Tarumoto, Keiya Ozawa, Ken Saito, Yoichi Sakata. (2007) Annexin 2 and hemorrhagic disorder in vascular intimal carcinomatosis. Thrombosis Research 119:2, 229-240
    CrossRef

  44. 44

    Frederick R. Rickles, Anna Falanga, Pau Montesinos, Miguel A. Sanz, Benjamin Brenner, Tiziano Barbui. (2007) Bleeding and thrombosis in acute leukemia: What does the future of therapy look like?. Thrombosis Research 120, S99-S106
    CrossRef

  45. 45

    H. C. Kwaan. (2007) Double Hazard of Thrombophilia and Bleeding in Leukemia. Hematology 2007:1, 151-157
    CrossRef

  46. 46

    Juan Pablo Rodrigo Tapia, Emma Pena Alonso, Juana M. García-Pedrero, Manuel Florentino Fresno, Carlos Suárez Nieto, Reginald Owen Morgan, María Pilar Fernández. (2007) Annexin A2 Expression in Head and Neck Squamous Cell Carcinoma. Acta Otorrinolaringologica (English Edition) 58:6, 257-262
    CrossRef

  47. 47

    Carrie LaBelle, Craig S. Kitchens. 2007. Disseminated Intravascular Coagulation. , 183-198.
    CrossRef

  48. 48

    FUMIHIKO NAMBA, HIROYUKI KITAJIMA, ATSUSHI TABATA, MASAHIRO NAKAYAMA, NORIYUKI SUEHARA, KATSURA MATSUNAMI, KEIKO YANAGIHARA, MASAHIRO NISHIHARA, AKIHIRO MORITA, MINORU YAMADA, AKIHITO KIMOTO, SHINYA HIRANO, KIYOTOSHI SEKIGUCHI, MASANORI FUJIMURA, ITARU YANAGIHARA. (2006) Anti-Annexin A2 IgM Antibody in Preterm Infants: Its Association with Chorioamnionitis. Pediatric Research 60:6, 699-704
    CrossRef

  49. 49

    Carolina Arbuthnot, Jonathan T. Wilde. (2006) Haemostatic problems in acute promyelocytic leukaemia. Blood Reviews 20:6, 289-297
    CrossRef

  50. 50

    Kazuko Yamaoka, Shinobu Imajoh-Ohmi, Hiroyuki Fukuda, Yoshiko Akita, Keiko Kurosawa, Yukio Yamamoto, Yutaka Sanai. (2006) Identification of phosphoproteins associated with maintenance of transformed state in temperature-sensitive Rous sarcoma-virus infected cells by proteomic analysis. Biochemical and Biophysical Research Communications 345:3, 1240-1246
    CrossRef

  51. 51

    Anja Rosengarth, Hartmut Luecke. 2006. Annexins: Calcium Binding Proteins with Unusual Binding Sites. .
    CrossRef

  52. 52

    Atsushi Tabata, Fumihiko Namba, Minoru Yamada, Taeko Hasegawa, Kumiko Nakahira, Daizo Hamada, Hiroyuki Kitajima, Eiichiro Fukusaki, Itaru Yanagihara. (2006) Expression and purification of recombinant human annexin A2 in Pichia pastoris and utility of expression product for detecting annexin A2 antibody. Journal of Bioscience and Bioengineering 101:2, 190-197
    CrossRef

  53. 53

    Hidesaku ASAKURA, Shigeki KUSHIMOTO. (2006) Definition of pathophysiology for DIC in patients with infections or non-infections diseases. Japanese Journal of Thrombosis and Hemostasis 17:3, 284-293
    CrossRef

  54. 54

    Seiji MADOIWA, Yoichi SAKATA. (2006) DIC and fibrinolysis system. Japanese Journal of Thrombosis and Hemostasis 17:3, 254-260
    CrossRef

  55. 55

    Hidesaku ASAKUR, Seiji MADAIWA. (2006) Fibrinolytic or antifibrinolytic treatment for DIC. Japanese Journal of Thrombosis and Hemostasis 17:3, 320-325
    CrossRef

  56. 56

    Ryan R Falsey, Marilyn T Marron, G M Kamal B Gunaherath, Nikhil Shirahatti, Daruka Mahadevan, A A Leslie Gunatilaka, Luke Whitesell. (2006) Actin microfilament aggregation induced by withaferin A is mediated by annexin II. Nature Chemical Biology 2:1, 33-38
    CrossRef

  57. 57

    Anna Cederholm, Johan Frostegård. (2005) Annexin A5 in cardiovascular disease and systemic lupus erythematosus. Immunobiology 210:10, 761-768
    CrossRef

  58. 58

    Shane A. Olwill, Hugh McGlynn, William S. Gilmore, H. D. Alexander. (2005) All-trans retinoic acid-induced downregulation of annexin II expression in myeloid leukaemia cell lines is not confined to acute promyelocytic leukaemia. British Journal of Haematology 131:2, 258-264
    CrossRef

  59. 59

    Su Mi Bae, Chang-Hun Lee, Young Lae Cho, Kye Hyun Nam, Yong Wan Kim, Chong Kook Kim, Byoung Don Han, Young Joo Lee, Heung Jae Chun, Woong Shick Ahn. (2005) Two-dimensional gel analysis of protein expression profile in squamous cervical cancer patients. Gynecologic Oncology 99:1, 26-35
    CrossRef

  60. 60

    Gabriela Cesarman-Maus, Katherine A. Hajjar. (2005) Molecular mechanisms of fibrinolysis. British Journal of Haematology 129:3, 307-321
    CrossRef

  61. 61

    Djordje Gverić, Blanca M. Herrera, M. Louise Cuzner. (2005) tPA Receptors and the Fibrinolytic Response in Multiple Sclerosis Lesions. The American Journal of Pathology 166:4, 1143-1151
    CrossRef

  62. 62

    Shane A. Olwill, Hugh McGlynn, William S. Gilmore, H. Denis Alexander. (2005) Annexin II cell surface and mRNA expression in human acute myeloid leukaemia cell lines. Thrombosis Research 115:1-2, 109-114
    CrossRef

  63. 63

    Matthew J. Hayes, Stephen E. Moss. (2004) Annexins and disease. Biochemical and Biophysical Research Communications 322:4, 1166-1170
    CrossRef

  64. 64

    M. S. Tallman, P. Lefebvre, R. M. Baine, M. Shoji, I. Cohen, D. Green, H. C. Kwaan, E. Paietta, F. R. Rickles. (2004) Effects of all-trans retinoic acid or chemotherapy on the molecular regulation of systemic blood coagulation and fibrinolysis in patients with acute promyelocytic leukemia. Journal of Thrombosis and Haemostasis 2:8, 1341-1350
    CrossRef

  65. 65

    Ernesto Carafoli. (2004) Calcium-mediated cellular signals: a story of failures. Trends in Biochemical Sciences 29:7, 371-379
    CrossRef

  66. 66

    H. C. Kwaan, J. Wang, I. Weiss. (2004) Expression of receptors for plasminogen activators on endothelial cell surface depends on their origin. Journal of Thrombosis and Haemostasis 2:2, 306-312
    CrossRef

  67. 67

    Qi Ling, Andrew T. Jacovina, Arunkumar Deora, Maria Febbraio, Ronit Simantov, Roy L. Silverstein, Barbara Hempstead, Willie H. Mark, Katherine A. Hajjar. (2004) Annexin II regulates fibrin homeostasis and neoangiogenesis in vivo. Journal of Clinical Investigation 113:1, 38-48
    CrossRef

  68. 68

    Jigar Shah, MD, Karl Theil, MD, Matt Kalaycio, MD. (2003) Clinical Significance of Cytogenetics in Acute Leukemias. Laboratory Medicine 34:11, 796-802
    CrossRef

  69. 69

    Anna Falanga, Frederick R Rickles. (2003) Pathogenesis and management of the bleeding diathesis in acute promyelocytic leukaemia. Best Practice & Research Clinical Haematology 16:3, 463-482
    CrossRef

  70. 70

    Laurent Degos. (2003) The history of acute promyelocytic leukaemia. British Journal of Haematology 122:4, 539-553
    CrossRef

  71. 71

    E. Kalk, A. Goede, P. Rose. (2003) Acute arterial thrombosis in acute promyelocytic leukaemia. Clinical and Laboratory Haematology 25:4, 267-270
    CrossRef

  72. 72

    Anaadriana Zakarija, Hau C Kwaan. (2003) Bleeding and thrombosis in the cancer patient. Expert Review of Cardiovascular Therapy 1:2, 271-281
    CrossRef

  73. 73

    Roser Lpez-Alemany, Colin Longstaff, Stephen Hawley, Massoud Mirshahi, Pere Fbregas, Merce Jard, Elizabeth Merton, Lindsey A. Miles, Jordi Flez. (2003) Inhibition of cell surface mediated plasminogen activation by a monoclonal antibody against ?-Enolase. American Journal of Hematology 72:4, 234-242
    CrossRef

  74. 74

    Fernando Perez-Zincer, Jaya V. Juturi, Eric D. Hsi, Gerald A. Hoeltge, Lisa A. Rybicki, Matt E. Kalaycio. (2003) A Pulmonary Syndrome in Patients with Acute Myelomonocytic Leukemia and Inversion of Chromosome 16. Leukemia & Lymphoma 44:1, 103-109
    CrossRef

  75. 75

    Chih-Yuan Chung, Nicholas C. Hsu, Huey-Ching Horng, Cheng-Shyong Chang. (2003) Successful Treatment for Multiple Cerebral Hemorrhage in a Newly Diagnosed Patient with Acute Promyelocytic Leukemia. Leukemia & Lymphoma 44:6, 1059-1061
    CrossRef

  76. 76

    Carmen M. Swaisgood, Detlef Schmitt, Dan Eaton, Edward F. Plow. (2002) In vivo regulation of plasminogen function by plasma carboxypeptidase B. Journal of Clinical Investigation 110:9, 1275-1282
    CrossRef

  77. 77

    D. Carradice, N. Austin, K. Bayston, P. S. Ganly. (2002) Successful treatment of acute promyelocytic leukaemia during pregnancy. Clinical and Laboratory Haematology 24:5, 307-311
    CrossRef

  78. 78

    Zhang Xiaohui, Zhou Huarong, Xia Linghui, Shen Guanxin, Hu Yu, Wei Wenning, Song Shanjun. (2002) Effect of antisense oligonucleotide to annexin II on the t-PA-mediated plasminogen activationin vitro. Journal of Huazhong University of Science and Technology [Medical Sciences] 22:3, 183-185
    CrossRef

  79. 79

    Torbjorn Hansen. (2002) No immunosuppressive effect of transfected annexin II. APMIS 110:5, 403-409
    CrossRef

  80. 80

    Munetaka Ozeki, Shinsuke Hoshino, Hiroshi Hiai, Shinya Toyokuni. (2002) Isolation and characterization of annexin 2 pseudogene in Rattus norvegicus. Gene 289:1-2, 185-190
    CrossRef

  81. 81

    Xiaohui Zhang, Huarong Zhou, Jun Wang, Linhua Yang, Yu Hu, Guanxin Shen, Peixue Guo, Zhenhua Qiao, Shanjun Song. (2002) Arsenic trioxide, retinoic acid and Ara-c regulated the expression of annexin II on the surface of APL cells, a novel co-receptor for plasminogen/tissue plasminogen activator. Thrombosis Research 106:1, 63-70
    CrossRef

  82. 82

    Zhang Xiaohui, Zhou Huarong, Shen Guanxin, Liu Zhongping, Hu Yu, Wei Wenning, Song Shanjun. (2002) Study on the mechanism of the annexin II-mediated Co-assembly of t-PA and plasminogen. Journal of Huazhong University of Science and Technology [Medical Sciences] 22:1, 21-23
    CrossRef

  83. 83

    Franco Mandelli, Giuseppe Avvisati, Francesco Lo Coco. (2002) ADVANCESINTHE UNDERSTANDINGAND MANAGEMENTOF ACUTE PROMYELOCYTIC LEUKEMIA. Reviews in Clinical and Experimental Hematology 6:1, 60-71
    CrossRef

  84. 84

    Hau C. Kwaan, Jun Wang, Lisa N. Boggio. (2002) Abnormalities in hemostasis in acute promyelocytic leukemia. Hematological Oncology 20:1, 33-41
    CrossRef

  85. 85

    CARRIE BROWNSTEIN, DOMENICK J. FALCONE, ANDREW JACOVINA, KATHERINE A. HAJJAR. (2001) Annexin II. Annals of the New York Academy of Sciences 947:1, 143-156
    CrossRef

  86. 86

    Koji Emoto, Yukishige Yamada, Hidetomo Sawada, Heisuke Fujimoto, Masatou Ueno, Tomoyoshi Takayama, Kiyoshi Kamada, Akihiko Naito, Shuya Hirao, Yoshiyuki Nakajima. (2001) Annexin II overexpression correlates with stromal tenascin-C overexpression. Cancer 92:6, 1419-1426
    CrossRef

  87. 87

    M DESANCHO, J RAND. (2001) BLEEDING AND THROMBOTIC COMPLICATIONS IN CRITICALLY ILL PATIENTS WITH CANCER. Critical Care Clinics 17:3, 599-622
    CrossRef

  88. 88

    Peter B. Langmuir, Richard Aplenc, Beverly J. Lange. (2001) Acute myeloid leukaemia in children. Best Practice & Research Clinical Haematology 14:1, 77-93
    CrossRef

  89. 89

    Daniela Matei, Benjamin Brenner, Victor J. Marder. (2001) Acquired thrombophilic syndromes. Blood Reviews 15:1, 31-48
    CrossRef

  90. 90

    Daniel T. Baran, John M. Quail, Rahul Ray, Thomas Honeyman. (2001) Binding of 1?,25-dihydroxyvitamin D3 to annexin II: Effect of vitamin D metabolites and calcium. Journal of Cellular Biochemistry 80:2, 259-265
    CrossRef

  91. 91

    Ishan Capila, Marı́a J Hernáiz, Y.D Mo, Tanya R Mealy, B Campos, John R Dedman, Robert J Linhardt, Barbara A Seaton. (2001) Annexin V–Heparin Oligosaccharide Complex Suggests Heparan Sulfate–Mediated Assembly on Cell Surfaces. Structure 9:1, 57-64
    CrossRef

  92. 92

    Giuseppe Awisati, Francesco Lo Coco, Franco Mandelli. (2001) Acute promyelocytic leukemia: Clinical and morphologic features and prognostic factors. Seminars in Hematology 38:1, 4-12
    CrossRef

  93. 93

    Elizabeth M. Calleja, Raymond P. Warrell. (2000) Differentiating agents in pediatric malignancies: All-trans-retinoic acid and arsenic in acute promyelocytic leukemia. Current Oncology Reports 2:6, 519-523
    CrossRef

  94. 94

    Sandra L Senno, Liberto Pechet, Rodger L Bick. (2000) Disseminated Intravascular Coagulopathy (DIC): Pathophysiology, Laboratory Diagnosis, and Management. Journal of Intensive Care Medicine 15:3, 144-158
    CrossRef

  95. 95

    Peter Maslak, David Scheinberg. (2000) Targeted therapies for the myeloid leukaemias. Expert Opinion on Investigational Drugs 9:6, 1197-1205
    CrossRef

  96. 96

    KATHERINE A. HAJJAR, SUCHITRA S. ACHARYA. (2000) Annexin II and Regulation of Cell Surface Fibrinolysis. Annals of the New York Academy of Sciences 902:1, 265-271
    CrossRef

  97. 97

    Klaus T. Preissner, Peter P. Nawroth, Sandip M. Kanse. (2000) Vascular protease receptors: integrating haemostasis and endothelial cell functions. The Journal of Pathology 190:3, 360-372
    CrossRef

  98. 98

    Annette Draeger. (2000) Enigmatic annexins. Trends in Cell Biology 10:1, 38-39
    CrossRef

  99. 99

    Jonathan M. Kurie. (1999) The biologic basis for the use of retinoids in cancer prevention and treatment. Current Opinion in Oncology 11:6, 497
    CrossRef

  100. 100

    Begoña Campos, Songtao Wang, Gregory S Retzinger, Marcia A Kaetzel, Barbara A Seaton, Norman J Karin, J.David Johnson, John R Dedman. (1999) Mutation of Highly Conserved Arginine Residues Disrupts the Structure and Function of Annexin V. Archives of Medical Research 30:5, 360-367
    CrossRef

  101. 101

    Rand, Jacob H., . (1999) “Annexinopathies” — A New Class of Diseases. New England Journal of Medicine 340:13, 1035-1036
    Full Text