Original Article
Increased Frequency of Genetic Thrombophilia in Women with Complications of Pregnancy
N Engl J Med 1999; 340:9-13January 7, 1999
- Abstract
Background
Obstetrical complications such as severe preeclampsia, abruptio placentae, fetal growth retardation, and stillbirth are associated with intervillous or spiral-artery thrombosis and inadequate placental perfusion. Whether these complications are associated with an increased frequency of thrombophilic mutations is not known.
Methods
We studied 110 women who had one of the above-mentioned obstetrical complications and 110 women who had one or more normal pregnancies. The women were tested several days after delivery for the mutation of adenine to guanine at nucleotide 506 in the factor V gene (factor V Leiden), the mutation of cytosine to thymine at nucleotide 677 in the gene encoding methylenetetrahydrofolate reductase, and the mutation of guanine to adenine at nucleotide 20210 in the prothrombin gene. Two to three months after delivery the women were tested for deficiency of protein C, protein S, or antithrombin III and for the presence of anticardiolipin antibodies.
Results
The mutation at nucleotide 506 in the factor V gene was detected in 22 of the women with obstetrical complications and in 7 of the women with normal pregnancies (20 percent and 6 percent, respectively; P=0.003). Twenty-four women with complications, as compared with nine women without complications, were homozygous for the C677T mutation in the gene encoding methylenetetrahydrofolate reductase (22 percent and 8 percent, respectively; P=0.005). The G20210A mutation in the prothrombin gene was found in 11 women with complications as compared with 3 women without complications (10 percent and 3 percent, respectively; P=0.03). Overall, 57 women with obstetrical complications had a thrombophilic mutation, as compared with 19 women with normal pregnancies (52 percent and 17 percent, respectively; P<0.001). Deficiency of protein S, protein C, or antithrombin III or anticardiolipin antibodies were detected in an additional 14 women with complications, as compared with 1 woman with a normal pregnancy (13 percent and 1 percent, respectively; P<0.001).
Conclusions
Women with serious obstetrical complications have an increased incidence of mutations predisposing them to thrombosis and other inherited and acquired forms of thrombophilia.
Media in This Article
Table 1
Clinical Characteristics of the Study Women.Table 2
Prevalence of Inherited and Acquired Thrombophilia in the Study Women.Article Activity
- Article
Severe preeclampsia, abruptio placentae, fetal growth retardation, and stillbirth contribute greatly to maternal and fetal morbidity and mortality. Their causes are unknown, but all of them may be associated with abnormal placental vasculature and disturbances of hemostasis, leading to inadequate maternal–fetal circulation.1-7
Several thrombophilic mutations are associated with an increased risk of thromboembolic complications. Resistance to activated protein C caused by an adenine-to-guanine mutation at nucleotide 506 in the factor V gene (the factor V Leiden mutation) has been linked with an increased risk of venous thromboembolism.8-10 Homozygosity for the mutation of cytosine to thymine at nucleotide 677 in the gene encoding methylenetetrahydrofolate reductase results in decreased synthesis of 5-methyltetrahydrofolate, the primary methyl donor in the conversion of homocysteine to methionine, and the resulting increase in plasma homocysteine concentrations is a risk factor for venous and arterial thrombosis.11,12 A recently described guanine-to-adenine mutation at nucleotide 20210 in the prothrombin gene is associated with higher plasma concentrations of prothrombin and an increased risk of venous thromboembolism,13 myocardial infarction,14 and cerebral-vein thrombosis.15
We hypothesized that the mutations predisposing patients to thrombosis may be important risk factors for obstetrical complications that are related to inadequate maternal–fetal circulation. We therefore studied the relation between severe preeclampsia, abruptio placentae, fetal growth retardation, and stillbirth, on the one hand, and several thrombophilic mutations, on the other. We also searched for deficiency of protein S, protein C, or antithrombin III and for the presence of anticardiolipin antibodies and lupus anticoagulant, which are also associated with thrombophilia.
Methods
Study Subjects
Between September 1996 and November 1997, we studied 110 consecutive women who had pregnancies complicated by severe preeclampsia, abruptio placentae, fetal growth retardation, or stillbirth. Severe preeclampsia was defined by a blood pressure higher than 160/110 mm Hg; urinary protein excretion greater than 5 g per 24 hours; a platelet count of less than 100,000 per cubic millimeter; the combination of hemolysis, high serum aminotransferase concentrations, and a platelet count below 100,000 per cubic millimeter; or eclampsia.16 Abruptio placentae was diagnosed on the basis of clinical criteria, and only women with grade 2 or 3 abruption (abruption associated with vaginal bleeding or concealed hemorrhage; uterine tenderness; and fetal distress, maternal shock, or maternal coagulopathy) were included.6 Fetal growth retardation was defined by a birth weight below the 5th percentile for gestational age, according to the criteria of Brenner et al.17 The exclusion criteria for women whose pregnancies were complicated by fetal growth retardation were the presence of congenital malformations or chromosomal abnormalities in the fetus, recent cytomegalovirus infection (defined by the presence of IgM anticytomegalovirus antibodies or increasing titers of IgG anticytomegalovirus antibodies in paired blood samples obtained three to four weeks apart, as well as cytomegalovirus in the urine of the newborn), or drug or alcohol abuse during pregnancy. Stillbirth was defined as fetal death after 23 weeks' gestation. Exclusion criteria in cases of stillbirth were abnormal results of karyotyping of the stillborn fetus or congenital anomalies detected at autopsy, Venereal Disease Research Laboratory results positive for syphilis, positive tests for antibodies against red-cell antigens, recent cytomegalovirus infection, positive cultures for Listeria monocytogenes in samples from the fetus and placenta, and abnormal results on the oral glucose-tolerance test.
Women who had more than one complication during pregnancy (for example, severe preeclampsia and fetal growth retardation) were assigned to one of the four groups according to the following hierarchy: severe preeclampsia was considered the most important complication, followed by abruptio placentae, fetal growth retardation, and then stillbirth.
We also studied 110 women who had normal pregnancies and no history of thromboembolic complications during any pregnancy. Each of these women was matched for age and for the geographic origin of each parent with a woman with normal pregnancy. All the women were of Jewish origin and were classified as Ashkenazi, non-Ashkenazi, or mixed Ashkenazi and non-Ashkenazi according to their family origin. The study was approved by the ethics committee of the Tel Aviv Sourasky Medical Center, and informed consent was obtained from each woman. The women in both groups were enrolled while in the hospital after delivery.
At enrollment, blood was drawn from all the women for DNA analysis for thrombophilic mutations. Investigation of women whose pregnancies were complicated by fetal growth retardation or stillbirth was initiated at that time (e.g., a cytomegalovirus test and autopsy of stillborn infants were performed). The women were then asked to return at least two months after the delivery, at which time blood was drawn for the assessment of protein S, protein C, antithrombin III, anticardiolipin antibodies, and lupus anticoagulant. All the women had received prenatal care, which is covered by the health insurance mandated by law for all the citizens of Israel.
Molecular Diagnosis
Molecular diagnosis of the factor V Leiden mutation was performed as described by Brenner et al.18 The mutation in the methylenetetrahydrofolate reductase gene was detected as described by Frosst et al.11 The mutation in the prothrombin gene was detected with use of a slight modification of the method of Poort et al.13 The forward primer was 5'CAACCGCTGGTATCAAATGG3', and the reverse primer was as reported by Poort et al.13 This method yielded a DNA fragment of 253 base pairs, which was digested with Hin dIII.
Assays
Free protein S in plasma was measured with a specific enzyme-linked immunosorbent assay (Asserachrom free protein S assay, Diagnostica Stago, Asnières, France). Levels of protein C antigen and antithrombin III antigen were determined by rocket electroimmunoassay with rabbit antihuman protein C (Sigma, Rehovot, Israel) and rabbit antihuman antithrombin III (Diagnostica Stago), respectively. The antithrombin III activity in plasma was determined by a chromogenic assay (Dade Diagnostica, Munich, Germany). Levels of IgG and IgM anticardiolipin antibodies were determined with an enzyme-linked immunosorbent assay (ORGenTec, Mainz, Germany); measurement of more than 15 IgG phospholipid units was considered to be a positive result. The presence of lupus anticoagulant was determined as described elsewhere.19 For all these assays, the intraassay and interassay coefficients of variation were less than 6 percent.
Statistical Analysis
Results for the two groups were compared with use of two-tailed Student's t-tests, Fisher's exact tests, and Pearson's chi-square tests. Odds ratios and 95 percent confidence intervals were calculated. Statistical analyses were performed with the Statistical Package for the Social Sciences for Windows, version 6 (SPSS, Chicago).
Results
The characteristics of the women with obstetrical complications and those with normal pregnancies are shown in Table 1Table 1
Clinical Characteristics of the Study Women.. The gestational ages at delivery and the birth weight of the infants were significantly lower and the number of primiparous women was significantly higher in the group with complications. Of the 18 multiparous women with complications, 12 had had obstetrical complications in a previous pregnancy, 3 had had one normal pregnancy and one complicated pregnancy, and 3 had had normal pregnancies.Thirty-four of the 110 women with complications (31 percent) had severe preeclampsia, indicated by a blood pressure higher than 160/110 mm Hg in 26 women; urinary protein excretion in excess of 5 g per 24 hours in 2; a platelet count below 100,000 per cubic millimeter in 2; the combination of hemolysis, high serum aminotransferase concentrations, and a platelet count below 100,000 per cubic millimeter in 3; and eclampsia in 1. Twenty women with complications (18 percent) had abruptio placentae, of whom three also had mild preeclampsia and seven had antepartum or postpartum hypertension. Eleven of the neonates in this group had birth weights below the 10th percentile for gestational age.17 Forty-four women (40 percent) had fetuses with growth retardation; 15 of these 44 women had mild hypertension (blood pressure elevated but not greater than 150/100 mm Hg). Twelve women (11 percent) had stillbirths. Two of these women had mild hypertension.
Overall, 57 of the 110 women with obstetrical complications (52 percent) had at least one of the three thrombophilic mutations, as compared with 19 of the 110 women with normal pregnancies (17 percent; odds ratio, 5.2; 95 percent confidence interval, 2.8 to 9.6) (Table 2Table 2
Prevalence of Inherited and Acquired Thrombophilia in the Study Women.). In addition, 14 other women in the group with complications (13 percent) had other types of inherited or acquired thrombophilia, as compared with only 1 woman in the group without complications (1 percent; odds ratio, 15.9; 95 percent confidence interval, 2.0 to 123.1). Seven of the women with complications had protein S deficiency, one had protein C deficiency, and one had antithrombin III deficiency, whereas among the women with normal pregnancies, one had protein S deficiency and none were deficient in protein C or antithrombin III. Lupus anticoagulant was detected in one of five women with complications in whom the test for anticardiolipin antibodies was positive and in none of the women with uncomplicated pregnancies. The combined prevalence of all the inherited and acquired types of thrombophilia in the women with obstetrical complications was 65 percent, as compared with 18 percent in the women without complications (odds ratio, 8.2; 95 percent confidence interval, 4.4 to 15.3) (Table 2).Five women with complications and one woman with a normal pregnancy had multiple thrombophilic mutations (Table 2). Combinations of other types of thrombophilia were found in another five women in the study group and in none of the women with normal pregnancies. Each of the women with combined thrombophilia was considered only once in the statistical analysis.
The odds ratios for the prevalence of thrombophilic mutations in the women with obstetrical complications as compared with the women without complications are shown in Table 3Table 3
Prevalence of Inherited Thrombophilias in Women with Specific Obstetrical Complications, as Compared with Women with Normal Pregnancies.. The prevalence of the three mutations was 53 percent among the women with severe preeclampsia, 60 percent among those with abruptio placentae, 50 percent for women who had fetuses with growth retardation, and 42 percent for women who had stillbirths. The prevalence of all the types of inherited and acquired thrombophilia that we studied was 68 percent in women with severe preeclampsia, 70 percent in women with abruptio placentae, 61 percent in women whose fetuses had growth retardation, and 58 percent in women who had stillbirths.The 23 women with severe preeclampsia and thrombophilia delivered infants at an earlier mean (±SD) gestational age and with a lower mean birth weight than the 11 women with severe preeclampsia and no thrombophilia (gestational age, 31.7±3.8 vs. 35.1±3.6 weeks; P=0.03; birth weight, 1375±684 vs. 1975±504 g; P=0.01). There were no differences in these variables between the women with and those without thrombophilia in the other three subgroups (those with abruptio placentae, fetal growth retardation, or stillbirth).
Of the 15 multiparous women with obstetrical complications who had also had complications during previous pregnancies, thrombophilia was found in 10 (67 percent).
Discussion
In this case–control study, we found a high prevalence (52 percent) of mutations in the genes encoding factor V, methylenetetrahydrofolate reductase, and prothrombin in otherwise healthy women who had severe complications of pregnancy. The incidence of these mutations in women with normal pregnancies who were matched with the women with complications for age and the geographic origin of each parent was only 17 percent. This study included only women who had severe obstetrical complications associated with abnormalities in the maternal–fetal circulation, and none of the women had a history of a previous thromboembolic event.
The factor V Leiden mutation was detected in 20 percent of the women with obstetrical complications, as compared with 6 percent of the women without complications. The rate of 6 percent is similar to the reported incidence of this mutation in healthy white people20 and in the Israeli population.21 This mutation was significantly more prevalent in women with severe preeclampsia, abruptio placentae, or stillbirth than in the women with uncomplicated pregnancies. In previous studies, resistance to activated protein C was detected in 16 percent22 and the factor V Leiden mutation in 9 to 22 percent23-25 of women with preeclampsia. In two of these studies, the prevalence of the mutation was significantly greater in women with preeclampsia than in women without complications.23,24 Of the women with abruptio placentae or stillbirth, 25 percent had the factor V Leiden mutation. In two other studies of women who delivered stillborn infants, 17 percent and 49 percent had the factor V Leiden mutation.19,26 In our study, 11 percent of women with fetuses affected by growth retardation had the factor V Leiden mutation, a prevalence that did not differ significantly from that among women with normal pregnancies; these findings confirm an earlier report.27 The factor V Leiden mutation was recently found to be associated with a reduction in the risk of intrapartum bleeding, conferring a possible survival advantage in carriers of this mutation.27
Homozygosity for the mutation in the methylenetetrahydrofolate reductase gene was found in 22 percent of the women with obstetrical complications, as compared with 8 percent of the women with normal pregnancies. This 8 percent prevalence is similar to that reported for the Israeli population21 and other groups.11,28,29 An increase in homozygosity for the methylenetetrahydrofolate reductase mutation associated with preeclampsia was reported in Italy24 and Japan.30 Hyperhomocysteinemia was found in 31 percent of women with abruptio placentae or placental infarction, as compared with 9 percent of a control group (P<0.05).31
The recently described mutation in the prothrombin gene is associated with an increased risk of venous and arterial thromboembolism.13,14 We found the prevalence of this mutation to be 10 percent in the group with complications, as compared with 3 percent in the group without complications. The latter value is similar to that found in a study of 474 normal subjects (2 percent).13 The prothrombin mutation was significantly more frequent in women with abruptio placentae and fetal growth retardation, but not in those with severe preeclampsia.
Fourteen women with obstetrical complications had other types of inherited or acquired thrombophilia, which were diagnosed at least two months after delivery. The most frequent abnormality was protein S deficiency (seven women), which was found most often in women who had stillbirths (17 percent), as previously reported by others.26,32
Altogether, 65 percent of the women with complications had some form of inherited or acquired thrombophilia, as compared with 18 percent of the women with normal pregnancies. The presence of these abnormalities in association with hypercoagulability further supports the proposed relation between impaired placental development and perfusion and abnormal hemostasis. The known thrombotic features of placental vascular lesions and the increased risk of thrombosis associated with the presence of thrombophilia strongly suggest a cause-and-effect relation between these inherited and acquired anomalies and serious obstetrical complications.
In conclusion, our findings suggest that women with severe complications of pregnancy should be tested for markers of thrombophilia, even in the absence of a history of thromboembolism. Because these complications tend to recur6,32,33 (for instance, preeclampsia recurs at a rate of 20 percent33), the presence of thrombophilia in these women may be an important consideration in planning future pregnancies. Although it is not known whether complications of pregnancy are more likely to recur in women with thrombophilia, the high rate of recurrence found in the 15 multiparous women in our study who had obstetrical complications in previous pregnancies suggests that this possibility should be evaluated further.
Supported by a Leu-Mintz grant from the Sackler Faculty of Medicine, Tel Aviv University, Tel Aviv, Israel.
We are indebted to Eti Zwang and Ruja Eichel of the Coagulation Laboratory for their dedicated assistance in performing the thrombophilia assays, and to Eshter Eshkol for her skillful editorial assistance.
Source Information
From the Department of Obstetrics and Gynecology, Lis Maternity Hospital (M.J.K., N.S., A.M., A.B.-A., A.J., G.F., J.B.L.), and the Department of Hematology (A.E.), Tel Aviv Sourasky Medical Center, Sackler Faculty of Medicine, Tel Aviv University, Tel Aviv, Israel.
Address reprint requests to Dr. Kupferminc at the Department of Obstetrics and Gynecology, Lis Maternity Hospital, Tel Aviv Sourasky Medical Center, 6 Weizman St., Tel Aviv 64239, Israel, or at tmcobgyn@tasmc.health.gov.il.
- References
References
1
Roberts JM ,Taylor RN ,Musci TJ ,Rodgers GM ,Hubel CA ,McLaughlin MK . Preeclampsia: an endothelial cell disorder. Am J Obstet Gynecol 1989;161:1200-1204
Web of Science | Medline2
Salafia CM ,Pezzullo JC ,Lopez-Zeno JA ,Simmens S ,Minior VK ,Vintzileos AM . Placental pathologic features of preterm preeclampsia. Am J Obstet Gynecol 1995;173:1097-1105
CrossRef | Web of Science | Medline3
Shanklin DR ,Sibai BM . Ultrastructural aspects of preeclampsia. I. Placental bed and uterine boundary vessels. Am J Obstet Gynecol 1989;161:735-741
Web of Science | Medline4
Khong TY ,Pearce JM ,Robertson WB . Acute atherosis in preeclampsia: maternal determinants and fetal outcome in the presence of the lesion. Am J Obstet Gynecol 1987;157:360-363
Web of Science | Medline5
Salafia CM ,Minior VK ,Pezzullo JC ,Popek EJ ,Rosenkrantz TS ,Vintzileos AM . Intrauterine growth restriction in infants of less than thirty-two weeks' gestation: associated placental pathologic features. Am J Obstet Gynecol 1995;173:1049-1057
CrossRef | Web of Science | Medline6
Creasy RK, Resnik R, eds. Maternal-fetal medicine: principles and practice. 3rd ed. Philadelphia: W.B. Saunders, 1994:609-10.
7
Infante-Rivard C ,David M ,Gauthier R ,Rivard GE . Lupus anticoagulants, anticardiolipin antibodies, and fetal loss: a case-control study. N Engl J Med 1991;325:1063-1066
Full Text | Web of Science | Medline8
Dahlback B . Inherited resistance to activated protein C, a major cause of venous thrombosis, is due to a mutation in the factor V gene. Haemostasis 1994;24:139-151
Medline9
Bertina RM ,Koeleman BPC ,Koster T , et al. Mutation in blood coagulation factor V associated with resistance to activated protein C. Nature 1994;369:64-67
CrossRef | Web of Science | Medline10
Svensson PJ ,Dahlback B . Resistance to activated protein C as a basis for venous thrombosis. N Engl J Med 1994;330:517-522
Full Text | Web of Science | Medline11
Frosst P ,Blom HJ ,Milos R , et al. A candidate genetic risk factor for vascular disease: a common mutation in methylenetetrahydrofolate reductase. Nat Genet 1995;10:111-113
CrossRef | Web of Science | Medline12
Kluijtmans LAJ ,van den Heuvel LPWJ ,Boers GHJ , et al. Molecular genetic analysis in mild hyperhomocysteinemia: a common mutation in the methylenetetrahydrofolate reductase gene is a genetic risk factor for cardiovascular disease. Am J Hum Genet 1996;58:35-41
Web of Science | Medline13
Poort SR ,Rosendaal FR ,Reitsma PH ,Bertina RM . A common genetic variation in the 3'-untranslated region of the prothrombin gene is associated with elevated plasma prothrombin levels and an increase in venous thrombosis. Blood 1996;88:3698-3703
Web of Science | Medline14
Rosendaal FR ,Siscovick DS ,Schwartz SM ,Psaty BM ,Raghunathan TE ,Vos HL . A common prothrombin variant (20210 G to A) increases the risk of myocardial infarction in young women. Blood 1997;90:1747-1750
Web of Science | Medline15
Martinelli I ,Sacchi E ,Landi G ,Taioli E ,Duca F ,Mannucci PM . High risk of cerebral-vein thrombosis in carriers of a prothrombin-gene mutation and in users of oral contraceptives. N Engl J Med 1998;338:1793-1797
Full Text | Web of Science | Medline16
Hypertension in pregnancy. Technical bulletin no. 219. Washington, D.C.: American College of Obstetricians and Gynecologists, January 1996.
17
Brenner WE ,Edelman DA ,Hendricks CH . A standard of fetal growth for the United States of America. Am J Obstet Gynecol 1976;126:555-564
Web of Science | Medline18
Brenner B ,Zivelin A ,Lanir N ,Greengard JS ,Griffin JH ,Seligsohn U . Venous thromboembolism associated with double heterozygosity for R506Q mutation of factor V and for T298M mutation of protein C in a large family of a previously described homozygous protein C-deficient newborn with massive thrombosis. Blood 1996;88:877-880
Web of Science | Medline19
Brenner B ,Mandel H ,Lanir N , et al. Activated protein C resistance can be associated with recurrent fetal loss. Br J Haematol 1997;97:551-554
CrossRef | Web of Science | Medline20
Rees DC ,Cox M ,Clegg JB . World distribution of factor V Leiden. Lancet 1995;346:1133-1134
CrossRef | Web of Science | Medline21
Seligsohn U ,Zivelin A . Thrombophilia as a multigenic disorder. Thromb Haemost 1997;78:297-301
Web of Science | Medline22
Dekker GA ,de Vries JI ,Doelitzsch PM , et al. Underlying disorders associated with severe early-onset preeclampsia. Am J Obstet Gynecol 1995;173:1042-1048
CrossRef | Web of Science | Medline23
Dizon-Townson DS ,Nelson LM ,Easton K ,Ward K . The factor V Leiden mutation may predispose women to severe preeclampsia. Am J Obstet Gynecol 1996;175:902-905
CrossRef | Web of Science | Medline24
Grandone E ,Margaglione M ,Colaizzo D , et al. Factor V Leiden, C>T MTHFR polymorphism and genetic susceptibility to preeclampsia. Thromb Haemost 1997;77:1052-1054
Web of Science | Medline25
Lindoff C ,Ingemarsson I ,Martinsson G ,Segelmark M ,Thysell H ,Astedt B . Preeclampsia is associated with a reduced response to activated protein C. Am J Obstet Gynecol 1997;176:457-460
CrossRef | Web of Science | Medline26
Preston FE ,Rosendaal FR ,Walker ID , et al. Increased fetal loss in women with heritable thrombophilia. Lancet 1996;348:913-916
CrossRef | Web of Science | Medline27
Lindqvist PG ,Svensson PJ ,Dahlback B ,Marsal K . Factor V Q506 mutation (activated protein C resistance) associated with reduced intrapartum blood loss -- a possible evolutionary selection mechanism. Thromb Haemost 1998;79:69-73
Web of Science | Medline28
Kang S-S ,Wong PWK ,Susmano A ,Sora J ,Norusis M ,Ruggie N . Thermolabile methylenetetrahydrofolate reductase: an inherited risk factor for coronary artery disease. Am J Hum Genet 1991;48:536-545
Web of Science | Medline29
Molloy AM ,Daly S ,Mills JL , et al. Thermolabile variant of 5,10-methylenetetrahydrofolate reductase associated with low red-cell folates: implications for folate intake recommendations. Lancet 1997;349:1591-1593
CrossRef | Web of Science | Medline30
Sohda S ,Arinami T ,Hamada HM ,Yamada N ,Hamaguchi H ,Kubo T . Methylenetetrahydrofolate reductase polymorphism and pre-eclampsia. J Med Genet 1997;34:525-526
CrossRef | Web of Science | Medline31
Goddijn-Wessel TA ,Wouters MG ,van de Molen EF , et al. Hyperhomocysteinemia: a risk factor for placental abruption or infarction. Eur J Obstet Gynecol Reprod Biol 1996;66:23-29
CrossRef | Web of Science | Medline32
de Vries JI ,Dekker GA ,Huijgens PC ,Jakobs C ,Blomberg BM ,van Geijn HP . Hyperhomocysteinaemia and protein S deficiency in complicated pregnancies. Br J Obstet Gynaecol 1997;104:1248-1254
CrossRef | Medline33
Caritis S ,Sibai B ,Hauth J , et al. Low-dose aspirin to prevent preeclampsia in women at high risk. N Engl J Med 1998;338:701-705
Full Text | Web of Science | Medline
- Citing Articles (340)
Citing Articles
1
FJ Korteweg, N Folkeringa, J-LP Brouwer, JJHM Erwich, JP Holm, J van der Meer, NJGM Veeger. (2012) Fetal loss in women with hereditary thrombophilic defects and concomitance of other thrombophilic defects: a retrospective family study. BJOG: An International Journal of Obstetrics & Gynaecology 119:4, 422-430
CrossRef2
Michael J. Paidas. 2012. Inherited and Acquired Thrombophilias. , 108-120.
CrossRef3
Andrew D. Hull, Thomas R. Moore. 2012. Hypertensive Complications of Pregnancy. , 105-110.
CrossRef4
Linda Björk Helgadottir, Finn Egil Skjeldestad, Anne Flem Jacobsen, Per Morten Sandset, Eva-Marie Jacobsen. (2011) The association of antiphospholipid antibodies with intrauterine fetal death: A case–control study. Thrombosis Research
CrossRef5
Linda B. Helgadottir, Finn E. Skjeldestad, Anne F. Jacobsen, Per M. Sandset, Eva-Marie Jacobsen. (2011) The association of inherited thrombophilia and intrauterine fetal death. Blood Coagulation & Fibrinolysis 22:8, 651-656
CrossRef6
Fátima Serrano, Maria Luísa Lima, Cristina Lopes, João Paulo Almeida, Jorge Branco. (2011) Factor V Leiden and prothrombin G20210A in Portuguese women with recurrent miscarriage: is it worthwhile to investigate?. Archives of Gynecology and Obstetrics 284:5, 1127-1132
CrossRef7
Zakia Mahdy Ibrahim, Mohamed Abd Elhamid Metawie, Ahmed Mohamed El-Baz, Mohamed Ahmed El-Bahie. (2011) Methylenetetrahydrofolate C677T polymorphism and pre-eclamptic Egyptian women. Middle East Fertility Society Journal
CrossRef8
JOANNE M. SAID, JOHN R. HIGGINS, ERIC K. MOSES, SUSAN P. WALKER, PAUL T. MONAGLE, SHAUN P. BRENNECKE. (2011) Inherited thrombophilias and adverse pregnancy outcomes: a case-control study in an Australian population. Acta Obstetricia et Gynecologica Scandinavicano-no
CrossRef9
Inanc Mendilcioglu, Turker Bilgen, Yunus Arikan, Ibrahim Keser, Mehmet Simsek, Aysen Timuragaoglu. (2011) The association between inherited thrombophilias and pregnancy-related hypertension recurrence. Archives of Gynecology and Obstetrics 284:4, 837-841
CrossRef10
Cemil Kaymaz, Ahmet Demir, Ozgur Bige, Erkan Cagliyan, Dilek Cımrın, Namik Demir. (2011) Analysis of perinatal outcome by combination of first trimester maternal plasma homocysteine with uterine artery Doppler velocimetry. Prenatal Diagnosisn/a-n/a
CrossRef11
M. Di Nisio, A. W. S. Rutjes, N. Ferrante, G. M. Tiboni, F. Cuccurullo, E. Porreca. (2011) Thrombophilia and outcomes of assisted reproduction technologies: a systematic review and meta-analysis. Blood 118:10, 2670-2678
CrossRef12
Amir Kuperman, Pierpaolo Di Micco, Benjamin Brenner. (2011) Fertility, infertility and thrombophilia. Women's Health 7:5, 545-553
CrossRef13
Patrick Van Dreden, Barry Woodhams, Aurélie Rousseau, Marie Favier, Remi Favier. (2011) Comparative evaluation of Tissue factor and Thrombomodulin activity changes during normal and idiopathic early and late foetal loss: The cause of hypercoagulability?. Thrombosis Research
CrossRef14
Reiko Neki, Tomio Fujita, Koichi Kokame, Isao Nakanishi, Masako Waguri, Yuzo Imayoshi, Noriyuki Suehara, Tomoaki Ikeda, Toshiyuki Miyata. (2011) Genetic analysis of patients with deep vein thrombosis during pregnancy and postpartum. International Journal of Hematology 94:2, 150-155
CrossRef15
E. Schleußner. (2011) Mütterliche Gerinnungsstörungen. Der Gynäkologe 44:7, 515-520
CrossRef16
J. Weichert, D.R. Hartge, D.W. Lüdders, K. Diedrich, M.K. Bohlmann. (2011) Fetale Thrombophilie. Der Gynäkologe 44:7, 521-526
CrossRef17
Fabio Facchinetti, Francesca Monari. 2011. Vascular/Thrombotic. , 132-142.
CrossRef18
Michael K. Bohlmann. (2011) Effects and effectiveness of heparin in assisted reproduction. Journal of Reproductive Immunology 90:1, 82-90
CrossRef19
Christopher Franco, Melissa Walker, Julie Robertson, Brendan Fitzgerald, Sarah Keating, Anne McLeod, John C. P. Kingdom. (2011) Placental Infarction and Thrombophilia. Obstetrics & Gynecology 117:4, 929-934
CrossRef20
Hyunkyong Ahn, Jooncheol Park, Alice Gilman-Sachs, Joanne Kwak-Kim. (2011) Immunologic Characteristics of Preeclampsia, a Comprehensive Review. American Journal of Reproductive Immunology 65:4, 377-394
CrossRef21
G. Valdés, J. Corthorn. (2011) Review: The angiogenic and vasodilatory utero-placental network. Placenta 32, S170-S175
CrossRef22
Michael Kupferminc, Eli Rimon, Ariel Many, Sharon Maslovitz, Joseph B Lessing, Ronni Gamzu. (2011) Low molecular weight heparin versus no treatment in women with previous severe pregnancy complications and placental findings without thrombophilia. Blood Coagulation & Fibrinolysis 22:2, 123-126
CrossRef23
MINNA TIKKANEN. (2011) Placental abruption: epidemiology, risk factors and consequences. Acta Obstetricia et Gynecologica Scandinavica 90:2, 140-149
CrossRef24
Michael J. Kupferminc, Eli Rimon, Ariel Many, Maslovitz Sharon, Joseph B. Lessing, Ronni Gamzu. (2011) Low molecular weight heparin treatment during subsequent pregnancies of women with inherited thrombophilia and previous severe pregnancy complications. Journal of Maternal-Fetal and Neonatal Medicine1-4
CrossRef25
Sara Sedano-Balbás, Mark Lyons, Brendan Cleary, Margaret Murray, Geraldine Gaffney, Majella Maher. (2011) Acquired Activated Protein C Resistance, Thrombophilia and Adverse Pregnancy Outcomes: A Study Performed in an Irish Cohort of Pregnant Women. Journal of Pregnancy 2011, 1-9
CrossRef26
Fabio Facchinetti, Francesca Ferrari, Francesca Monari, Isabella Neri. (2011) Stillbirth: issues and new insights. Expert Review of Obstetrics & Gynecology 6:1, 93-108
CrossRef27
Jody Lynn Kujovich. (2011) Factor V Leiden thrombophilia. Genetics in Medicine 13:1, 1-16
CrossRef28
Aline D. do Prado, Deise M. Piovesan, Henrique L. Staub, Bernardo L. Horta. (2010) Association of Anticardiolipin Antibodies With Preeclampsia. Obstetrics & Gynecology 116:6, 1433-1443
CrossRef29
Michal J. Simchen, Keren Ofir, Orit Moran, Alon Kedem, Eyal Sivan, Eyal Schiff. (2010) Thrombophilic risk factors for placental stillbirth. European Journal of Obstetrics & Gynecology and Reproductive Biology 153:2, 160-164
CrossRef30
Charles J. Glueck, Joel Pranikoff, Naseer Khan, Kashif Riaz, Kirti Chavan, Pavithra Raj, Muhammad Umar, Ping Wang. (2010) High factor XI, recurrent pregnancy loss, enoxaparin. Fertility and Sterility 94:7, 2828-2831
CrossRef31
Michael J. Paidas, Christina S. Han, Nazli Hossain, Charles J. Lockwood. 2010. Inherited and Acquired Thrombophilia in Obstetrics. , 67-110.
CrossRef32
Jooske M.F. Boomsma, Richard A. van Lingen, Jim van Eyck, Pieter Tamminga, Boudewijn J. Kollen, Ruurd M. van Elburg. (2010) Short- and long-term outcome of infants born after maternal (pre)-eclampsia, HELLP syndrome and thrombophilia: a retrospective, cohort study. European Journal of Obstetrics & Gynecology and Reproductive Biology 153:1, 47-51
CrossRef33
O. Pourrat, F. Pierre. (2010) La consultation médicale après une pré-éclampsie : pourquoi ? Pour qui ? Quand ? Comment ? Pour trouver quoi ?. La Revue de Médecine Interne 31:11, 766-771
CrossRef34
Berna Haliloglu, Fehime Benli Aksungar, Aygen Celik, Erdin Ilter, Hakan Coksuer, Umit Ozekici. (2010) Negative correlation between D-dimer and homocysteine levels during pregnancy and the postpartum period: a prospective study. European Journal of Obstetrics & Gynecology and Reproductive Biology 153:1, 23-26
CrossRef35
Giovanni Larciprete, Federica Rossi, Therese Deaibess, Letizia Brienza, Giulia Barbati, Elisabetta Romanini, Stefano Gioia, Elio Cirese. (2010) Double inherited thrombophilias and adverse pregnancy outcomes: Fashion or science?. Journal of Obstetrics and Gynaecology Research 36:5, 996-1002
CrossRef36
O. Manor, I. Koupil. (2010) Birth weight of infants and mortality in their parents and grandparents: the Uppsala Birth Cohort Study. International Journal of Epidemiology 39:5, 1264-1276
CrossRef37
ERIKA F. WERNER, CHARLES J. LOCKWOOD. (2010) Thrombophilias and Stillbirth. Clinical Obstetrics and Gynecology 53:3, 617-627
CrossRef38
Fleurisca J. Korteweg, Jan Jaap H. M. Erwich, Nienke Folkeringa, Albertus Timmer, Nic J. G. M. Veeger, Joke M. Ravisé, Jozien P. Holm, Jan van der Meer. (2010) Prevalence of Parental Thrombophilic Defects After Fetal Death and Relation to Cause. Obstetrics & Gynecology 116:2, Part 1, 355-364
CrossRef39
Mohammed M Abdalla. (2010) Using heparin and low-dose aspirin in expectant management of early-onset severe preeclampsia. Expert Review of Obstetrics & Gynecology 5:4, 397-401
CrossRef40
Leena M. Hiltunen, Hannele Laivuori, Anna Rautanen, Risto Kaaja, Juha Kere, Tom Krusius, Mikko Paunio, Vesa Rasi. (2010) Factor V Leiden as risk factor for unexplained stillbirth – a population-based nested case-control study. Thrombosis Research 125:6, 505-510
CrossRef41
S Bianca, N Cutuli, M Bianca, B Barrano, A Cataliotti, C Barone, L Indaco, G Milana. (2010) Hereditary haemorrhagic telangiectasia and genetic thrombophilia. European Journal of Human Genetics 18:4, 405-405
CrossRef42
Haytham Dimashkieh, Tihana Rumboldt, Mary S. Richardson, Janice M. Lage. (2010) Clinical and Pathologic Features of Placental Abruption. Pathology Case Reviews 15:2, 45-49
CrossRef43
Peggy Walker, Anthony R. Gregg. (2010) Screening, Testing, or Personalized Medicine: Where do Inherited Thrombophilias Fit Best?. Obstetrics and Gynecology Clinics of North America 37:1, 87-107
CrossRef44
Muglia, Louis J., Katz, Michael, . (2010) The Enigma of Spontaneous Preterm Birth. New England Journal of Medicine 362:6, 529-535
Full Text45
Andra H. James. (2010) Pregnancy and thrombotic risk. Critical Care Medicine 38, S57-S63
CrossRef46
Joanne M. Said, John R. Higgins, Eric K. Moses, Susan P. Walker, Anthony J. Borg, Paul T. Monagle, Shaun P. Brennecke. (2010) Inherited Thrombophilia Polymorphisms and Pregnancy Outcomes in Nulliparous Women. Obstetrics & Gynecology 115:1, 5-13
CrossRef47
Maria Teresa DeSancho, Nickisha Berlus, Paul J Christos, Jacob Rand. (2010) Risk factors for clinical manifestations in carriers of Factor V Leiden and prothrombin gene mutations. Blood Coagulation & Fibrinolysis 21:1, 11-15
CrossRef48
Patrizia Ferroni, Francesca La Farina, Raffaele Palmirotta, Francesca Martini, Valeria Raparelli, Carmen Nigro, Silvia Riondino, Maria Rita Rampini, Stefania Basili, Fiorella Guadagni. (2010) Predictive value of thrombopath determination in women with infertility and pregnancy complications. Clinica Chimica Acta 411:1-2, 37-42
CrossRef49
Eric Verspyck, Jeanne-Yvonne Borg, Horace Roman, Bernard Thobois, Patrick Pia, Loïc Marpeau. (2010) Hereditary thrombophilia and recurrence of ischemic placental disease. American Journal of Obstetrics and Gynecology 202:1, 54.e1-54.e5
CrossRef50
Thomas S. Price, Tilo Grosser, Robert Plomin, Sara R. Jaffee. (2010) Fetal Genotype for the Xenobiotic Metabolizing Enzyme NQO1 Influences Intrauterine Growth Among Infants Whose Mothers Smoked During Pregnancy. Child Development 81:1, 101-114
CrossRef51
Susan Murin, Kathryn Bilello, Lisa Moores, Aaron Holley. 2010. Gender Issues in Venous Thromboembolism. , 225-243.
CrossRef52
Min Li, S. Joseph Huang. (2009) Innate immunity, coagulation and placenta-related adverse pregnancy outcomes. Thrombosis Research 124:6, 656-662
CrossRef53
Tsunenobu Tamura, Mary Picciano, Michelle McGuire. 2009. Folate in Pregnancy and Lactation. , 111-131.
CrossRef54
Jeanie L.Y. Cheong, Frances M. Cowan. (2009) Neonatal arterial ischaemic stroke: obstetric issues. Seminars in Fetal and Neonatal Medicine 14:5, 267-271
CrossRef55
Edward E. Winger, Jane L. Reed. (2009) ORIGINAL ARTICLE: A Retrospective Analysis of Fondaparinux Versus Enoxaparin Treatment in Women with Infertility or Pregnancy Loss. American Journal of Reproductive Immunology 62:4, 253-260
CrossRef56
Santiago L. Bongiovanni, Maximiliano Ranalletta, Agustin Guala, Gaston D. Maignon. (2009) Case Reports: Heritable Thrombophilia Associated with Deep Venous Thrombosis after Shoulder Arthroscopy. Clinical Orthopaedics and Related Research® 467:8, 2196-2199
CrossRef57
V. Romanelli, A. Belinchón, A. Campos-Barros, K.E. Heath, S. García-Miñaur, V. Martínez-Glez, R. Palomo, G. Mercado, R. Gracia, P. Lapunzina. (2009) CDKN1C Mutations in HELLP/Preeclamptic Mothers of Beckwith–Wiedemann Syndrome (BWS) Patients. Placenta 30:6, 551-554
CrossRef58
Rita Santoro, Piergiorgio Iannaccaro, Simona Prejanò, Gaetano Muleo. (2009) Efficacy and safety of the long-term administration of low-molecular-weight heparins in pregnancy. Blood Coagulation & Fibrinolysis 20:4, 240-243
CrossRef59
WILLIAM R. BROWN. (2009) Association of Preterm Birth With Brain Malformations. Pediatric Research 65:6, 642-646
CrossRef60
Ramiro A Sanchez, Miryam Ayala, Hugo Baglivo, Carlos Velazquez, Guillermo Burlando, Oswaldo Kohlmann, Jorge Jimenez, Patricio López Jaramillo, Ayrton Brandao, Gloria Valdes, Luis Alcocer, Mario Bendersky, Agustín José Ramirez, Alberto Zanchetti. (2009) Latin American guidelines on hypertension*. Journal of Hypertension 27:5, 905-922
CrossRef61
Petar D Ivanov, Regina S Komsa-Penkova, Emiliana I Konova, Katia S Kovacheva, Maria N Simeonova, Jordan D Popov. (2009) Association of inherited thrombophilia with embryonic and postembryonic recurrent pregnancy loss. Blood Coagulation & Fibrinolysis 20:2, 134-140
CrossRef62
E. PASQUIER, C. BOHEC, D. MOTTIER, S. JAFFUEL, B. MERCIER, C. FÉREC, M. COLLET, L. DE SAINT MARTIN. (2009) Inherited thrombophilias and unexplained pregnancy loss: an incident case-control study. Journal of Thrombosis and Haemostasis 7:2, 306-311
CrossRef63
Susan R. Kahn, Robert Platt, Helen McNamara, Rima Rozen, Moy Fong Chen, Jacques Genest, Lise Goulet, John Lydon, Louise Seguin, Clement Dassa, André Masse, Guylaine Asselin, Alice Benjamin, Louise Miner, Antoinette Ghanem, Michael S. Kramer. (2009) Inherited thrombophilia and preeclampsia within a multicenter cohort: the Montreal Preeclampsia Study. American Journal of Obstetrics and Gynecology 200:2, 151.e1-151.e9
CrossRef64
Stef Kaandorp, Marcello Di Nisio, Mariette Goddijn, Saskia Middeldorp, Stef Kaandorp. 2009. Aspirin or anticoagulants for treating recurrent miscarriage in women without antiphospholipid syndrome. .
CrossRef65
M.K. Bohlmann, D.W. Luedders, J. Weichert, K. Baumann, M. Thill, K. Diedrich, E. Schleussner, A. Hornemann. (2009) Thrombophile Gerinnungsstörungen als Risikofaktoren für habituelle Aborte. Der Gynäkologe 42:1, 17-24
CrossRef66
Ingrid Pabinger. (2009) Thrombophilia and its impact on pregnancy. Thrombosis Research 123, S16-S21
CrossRef67
Ganga Ramidi, Naseer Khan, Charles J. Glueck, Ping Wang, Naila Goldenberg. (2009) Enoxaparin-metformin and enoxaparin alone may safely reduce pregnancy loss. Translational Research 153:1, 33-43
CrossRef68
Philippe Merviel, Emmanuelle Lourdel, Rosalie Cabry, Véronique Boulard, Mélanie Brzakowski, Pauline Demailly, Françoise Brasseur, Henri Copin, Aviva Devaux. (2009) Physiopathology of human embryonic implantation: clinical incidences. Folia Histochemica et Cytobiologica 47:5, S25-S34
CrossRef69
A.-S. Ducloy-Bouthors. 2009. Hémostase et prééclampsie. , 205-236.
CrossRef70
Louise Kenny, Philip N. Baker, F. Gary Cunningham. 2009. Platelets, Coagulation, and the Liver. , 335-351.
CrossRef71
Joanne M. SAID, Shaun P. BRENNECKE, Eric K. MOSES, Susan P. WALKER, Paul T. MONAGLE, Janine CAMPBELL, Valerie J. BRYANT, Anthony J. BORG, John R. HIGGINS. (2008) The prevalence of inherited thrombophilic polymorphisms in an asymptomatic Australian antenatal population. Australian and New Zealand Journal of Obstetrics and Gynaecology 48:6, 536-541
CrossRef72
Andra H James. (2008) Thromboembolism in pregnancy: recurrence risks, prevention and management. Current Opinion in Obstetrics and Gynecology 20:6, 550-556
CrossRef73
Anne L. Dunlop, Brian W. Jack, Joseph N. Bottalico, Michael C. Lu, Andra James, Cynthia S. Shellhaas, Lynne Haygood-Kane Hallstrom, Benjamin D. Solomon, W. Gregory Feero, M. Kathryn Menard, Mona R. Prasad. (2008) The clinical content of preconception care: women with chronic medical conditions. American Journal of Obstetrics and Gynecology 199:6, S310-S327
CrossRef74
Ozgur Dundar, Pinar Yoruk, Levent Tutuncu, Alev Akyol Erikci, Murat Muhcu, Ali Rustu Ergur, Vedat Atay, Ercument Mungen. (2008) Longitudinal study of platelet size changes in gestation and predictive power of elevated MPV in development of pre-eclampsia. Prenatal Diagnosis 28:11, 1052-1056
CrossRef75
Navneet Gogia, Geoffrey A. Machin. (2008) Maternal Thrombophilias Are Associated with Specific Placental Lesions. Pediatric and Developmental Pathology 11:6, 424-429
CrossRef76
T. DUDDING, J. HERON, A. THAKKINSTIAN, E. NURK, J. GOLDING, M. PEMBREY, S. M. RING, J. ATTIA, R. J. SCOTT. (2008) Factor V Leiden is associated with pre-eclampsia but not with fetal growth restriction: a genetic association study and meta-analysis. Journal of Thrombosis and Haemostasis 6:11, 1868-1875
CrossRef77
Denise L.F. Furness, Michael F. Fenech, Yee T. Khong, Roberto Romero, Gustaaf A. Dekker. (2008) One-carbon metabolism enzyme polymorphisms and uteroplacental insufficiency. American Journal of Obstetrics and Gynecology 199:3, 276.e1-276.e8
CrossRef78
Sonal Vora, Shrimati Shetty, Kanjaksha Ghosh. (2008) Thrombophilic dimension of recurrent fetal loss in Indian patients. Blood Coagulation & Fibrinolysis 19:6, 581-584
CrossRef79
Azim Nejatizadeh, Tsering Stobdan, Neena Malhotra, M. A. Qadar Pasha. (2008) The Genetic Aspects of Pre-eclampsia: Achievements and Limitations. Biochemical Genetics 46:7-8, 451-479
CrossRef80
Aiko Makino, Mayumi Sugiura-Ogasawara. (2008) Anticoagulant therapy and pregnancy. Reproductive Medicine and Biology 7:1, 1-10
CrossRef81
Nikos Zdoukopoulos, Elias Zintzaras. (2008) Genetic Risk Factors for Placental Abruption. Epidemiology 19:2, 309-323
CrossRef82
Marina Karakantza, Georgios Androutsopoulos, Athina Mougiou, Georgios Sakellaropoulos, Georgios Kourounis, Georgios Decavalas. (2008) Inheritance and perinatal consequences of inherited thrombophilia in Greece. International Journal of Gynecology & Obstetrics 100:2, 124-129
CrossRef83
Sabine Mütze, Sabine Rudnik-Schöneborn, Klaus Zerres, Werner Rath. (2008) Genes and the preeclampsia syndrome. Journal of Perinatal Medicine 36:1, 38-58
CrossRef84
N. Özbeka
, F.B. Ataçb,, H. Verdib, S. Çetintaşa, B. Gürakan, A. Haberald. (2008) Relationship between small-for-gestational age births and maternal thrombophilic mutations. Thrombosis Research 122:2, 175-178
CrossRef85
Benjamin Brenner, Anat Aharon. (2007) Thrombophilia and Adverse Pregnancy Outcome. Clinics in Perinatology 34:4, 527-541
CrossRef86
Saad Jamshed, Peter Kouides, Ronald Sham, Stewart Cramer. (2007) Pathology of Thrombotic Thrombocytopenic Purpura in the Placenta, with Emphasis on the “Snowman Sign”. Pediatric and Developmental Pathology 10:6, 455-462
CrossRef87
Adam J. Duhl, Michael J. Paidas, Serdar H. Ural, Ware Branch, Holly Casele, Joan Cox-Gill, Sheri Lynn Hamersley, Thomas M. Hyers, Vern Katz, Randall Kuhlmann, Edith A. Nutescu, James A. Thorp, James L. Zehnder. (2007) Antithrombotic therapy and pregnancy: consensus report and recommendations for prevention and treatment of venous thromboembolism and adverse pregnancy outcomes. American Journal of Obstetrics and Gynecology 197:5, 457.e1-457.e21
CrossRef88
D. TORMENE, V. DE STEFANO, E. GRANDONE, T. ZA, M. PERLATI, E. ROSSI, M. MARGAGLIONE, P. SIMIONI. (2007) The G20210A prothrombin variant and the risk of venous thromboembolism or fetal loss in pregnant women: a family study. Journal of Thrombosis and Haemostasis 5:11, 2193-2196
CrossRef89
Arianna Pacchiarotti, Mohamed A. Mohamed, Giulietta Micara, Antonella Linari, Daniela Tranquilli, Salomè B. Espinola, Cesare Aragona. (2007) The possible role of hyperhomocysteinemia on IVF outcome. Journal of Assisted Reproduction and Genetics 24:10, 459-462
CrossRef90
Adi Y. Weintraub, Eyal Sheiner. (2007) Anticoagulant therapy and thromboprophylaxis in patients with thrombophilia. Archives of Gynecology and Obstetrics 276:6, 567-571
CrossRef91
Cande V. Ananth, Morgan R. Peltier, Celeste De Marco, Denise A. Elsasser, Darios Getahun, Rima Rozen, John C. Smulian. (2007) Associations between 2 polymorphisms in the methylenetetrahydrofolate reductase gene and placental abruption. American Journal of Obstetrics and Gynecology 197:4, 385.e1-385.e7
CrossRef92
Young-Hoo Kim, Jeong-Hyun Yoo, Jun-Shik Kim. (2007) Factors Leading to Decreased Rates of Deep Vein Thrombosis and Pulmonary Embolism After Total Knee Arthroplasty. The Journal of Arthroplasty 22:7, 974-980
CrossRef93
Jane Cleary-Goldman, Barbara Bettes, Julian N. Robinson, Errol Norwitz, Jay Schulkin. (2007) Thrombophilia and the Obstetric Patient. Obstetrics & Gynecology 110:3, 669-674
CrossRef94
Asli Somunkiran, Ismail Ozdemir, Yavuz Demiraran, Oguz Yucel. (2007) B-Lynch suture after the failure of hypogastric artery ligation to control post-partum hemorrhage due to placenta increta in a patient with the factor V Leiden mutation. Journal of Obstetrics and Gynaecology Research 33:4, 557-560
CrossRef95
Giovanni Larciprete, Stefano Gioia, Piero A. Angelucci, Federica Brosio, Giulia Barbati, Giulio P. Angelucci, Maria G. Frigo, Federico Baiocco, Maria Elisabetta Romanini, Domenico Arduini, Elio Cirese. (2007) Single inherited thrombophilias and adverse pregnancy outcomes. Journal of Obstetrics and Gynaecology Research 33:4, 423-430
CrossRef96
Martin PROCHÁZKA, Marek LUBUŠKÝ, Luděk SLAVÍK, Petr HRACHOVEC, Petr ZIELINA, Milan KUDELA, Pelle G. LINDQVIST. (2007) Frequency of selected thrombophilias in women with placental abruption. Australian and New Zealand Journal of Obstetrics and Gynaecology 47:4, 297-301
CrossRef97
John F Visintine. 2007. Abruptio placentae. , 195-200.
CrossRef98
Mrinal M Patnaik, Tufia Haddad, Colleen T Morton. (2007) Pregnancy and thrombophilia. Expert Review of Cardiovascular Therapy 5:4, 753-765
CrossRef99
X.Q. Zhang, C. Craven, L. Nelson, M.W. Varner, K.J. Ward. (2007) Placental Abruption Is More Frequent in Women with the Angiotensinogen Thr235 Mutation. Placenta 28:7, 616-619
CrossRef100
Elizabeth Varga. (2007) Inherited Thrombophilia: Key Points for Genetic Counseling. Journal of Genetic Counseling 16:3, 261-277
CrossRef101
Howard JA Carp. 2007. Obstetric outcomes after recurrent pregnancy loss. , 231-242.
CrossRef102
Aida Inbal, Howard JA Carp. 2007. Defects in coagulation factors leading to recurrent pregnancy loss. , 127-138.
CrossRef103
Wendy L. Kinzler, Lillian Kaminsky. (2007) Fetal Growth Restriction and Subsequent Pregnancy Risks. Seminars in Perinatology 31:3, 126-134
CrossRef104
Andra H. James, Chad A. Grotegut, Leo R. Brancazio, Haywood Brown. (2007) Thromboembolism in Pregnancy: Recurrence and Its Prevention. Seminars in Perinatology 31:3, 167-175
CrossRef105
Adi Y Weintraub, Fernanda Press, Arnon Wiznitzer, Eyal Sheiner. (2007) Maternal thrombophilia and adverse pregnancy outcomes. Expert Review of Obstetrics & Gynecology 2:2, 203-216
CrossRef106
Marc Zumberg, Craig S. Kitchens. 2007. Venous Thromboses at Unusual Sites. , 257-280.
CrossRef107
Jody L. Kujovich, Barbara M. Alving. 2007. Management of Thrombophilia and Antiphospholipid Syndrome During Pregnancy. , 593-609.
CrossRef108
ROBERT M. SILVER, JENNIFER E. WARREN. (2006) Preconception Counseling for Women With Thrombophilia. Clinical Obstetrics and Gynecology 49:4, 906-919
CrossRef109
CAROLINE L. STELLA, BAHA M. SIBAI. (2006) Thrombophilia and Adverse Maternal-Perinatal Outcome. Clinical Obstetrics and Gynecology 49:4, 850-860
CrossRef110
Burak Beksa??, Alejandro Gonz??lez Della Valle, Eduardo A Salvati. (2006) Thromboembolic Disease after Total Hip Arthroplasty. Clinical Orthopaedics and Related Research 453, 211-224
CrossRef111
M. Tanaka, G. Jaamaa, M. Kaiser, E. Hills, A. Soim, M. Zhu, I. Y. Shcherbatykh, R. Samelson, E. Bell, M. Zdeb, L.-A. McNutt. (2006) Racial Disparity in Hypertensive Disorders of Pregnancy in New York State: A 10-Year Longitudinal Population-Based Study. American Journal of Public Health 97:1, 163-170
CrossRef112
Stephanie M. Engel, Andrew F. Olshan, Anna Maria Siega-Riz, David A. Savitz, Stephen J. Chanock. (2006) Polymorphisms in folate metabolizing genes and risk for spontaneous preterm and small-for-gestational age birth. American Journal of Obstetrics and Gynecology 195:5, 1231.e1-1231.e11
CrossRef113
Maria Grazia Andreassi, Nicoletta Botto, Silvia Maffei. (2006) Factor V Leiden, prothrombin G20210A substitution and hormone therapy: indications for molecular screening testing / Faktor-V-Leiden, Prothrombin G20210A Substitution und Hormontherapie: Indikationen für molekulare Screening Tests. LaboratoriumsMedizin 30:5, 317-325
CrossRef114
Cyle S. Goodman, Carolyn B. Coulam, Rajasingam S. Jeyendran, Vida A. Acosta, Roumen Roussev. (2006) Which Thrombophilic Gene Mutations are Risk Factors for Recurrent Pregnancy Loss?. American Journal of Reproductive Immunology 56:4, 230-236
CrossRef115
Laila F. Zahed, Roni F. Rayes, Rami A. Mahfouz, Ali T. Taher, Huda H. Maarouf, Anwar H. Nassar. (2006) Prevalence of factor V Leiden, prothrombin and methylene tetrahydrofolate reductase mutations in women with adverse pregnancy outcomes in Lebanon. American Journal of Obstetrics and Gynecology 195:4, 1114-1118
CrossRef116
Yinka Oyelese, Cande V. Ananth. (2006) Placental Abruption. Obstetrics & Gynecology 108:4, 1005-1016
CrossRef117
B BRENNER. (2006) Thrombophilia and Adverse Pregnancy Outcome. Obstetrics and Gynecology Clinics of North America 33:3, 443-456
CrossRef118
H CARP. (2006) Thrombophilia and Recurrent Pregnancy Loss. Obstetrics and Gynecology Clinics of North America 33:3, 429-442
CrossRef119
Marco De Santis, A.F. Cavaliere, G. Straface, E. Di Gianantonio, A. Caruso. (2006) Inherited and acquired thrombophilia: Pregnancy outcome and treatment. Reproductive Toxicology 22:2, 227-233
CrossRef120
Mieczysław Uszyński, Ewa Żekanowska, Marcin Kotzbach, Waldemar Uszyński, Roman Kotzbach. (2006) Protein C, protein S, and thrombomodulin in amniotic fluid. A preliminary study. Journal of Perinatal Medicine 34:4, 289-292
CrossRef121
Lin Wang, Yan Feng, Yan Zhang, Huanyu Zhou, Shanqun Jiang, Tianhua Niu, Lee-Jen Wei, Xin Xu, Xiping Xu, Xiaobin Wang. (2006) Prolylcarboxypeptidase gene, chronic hypertension, and risk of preeclampsia. American Journal of Obstetrics and Gynecology 195:1, 162-171
CrossRef122
Yong-Soo Kim, Myung-Sun Kim, Sook-Hwan Lee, Bum-Chae Choi, Jeong-Mook Lim, Kwang Yul Cha, Kwang-Hyun Baek. (2006) Proteomic analysis of recurrent spontaneous abortion: Identification of an inadequately expressed set of proteins in human follicular fluid. PROTEOMICS 6:11, 3445-3454
CrossRef123
Adi Y. Weintraub, Eyal Sheiner, Amalia Levy, Ronit Yerushalmi, Moshe Mazor. (2006) Pregnancy complications in women with inherited thrombophilia. Archives of Gynecology and Obstetrics 274:3, 125-129
CrossRef124
S. DANCKWARDT, K. HARTMANN, B. KATZ, M. W. HENTZE, Y. LEVY, R. EICHELE, V. DEUTSCH, A. E. KULOZIK, O. BEN-TAL. (2006) The prothrombin 20209 CT mutation in Jewish-Moroccan Caucasians: molecular analysis of gain-of-function of 3' end processing. Journal of Thrombosis and Haemostasis 4:5, 1078-1085
CrossRef125
Carolyn B. Coulam, Rajasinqam S. Jeyendran, Laurence A. Fishel, Roumen Roussev. (2006) Multiple Thrombophilic Gene Mutations Rather than Specific Gene Mutations are Risk Factors for Recurrent Miscarriage. American Journal of Reproductive Immunology 55:5, 360-368
CrossRef126
Maria Grazia Andreassi, Nicoletta Botto, Silvia Maffei. (2006) Factor V Leiden, prothrombin G20210A substitution and hormone therapy: indications for molecular screening. Clinical Chemistry and Laboratory Medicine 44:5, 514-521
CrossRef127
Marc E.A. Spaanderman, Marianne Schippers, Fedde van der Graaf, Henricus J.M. Thijssen, Ing Han Liem, Louis L.H. Peeters. (2006) Subclinical signs of vascular damage relate to enhanced platelet responsiveness among nonpregnant formerly preeclamptic women. American Journal of Obstetrics and Gynecology 194:3, 855-860
CrossRef128
Kanjaksha Ghosh, Sonal Vora, Shrimati Shetty. (2006) Thrombophilia and pregnancy loss—Picking up a needle from the haystack!. American Journal of Obstetrics and Gynecology 194:3, 900
CrossRef129
McDonald K. Horne, Donna Jo McCloskey. (2006) Factor V Leiden as a Common Genetic Risk Factor for Venous Thromboembolism. Journal of Nursing Scholarship 38:1, 19-25
CrossRef130
Ichiro Sato, Tomohiro Nakayama, Aya Maruyama, Kiyohide Furuya, Naoyuki Sato, Yoshihiro Mizutani, Tatsuo Yamamoto. (2006) Study of Association Between Hypertensive Disorders of Pregnancy and the Human Coagulation Factor XI Gene. Hypertension in Pregnancy 25:1, 21-31
CrossRef131
L. Robertson, O. Wu, P. Langhorne, S. Twaddle, P. Clark, G. D. O. Lowe, I. D. Walker, M. Greaves, I. Brenkel, L. Regan, I. A. Greer, . (2006) Thrombophilia in pregnancy: a systematic review. British Journal of Haematology 132:2, 171-196
CrossRef132
Tuuli Metsvaht, Toomas Hermlin, Hartmut Kern, Tiina Kahre, Joel Starkopf. (2006) Aortic Arch Thrombosis in a Neonate With Heterozygous Carrier Status of Factor V Leiden Mutation. Congenital Heart Disease 1:1-2, 40-45
CrossRef133
Urania Magriples, Tulin Ozcan, Anita Karne, Joshua Abbott Copel. (2006) The effect of anticoagulation on antenatal ultrasound findings in pregnant women with thrombophilia. Journal of Maternal-Fetal and Neonatal Medicine 19:1, 27-30
CrossRef134
Eduardo A Salvati, Alejandro Gonz??lez Della Valle, Geoffrey H Westrich, Adam J Rana, Lawrence Specht, Babette B Weksler, Ping Wang, Charles J Glueck. (2005) THE JOHN CHARNLEY AWARD: Heritable Thrombophilia and Development of Thromboembolic Disease after Total Hip Arthroplasty. Clinical Orthopaedics and Related Research 441:&NA;, 40-55
CrossRef135
Marina Noris, Norberto Perico, Giuseppe Remuzzi. (2005) Mechanisms of Disease: pre-eclampsia. Nature Clinical Practice Nephrology 1:2, 98-114
CrossRef136
Florence Bretelle, Dominique Arnoux, Raha Shojai, Claude D'Ercole, José Sampol, Françoise Dignat, Laurence Camoin-Jau. (2005) Protein Z in patients with pregnancy complications. American Journal of Obstetrics and Gynecology 193:5, 1698-1702
CrossRef137
Jaume Alijotas-Reig, Juan Carlos Ferrer-Raventós. (2005) Trombofilia congénita y aborto recurrente: estrategias diagnósticas y recomendaciones terapéuticas. Medicina Clínica 125:16, 626-631
CrossRef138
Anna-Karin Wikstrom, Bengt Haglund, Matts Olovsson, Solveig Norden Lindeberg. (2005) The risk of maternal ischaemic heart disease after gestational hypertensive disease. BJOG: An International Journal of Obstetrics and Gynaecology 112:11, 1486-1491
CrossRef139
Catherine S. Gibson, Alastair H. MacLennan, William M. Hague, Eric A. Haan, Kevin Priest, Annabelle Chan, Gustaaf A. Dekker. (2005) Associations between inherited thrombophilias, gestational age, and cerebral palsy. American Journal of Obstetrics and Gynecology 193:4, 1437.e1-1437.e12
CrossRef140
A. AHARON, N. LANIR, A. DRUGAN, B. BRENNER. (2005) Placental TFPI is decreased in gestational vascular complications and can be restored by maternal enoxaparin treatment. Journal of Thrombosis and Haemostasis 3:10, 2355-2357
CrossRef141
B. Brenner. (2005) Thrombophilia and pregnancy. Hematology 10:4, 186-189
CrossRef142
Donna Dizon-Townson, Connie Miller, Baha Sibai, Catherine Y. Spong, Elizabeth Thom, George Wendel, Katharine Wenstrom, Philip Samuels, Margaret A. Cotroneo, Atef Moawad, Yoram Sorokin, Paul Meis, Menachem Miodovnik, Mary J. O’Sullivan, Deborah Conway, Ronald J. Wapner, Steven G. Gabbe. (2005) The Relationship of the Factor V Leiden Mutation and Pregnancy Outcomes for Mother and Fetus. Obstetrics & Gynecology 106:3, 517-524
CrossRef143
Benjamin Brenner, Jacob Bar, Martin Ellis, Ilan Yarom, David Yohai, Aaron Samueloff. (2005) Effects of enoxaparin on late pregnancy complications and neonatal outcome in women with recurrent pregnancy loss and thrombophilia: results from the Live-Enox study. Fertility and Sterility 84:3, 770-773
CrossRef144
Elizabeth A. Chalmers. (2005) Perinatal stroke - risk factors and management. British Journal of Haematology 130:3, 333-343
CrossRef145
Manoj Kumar Pandey, Reena Rani, Suraksha Agrawal. (2005) An update in recurrent spontaneous abortion. Archives of Gynecology and Obstetrics 272:2, 95-108
CrossRef146
I. PABINGER, R. VORMITTAG. (2005) Thrombophilia and pregnancy outcomes. Journal of Thrombosis and Haemostasis 3:8, 1603-1610
CrossRef147
C. J. M. Groot, A. Franx, E. A. P. Steegers. (2005) Trombofilie en zwangerschap. Tijdschrift voor kindergeneeskunde 73:4, 130-135
CrossRef148
Hamisu M. Salihu, Brigitte Bekan, Muktar H. Aliyu, Dwight J. Rouse, Russell S. Kirby, Greg R. Alexander. (2005) Perinatal mortality associated with abruptio placenta in singletons and multiples. American Journal of Obstetrics and Gynecology 193:1, 198-203
CrossRef149
Amy E. Sullivan, Lesa Nelson, Juhree A. Rice, T. Flint Porter, D. Ware Branch, Robert M. Silver. (2005) The Factor V Leiden and the G20210A Prothrombin Gene Mutations are Rare in Women with Fetal Death. American Journal of Reproductive Immunology 54:1, 1-4
CrossRef150
Benjamin Brenner. (2005) Thrombophilia in pregnancy and its role in abortion. Women's Health 1:1, 35-38
CrossRef151
I.P. Dávalos, M.C. Moran, E. Martínez-Abundis, M. González-Ortiz, S.E. Flores-Martínez, V. Machorro, L. Sandoval, L.E. Figuera, J.P. Mena, J.M. Oliva, J.A. Tlacuilo-Parra, J. Sánchez-Corona, M. Salazar-Páramo. (2005) Methylenetetrahydrofolate reductase C677T polymorphism and Factor V Leiden variant in Mexican women with preeclampsia/eclampsia. Blood Cells, Molecules, and Diseases 35:1, 66-69
CrossRef152
Michael J Kupferminc. (2005) Thrombophilia and Preeclampsia: The Evidence So Far. Clinical Obstetrics and Gynecology 48:2, 406-415
CrossRef153
Dorothy-Jo Jordaan, Martinus Gerhardus Schoon, Philip Nel Badenhorst. (2005) Thrombophilia Screening in Pregnancy. Obstetrical & Gynecological Survey 60:6, 394-404
CrossRef154
Patricio López-Jaramillo, Ronald G García, Marcos López. (2005) Preventing pregnancy-induced hypertension: are there regional differences for this global problem?. Journal of Hypertension 23:6, 1121-1129
CrossRef155
Michael J. Paidas, De-Hui W. Ku, Jens Langhoff-Roos, Yale S. Arkel. (2005) Inherited Thrombophilias and Adverse Pregnancy Outcome: Screening and Management. Seminars in Perinatology 29:3, 150-163
CrossRef156
Claire Infante-Rivard, Georges-Etienne Rivard, Marguerite Guiguet, Robert Gauthier. (2005) Thrombophilic Polymorphisms and Intrauterine Growth Restriction. Epidemiology 16:3, 281-287
CrossRef157
Karin Zetterstrom, Solveig Norden Lindeberg, Bengt Haglund, Ulf Hanson. (2005) Maternal complications in women with chronic hypertension: a population-based cohort study. Acta Obstetricia et Gynecologica Scandinavica 84:5, 419-424
CrossRef158
M Di Nisio, LW Peters, S Middeldorp, Saskia Middeldorp. 2005. Aspirin or anticoagulants for the treatment of recurrent miscarriage in women without antiphospholipid syndrome. .
CrossRef159
Adi Y. Weintraub, Eyal Sheiner, Asher Bashiri, Ilana Shoham-Vardi, Moshe Mazor. (2005) Is there a higher prevalence of pregnancy complications in a live-birth preceding the appearance of recurrent abortions?. Archives of Gynecology and Obstetrics 271:4, 350-354
CrossRef160
Vincenzo Zanardo, Valentina Savio, Gavasso Sabrina, Malida Franzoi, Patrizia Zerbinati, Mariangela Fadin, Giulio Tognin, Daniela Tormene, Antonio Pagnan, Paolo Simioni. (2005) The effect of pre-eclampsia on the levels of coagulation and fibrinolysis factors in umbilical cord blood of newborns. Blood Coagulation & Fibrinolysis 16:3, 177-181
CrossRef161
A. GERHARDT, T. W. GOECKE, M. W. BECKMANN, K. J. WAGNER, B. TUTSCHEK, R. WILLERS, H-G. BENDER, R. E. SCHARF, R. B. ZOTZ. (2005) The G20210A prothrombin-gene mutation and the plasminogen activator inhibitor (PAI-1) 5G/5G genotype are associated with early onset of severe preeclampsia. Journal of Thrombosis and Haemostasis 3:4, 686-691
CrossRef162
Ron Gonen, Noa Lavi, Dina Attias, Liliana Schliamser, Zvi Borochowitz, Elias Toubi, Gonen Ohel. (2005) Absence of association of inherited thrombophilia with unexplained third-trimester intrauterine fetal death. American Journal of Obstetrics and Gynecology 192:3, 742-746
CrossRef163
Heather E.A. Howley, Mark Walker, Marc A. Rodger. (2005) A systematic review of the association between factor V Leiden or prothrombin gene variant and intrauterine growth restriction. American Journal of Obstetrics and Gynecology 192:3, 694-708
CrossRef164
M. J. PAIDAS, D-H. W. KU, M-J. LEE, S. MANISH, A. THURSTON, C. J. LOCKWOOD, Y. S. ARKEL. (2005) Protein Z, protein S levels are lower in patients with thrombophilia and subsequent pregnancy complications. Journal of Thrombosis and Haemostasis 3:3, 497-501
CrossRef165
Mehmet A. Osmanağaoğlu, Kenan Topçuoğlu, Mehmet Özeren, Hasan Bozkaya. (2005) Coagulation inhibitors in preeclamptic pregnant women. Archives of Gynecology and Obstetrics 271:3, 227-230
CrossRef166
Agnes E.M. Galan-Roosen, Johan C. Kuijpers, Frits R. Rosendaal, Eric A. Steegers, Wil A. Beers, Gabrielle A. Ponjee, Hans M. Merkus. (2005) Maternal and paternal thrombophilia: risk factors for perinatal mortality. BJOG: An International Journal of Obstetrics and Gynaecology 112:3, 306-311
CrossRef167
T PORTER, J SCOTT. (2005) Evidence-based care of recurrent miscarriage. Best Practice & Research Clinical Obstetrics & Gynaecology
CrossRef168
Anne Parle-McDermott, James L. Mills, Peadar N. Kirke, Christopher Cox, Caroline C. Signore, Sandra Kirke, Anne M. Molloy, Valerie B. O'Leary, Faith J. Pangilinan, Colm O'Herlihy, Lawrence C. Brody, John M. Scott. (2005) MTHFD1 R653Q polymorphism is a maternal genetic risk factor for severe abruptio placentae. American Journal of Medical Genetics Part A 132A:4, 365-368
CrossRef169
T. B. LARSEN, S. P. JOHNSEN, M. GISLUM, C. A. I. MOLLER, H. LARSEN, H. T. SORENSEN. (2005) ABO blood groups and risk of venous thromboembolism during pregnancy and the puerperium. A population-based, nested case-control study. Journal of Thrombosis and Haemostasis 3:2, 300-304
CrossRef170
Laura Ruzzi, Iolanda Ciarafoni, Lorena Silvestri, Maria Letizia Semeraro, Damiano Abeni. (2005) Association of PLA2 polymorphism of the ITGB3 gene with early fetal loss. Fertility and Sterility 83:2, 511-512
CrossRef171
Luciano E. Mignini, Pallavi M. Latthe, Jose Villar, Mark D. Kilby, Guillermo Carroli, Khalid S. Khan. (2005) Mapping the Theories of Preeclampsia: The Role of Homocysteine. Obstetrics & Gynecology 105:2, 411-425
CrossRef172
Marc E.A. Spaanderman, Christine Willekes, Arnold P.G. Hoeks, Timo H.A. Ekhart, Robert Aardenburg, Dorette A. Courtar, Hugo W.F. van Eijndhoven, Louis L.H. Peeters. (2005) Maternal nonpregnant vascular function correlates with subsequent fetal growth. American Journal of Obstetrics and Gynecology 192:2, 504-512
CrossRef173
J. A. HEIT, J. L. SOBELL, H. LI, S. S. SOMMER. (2005) The incidence of venous thromboembolism among Factor V Leiden carriers: a community-based cohort study. Journal of Thrombosis and Haemostasis 3:2, 305-311
CrossRef174
E. Verspyck, L. Marpeau. (2005) Thrombophilies et pathologies vasculaires placentaires. Revue de la littérature. La Revue de Médecine Interne 26:2, 103-108
CrossRef175
Andrew D. Hull, Thomas R. Moore. 2005. Hypertensive Complications of Pregnancy. , 99-105.
CrossRef176
C.P.J. Witsenburg, F.R. Rosendaal, J.M. Middeldorp, F.J.M. Van der Meer, S.A. Scherjon. (2005) Factor VIII levels and the risk of pre-eclampsia, HELLP syndrome, pregnancy related hypertension and severe intrauterine growth retardation. Thrombosis Research 115:5, 387-392
CrossRef177
Ates Karateke, Berna Haliloglu, Ayse Gurbuz. (2005) Third trimester nonrecurrent fetal loss is associated with factor V Leiden and prothrombin gene mutations. Journal of Maternal-Fetal and Neonatal Medicine 18:5, 299-304
CrossRef178
Fiona M. Miall, Paramjeet S. Deol, Tim A. Barnes, Karen Dampier, Christopher C. Watson, Christina A. Oppenheimer, K. John Pasi, Sue R. Pavord. (2005) Coagulation status and complications of pregnancy. Thrombosis Research 115:6, 461-467
CrossRef179
Julie Lin, Phyllis August. (2005) Genetic Thrombophilias and Preeclampsia: A Meta-Analysis. Obstetrics & Gynecology 105:1, 182-192
CrossRef180
P E LEVI SETTI, G V COLOMBO, V SAVASI, C BULLETTI, E ALBANI, E FERRAZZI. (2004) Implantation Failure in Assisted Reproduction Technology and a Critical Approach to Treatment. Annals of the New York Academy of Sciences 1034:1, 184-199
CrossRef181
Ophira Salomon, Uri Seligsohn, David M. Steinberg, Yaron Zalel, Asaf Lerner, Nurit Rosenberg, Meirav Pshithizki, Mary Oren, Bruria Ravid, Jacquelin Davidson, Eyal Schiff, Reuwen Achiron. (2004) The common prothrombotic factors in nulliparous women do not compromise blood flow in the feto-maternal circulation and are not associated with preeclampsia or intrauterine growth restriction. American Journal of Obstetrics and Gynecology 191:6, 2002-2009
CrossRef182
Clemens B Tempfer, Eva-Katrin Riener, Lukas A Hefler, Christoph Keck. (2004) Genetic thrombophilia has pleiotropic effects in pregnancy. Personalized Medicine 1:1, 105-114
CrossRef183
Evgenia Frenkel, Chen Duksin, Arie Herman, Dan J. Sherman. (2004) Congenital Hypofibrinogenemia in Pregnancy: Report of Two Cases and Review of the Literature. Obstetrical & Gynecological Survey 59:11, 775-779
CrossRef184
R. Lecumberri Villamediana, M.P. Sánchez Antón, J. Feliú Sánchez, E. Rocha Hernando. (2004) Trombofilia venosa. Clasificación, implicaciones clínicas y terapéuticas. Medicine - Programa de Formación Médica Continuada Acreditado 9:22, 1393-1400
CrossRef185
Hulya YILMAZ, Yesim UNLUCERCI, Figen GURDOL, Elif ISBILEN, Turgay ISBIR. (2004) Association of pre-eclampsia with hyperhomocysteinaemia and methylenetetrahydrofolate reductase gene C677T polymorphism in a Turkish population. The Australian and New Zealand Journal of Obstetrics and Gynaecology 44:5, 423-427
CrossRef186
E. Jääskeläinen, S. Toivonen, E.-L. Romppanen, S. Helisalmi, L. Keski-Nisula, K. Punnonen, S. Heinonen. (2004) M385T polymorphism in the factor V gene, but not Leiden mutation, is associated with placental abruption in Finnish women. Placenta 25:8-9, 730-734
CrossRef187
Ase Rasmussen, Pernille Ravn. (2004) High frequency of congenital thrombophilia in women with pathological pregnancies?. Acta Obstetricia et Gynecologica Scandinavica 83:9, 808-817
CrossRef188
Antonio E. Frias, Rixt A. Luikenaar, Amy E. Sullivan, Richard M. Lee, T Flint Porter, D Ware Branch, Robert M. Silver. (2004) Poor Obstetric Outcome in Subsequent Pregnancies in Women With Prior Fetal Death. Obstetrics & Gynecology 104:3, 521-526
CrossRef189
Ioannis P Kosmas, Athina Tatsioni, John PA Ioannidis. (2004) Association of C677T polymorphism in the methylenetetrahydrofolate reductase gene with hypertension in pregnancy and pre-eclampsia. Journal of Hypertension 22:9, 1655-1662
CrossRef190
Zeev Weiner, Ronit Beck-Fruchter, Amir Weiss, Yasir Hujirat, Eliezer Shalev, Stavit A. Shalev. (2004) Thrombophilia and stillbirth: possible connection by intrauterine growth restriction. BJOG: An International Journal of Obstetrics and Gynaecology 111:8, 780-783
CrossRef191
Jody L. Kujovich. (2004) Thrombophilia and pregnancy complications. American Journal of Obstetrics and Gynecology 191:2, 412-424
CrossRef192
Siobhan Quenby, Steve Mountfield, Judith E. Cartwright, Guy St. J. Whitley, Gill Vince. (2004) Effects of Low-Molecular-Weight and Unfractionated Heparin on Trophoblast Function. Obstetrics & Gynecology 104:2, 354-361
CrossRef193
Barry N. J. WALTERS. (2004) Obstetric medicine, its premise and promise. The Australian and New Zealand Journal of Obstetrics and Gynaecology 44:4, 295-297
CrossRef194
M. Paidas, D.-H. Ku, E. Triche, C. Lockwood, Y. Arkel. (2004) Does heparin therapy improve pregnancy outcome in patients with thrombophilias?. Journal of Thrombosis and Haemostasis 2:7, 1194-1195
CrossRef195
Laura L Valdez, Antonio Quintero, Ernesto Garcia, Norma Olivares, Alfredo Celis, Fernando Rivas, Fernando Rivas. (2004) Thrombophilic polymorphisms in preterm delivery. Blood Cells, Molecules, and Diseases 33:1, 51-56
CrossRef196
Lisa Moores, Kathryn L Bilello, Susan Murin. (2004) Sex and gender issues and venous thromboembolism. Clinics in Chest Medicine 25:2, 281-297
CrossRef197
Ilana Ariel, Eyal Anteby, Yaron Hamani, Raymond W Redline. (2004) Placental pathology in fetal thrombophilia. Human Pathology 35:6, 729-733
CrossRef198
N DOYLE, M MONGA. (2004) Thromboembolic disease in pregnancy. Obstetrics and Gynecology Clinics of North America 31:2, 319-344
CrossRef199
E LETSKY. (2004) Haematology of pregnancy. Medicine 32:5, 42-45
CrossRef200
Rosemary J. Pegoraro, Aggrey Chikosi, Lee Rom, Candice Roberts, Jack Moodley. (2004) Methylenetetrahydrofolate reductase gene polymorphisms in black South Africans and the association with preeclampsia. Acta Obstetricia et Gynecologica Scandinavica 83:5, 449-454
CrossRef201
M.J. Kupferminc, E. Rimon, J. Ascher-Landsberg, J.B. Lessing, A. Many. (2004) Perinatal outcome in women with severe pregnancy complications and multiple thrombophilias. Journal of Perinatal Medicine 32:3, 225-227
CrossRef202
Hege Vefring, Rolv Terje Lie, Rønnaug Ødegård, M Azam Mansoor, Stein Tore Nilsen. (2004) Maternal and Fetal Variants of Genetic Thrombophilias and the Risk of Preeclampsia. Epidemiology 15:3, 317-322
CrossRef203
Cabot, Richard C.Harris, Nancy Lee, Shepard, Jo-Anne O., Ebeling, Sally H.Ellender, Stacey M.Peters, Christine C., O'Gara, Patrick T., Greenfield, Alan J., Afridi, Nadeem A., Houser, Stuart L., . (2004) Case 12-2004. New England Journal of Medicine 350:16, 1666-1674
Full Text204
C. Y. Vossen, F. E. Preston, J. Conard, J. Fontcuberta, M. Makris, F. J. M. Van Der Meer, I. Pabinger, G. Palareti, I. Scharrer, J. C. Souto, P. Svensson, I. D. Walker, F. R. Rosendaal. (2004) Hereditary thrombophilia and fetal loss: a prospective follow-up study. Journal of Thrombosis and Haemostasis 2:4, 592-596
CrossRef205
Leonard P. Morssink, Job G. Santema, Feike Willemse. (2004) Thrombophilia is not associated with an increase in placental abnormalities in women with intra-uterine fetal death. Acta Obstetricia et Gynecologica Scandinavica 83:4, 348-350
CrossRef206
Samuel Z Goldhaber. (2004) Pulmonary embolism. The Lancet 363:9417, 1295-1305
CrossRef207
Maarten T.M. Raijmakers, Eva Maria Roes, Petra L.M. Zusterzeel, Eric A.P. Steegers, Wilbert H.M. Peters. (2004) Thiol status and antioxidant capacity in women with a history of severe pre-eclampsia. BJOG: An International Journal of Obstetrics and Gynaecology 111:3, 207-212
CrossRef208
Raymond S Camilleri, Donald Peebles, Carol Portmann, Tamara Everington, Hannah Cohen. (2004) ???455G/A ??-fibrinogen gene polymorphism, factor V Leiden, prothrombin G20210A mutation and MTHFR C677T, and placental vascular complications. Blood Coagulation & Fibrinolysis 15:2, 139-147
CrossRef209
E. Lindhoff-Last. (2004) Maternal thrombophilia and obstetric complications / Mütterliche Thrombophilie und geburtshilfliche Komplikationen. LaboratoriumsMedizin 28:1, 34-41
CrossRef210
Lesley M. E. McCowan, Larry W. Chamley. (2004) Antiphosphatidyl serine antibodies are more common in normotensive women with small for gestational age pregnancies. The Australian and New Zealand Journal of Obstetrics and Gynaecology 44:1, 14-18
CrossRef211
Pelle Lindqvist. (2004) Author's Reply. BJOG: An International Journal of Obstetrics and Gynaecology 111:1, 93-94
CrossRef212
Fabio Facchinetti. (2004) Factor V Leiden in pregnancies complicated by placental abruption. BJOG: An International Journal of Obstetrics and Gynaecology 111:1, 93-93
CrossRef213
Noga Carmi, Dana Cohen, Eti Zvang, Elizabeth Naparstek, Varda Deutsch. (2004) Pronto
ThromboRisk??A novel primer-extension ELISA based assay for the detection of mutations associated with increased risk for thrombophilia. Journal of Clinical Laboratory Analysis 18:5, 259-264
CrossRef214
Charles J Glueck, Ping Wang, Seref Bornovali, Naila Goldenberg, Luann Sieve. (2003) Polycystic ovary syndrome, the G1691A factor V Leiden mutation, and plasminogen activator inhibitor activity: associations with recurrent pregnancy loss. Metabolism 52:12, 1627-1632
CrossRef215
Gabriel S Gebhardt, David R Hall. (2003) Inherited and acquired thrombophilias and poor pregnancy outcome: should we be treating with heparin?. Current Opinion in Obstetrics and Gynecology 15:6, 501-506
CrossRef216
Chiaki Takeya, Mariko Esumi, Toshihiko Shiroishi, Ryohei Hishida, Tatsuo Yamamoto. (2003) Multiple single-nucleotide polymorphisms in the methylenetetrahydrofolate reductase and its truncated pseudogene of 23 inbred strains of mice. Biochemical and Biophysical Research Communications 312:2, 480-486
CrossRef217
Marie M Budev, Majed Abu-Hajir, Steven R Deitcher, Marcelo P.V Gomes. (2003) Estrogen-containing oral contraceptives are allowable in young women with factor V Leiden heterozygosity without a history of thrombosis. Medical Clinics of North America 87:6, 1225-1236
CrossRef218
Bryan Kestenbaum, Stephen L. Seliger, Thomas R. Easterling, Daniel L. Gillen, Cathy W. Critchlow, Catherine O. Stehman-Breen, Stephen M. Schwartz. (2003) Cardiovascular and thromboembolic events following hypertensive pregnancy. American Journal of Kidney Diseases 42:5, 982-989
CrossRef219
Iris Schrijver, Tiffanee J. Lenzi, Carol D. Jones, Marla J. Lay, Maurice L. Druzin, James L. Zehnder. (2003) Prothrombin Gene Variants in Non-Caucasians with Fetal Loss and Intrauterine Growth Retardation. The Journal of Molecular Diagnostics 5:4, 250-253
CrossRef220
B. Brenner. (2003) Antithrombotic prophylaxis for women with thrombophilia and pregnancy complications - Yes. Journal of Thrombosis and Haemostasis 1:10, 2070-2072
CrossRef221
Gemma D'Aniello, Pasquale Florio, Laura Sabatini, Filiberto M Severi, Daniela Fineschi, Giuseppe Cito, Claudio G Guidoni, Felice Petraglia. (2003) The search for thrombophilic gene mutations in women with gestational hypertension does not help in predicting poor pregnancy outcome. Journal of Hypertension 21:10, 1915-1920
CrossRef222
Claire N Harrison, Anthony R Green. (2003) Essential thrombocythemia. Hematology/Oncology Clinics of North America 17:5, 1175-1190
CrossRef223
Meyer-Michel Samama, Roberto A. Rached, Marie-Hélène Horellou, Sandro Aquilanti, Valérie G. Mathieux, Geneviève Plu-Bureau, Ismail Elalamy, Jacqueline Conard. (2003) Pregnancy-associated venous thromboembolism (VTE) in combined heterozygous factor V Leiden (FVL) and prothrombin (FII) 20210 A mutation and in heterozygous FII single gene mutation alone. British Journal of Haematology 123:2, 327-334
CrossRef224
Sherri A. Longo, Chi P. Dola, Gabriella Pridjian. (2003) Preeclampsia and Eclampsia Revisited. Southern Medical Journal 96:9, 891-899
CrossRef225
Dondapati Chowdary, Deanna Streck, Marvin N. Schwalb, James J. Dermody. (2003) High Incidence of Two Methylenetetrahydrofolate Reductase Mutations (C677T and A1298C) in Hispanics. Genetic Testing 7:3, 255-257
CrossRef226
James N. George. (2003) The association of pregnancy with thrombotic thrombocytopenic purpura–hemolytic uremic syndrome. Current Opinion in Hematology 10:5, 339-344
CrossRef227
R. Pauzner, M. Dulitzky, H. Carp, H. Mayan, R. Kenett, Z. Farfel, A. Many. (2003) Hepatic infarctions during pregnancy are associated with the antiphospholipid syndrome and in addition with complete or incomplete HELLP syndrome. Journal of Thrombosis and Haemostasis 1:8, 1758-1763
CrossRef228
Ioannis P Kosmas, Athina Tatsioni, John PA Ioannidis. (2003) Association of Leiden mutation in Factor V gene with hypertension in pregnancy and pre-eclampsia. Journal of Hypertension 21:7, 1221-1228
CrossRef229
Tina Buchholz, Christian J. Thaler. (2003) Inherited Thrombophilia: Impact on Human Reproduction. American Journal of Reproductive Immunology 50:1, 20-32
CrossRef230
Benjamin Brenner. (2003) Inherited thrombophilia and pregnancy loss. Best Practice & Research Clinical Haematology 16:2, 311-320
CrossRef231
Johnny S Younis, Arnon Samueloff. (2003) Gestational vascular complications. Best Practice & Research Clinical Haematology 16:2, 135-151
CrossRef232
William M Hague, Gustaaf A Dekker. (2003) Risk factors for thrombosis in pregnancy. Best Practice & Research Clinical Haematology 16:2, 197-210
CrossRef233
Elvira Grandone, Maurizio Margaglione. (2003) Inherited thrombophilia and gestational vascular complications. Best Practice & Research Clinical Haematology 16:2, 321-332
CrossRef234
Rashmi Sood, Hartmut Weiler. (2003) Embryogenesis and gene targeting of coagulation factors in mice. Best Practice & Research Clinical Haematology 16:2, 169-181
CrossRef235
Naomi Lanir, Anat Aharon, Benjamin Brenner. (2003) Haemostatic mechanisms in human placenta. Best Practice & Research Clinical Haematology 16:2, 183-195
CrossRef236
J SAID, G DEKKER. (2003) Pre-eclampsia and thrombophilia. Best Practice & Research Clinical Obstetrics & Gynaecology 17:3, 441-458
CrossRef237
B BRENNER, M KUPFERMINC. (2003) Inherited thrombophilia and poor pregnancy outcome. Best Practice & Research Clinical Obstetrics & Gynaecology 17:3, 427-439
CrossRef238
B Granel, P.-E Morange, J Serratrice, N Ene, S Cremades, L Swiader, P Disdier, I Juhan-Vague, P.-J Weiller. (2003) Mutation G20210A du gène de la prothrombine à l'état hétérozygote et pathologies associées. La Revue de Médecine Interne 24:5, 282-287
CrossRef239
Valerie A. Holmes. (2003) Changes in haemostasis during normal pregnancy: does homocysteine play a role in maintaining homeostasis?. Proceedings of the Nutrition Society 62:02, 479-493
CrossRef240
Mark C Walker, Sarah E Ferguson, Victoria M Allen, Mark C Walker. 2003. Heparin for pregnant women with acquired or inherited thrombophilias. .
CrossRef241
Sassan HajMohammadi, Keiichi Enjyoji, Marc Princivalle, Patricia Christi, Miroslav Lech, David Beeler, Helen Rayburn, John J. Schwartz, Samad Barzegar, Ariane I. de Agostini, Mark J. Post, Robert D. Rosenberg, Nicholas W. Shworak. (2003) Normal levels of anticoagulant heparan sulfate are not essential for normal hemostasis. Journal of Clinical Investigation 111:7, 989-999
CrossRef242
Rosemary J. Pegoraro, Bavna Hira, Lee Rom, Jack Moodley. (2003) Plasminogen activator inhibitor type 1 (PAI1) and platelet glycoprotein IIIa (PGIIIa) polymorphisms in Black South Africans with pre-eclampsia. Acta Obstetricia et Gynecologica Scandinavica 82:4, 313-317
CrossRef243
Mitchell S Cappell, David Friedel. (2003) Abdominal pain during pregnancy. Gastroenterology Clinics of North America 32:1, 1-58
CrossRef244
Evelyne Rey, Susan R Kahn, Michèle David, Ian Shrier. (2003) Thrombophilic disorders and fetal loss: a meta-analysis. The Lancet 361:9361, 901-908
CrossRef245
Paolo Carraro. (2003) Guidelines for the Laboratory Investigation of Inherited Thrombophilias. Recommendations for the First Level Clinical Laboratories. Clinical Chemistry and Laboratory Medicine 41:3, 382-391
CrossRef246
W. Visser. (2003) Hypertensie en zwangerschapzwangerschap hypertensie. Bijblijven 19:2, 56-63
CrossRef247
I Korn-Lubetzki. (2003) Homozygous C677T mutation in the MTHFR gene as an independent risk factor for multiple small artery occlusions. Thrombosis Research 112:5-6, 355
CrossRef248
M. C. Lu, V. Tache, G. R. Alexander, M. Kotelchuck, N. Halfon. (2003) Preventing low birth weight: is prenatal care the answer?. Journal of Maternal-Fetal and Neonatal Medicine 13:6, 362-380
CrossRef249
Ian A. Greer. (2003) Thrombophilia: implications for pregnancy outcome. Thrombosis Research 109:2-3, 73-81
CrossRef250
Melissa L. Wilson, Thomas Murphy Goodwin, Vivien L. Pan, Sue Ann Ingles. (2003) Molecular Epidemiology of Preeclampsia. Obstetrical & Gynecological Survey 58:1, 39-66
CrossRef251
Chiara Benedetto, Luca Marozio, Loredana Salton, Vincenza Maula, Giuseppina Chieppa, Marco Massobrio. (2002) Factor V Leiden and factor II G20210A in preeclampsia and HELLP syndrome. Acta Obstetricia et Gynecologica Scandinavica 81:12, 1095-1100
CrossRef252
(2002) Thrombophilia Polymorphisms and Intrauterine Growth Restriction. New England Journal of Medicine 347:19, 1530-1531
Full Text253
Benjamin Brenner. (2002) Thrombophilia and pregnancy loss. Thrombosis Research 108:4, 197-202
CrossRef254
M Beaufils. (2002) Hypertensions gravidiques. La Revue de Médecine Interne 23:11, 927-938
CrossRef255
S Aronis, H Bouza, H Pergantou, Z Kapsimalis, H Platokouki, M Xanthou. (2002) Prothrombotic factors in neonates with cerebral thrombosis and intraventricular hemorrhage. Acta Paediatrica 91, 87-91
CrossRef256
TREVOR WOODAGE, J. CRAIG VENTER, SAMUEL BRODER. (2002) Application of the Human Genome to Obstetrics and Gynecology. Clinical Obstetrics and Gynecology 45:3, 711-729
CrossRef257
Gabriella Pridjian, Jules B. Puschett. (2002) Preeclampsia. Part 2: Experimental and Genetic Considerations. Obstetrical & Gynecological Survey 57:9, 619-640
CrossRef258
Gabriella Pridjian, Jules B. Puschett. (2002) Preeclampsia. Part 1: Clinical and Pathophysiologic Considerations. Obstetrical & Gynecological Survey 57:9, 598-618
CrossRef259
Elvira Grandone, Vincenzo Brancaccio, Donatella Colaizzo, Natale Sciannamé, Giuseppe Pavone, Giovanni Di Minno, Maurizio Margaglione. (2002) Preventing adverse obstetric outcomes in women with genetic thrombophilia. Fertility and Sterility 78:2, 371-375
CrossRef260
Peter von Dadelszen, Laura A. Magee, Shoo K. Lee, Shawn D. Stewart, Carmine Simone, Gideon Koren, Keith R. Walley, James A. Russell. (2002) Activated protein C in normal human pregnancy and pregnancies complicated by severe preeclampsia: A therapeutic opportunity?*. Critical Care Medicine 30:8, 1883-1892
CrossRef261
Infante-Rivard, Claire, Rivard, Georges-Etienne, Yotov, Wagner V., Génin, Emmanuelle, Guiguet, Marguerite, Weinberg, Clarice, Gauthier, Robert, Feoli-Fonseca, Juan Carlos, . (2002) Absence of Association of Thrombophilia Polymorphisms with Intrauterine Growth Restriction. New England Journal of Medicine 347:1, 19-25
Full Text262
Roberts, Drucilla, , Schwartz, Robert S., . (2002) Clotting and Hemorrhage in the Placenta — A Delicate Balance. New England Journal of Medicine 347:1, 57-59
Full Text263
Claire N. Harrison . (2002) Current trends in essential thrombocythaemia. British Journal of Haematology 117:4, 796-808
CrossRef264
Katherine Hladky, Jerome Yankowitz, Wendy F. Hansen. (2002) Placental Abruption. Obstetrical and Gynecological Survey 57:5, 299-305
CrossRef265
Lesley Regan, Raj Rai. (2002) Thrombophilia and pregnancy loss. Journal of Reproductive Immunology 55:1-2, 163-180
CrossRef266
Jenny E. Myers, Philip N. Baker. (2002) Hypertensive diseases and eclampsia. Current Opinion in Obstetrics and Gynecology 14:2, 119-125
CrossRef267
Petersson Karin, Bremme Katarina, Bottinga Roger, Hofsjo Alexandra, Hulthen-Varli Ingela, Kublickas Marius, Norman Margareta, Papadogiannakis Nikos, Wanggren Kjell, Wolff Kerstin. (2002) Diagnostic evaluation of intrauterine fetal deaths in Stockholm 1998-99. Acta Obstetricia et Gynecologica Scandinavica 81:4, 284-292
CrossRef268
J.M. Sikkema, A. Franx, H.W. Bruinse, N.G. van der Wijk, H.W. de Valk, P.G.J. Nikkels. (2002) Placental Pathology in Early Onset Pre-eclampsia and Intra-uterine Growth Restriction in Women With and Without Thrombophilia. Placenta 23:4, 337-342
CrossRef269
David Soriano, Howard Carp, Daniel S. Seidman, Eyal Schiff, Pnina Langevitz, Shlomo Mashiach, Motti Dulitzky. (2002) Management and outcome of pregnancy in women with thrombophylic disorders and past cerebrovascular events. Acta Obstetricia et Gynecologica Scandinavica 81:3, 204-207
CrossRef270
Takayuki Iwaki, Mayra J. Sandoval-Cooper, Melissa Paiva, Takao Kobayashi, Victoria A. Ploplis, Francis J. Castellino. (2002) Fibrinogen Stabilizes Placental-Maternal Attachment During Embryonic Development in the Mouse. The American Journal of Pathology 160:3, 1021-1034
CrossRef271
Lea Currie, Michael Peek, Michelle McNiven, Ian Prosser, Julia Mansour, Jennifer Ridgway. (2002) Is there an increased maternal-infant prevalence of Factor V Leiden in association with severe pre-eclampsia?. BJOG: An International Journal of Obstetrics and Gynaecology 109:2, 191-196
CrossRef272
Galit Sarig, Johnny S Younis, Ron Hoffman, Naomi Lanir, Zeev Blumenfeld, Benjamin Brenner. (2002) Thrombophilia is common in women with idiopathic pregnancy loss and is associated with late pregnancy wastage. Fertility and Sterility 77:2, 342-347
CrossRef273
George R. Saade, Claire McLintock. (2002) Inherited thrombophilia and stillbirth. Seminars in Perinatology 26:1, 51-69
CrossRef274
T. Agorastos, A. Karavida, A. Lambropoulos, T. Constantinidis, S. Tzitzimikas, S. Chrisafi, H. Saravelos, D. Vavilis, A. Kotsis, J. Bontis. (2002) Factor V Leiden and prothrombin G20210A mutations in pregnancies with adverse outcome. Journal of Maternal-Fetal and Neonatal Medicine 12:4, 267-273
CrossRef275
Annalyn Gilchrist, Natalie Solomon, Dwight Erickson, Anita Sikand, Kenneth A Bauer, Margot S Kruskall, Olivier Kocher. (2001) Automated detection of the G20210A prothrombin mutation using the LCx® microparticle enzyme immunoassay. Clinica Chimica Acta 314:1-2, 249-254
CrossRef276
P GIBSON, K ROSENEMONTELLA. (2001) Anticoagulants. Best Practice & Research Clinical Obstetrics & Gynaecology 15:6, 847-861
CrossRef277
Jacques Lepercq, Jacqueline Conard, Annie Borel-Derlon, Jean-Yves Darmon, Odile Boudignat, Christine Francoual, Pascal Priollet, Corinne Cohen, Nicole Yvelin, Jean-Francois Schved, Michel Tournaire, Jeanne-Yvonne Borg. (2001) Venous thromboembolism during pregnancy: a retrospective study of enoxaparin safety in 624 pregnancies. BJOG: An International Journal of Obstetrics and Gynaecology 108:11, 1134-1140
CrossRef278
Marc Spaanderman, Timo Ekhart, Jim van Eyck, Peter de Leeuw, Louis Peeters. (2001) Preeclampsia and maladaptation to pregnancy: A role for atrial natriuretic peptide?. Kidney International 60:4, 1397-1406
CrossRef279
Pelle G. Lindqvist, Saemundur Gudmundsson. (2001) Maternal carriership of factor V Leiden associated with pathological uterine artery Doppler measurements during pregnancy. BJOG: An International Journal of Obstetrics and Gynaecology 108:10, 1103-1105
CrossRef280
Franca Franchi, Eugenia Biguzzi, Irene Cetin, Floriana Facchetti, Tatjana Radaelli, Maddalena Bozzo, Giorgio Pardi, Elena M. Faioni. (2001) Mutations in the thrombomodulin and endothelial protein C receptor genes in women with late fetal loss. British Journal of Haematology 114:3, 641-646
CrossRef281
Yifat Ochshorn, Michael J. Kupferminc, Amiram Eldor, Igal Wolman, Joseph B. Lessing, Yuval Yaron. (2001) Second-trimester maternal serum alpha-fetoprotein (MSAFP) iselevated in women with adverse pregnancy outcome associated with inherited thrombophilias. Prenatal Diagnosis 21:8, 658-661
CrossRef282
Svein Rasmussen, Lorentz M. Irgens, Susanne Albrechtsen, Knut Dalaker. (2001) Women with a history of placental abruption: when in a subsequent pregnancy should special surveillance for a recurrent placental abruption be initiated?. Acta Obstetricia et Gynecologica Scandinavica 80:8, 708-712
CrossRef283
Willianne L.D.M. Nelen. (2001) Hyperhomocysteinaemia and Human Reproduction. Clinical Chemistry and Laboratory Medicine 39:8, 758-763
CrossRef284
E LETSKY. (2001) Disseminated intravascular coagulation. Best Practice & Research Clinical Obstetrics & Gynaecology 15:4, 623-644
CrossRef285
Jun Zhang, James F. Troendle, Richard J. Levine. (2001) Risks of hypertensive disorders in the second pregnancy. Paediatric and Perinatal Epidemiology 15:3, 226-231
CrossRef286
Michael S. Kramer, Lise Goulet, John Lydon, Louise Seguin, Helen McNamara, Clement Dassa, Robert W. Platt, Moy Fong Chen, Henriette Gauthier, Jacques Genest, Susan Kahn, Michael Libman, Rima Rozen, Andre Masse, Louise Miner, Guylaine Asselin, Alice Benjamin, Julia Klein, Gideon Koren. (2001) Socio-economic disparities in preterm birth: causal pathways and mechanisms. Paediatric and Perinatal Epidemiology 15:s2, 104-123
CrossRef287
Irene Hoesli, Frank Louwen, Wolfgang Holzgreve. (2001) Medical and obstetric problems complicating pregnancy. Current Opinion in Anaesthesiology 14:3, 299-306
CrossRef288
J. T. Sprouse, C. S. Wong, W. L. Chandler, G. D. Williams, S. L. Watkins, P. I. Tarr. (2001) Thrombogenic alleles, Escherichia coli O157:H7 infections, and hemolytic uremic syndrome. Blood Coagulation and Fibrinolysis 12:4, 283-288
CrossRef289
Gordon CS Smith, Jill P Pell, David Walsh. (2001) Pregnancy complications and maternal risk of ischaemic heart disease: a retrospective cohort study of 129 290 births. The Lancet 357:9273, 2002-2006
CrossRef290
JARI PET??J??, LEENA HILTUNEN, AND, VINETA FELLMAN. (2001) Increased Risk of Intraventricular Hemorrhage in Preterm Infants with Thrombophilia. Pediatric Research 49:5, 643-646
CrossRef291
Seligsohn, Uri, Lubetsky, Aharon, . (2001) Genetic Susceptibility to Venous Thrombosis. New England Journal of Medicine 344:16, 1222-1231
Full Text292
Vandana Shashi, Amy Rickheim, Mark J. Pettenati. (2001) Maternal homozygosity for the commonMTHFR mutation as a potential risk factor for offspring with limb defects. American Journal of Medical Genetics 100:1, 25-29
CrossRef293
Amiram Eldor. (2001) Unexplored territories in the nonsurgical patient: A look at pregnancy. Seminars in Hematology 38, 39-48
CrossRef294
Bruce L Davidson, Alexander T Cohen. (2001) A targeted approach to thrombosis: New data, new perspectives—Introduction. Seminars in Hematology 38, 1-3
CrossRef295
Mark Scher. (2001) Perinatal asphyxia: Timing and mechanisms of injury in neonatal encephalopathy. Current Neurology and Neuroscience Reports 1:2, 175-184
CrossRef296
M Bozzo. (2001) HELLP syndrome and factor V Leiden. European Journal of Obstetrics & Gynecology and Reproductive Biology 95:1, 55-58
CrossRef297
Wayne W. Grody, John H. Griffin, Annette K. Taylor, Bruce R. Korf, John A. Heit. (2001) American College of Medical Genetics Consensus Statement on Factor V Leiden Mutation Testing. Genetics in Medicine 3:2, 139-148
CrossRef298
Jacob Bar, Reuven Mashiah, Bina Cohen-Sacher, Moshe Hod, Raoul Orvieto, Zion Ben-Rafael, Judith Lahav. (2001) Effect of Thrombophylaxis on Uterine and Fetal Circulation in Pregnant Women with a History of Pregnancy Complications. Thrombosis Research 101:4, 235-241
CrossRef299
Bernd Schwahn, Rima Rozen. (2001) Polymorphisms in the Methylenetetrahydrofolate Reductase Gene. American Journal of PharmacoGenomics 1:3, 189-201
CrossRef300
Mario Bazzan, Valentina Donvito. (2001) Low-molecular-weight Heparin During Pregnancy. Thrombosis Research 101:1, 175-186
CrossRef301
C.J Glueck, Harvey Phillips, Dan Cameron, Luann Sieve-Smith, Ping Wang. (2001) Continuing metformin throughout pregnancy in women with polycystic ovary syndrome appears to safely reduce first-trimester spontaneous abortion: a pilot study. Fertility and Sterility 75:1, 46-52
CrossRef302
Georg–Friedrich von Tempelhoff, Lothar Heilmann, Eberhard Spanuth, Erich Kunzmann, Gerhard Hommel. (2000) Incidence of the Factor V Leiden-mutation, Coagulation Inhibitor Deficiency, and Elevated Antiphospholipid-antibodies in Patients with Preeclampsia or HELLP–Syndrome. Thrombosis Research 100:4, 363-365
CrossRef303
Martinelli, Ida, Taioli, Emanuela, Cetin, Irene, Marinoni, Alessandra, Gerosa, Sonia, Villa, Maria V., Bozzo, Maddalena, Mannucci, Pier M., . (2000) Mutations in Coagulation Factors in Women with Unexplained Late Fetal Loss. New England Journal of Medicine 343:14, 1015-1018
Full Text304
Antonio Preti, Lucia Cardascia, Tiziana Zen, Maria Marchetti, Gerardo Favaretto, Paola Miotto. (2000) Risk for obstetric complications and schizophrenia. Psychiatry Research 96:2, 127-139
CrossRef305
C. Fatini, F. Gensini, B. Battaglini, D. Prisco, A. P. Cellai, S. Fedi, R. Marcucci, T. Brunelli, G. Mello, E. Parretti, G. Pepe, R. Abbate. (2000) Angiotensin-converting enzyme DD genotype, angiotensin type 1 receptor CC genotype, and hyperhomocysteinemia increase first-trimester fetal-loss susceptibility. Blood Coagulation and Fibrinolysis 11:7, 657-662
CrossRef306
Lothar Heilmann, Dirk M. Schneider, Georg-Friedrich von Tempelhoff. (2000) ANTITHROMBOTIC THERAPY IN HIGH-RISK PREGNANCY. Hematology/Oncology Clinics of North America 14:5, 1133-1150
CrossRef307
George B Segel, Charles A Francis. (2000) Anticoagulant Proteins in Childhood Venous and Arterial Thrombosis: A Review. Blood Cells, Molecules, and Diseases 26:5, 540-560
CrossRef308
L REGAN, R RAI. (2000) Epidemiology and the medical causes of miscarriage. Best Practice & Research Clinical Obstetrics & Gynaecology 14:5, 839-854
CrossRef309
Benjamin Brenner. (2000) Inherited thrombophilia and fetal loss. Current Opinion in Hematology 7:5, 290-295
CrossRef310
C.J Glueck, Sherif G Awadalla, Harvey Phillips, Dan Cameron, Ping Wang, Robert N Fontaine. (2000) Polycystic ovary syndrome, infertility, familial thrombophilia, familial hypofibrinolysis, recurrent loss of in vitro fertilized embryos, and miscarriage. Fertility and Sterility 74:2, 394-397
CrossRef311
Gen Kobashi, Hideto Yamada, Toshimichi Asano, Shunsuke Nagano, Akira Hata, Reiko Kishi, Seiichiro Fujimoto, Kiyotaro Kondo. (2000) Absence of association between a common mutation in the methylenetetrahydrofolate reductase gene and preeclampsia in Japanese women. American Journal of Medical Genetics 93:2, 122-125
CrossRef312
Martin W. Lunnon, Martin Braddock. (2000) The impact of molecular medicine upon early cardiovascular drug development. British Journal of Clinical Pharmacology 50:1, 1-8
CrossRef313
E. F. Molen, B. Verbruggen, I. Novakova, T. K. A. B. Eskes, L. A. H. Monnens, H. J. Blom. (2000) Hyperhomocysteinemia and other thrombotic risk factors in women with placental vasculopathy. BJOG: An International Journal of Obstetrics and Gynaecology 107:6, 785-791
CrossRef314
Jeremy Tuohy. (2000) Multiple obstetric complications of factor V Leiden mutation. The Australian and New Zealand Journal of Obstetrics and Gynaecology 40:2, 203-204
CrossRef315
S N Baré, R Póka, I Balogh, É Ajzner. (2000) Factor V Leiden as a risk factor for miscarriage and reduced fertility. The Australian and New Zealand Journal of Obstetrics and Gynaecology 40:2, 186-190
CrossRef316
John R Higgins. (2000) Pregnancy and the impact of inherited thrombophilias. The Australian and New Zealand Journal of Obstetrics and Gynaecology 40:2, 118-121
CrossRef317
Simon Gates. (2000) Thromboembolic disease in pregnancy. Current Opinion in Obstetrics and Gynecology 12:2, 117-122
CrossRef318
Martin W Lunnon. (2000) 72nd Meeting of the American Heart Association. Expert Opinion on Pharmacotherapy 1:3, 581-587
CrossRef319
Greer, Ian A., . (2000) The Challenge of Thrombophilia in Maternal–Fetal Medicine. New England Journal of Medicine 342:6, 424-425
Full Text320
Robert B. Gherman, T. Murphy Goodwin. (2000) Obstetric Implications of Activated Protein C Resistance and Factor V Leiden Mutation. Obstetrical & Gynecological Survey 55:2, 117
CrossRef321
C. Kearon, M. Crowther, J. Hirsh. (2000) Management of Patients with Hereditary Hypercoagulable Disorders. Annual Review of Medicine 51:1, 169-185
CrossRef322
Donald Silver, Angela Vouyouka. (2000) The caput medusae of hypercoagulability. Journal of Vascular Surgery 31:2, 396-405
CrossRef323
C.J. Glueck, Ping Wang, Robert N. Fontaine, Luann Sieve-Smith, Trent Tracy, Sarah K. Moore. (1999) Plasminogen activator inhibitor activity: An independent risk factor for the high miscarriage rate during pregnancy in women with polycystic ovary syndrome. Metabolism 48:12, 1589-1595
CrossRef324
Roberta Shear, Line Leduc, Evelyne Rey, Jean-Marie Moutquin. (1999) Hypertension in pregnancy: New recommendations for managemen. Current Hypertension Reports 1:6, 529-539
CrossRef325
Karen H Harum, Alexander H Hoon, James F Casella. (1999) Factor-V Leiden: a risk factor for cerebral palsy. Developmental Medicine & Child Neurology 41:11, 781-785
CrossRef326
John D. Busowski, A. Dwayne Jenkins, Elsa Ulfers Hale, Mary Busowski, John V. Dacus. (1999) Activated protein C resistance and lupus anticoagulant in pregnancy. The Journal of Maternal-Fetal Medicine 8:6, 298-299
CrossRef327
Carl A Hubel, James M Roberts, Robert E Ferrell. (1999) Association of pre-eclampsia with common coding sequence variations in the lipoprotein lipase gene. Clinical Genetics 56:4, 289-296
CrossRef328
Zoltan Ban, Janos Rigo, Balint Nagy. (1999) Unusual cases of severe thrombotic episodes during the peripartum period. American Journal of Obstetrics and Gynecology 181:4, 1040-1041
CrossRef329
Elvira Grandone, Maurizio Margaglione, Giovanni Di Minno. (1999) Reply. American Journal of Obstetrics and Gynecology 181:4, 1041
CrossRef330
Christianne J.M. De Groot, Kitty W.M. Bloemenkamp, Ella J. Duvekot, Frans M. Helmerhorst, Rogier M. Bertina, Felix Van Der Meer, Hans De Ronde, S.Guid Oei, Humphrey H.H. Kanhai, Frits R. Rosendaal. (1999) Preeclampsia and genetic risk factors for thrombosis: A case-control study. American Journal of Obstetrics and Gynecology 181:4, 975-980
CrossRef331
Anat Loewenstein, Michaela Goldstein, Asher Winder, Moshe Lazar, Amiram Eldor. (1999) Retinal vein occlusion associated with methylenetetrahydrofolate reductase mutation. Ophthalmology 106:9, 1817-1820
CrossRef332
T. Hatzis, E. Cardamakis, E. Drivalas, K. Makatsoris, D. Bevan, C. Pantos, V. Malliopoulou, N. Tsagaris, O. Kreatsa, T. Antoniadi, M. B. Petersen, H. Karageorgiou, H. Mantouvalos. (1999) Increased resistance to activated protein C and factor V Leiden in recurrent abortions. Review of other hypercoagulability factors. The European Journal of Contraception and Reproductive Health Care 4:3, 135-144
CrossRef333
GUSTAAF A. DEKKER. (1999) Risk Factors for Preeclampsia. Clinical Obstetrics and Gynecology 42:3, 422
CrossRef334
M. D. McColl, I. D. Walker, I. A. Greer. (1999) The role of inherited thrombophilia in venous thromboembolism associated with pregnancy. BJOG: An International Journal of Obstetrics and Gynaecology 106:8, 756-766
CrossRef335
T. Antoniadi, T. Hatzis, C. Kroupis, E. Economou-Petersen, M.B. Petersen. (1999) Prevalence of factor V Leiden, prothrombin G20210A, and MTHFR C677T mutations in a Greek population of blood donors. American Journal of Hematology 61:4, 265-267
CrossRef336
Catherine Nelson-Piercy. (1999) Inherited thrombophilia and adverse pregnancy outcome: has the time come for selective testing?. BJOG: An International Journal of Obstetrics and Gynaecology 106:6, 513-515
CrossRef337
Corral, Zuazu-Jausoro, Rivera, Gonzalez-Conejero, Ferrer, Vicente. (1999) Clinical and analytical relevance of the combination of prothrombin 20210A/A and factor V Leiden: results from a large family. British Journal of Haematology 105:2, 560-563
CrossRef338
Carsten Ranke, Hans-Joachim Trappe. (1999) Update Angiologie. Medizinische Klinik 94:5, 251-263
CrossRef339
Ian A Greer. (1999) Thrombosis in pregnancy: maternal and fetal issues. The Lancet 353:9160, 1258-1265
CrossRef340
Sibai, Baha M., . (1999) Thrombophilias and Adverse Outcomes of Pregnancy — What Should a Clinician Do?. New England Journal of Medicine 340:1, 50-52
Full Text
