Original Article
Prenatal Diagnosis of Fetal RhD Status by Molecular Analysis of Maternal Plasma
N Engl J Med 1998; 339:1734-1738December 10, 1998
- Abstract
Background
The ability to determine fetal RhD status noninvasively is useful in the treatment of RhD-sensitized pregnant women whose partners are heterozygous for the RhD gene. The recent demonstration of fetal DNA in maternal plasma raises the possibility that fetal RhD genotyping may be possible with the use of maternal plasma.
Methods
We studied 57 RhD-negative pregnant women and their singleton fetuses. DNA extracted from maternal plasma was analyzed for the RhD gene with a fluorescence-based polymerase-chain-reaction (PCR) test sensitive enough to detect the RhD gene in a single cell. Fetal RhD status was determined directly by serologic analysis of cord blood or PCR analysis of amniotic fluid.
Results
Among the 57 RhD-negative women, 12 were in their first trimester of pregnancy, 30 were in their second trimester, and 15 were in their third trimester. Thirty-nine fetuses were RhD-positive, and 18 were RhD-negative. In the samples obtained from women in their second or third trimester of pregnancy, the results of RhD PCR analysis of maternal plasma DNA were completely concordant with the results of serologic analysis. Among the maternal plasma samples collected in the first trimester, 2 contained no RhD DNA, but the fetuses were RhD-positive; the results in the other 10 samples were concordant (7 were RhD-positive, and 3 RhD-negative).
Conclusions
Noninvasive fetal RhD genotyping can be performed rapidly and reliably with the use of maternal plasma beginning in the second trimester of pregnancy.
Media in This Article
Figure 1
Sensitivity of the PCR Analysis for the Detection of RhD DNA.Figure 2
Detection of Fetal RhD DNA in Maternal Plasma.Article Activity
- Article
The Rh blood-group system is involved in hemolytic disease of the newborn, transfusion reactions, and autoimmune hemolytic anemia.1 Despite the widespread use of Rh immune globulin prophylaxis in RhD-negative pregnant women, Rh isoimmunization still occurs.2 In cases in which the father is heterozygous for the RhD gene, and the mother is RhD-negative, there is a 50 percent chance that the child will be RhD-positive. Prenatal determination of RhD status in these cases is clinically useful because no further testing or therapeutic procedures will be necessary if the fetus is RhD-negative. If the fetus is RhD-positive, further studies will be necessary to determine the level of fetal hemolysis (e.g., by fetal-blood sampling).
The human RhD gene3 has been cloned, and it is absent in RhD-negative subjects.4 Fetal RhD status has been determined in samples of amniotic fluid and chorionic villi with the use of techniques based on the polymerase chain reaction (PCR).5 However, because of the invasive means by which such samples are obtained, these approaches increase the risk of further sensitizing the mother. To circumvent this risk, several groups have investigated the possibility of determining fetal RhD status through the use of fetal cells isolated from maternal blood.6-9 The main problem with this approach is that the procedures needed to isolate sufficient numbers of fetal cells from maternal blood are time consuming, technically demanding, and expensive.7,8 An alternative approach based on the detection of RhD messenger RNA in fetal nucleated red cells has also been described,10 but the small number of subjects analyzed precludes any firm conclusion as to the reliability of this method.
In a recent study, we identified fetal DNA in maternal plasma and serum.11 Therefore, in the current study, we assessed the feasibility of fetal RhD genotyping using fetal DNA extracted from plasma samples from RhD-negative pregnant women.
Methods
Subjects
We collected 10-ml blood samples from 30 blood donors who were positive on serologic testing for RhD and 30 blood donors who were negative at the Department of Hematology, John Radcliffe Hospital, Oxford, United Kingdom. We used these samples to establish the accuracy of the RhD PCR system.
To assess the value of the system for prenatal diagnosis, we collected 10-ml blood samples from 57 women with singleton pregnancies who were patients at the Nuffield Department of Obstetrics and Gynecology, John Radcliffe Hospital. Twelve women were in the first trimester of pregnancy (7 to 14 weeks), 30 were in the second trimester (15 to 23 weeks), and 15 were in the third trimester (37 to 41 weeks). Ten were primigravidas. The blood samples were collected from the women who were in the first trimester of pregnancy during a routine prenatal checkup. Blood samples from the women in their second trimester were collected just before routine amniocentesis; 10 ml of amniotic fluid was also collected for fetal RhD genotyping. The blood samples were collected from the women in their third trimester just before delivery. For the women who were studied during the first and third trimesters, a sample of cord blood was collected after delivery for the determination of fetal RhD status by serologic methods. The project was approved by the Central Oxfordshire Research Ethics Committee, and all the women gave informed consent.
Preparation of Samples
The blood samples were collected in tubes containing EDTA and centrifuged at 3000×g, and the plasma was then transferred into plain polypropylene tubes, with care taken to ensure that the buffy coat was not disturbed. The buffy coat was then removed and stored at –20°C until further processing. The plasma samples were recentrifuged at 3000×g, and the supernatants were stored at –20°C until further processing.
DNA Extraction
DNA was extracted from samples of plasma (800 μl), buffy coat, and amniotic fluid (200 μl each) with a QIAamp Blood Kit (Qiagen, Hilden, Germany) according to the “blood and body fluid protocol” recommended by the manufacturer.12 An elution volume of 50 μl was used for the final washing of the DNA from the column.
Real-Time Fluorogenic PCR Analysis
Real-time fluorogenic PCR analysis was performed with a Perkin–Elmer Sequence Detector (model 7700, Perkin–Elmer Applied Biosystems, Foster City, Calif.), which is a combined thermal cycler and fluorescence detector with the ability to monitor the progress of individual PCR reactions optically.13 The RhD fluorogenic PCR system consisted of the amplification primers RD-A (5'CCTCTCACTGTTGCCTGCATT3') and RD-B (5'AGTGCCTGCGCGAACATT3') and a dual-labeled fluorescent probe, RD-T (5'(FAM)TACGTGAGAAACGCTCATGACAGCAAAGTCT(TAMRA)3'; FAM [6 carboxyfluorescein] and TAMRA [6 carboxytetramethylrhodamine] were the fluorescent reporter dye and quencher dye, respectively).13 The primers and probe were targeted toward the 3' untranslated region (exon 10) of the RhD gene.3 The β-globin PCR system consisted of the amplification primers and probe as previously described.14 The fluorescent probes contained a 3'-blocking phosphate group to prevent extension of the probe during the PCR. Combinations of primers and probes were designed with Primer Express software (Perkin–Elmer). Sequence data for the RhD gene were obtained from the GenBank data base (accession number, X63097).
The fluorogenic PCR reactions were set up according to the manufacturer's instructions in a reaction volume of 50 μl with all components except the fluorescent probes and amplification primers obtained from a TaqMan PCR Core Reagent Kit (Perkin–Elmer). The RhD and β-globin fluorescent probes were custom-synthesized by Perkin–Elmer and were used at concentrations of 25 nM and 100 nM, respectively. The PCR primers were synthesized by Life Technologies (Gaithersburg, Md.) and were used at a concentration of 300 nM. A total of 5 μl of the extracted plasma or amniotic fluid DNA was used for amplification; for buffy-coat DNA, 10 ng was used. DNA amplifications were carried out in 96-well reaction plates that were designed to capture optical data (Perkin–Elmer).
Thermal cycling was initiated with a two-minute period of incubation at 50°C to allow time for the enzyme uracil N-glycosylase, which destroys any contaminating PCR amplicons, to act. This step was followed by initial denaturation for 10 minutes at 95°C and then by 40 cycles of denaturation at 95°C for 15 seconds and reannealing and extension for 1 minute at 60°C.
Amplification data collected by the Sequence Detector and stored in a Macintosh computer (Apple, Cupertino, Calif.) were analyzed with Sequence Detection System software (Perkin–Elmer). The threshold of detection was set at 10 SD above the mean base-line fluorescence calculated from cycles 1 to 15.13 An amplification reaction in which the intensity of fluorescence increased above the threshold during the course of thermal cycling was defined as a positive reaction.
Anticontamination Measures
Strict precautions against contamination of the PCR assay were used.15 Aerosol-resistant pipette tips were used to handle all liquids. Separate areas were used to set up amplification reactions, add DNA template, and carry out amplification reactions. The use of the Sequence Detector offered an extra level of protection in that its optical-detection system obviated the need to reopen the reaction tubes after the completion of the amplification reactions, thus minimizing the possibility of carryover contamination. In addition, the PCR assay included a further anticontamination measure in the form of preamplification treatment with uracil N-glycosylase, which destroyed uracil-containing PCR products.16 Multiple water blanks were included as negative controls in every analysis.
Results
The RhD PCR system was used to genotype buffy-coat DNA extracted from the 30 RhD-positive blood donors and the 30 RhD-negative blood donors. There was complete concordance between the results of RhD PCR genotyping and the serologic results.
To determine the sensitivity of fluorogenic RhD PCR analysis, genomic DNA from an RhD-positive subject was diluted serially both in water and in 1 μg of genomic DNA from an RhD-negative subject. The smaller the amount of DNA, the more amplification cycles were needed to produce detectable amounts of fluorescent reporter molecules (Figure 1Figure 1
Sensitivity of the PCR Analysis for the Detection of RhD DNA.). Positive signals were detected with as little DNA as the approximate amount (7.8 pg) contained in a single RhD-positive cell.All 57 of the pregnant women were RhD-negative on serologic testing. Analysis of DNA extracted from buffy-coat samples from the 45 women who were in the second or third trimester of pregnancy revealed no RhD DNA, a finding in agreement with the serologic results. Among the 57 fetuses, 39 were RhD-positive and 18 were RhD-negative on serologic analysis of cord blood or PCR testing of amniotic fluid.
The results of the RhD PCR assay of plasma samples from the 57 women are shown in Table 1Table 1
Results of RhD Genotyping of Fetuses of RhD-Negative Women with the Use of the RhD PCR Assay.. Representative amplification data are shown in Figure 2Figure 2Detection of Fetal RhD DNA in Maternal Plasma.. Among the women who were in the second or third trimester of pregnancy, there was complete concordance between results of the fetal RhD genotyping with use of the RhD PCR assay of maternal plasma samples and the results obtained from genotyping of amniotic fluid or serologic testing of cord blood. Plasma samples from two women in the first trimester of pregnancy who were carrying RhD-positive fetuses, with gestational ages of eight and nine weeks, yielded false negative results. The results in the other 10 women in their first trimester of pregnancy were concordant: 7 were RhD-positive on PCR testing and had RhD-positive fetuses, and 3 were RhD-negative on PCR testing and had RhD-negative fetuses. Forty-seven of the 57 subjects had had previous pregnancies.As a control for the amplifiability of DNA extracted from maternal plasma, the samples were also subjected to the β-globin PCR assay. The signal was positive in all 57 samples of maternal plasma DNA.
Discussion
Our study demonstrates the feasibility of fetal RhD genotyping with the use of DNA extracted from maternal plasma. This type of analysis should be very useful for the treatment of sensitized RhD-negative women whose partners are heterozygous for the RhD gene. If testing shows that the fetus is RhD-negative, the parents can be reassured that the fetus is not at risk. On the other hand, if testing shows that the fetus is RhD-positive, treatment can be planned. The advantage of this test, which analyzes maternal plasma, is that neither the mother nor the fetus is exposed to the risks normally associated with amniocentesis or chorionic-villus sampling.17 An additional important advantage of this approach is the avoidance of further immunologic sensitization as a result of fetomaternal hemorrhage after invasive procedures.18,19
Our data suggest that the results of the RhD PCR test are reliable beginning in the second trimester. The availability of such early, reliable results gives clinicians sufficient time to plan for further tests or treatment such as fetal-blood sampling and fetal transfusion,20,21 which are usually performed beginning in the middle of the second trimester. The results for two first-trimester samples were false negative, presumably because of the low concentration of fetal DNA in maternal plasma at that time.14
This test may also have an application in the routine testing of nonsensitized RhD-negative pregnant women. If the fetus is found to be RhD-negative, then unnecessary use of RhD immune globulin can be avoided.22
From the data obtained so far, analysis of fetal DNA in maternal plasma does not appear to be affected by the persistence of fetal cells from previous pregnancies.23 For example, we found no false positive results in plasma from women who had been pregnant before and who were carrying RhD-negative fetuses in the current pregnancy. This finding is consistent with our previous data obtained using Y-chromosome–specific PCR testing: there were no false positive results in women who had previously been pregnant with a male fetus.14
Because of the high concentration of fetal DNA in maternal plasma,14 the results of fetal genotyping of DNA extracted from maternal plasma are more reliable than those obtained by fetal genetic analysis of the cellular fraction of maternal blood. It also does not rely on the isolation of fetal cells, which requires the use of specialized, time-consuming, and technically demanding techniques such as cell sorting24 and micromanipulation.25 The high sensitivity of our PCR system is most likely the result of the use of an efficient protocol for the extraction of DNA and a fluorescence-based DNA system of amplification detection. Our current protocol for the extraction of DNA allows us to use eight times as much plasma DNA per amplification as was used in our previous study.11
The method that we used has a number of advantages. First, it is based on an optical system of detection that obviates the need for any postamplification manipulation or analysis of samples. Second, the system is efficient, because the amplification and product-detection steps are combined. This allows 96 samples to be analyzed within a period of two hours. Even when one factors in the time needed to extract DNA from plasma, this method of fetal genotyping can easily be performed in one day. The brevity of this method should facilitate efficient clinical decision making and decrease the time that sensitized RhD-negative women spend waiting to learn the RhD status of their fetuses.
The Rh family of polypeptides is encoded by two related genes: the RhCE gene and the RhD gene.3,26 Because of the genetic complexity of the Rh system, several primer sets have been described for use in RhD genotyping.5,6,27 The extent of agreement between the results of genotyping and serologic results is high, although the results can be discordant, possibly because of the existence of uncommon polymorphisms.27
Our findings indicate that the results of genotyping of fetal DNA extracted from maternal plasma are accurate and can potentially be used for the diagnosis of many disorders involving single genes. This approach may also be used to identify disorders such as cystic fibrosis and β-thalassemia in families in which the father and mother carry different mutations.28
Drs. Lo and Hjelm are supported by the Hong Kong Research Grants Council.
Drs. Lo and Wainscoat have applied for a patent for the RhD test procedure described in this paper.
We are indebted to J. Zhang for technical help.
Source Information
From the Department of Chemical Pathology, Chinese University of Hong Kong, Prince of Wales Hospital, Hong Kong, China (Y.M.D.L., N.M.H., P.M.K.P.); and the Department of Hematology (C.F., M.F.M., J.S.W.) and the Nuffield Department of Obstetrics and Gynecology (I.L.S., P.F.C., C.W.G.R.), John Radcliffe Hospital, Oxford, United Kingdom.
Address reprint requests to Dr. Lo at the Department of Chemical Pathology, Rm. 38023, Clinical Sciences Bldg., Prince of Wales Hospital, 30–32 Ngan Shing St., Hong Kong, China.
- References
References
1
Mollison PL, Engelfriet CP, Contreras M. Blood transfusion in clinical medicine. 9th ed. Oxford, England: Blackwell Scientific, 1993:204-45.
2
Clarke CA ,Whitfield AG ,Mollison PL . Deaths from Rh haemolytic disease in England and Wales in 1984 and 1985. BMJ 1987;294:1001-1001
CrossRef | Web of Science | Medline3
Le Van Kim C ,Mouro I ,Cherif-Zahar B , et al. Molecular cloning and primary structure of the human blood group RhD polypeptide. Proc Natl Acad Sci U S A 1992;89:10925-10929
CrossRef | Web of Science | Medline4
Colin Y ,Cherif-Zahar B ,Le Van Kim C ,Raynal V ,Van Huffel V ,Cartron J-P . Genetic basis of the RhD-positive and RhD-negative blood group polymorphism as determined by Southern analysis. Blood 1991;78:2747-2752
Web of Science | Medline5
Bennett PR ,Le Van Kim C ,Colin Y , et al. Prenatal determination of fetal RhD type by DNA amplification. N Engl J Med 1993;329:607-610
Full Text | Web of Science | Medline6
Lo YMD ,Bowell PJ ,Selinger M , et al. Prenatal determination of fetal RhD status by analysis of peripheral blood of rhesus negative mothers. Lancet 1993;341:1147-1148
CrossRef | Web of Science | Medline7
Geifman-Holtzman O ,Bernstein IM ,Berry SM , et al. Fetal RhD genotyping in fetal cells flow sorted from maternal blood. Am J Obstet Gynecol 1996;174:818-822
CrossRef | Web of Science | Medline8
Sekizawa A ,Watanabe A ,Kimura T ,Saito H ,Yanaihara T ,Sato T . Prenatal diagnosis of the fetal RhD blood type using a single fetal nucleated erythrocyte from maternal blood. Obstet Gynecol 1996;87:501-505
CrossRef | Web of Science | Medline9
Toth T ,Papp C ,Toth-Pal E ,Nagy B ,Papp Z . Fetal RhD genotyping by analysis of maternal blood: a case report. J Reprod Med 1998;43:219-222
Web of Science | Medline10
Hamlington J ,Cunningham J ,Mason G ,Mueller R ,Miller D . Prenatal detection of rhesus D genotype. Lancet 1997;349:540-540
CrossRef | Web of Science | Medline11
Lo YMD ,Corbetta N ,Chamberlain PF , et al. Presence of fetal DNA in maternal plasma and serum. Lancet 1997;350:485-487
CrossRef | Web of Science | Medline12
Chen XQ ,Stroun M ,Magnenat J-L , et al. Microsatellite alterations in plasma DNA of small cell lung cancer patients. Nat Med 1996;2:1033-1035
CrossRef | Web of Science | Medline13
Heid CA ,Stevens J ,Livak KJ ,Williams PM . Real time quantitative PCR. Genome Res 1996;6:986-994
CrossRef | Web of Science | Medline14
Lo YMD ,Tein MSC ,Lau TK , et al. Quantitative analysis of fetal DNA in maternal plasma and serum: implications for noninvasive prenatal diagnosis. Am J Hum Genet 1998;62:768-775
CrossRef | Web of Science | Medline15
Kwok S ,Higuchi R . Avoiding false positives with PCR. Nature 1989;339:237-238[Erratum, Nature 1989;339:490.]
CrossRef | Web of Science | Medline16
Longo MC ,Berninger MS ,Hartley JL . Use of uracil DNA glycosylase to control carry-over contamination in polymerase chain reactions. Gene 1990;93:125-128
CrossRef | Web of Science | Medline17
The Canadian Collaborative CVS-Amniocentesis Clinical Trial Group
Web of Science | Medline18
Blakemore KJ ,Baumgarten A ,Schoenfeld-Dimaio M ,Hobbins JC ,Mason EA ,Mahoney MJ . Rise in maternal serum alpha-fetoprotein concentration after chorionic villus sampling and the possibility of isoimmunization. Am J Obstet Gynecol 1986;155:988-993
Web of Science | Medline19
Tabor A ,Bang J ,Norgaard-Pedersen B . Feto-maternal haemorrhage associated with genetic amniocentesis: results of a randomized trial. Br J Obstet Gynaecol 1987;94:528-534
CrossRef | Medline20
Dildy GA ,Jackson GM ,Ward K . Determination of fetal RhD status from uncultured amniocytes. Obstet Gynecol 1996;88:207-210
CrossRef | Web of Science | Medline21
Schumacher B ,Moise KJ Jr . Fetal transfusion for red blood cell alloimmunization in pregnancy. Obstet Gynecol 1996;88:137-150
CrossRef | Web of Science | Medline22
Robson SC ,Lee D ,Urbaniak S . Anti-D immunoglobulin in RhD prophylaxis. Br J Obstet Gynaecol 1998;105:129-134
CrossRef | Medline23
Bianchi DW ,Zickwolf GK ,Weil GJ ,Sylvester S ,DeMaria MA . Male fetal progenitor cells persist in maternal blood for as long as 27 years postpartum. Proc Natl Acad Sci U S A 1996;93:705-708
CrossRef | Web of Science | Medline24
Bianchi DW ,Flint AF ,Pizzimenti MF ,Knoll JH ,Latt SA . Isolation of fetal DNA from nucleated erythrocytes in maternal blood. Proc Natl Acad Sci U S A 1990;87:3279-3283
CrossRef | Web of Science | Medline25
Cheung MC ,Goldberg JD ,Kan YW . Prenatal diagnosis of sickle cell anaemia and thalassaemia by analysis of fetal cells in maternal blood. Nat Genet 1996;14:264-268
CrossRef | Web of Science | Medline26
Cherif-Zahar B ,Bloy C ,Le Van Kim C , et al. Molecular cloning and protein structure of a human blood group Rh polypeptide. Proc Natl Acad Sci U S A 1990;87:6243-6247
CrossRef | Web of Science | Medline27
Aubin JT ,Le Van Kim C ,Mouro I , et al. Specificity and sensitivity of RhD genotyping methods by PCR-based DNA amplification. Br J Haematol 1997;98:356-364
CrossRef | Web of Science | Medline28
Lo YMD ,Fleming KA ,Wainscoat JS . Strategies for the detection of autosomal fetal DNA sequence from maternal peripheral blood. Ann N Y Acad Sci 1994;731:204-213
CrossRef | Web of Science | Medline
- Citing Articles (185)
Citing Articles
1
Linnea M Baudhuin, Leslie J Donato, Timothy S Uphoff. (2012) How novel molecular diagnostic technologies and biomarkers are revolutionizing genetic testing and patient care. Expert Review of Molecular Diagnostics 12:1, 25-37
CrossRef2
C. Jungbauer. (2011) Blood group molecular genotyping. ISBT Science Series 6:2, 399-403
CrossRef3
Osama Azmy, Eman Shahin, Tamer Taha, Maged Abu Seada, Waleed El-Tantawy, Mahmoud El-Shorbagy, Wael El-Garf. (2011) Detection of cell-free fetal DNA in plasma of pregnant women using multiplex quantitative fluorescent-PCR. Medical Research Journal 10:2, 54-62
CrossRef4
J.B. Geigl, M.R. Speicher. (2011) Nichtinvasive molekulargenetische Methoden in der pränatalen Diagnostik. medizinische genetik 23:4, 485-490
CrossRef5
Gary J. W. Liao, Rossa W. K. Chiu, Y. M. Dennis Lo. (2011) Prenatal assessment of fetal chromosomal and genetic disorders through maternal plasma DNA analysis. Pathology1
CrossRef6
Frederik Banch Clausen, Mette Christiansen, Rudi Steffensen, Steffen Jørgensen, Christian Nielsen, Marianne Antonius Jakobsen, Rikke Dyhrberg Madsen, Karina Jensen, Grethe Risum Krog, Klaus Rieneck, Ulrik Sprogøe, Keld Mikkelsen Homburg, Niels Grunnet, Morten Hanefeld Dziegiel. (2011) Report of the first nationally implemented clinical routine screening for fetal RHD in D− pregnant women to ascertain the requirement for antenatal RhD prophylaxis. Transfusionno-no
CrossRef7
Grethe Risum Krog, Frederik Banch Clausen, Adela Berkowicz, Lone Jørgensen, Klaus Rieneck, Leif Kofoed Nielsen, Morten Hanefeld Dziegiel. (2011) Is current serologic RhD typing of blood donors sufficient for avoiding immunization of recipients? (CME). Transfusion 51:11, 2278-2285
CrossRef8
YM Lo, Rossa WK Chiu. (2011) Plasma nucleic acid analysis by massively parallel sequencing: pathological insights and diagnostic implications. The Journal of Pathology 225:3, 318-323
CrossRef9
P. Tasinato, M. Montisci, G. te Kronnie, G. Basso. (2011) Non-medical applications of non-invasive prenatal diagnosis: Ethical issues. Forensic Science International: Genetics Supplement Series
CrossRef10
Yuk Ming Dennis Lo. (2011) Fetal nucleic acids in maternal blood: the promises. Clinical Chemistry and Laboratory Medicine---
CrossRef11
P. Metcalfe, P. Rigsby, E. Tait, S. Urbaniak. (2011) An international reference reagent for the detection of RHD and SRY DNA in plasma. Vox Sanguinisno-no
CrossRef12
Qinyu Ge, Hailing Li, Qi Yang, Jiafeng Lu, Jing Tu, Yunfei Bai, Zuhong Lu. (2011) Sequencing circulating miRNA in maternal plasma with modified library preparation. Clinica Chimica Acta 412:21-22, 1989-1994
CrossRef13
C. Boyon, D. Vinatier. (2011) Microchimérisme fœtal : soi et non soi, finalement qui sommes-nous ?. Journal de Gynécologie Obstétrique et Biologie de la Reproduction 40:5, 387-398
CrossRef14
Christof Jungbauer. (2011) Routine use of DNA testing for red cell antigens in blood centres. Transfusion and Apheresis Science 45:1, 61-68
CrossRef15
Corinne Rusterholz, Marianne Messerli, Irene Hoesli, Sinuhe Hahn. (2011) Placental Microparticles, DNA, and RNA in Preeclampsia. Hypertension in Pregnancy 30:3, 364-375
CrossRef16
Allan T. Bombard, Ranjit Akolekar, Daniel H. Farkas, Anna L. VanAgtmael, Frank Aquino, Paul Oeth, Kypros H. Nicolaides. (2011) Fetal RHD genotype detection from circulating cell-free fetal DNA in maternal plasma in non-sensitized RhD negative women. Prenatal Diagnosis 31:8, 802-808
CrossRef17
C. E. Butler, E. L. Dickens. (2011) Transfusion tomorrow: Royal College of Pathologists, November 2010. Transfusion Medicine 21:4, 224-230
CrossRef18
M Hill, K Finning, P Martin, J Hogg, C Meaney, G Norbury, G Daniels, LS Chitty. (2011) Non-invasive prenatal determination of fetal sex: translating research into clinical practice. Clinical Genetics 80:1, 68-75
CrossRef19
N. R. Treff, X. Tao, J. Su, A. Lonczak, L. E. Northrop, A. A. Ruiz, R. T. Scott. (2011) Tracking embryo implantation using cell-free fetal DNA enriched from maternal circulation at 9 weeks gestation. Molecular Human Reproduction 17:7, 434-438
CrossRef20
Katerina Kotlabova, Jindrich Doucha, Ilona Hromadnikova. (2011) Placental-specific microRNA in maternal circulation – identification of appropriate pregnancy-associated microRNAs with diagnostic potential. Journal of Reproductive Immunology 89:2, 185-191
CrossRef21
Rossa W.K. Chiu, Y.M. Dennis Lo. (2011) Non-invasive prenatal diagnosis by fetal nucleic acid analysis in maternal plasma: the coming of age. Seminars in Fetal and Neonatal Medicine 16:2, 88-93
CrossRef22
P. Bricca, E. Guinchard, C. Guitton Bliem. (2011) Prise en charge des allo-immunisations fœto-maternelles antiérythrocytaires. Transfusion Clinique et Biologique 18:2, 269-276
CrossRef23
Elisavet A Papageorgiou, Alex Karagrigoriou, Evdokia Tsaliki, Voula Velissariou, Nigel P Carter, Philippos C Patsalis. (2011) Fetal-specific DNA methylation ratio permits noninvasive prenatal diagnosis of trisomy 21. Nature Medicine 17:4, 510-513
CrossRef24
Alfred Ian Lee, Richard M. Kaufman. (2011) Transfusion Medicine and the Pregnant Patient. Hematology/Oncology Clinics of North America 25:2, 393-413
CrossRef25
Jan M. M. van Lith, Beryl R. Benacerraf, Simcha Yagel. (2011) Current controversies in prenatal diagnosis 2: Down syndrome screening: Is ultrasound better than cell-free nucleic acids in maternal blood?. Prenatal Diagnosis 31:3, 231-234
CrossRef26
Yingying Du, Jin Zhang, Huijun Wang, Xiaoling Yan, Yingjun Yang, Lu Yang, Xin Luo, Yating Chen, Tao Duan, Duan Ma. (2011) Hypomethylated DSCR4 is a placenta-derived epigenetic marker for trisomy 21. Prenatal Diagnosis 31:2, 207-214
CrossRef27
Frederik Banch Clausen, Grethe Risum Krog, Klaus Rieneck, Emma Elin Frida Råsmark, Morten Hanefeld Dziegiel. (2011) Evaluation of Two Real-Time Multiplex PCR Screening Assays Detecting Fetal <i>RHD</i> in Plasma from RhD Negative Women to Ascertain the Requirement for Antenatal RhD Prophylaxis. Fetal Diagnosis and Therapy 29:2, 155-163
CrossRef28
Young-Ho Yang, Sung-Hee Han, Kyoung-Ryul Lee. (2011) Noninvasive Prenatal Diagnosis using Cell-Free Fetal DNA in Maternal Plasma: Clinical Applications. Journal of Genetic Medicine 8:1, 1
CrossRef29
Daphne R.T. Amaral, Débora C. Credidio, Jordão Pellegrino, Lilian Castilho. (2011) Fetal RHD genotyping by analysis of maternal plasma in a mixed population. Journal of Clinical Laboratory Analysis 25:2, 100-104
CrossRef30
Ranjit Akolekar, Kirstin Finning, Ramesh Kuppusamy, Geoff Daniels, Kypros H. Nicolaides. (2011) Fetal <i>RHD</i> Genotyping in Maternal Plasma at 11–13 Weeks of Gestation. Fetal Diagnosis and Therapy 29:4, 301-306
CrossRef31
Y. M. D. Lo, K. C. A. Chan, H. Sun, E. Z. Chen, P. Jiang, F. M. F. Lun, Y. W. Zheng, T. Y. Leung, T. K. Lau, C. R. Cantor, R. W. K. Chiu. (2010) Maternal Plasma DNA Sequencing Reveals the Genome-Wide Genetic and Mutational Profile of the Fetus. Science Translational Medicine 2:61, 61ra91-61ra91
CrossRef32
Y.M. Dennis Lo, Rossa W.K. Chiu. (2010) Noninvasive Approaches to Prenatal Diagnosis of Hemoglobinopathies Using Fetal DNA in Maternal Plasma. Hematology/Oncology Clinics of North America 24:6, 1179-1186
CrossRef33
L. Zejskova, T. Jancuskova, K. Kotlabova, J. Doucha, I. Hromadnikova. (2010) Feasibility of fetal-derived hypermethylated RASSF1A sequence quantification in maternal plasma — Next step toward reliable non-invasive prenatal diagnostics. Experimental and Molecular Pathology 89:3, 241-247
CrossRef34
Floriana Della Ragione, Paola Mastrovito, Ciro Campanile, Anna Conti, Elisavet A. Papageorgiou, Maj A. Hultén, Philippos C. Patsalis, Nigel P. Carter, Maurizio D'Esposito. (2010) Differential DNA Methylation as a Tool for Noninvasive Prenatal Diagnosis (NIPD) of X Chromosome Aneuploidies. The Journal of Molecular Diagnostics 12:6, 797-807
CrossRef35
Dan Handley, David G Peters. (2010) Noninvasive prenatal chromosomal aneuploidy detection using plasma cell-free nucleic acid. Expert Review of Obstetrics & Gynecology 5:5, 581-590
CrossRef36
Mahesh Choolani, Jerry Chan, Nicholas M. Fisk. (2010) Fetal therapy: 2020 and beyond. Prenatal Diagnosis 30:7, 699-701
CrossRef37
K Gutensohn, SP Müller, K Thomann, W Stein, A Suren, S Körtge-Jung, G Schlüter, TJ Legler. (2010) Diagnostic accuracy of noninvasive polymerase chain reaction testing for the determination of fetal rhesus C, c and E status in early pregnancy. BJOG: An International Journal of Obstetrics & Gynaecology 117:6, 722-729
CrossRef38
Aggeliki Kolialexi, Georgia Tounta, Ariadni Mavrou. (2010) Noninvasive fetal RhD genotyping from maternal blood. Expert Review of Molecular Diagnostics 10:3, 285-296
CrossRef39
Ana Bustamante-Aragones, Cristina Gonzalez-Gonzalez, Marta Rodriguez de Alba, Eva Ainse, Carmen Ramos. (2010) Noninvasive prenatal diagnosis using ccffDNA in maternal blood: state of the art. Expert Review of Molecular Diagnostics 10:2, 197-205
CrossRef40
Y.M. Dennis Lo, Ivy H.N. Wong, Nancy B.Y. Tsui, Ching-Wan Lam. 2009. Molecular Biological Analyses and Molecular Pathology in Clinical Chemistry. .
CrossRef41
Cornelis L. Harteveld, Marina Kleanthous, Joanne Traeger-Synodinos. (2009) Prenatal diagnosis of hemoglobin disorders: Present and future strategies. Clinical Biochemistry 42:18, 1767-1779
CrossRef42
N. B. Y. Tsui, Y. M. D. Lo. (2009) Non-invasive detection of foetal RhD status and other genetic characteristics by circulating nucleic acids in maternal plasma. ISBT Science Series 4:n2, 245-250
CrossRef43
Thomas Klonisch, Régen Drouin. (2009) Fetal–maternal exchange of multipotent stem/progenitor cells: microchimerism in diagnosis and disease. Trends in Molecular Medicine 15:11, 510-518
CrossRef44
Tianjiao Chu, Brian Burke, Kimberly Bunce, Urvashi Surti, W. Allen Hogge, David G. Peters. (2009) A microarray-based approach for the identification of epigenetic biomarkers for the noninvasive diagnosis of fetal disease. Prenatal Diagnosis 29:11, 1020-1030
CrossRef45
X. D. Wang, B. L. Wang, S. L. Ye, Y. Q. Liao, L. F. Wang, Z. M. He. (2009) Non-invasive foetal RHD genotyping via real-time PCR of foetal DNA from Chinese RhD-negative maternal plasma. European Journal of Clinical Investigation 39:7, 607-617
CrossRef46
Ilona Hromadnikova, Martina Benesova, Lenka Zejskova, Jana Stehnova, Jindrich Doucha, Petr Sedlacek, Klara Dlouha, Ladislav Krofta. (2009) The Effect of DYS-14 Copy Number Variations on Extracellular Fetal DNA Quantification in Maternal Circulation. DNA and Cell Biology 28:7, 351-358
CrossRef47
Wen-bo WANG, Yi ZHANG, Shu-han SUN. (2009) Prenatal diagnosis value of free fetal DNA in maternal blood. Academic Journal of Second Military Medical University 29:4, 442-446
CrossRef48
Y.M. Dennis Lo, Rossa W.K. Chiu. (2009) Nicht-invasive pränatale Diagnostik fetaler chromosomaler Aneuploidien mittels Nukleinsäureanalyse des mütterlichen Plasmas / Noninvasive prenatal diagnosis of fetal chromosomal aneuploidies by maternal plasma nucleic acid analysis 1). LaboratoriumsMedizin 33:3, 159-165
CrossRef49
Dong-ling Tang, Yan Li, Xin Zhou, Xia Li, Fang Zheng. (2009) Multiplex fluorescent PCR for noninvasive prenatal detection of fetal-derived paternally inherited diseases using circulatory fetal DNA in maternal plasma. European Journal of Obstetrics & Gynecology and Reproductive Biology 144:1, 35-39
CrossRef50
Elisavet A. Papageorgiou, Heike Fiegler, Vardhman Rakyan, Stephan Beck, Maj Hulten, Klea Lamnissou, Nigel P. Carter, Philippos C. Patsalis. (2009) Sites of Differential DNA Methylation between Placenta and Peripheral Blood. The American Journal of Pathology 174:5, 1609-1618
CrossRef51
Vijayakrishna K. Gadi. (2009) Fetal microchimerism and cancer. Cancer Letters 276:1, 8-13
CrossRef52
Simon Grill, Irina Banzola, Ying Li, Tea Rekhviashvili, Tobias J. Legler, Sina P. Müller, Xiao Yan Zhong, Sinuhe Hahn, Wolfgang Holzgreve. (2009) High throughput non-invasive determination of foetal Rhesus D status using automated extraction of cell-free foetal DNA in maternal plasma and mass spectrometry. Archives of Gynecology and Obstetrics 279:4, 533-537
CrossRef53
Karoline Freeman, Ala Szczepura, Leeza Osipenko. (2009) Non-invasive fetal RHD genotyping tests: A systematic review of the quality of reporting of diagnostic accuracy in published studies. European Journal of Obstetrics & Gynecology and Reproductive Biology 142:2, 91-98
CrossRef54
Neil D. Avent. (2009) Large-scale blood group genotyping - clinical implications. British Journal of Haematology 144:1, 3-13
CrossRef55
YMD Lo. (2009) Noninvasive prenatal detection of fetal chromosomal aneuploidies by maternal plasma nucleic acid analysis: a review of the current state of the art. BJOG: An International Journal of Obstetrics & Gynaecology 116:2, 152-157
CrossRef56
Timothy H. Rainer, Allen K.C. Chan, Larry L.Y. Lee, Veronica W.T. Yim, Nicole Y.L. Lam, S.W. Yeung, Colin A. Graham, Dennis Y.M. Lo. (2008) Use of plasma DNA to predict mortality and need for intensive care in patients with abdominal pain. Clinica Chimica Acta 398:1-2, 113-117
CrossRef57
Irina Banzola, Inès Kaufmann, Olav Lapaire, Sinuhe Hahn, Wolfgang Holzgreve, Corinne Rusterholz. (2008) Isolation of serum nucleic acids for fetal DNA analysis: comparison of manual and automated extraction methods. Prenatal Diagnosis 28:13, 1227-1231
CrossRef58
Ossie Geifman-Holtzman, Janet Ober Berman. (2008) Prenatal diagnosis: update on invasive versus noninvasive fetal diagnostic testing from maternal blood. Expert Review of Molecular Diagnostics 8:6, 727-751
CrossRef59
Sina P. Müller, Iris Bartels, Werner Stein, Günther Emons, Kai Gutensohn, Michael Köhler, Tobias J. Legler. (2008) The determination of the fetal D status from maternal plasma for decision making on Rh prophylaxis is feasible. Transfusion 48:11, 2292-2301
CrossRef60
Miho Tanigawa, Hiroshi Miyoshi, Osamu Samura, Keizo Sugino, Naoya Fujito, Maki Hyodo, Norio Miharu, Yoshiki Kudo. (2008) Cell-free fetal DNA in the non-pregnant woman with thyroid disease disappeared after surgery. Clinica Chimica Acta 397:1-2, 101-102
CrossRef61
C. F. Wright, H. Burton. (2008) The use of cell-free fetal nucleic acids in maternal blood for non-invasive prenatal diagnosis. Human Reproduction Update 15:1, 139-151
CrossRef62
Kenneth J. Moise. (2008) Management of Rhesus Alloimmunization in Pregnancy. Obstetrics & Gynecology 112:1, 164-176
CrossRef63
Machiko Kimura, Chiaki Sato, Masaaki Hara, Osamu Ishihara, Kenji Ikebuchi. (2008) Noninvasive fetal RHD genotyping by maternal plasma with capillary electrophoresis. Transfusion 48:6, 1156-1163
CrossRef64
F M. Ndumbe, O Navti, V N. Chilaka, J C. Konje. (2008) Prenatal Diagnosis in the First Trimester of Pregnancy. Obstetrical & Gynecological Survey 63:5, 317-328
CrossRef65
C. Ellen van der Schoot, Sinuhe Hahn, Lyn S. Chitty. (2008) Non-invasive prenatal diagnosis and determination of fetal Rh status. Seminars in Fetal and Neonatal Medicine 13:2, 63-68
CrossRef66
Ying Li, Kirstin Finning, Geoff Daniels, Sinuhe Hahn, Xiaoyan Zhong, Wolfgang Holzgreve. (2008) Noninvasive genotyping fetal Kell blood group (KEL1) using cell-free fetal DNA in maternal plasma by MALDI-TOF mass spectrometry. Prenatal Diagnosis 28:3, 203-208
CrossRef67
J. C. Goebel, P. Soergel, M. Pruggmayer, K. Mühlhaus, M. Stuhrmann, A. Scharf. (2008) Prenatal diagnosis of the Rhesus D fetal blood type on amniotic fluid in daily practice. Archives of Gynecology and Obstetrics 277:2, 155-160
CrossRef68
Michael F. Murphy, Lorna M. Williamson. (2008) Antenatal screening for fetomaternal alloimmune thrombocytopenia: an evaluation using the criteria of the uk national screening committee. British Journal of Haematology 111:3, 726
CrossRef69
Dana W. Y. Tsui, K. C. Allen Chan, Stephen S. C. Chim, Lin-wai Chan, Tak-yeung Leung, Tze-kin Lau, Y. M. Dennis Lo, Rossa W. K. Chiu. (2007) Quantitative aberrations of hypermethylatedRASSF1A gene sequences in maternal plasma in pre-eclampsia. Prenatal Diagnosis 27:13, 1212-1218
CrossRef70
Akihiko Sekizawa, Yuditiya Purwosunu, Ryu Matsuoka, Keiko Koide, Shiho Okazaki, Antonio Farina, Hiroshi Saito, Takashi Okai. (2007) Recent advances in non-invasive prenatal DNA diagnosis through analysis of maternal blood. Journal of Obstetrics and Gynaecology Research 33:6, 747-764
CrossRef71
Jean-Marc Minon, Christiane Gerard, Jean-Marc Senterre, Jean-Pierre Schaaps, Jean-Michel Foidart. (2007) Routine fetal RHD genotyping with maternal plasma: a four-year experience in Belgium. Transfusion 0:0, 071202181846001-???
CrossRef72
Eva Seto, Bernard J. Fernandes, Chen Wang, Gregory A. Denomme. (2007) Predictive blood group genetics in hemolytic disease of the fetus and newborn: a 10-year review of a laboratory evaluation of amniotic fluid-derived DNA. Prenatal Diagnosis 27:11, 1017-1023
CrossRef73
Tobias J. Legler, Zhong Liu, Ariadni Mavrou, Kirstin Finning, Ilona Hromadnikova, Silvia Galbiati, Cathy Meaney, Maj A. Hultén, Francesco Crea, Martin L. Olsson, Deborah G. Maddocks, Dorothy Huang, Sylvia Armstrong Fisher, Markus Sprenger-Haussels, Aicha Ait Soussan, C. Ellen van der Schoot. (2007) Workshop report on the extraction of foetal DNA from maternal plasma. Prenatal Diagnosis 27:9, 824-829
CrossRef74
Jin-Lai Meng, Xie-Tong Wang, Yu Wang, Ya-Fei Yue, Xin Wang, Zi-Jiang Chen. (2007) Use of maternal plasma for non-invasive prenatal diagnosis of fetal ABO genotypes. Clinical Chemistry and Laboratory Medicine 45:8, 981-986
CrossRef75
Bernhard G. Zimmermann. (2007) Nicht-invasive Pränataldiagnostik durch Analyse fetaler DNA im mütterlichen Blut / Non-invasive prenatal diagnosis by genetic analysis of maternal blood. LaboratoriumsMedizin 31:4, 165-170
CrossRef76
Gregory A. Denomme, Bernard J. Fernandes. (2007) Fetal blood group genotyping. Transfusion 47:s1, 64S-68S
CrossRef77
Xiao Yan Zhong, Sinuhe Hahn, Andrea Steinborn, Wolfgang Holzgreve. (2007) Quantitative analysis of intact fetal cells in maternal plasma by real-time PCR. European Journal of Obstetrics & Gynecology and Reproductive Biology 133:1, 20-24
CrossRef78
Qinyu Ge, Yunfei Bai, Dingdong Zhang, Zuhong Lu. (2007) Microarray Detection of Fetal DNA Levels in Maternal Plasma. Analytical Letters 40:8, 1540-1548
CrossRef79
Anna R Shope, Kristina M Adams. (2007) Fetal and maternal microchimerism: implications for prenatal diagnosis, fetal tolerance and autoimmune disease. Expert Review of Obstetrics & Gynecology 2:3, 331-340
CrossRef80
Martin H. Bluth, Marion E. Reid, Noga Manny. (2007) Chimerism in the Immunohematology Laboratory in the Molecular Biology Era. Transfusion Medicine Reviews 21:2, 134-146
CrossRef81
Wolfgang Holzgreve, Sinuhe Hahn, Xiao Yan Zhong, Olav Lapaire, Irene Hösli, Sevgi Tercanli, Peter Miny, Claude Diesch. (2007) Genetic communication between fetus and mother: short- and long-term consequences. American Journal of Obstetrics and Gynecology 196:4, 372-381
CrossRef82
Jill L. Maron, Diana W. Bianchi. (2007) Prenatal diagnosis using cell-free nucleic acids in maternal body fluids: A decade of progress. American Journal of Medical Genetics Part C: Seminars in Medical Genetics 145C:1, 5-17
CrossRef83
Timothy H. Rainer, Ka Sing Wong, Wynnie Lam, Nicole Y.L. Lam, Colin A. Graham, Y.M. Dennis Lo. (2007) Comparison of plasma β-globin DNA and S-100 protein concentrations in acute stroke. Clinica Chimica Acta 376:1-2, 190-196
CrossRef84
Ying Li, Godelieve C. M. L. Page-Christiaens, Johan J. P. Gille, Wolfgang Holzgreve, Sinuhe Hahn. (2007) Non-invasive prenatal detection of achondroplasia in size-fractionated cell-free DNA by MALDI-TOF MS assay. Prenatal Diagnosis 27:1, 11-17
CrossRef85
Y. M. Dennis Lo, Rossa W. K. Chiu. (2007) Prenatal diagnosis: progress through plasma nucleic acids. Nature Reviews Genetics 8:1, 71-77
CrossRef86
M.K. Al-Yatama, A.S. Mustafa, F.M. Al-Kandari, N. Khaja, K. Zohra, R.A. Monem, S. Abraham. (2007) Polymerase-Chain-Reaction-Based Detection of Fetal Rhesus D and Y-Chromosome-Specific DNA in the Whole Blood of Pregnant Women during Different Trimesters of Pregnancy. Medical Principles and Practice 16:5, 327-332
CrossRef87
Connie M. Westhoff. (2007) The Structure and Function of the Rh Antigen Complex. Seminars in Hematology 44:1, 42-50
CrossRef88
Connie M Westhoff. (2006) Molecular testing for transfusion medicine. Current Opinion in Hematology 13:6, 471-475
CrossRef89
I. Hromadnikova, L. Zejskova, J. Doucha, D. Codl. (2006) Quantification of Fetal and Total Circulatory DNA in Maternal Plasma Samples Before and After Size Fractionation by Agarose Gel Electrophoresis. DNA and Cell Biology 25:11, 635-640
CrossRef90
Ossie Geifman-Holtzman, Chad A. Grotegut, John P. Gaughan. (2006) Diagnostic accuracy of noninvasive fetal Rh genotyping from maternal blood—A meta-analysis. American Journal of Obstetrics and Gynecology 195:4, 1163-1173
CrossRef91
Y.M. Dennis Lo, Ching-Wan Lam, Ivy H.N. Wong. 2006. Molecular Biological Analyses and Molecular Pathology in Clinical Chemistry. .
CrossRef92
Jean-Marc Minon, Jean-Marc Senterre, Jean-Pierre Schaaps, Jean-Michel Foidart. (2006) An unusual false-positive fetal RHD typing result using DNA derived from maternal plasma from a solid organ transplant recipient. Transfusion 46:8, 1454-1455
CrossRef93
Oepkes, Dick, Seaward, P. Gareth, Vandenbussche, Frank P.H.A., Windrim, Rory, Kingdom, John, Beyene, Joseph, Kanhai, Humphrey H.H., Ohlsson, Arne, Ryan, Greg, . (2006) Doppler Ultrasonography versus Amniocentesis to Predict Fetal Anemia. New England Journal of Medicine 355:2, 156-164
Full Text94
R. SANTACROCE, G. VECCHIONE, M. TOMAIYOLO, F. SESSA, M. SARNO, D. COLAIZZO, E. GRANDONE, M. MARGAGLIONE. (2006) Identification of fetal gender in maternal blood is a helpful tool in the prenatal diagnosis of haemophilia. Haemophilia 12:4, 417-422
CrossRef95
Joanne Traeger-Synodinos. (2006) Real-time PCR for prenatal and preimplantation genetic diagnosis of monogenic diseases. Molecular Aspects of Medicine 27:2-3, 176-191
CrossRef96
Caroline Le Van Kim, Yves Colin, Jean-Pierre Cartron. (2006) Rh proteins: Key structural and functional components of the red cell membrane. Blood Reviews 20:2, 93-110
CrossRef97
Yan Yun Wu, Gyorgy Csako. (2006) Rapid and/or high-throughput genotyping for human red blood cell, platelet and leukocyte antigens, and forensic applications. Clinica Chimica Acta 363:1-2, 165-176
CrossRef98
Leandros Lazaros, Elisabeth Hatzi, Ioanna Bouba, Evangelos Paraskevaidis, Ioannis Georgiou. (2006) Non-Invasive Prenatal Detection of Paternal Origin Hb Lepore in a Male Fetus at the 7th Week of Gestation. Fetal Diagnosis and Therapy 21:6, 506-509
CrossRef99
Yu-Kwan Tong, Y.M. Dennis Lo. (2006) Diagnostic developments involving cell-free (circulating) nucleic acids. Clinica Chimica Acta 363:1-2, 187-196
CrossRef100
I. Hromadnikova, K. Vesela, B. Benesova, K. Nekovarova, D. Duskova, R. Vlk, I. Spalova, R. Gerychova, A. Hakenova, Z. Rosenbaumova, P. Vlasin, A. Vlachova, V. Palasek, E. Roznakova, P. Calda. (2005) Non-invasive fetal RHD and RHCE genotyping from maternal plasma in alloimmunized pregnancies. Prenatal Diagnosis 25:12, 1079-1083
CrossRef101
Lan Zhou, John A. Thorson, Clark Nugent, Robertson D. Davenport, Suzanne H. Butch, W. John Judd. (2005) Noninvasive prenatal RHD genotyping by real-time polymerase chain reaction using plasma from D-negative pregnant women. American Journal of Obstetrics and Gynecology 193:6, 1966-1971
CrossRef102
Frederik Banch Clausen, Grethe Risum Krog, Klaus Rieneck, Leif Kofoed Nielsen, Rasmus Lundquist, Kirstin Finning, Ebbe Dickmeiss, Morten Hedegaard, Morten Hanefeld Dziegiel. (2005) Reliable test for prenatal prediction of fetal RhD type using maternal plasma from RhD negative women. Prenatal Diagnosis 25:11, 1040-1044
CrossRef103
Qinyu Ge, Quanjun Liu, Yunfei Bai, Tian Wen, Zuhong Lu. (2005) A semi-quantitative microarray method to detect fetal RNAs in maternal plasma. Prenatal Diagnosis 25:10, 912-918
CrossRef104
John T. Queenan. (2005) Noninvasive Fetal Rh Genotyping. Obstetrics & Gynecology 106:4, 682-683
CrossRef105
Diana W. Bianchi, Neil D. Avent, Jean-Marc Costa, C Ellen van der Schoot. (2005) Noninvasive Prenatal Diagnosis of Fetal Rhesus D. Obstetrics & Gynecology 106:4, 841-844
CrossRef106
E. Brojer, B. Żupanska, K. Guz, A. Orzinska, A. Kalinska. (2005) Noninvasive determination of fetal RHD status by examination of cell-free DNA in maternal plasma. Transfusion 45:9, 1473-1480
CrossRef107
Keiko Koide, Akihiko Sekizawa, Mariko Iwasaki, Ryu Matsuoka, Susumu Honma, Antonio Farina, Hiroshi Saito, Takashi Okai. (2005) Fragmentation of cell-free fetal DNA in plasma and urine of pregnant women. Prenatal Diagnosis 25:7, 604-607
CrossRef108
Akihiko Sekizawa, Antonio Farina, Takashi Okai. (2005) Cell-Free Fetal DNA in Plasma of Pregnant Women: Clinical Potential and Origin. Taiwanese Journal of Obstetrics and Gynecology 44:2, 116-122
CrossRef109
Amanda M. Cotter, Cara M. Martin, John J. O'Leary, Sean F. Daly. (2005) Increased fetal RhD gene in the maternal circulation in early pregnancy is associated with an increased risk of pre-eclampsia. BJOG: An International Journal of Obstetrics & Gynaecology 112:5, 584-587
CrossRef110
Tze Kin Lau, Tse Ngong Leung. (2005) Genetic screening and diagnosis. Current Opinion in Obstetrics and Gynecology 17:2, 163-169
CrossRef111
Kenneth J. Moise. (2005) Fetal RhD typing with free DNA in maternal plasma. American Journal of Obstetrics and Gynecology 192:3, 663-665
CrossRef112
Evelyne Gautier, Alexandra Benachi, Yves Giovangrandi, Pauline Ernault, Martine Olivi, Thierry Gaillon, Jean-Marc Costa. (2005) Fetal RhD genotyping by maternal serum analysis: A two-year experience. American Journal of Obstetrics and Gynecology 192:3, 666-669
CrossRef113
Ilona Hromadnikova, Lenka Vechetova, Klara Vesela, Blanka Benesova, Jindrich Doucha, Eduard Kulovany, Radovan Vlk. (2005) Non-Invasive Fetal RHD Exon 7 and Exon 10 Genotyping Using Real-Time PCR Testing of Fetal DNA in Maternal Plasma. Fetal Diagnosis and Therapy 20:4, 275-280
CrossRef114
Lilian Castilho. 2004. Blood Group Genotyping. , 130-134.
CrossRef115
Jean‐Marc Costa, Alexandra Benachi. 2004. Prenatal Diagnosis of Fetal RhD Status by Molecular Analysis of Maternal Blood. , 1074-1078.
CrossRef116
Terry C. Harper, Kirstin M. Finning, Pete Martin, Kenneth J. Moise. (2004) Use of maternal plasma for noninvasive determination of fetal RhD status. American Journal of Obstetrics and Gynecology 191:5, 1730-1732
CrossRef117
G. Daniels, K. Finning, P. Martin, P. Soothill. (2004) Fetal blood group genotyping from DNA from maternal plasma: an important advance in the management and prevention of haemolytic disease of the fetus and newborn. Vox Sanguinis 87:4, 225-232
CrossRef118
Connie M. Westhoff. (2004) The Rh blood group system in review: A new face for the next decade. Transfusion 44:11, 1663-1673
CrossRef119
Y. Li, W. Holzgreve, G. C. M. L. Page-Christiaens, J. J. P. Gille, S. Hahn. (2004) Improved prenatal detection of a fetal point mutation for achondroplasia by the use of size-fractionated circulatory DNA in maternal plasma?case report. Prenatal Diagnosis 24:11, 896-898
CrossRef120
Jill R. Storry, Martin L. Olsson. (2004) Genetic basis of blood group diversity. British Journal of Haematology 126:6, 759-771
CrossRef121
A. L. Nicolle, K. L. Talks, J. Hanley. (2004) The Genetics of bleeding disorders: a report on the UK Haemophilia Centre Doctors' Organisation annual scientific symposium, 10th October 2003. Haemophilia 10:4, 390-396
CrossRef122
D.W. Bianchi. (2004) Circulating Fetal DNA: Its Origin and Diagnostic Potential—A Review. Placenta 25, S93-S101
CrossRef123
Robbert J. P. Rijnders, Godelieve C. M. L. Christiaens, Bernadette Bossers, Jasper J. van der Smagt, C Ellen van der Schoot, Masja de Haas. (2004) Clinical Applications of Cell-Free Fetal DNA From Maternal Plasma. Obstetrics & Gynecology 103:1, 157-164
CrossRef124
Christelle Rouillac-Le Sciellour, Philippe Puillandre, Rolande Gillot, C??line Baulard, Sylvain M??tral, Caroline Le Van Kim, Jean-Pierre Cartron, Yves Colin, Yves Brossard. (2004) Large-Scale Pre-Diagnosis Study of Fetal RHD Genotyping by PCR on Plasma DNA from RhD-Negative Pregnant Women. Molecular Diagnosis 8:1, 23-31
CrossRef125
R. J. P. Rijnders, R. B. Van Der Luijt, E. D. J. Peters, J. K. Goeree, C. E. Van Der Schoot, J. K. Ploos Van Amstel, G. C. M. L. Christiaens. (2003) Earliest gestational age for fetal sexing in cell-free maternal plasma. Prenatal Diagnosis 23:13, 1042-1044
CrossRef126
M.E. Reid. (2003) Applications of DNA-based assays in blood group antigen and antibody identification. Transfusion 43:12, 1748-1757
CrossRef127
I. Randen, R. Hauge, J. Kjeldsen-Kragh, M. K. Fagerhol. (2003) Prenatal genotyping of RHD and SRY using maternal blood. Vox Sanguinis 85:4, 300-306
CrossRef128
Blenda CK Wong, YM Dennis Lo. (2003) Cell-free DNA and RNA in plasma as new tools for molecular diagnostics. Expert Review of Molecular Diagnostics 3:6, 785-797
CrossRef129
L. Johnson, S. A. McCracken, J. M. Morris, N. B. Woodland, R. L. Flower. (2003) Variation in the reliability of RHD antenatal genotyping using the polymerase chain reaction and targeting multiple exons of the RHD gene. Vox Sanguinis 85:3, 222-223
CrossRef130
Jouni Uitto, Ellen Pfendner, Laird G. Jackson. (2003) Probing the fetal genome: progress in non-invasive prenatal diagnosis. Trends in Molecular Medicine 9:8, 339-343
CrossRef131
Michael J. Turner, Cara M. Martin, John J. O’Leary. (2003) Detection of fetal Rhesus D gene in whole blood of women booking for routine antenatal care. European Journal of Obstetrics & Gynecology and Reproductive Biology 108:1, 29-32
CrossRef132
Ilona Hromadnikova, Bela Houbova, Dana Hridelova, Sona Voslarova, Josef Kofer, Vladimir Komrska, David Habart. (2003) Replicate real-time PCR testing of DNA in maternal plasma increases the sensitivity of non-invasive fetal sex determination. Prenatal Diagnosis 23:3, 235-238
CrossRef133
Carol M. Artlett, C. Gennaro Dito, Paul J. Christner. (2003) Methodology for detecting trace amounts of microchimeric DNA from peripheral murine white blood cells by real-time PCR. Biological Procedures Online 5:1, 103-107
CrossRef134
Sashi C. Siva, Sylvia I. Johnson, Sharon A. Mccracken, Jonathan M. Morris. (2003) Evaluation of the clinical usefulness of isolation of fetal DNA from the maternal circulation. The Australian and New Zealand Journal of Obstetrics and Gynaecology 43:1, 10-15
CrossRef135
Farideh Z Bischoff, Dianne X Dang, Deborah Marquez-Do, Denisse Martinez, Cassandra Horne, Dorothy E Lewis, Joe Leigh Simpson. (2003) Detecting fetal DNA from dried maternal blood spots: another step towards broad scale non-invasive prenatal genetic screening and feasible testing. Reproductive BioMedicine Online 6:3, 349-351
CrossRef136
Madhulika Kabra. (2003) Prenatal diagnosis. The Indian Journal of Pediatrics 70:1, 81-85
CrossRef137
Y.M. DENNIS LO. (2003) Fetal DNA in Maternal Plasma/Serum: The First 5 Years. Pediatric Research 53:1, 16-17
CrossRef138
Monique Gannag
, Zahir Amoura, Olivier Lantz, Jean-Charles Piette, Sophie Caillat-Zucman. (2002) Feto-maternal microchimerism in connective tissue diseases. European Journal of Immunology 32:12, 3405-3413
CrossRef139
Frank Pessler, David Hart. (2002) Hyporegenerative Anemia Associated With Rh Hemolytic Disease: Treatment Failure of Recombinant Erythropoietin. Journal of Pediatric Hematology/Oncology 24:8, 689-693
CrossRef140
Yanni Y. N. Lui, Y. M. Dennis Lo. (2002) Circulating DNA in Plasma and Serum: Biology, Preanalytical Issues and Diagnostic Applications. Clinical Chemistry and Laboratory Medicine 40:10, 962-968
CrossRef141
Jean-Marc Costa, Yves Giovangrandi, Pauline Ernault, Laurence Lohmann, Valerie Nataf, Najua El Halali, Evelyne Gautier. (2002) Fetal RHD genotyping in maternal serum during the first trimester of pregnancy. British Journal of Haematology 119:1, 255-260
CrossRef142
Rossa WK Chiu, Tze K Lau, Tse N Leung, Katherine CK Chow, David HK Chui, YM Dennis Lo. (2002) Prenatal exclusion of β thalassaemia major by examination of maternal plasma. The Lancet 360:9338, 998-1000
CrossRef143
K.M. Finning, P.G. Martin, P.W. Soothill, N.D. Avent. (2002) Prediction of fetal D status from maternal plasma: introduction of a new noninvasive fetal RHD genotyping service. Transfusion 42:8, 1079-1085
CrossRef144
M.F. Murphy, L.M. Williamson, S.J. Urbaniak. (2002) Antenatal Screening for Fetomaternal Alloimmune Thrombocytopenia: Should we be doing it?. Vox Sanguinis 83, 409-416
CrossRef145
Costa, Jean-Marc, Benachi, Alexandra, , Gautier, Evelyne, . (2002) New Strategy for Prenatal Diagnosis of X-Linked Disorders. New England Journal of Medicine 346:19, 1502-1502
Full Text146
Marion E. Reid, Christine Lomas-Francis. (2002) Molecular approaches to blood group identification. Current Opinion in Hematology 9:2, 152-159
CrossRef147
Rossa WK Chiu, YM Dennis Lo. (2002) Application of fetal DNA in maternal plasma for noninvasive prenatal diagnosis. Expert Review of Molecular Diagnostics 2:1, 32-40
CrossRef148
Jean-Marc Costa, Alexandra Benachi, Evelyne Gautier, Jean-Marie Jouannic, Pauline Ernault, Yves Dumez. (2001) First-trimester fetal sex determination in maternal serum using real-time PCR. Prenatal Diagnosis 21:12, 1070-1074
CrossRef149
Leo L.M Poon, Y.M.Dennis Lo. (2001) Circulating fetal DNA in maternal plasma. Clinica Chimica Acta 313:1-2, 151-155
CrossRef150
James A. Stockman. (2001) Overview of the State of the Art of Rh Disease: History, Current Clinical Management, and Recent Progress. Journal of Pediatric Hematology/Oncology 23:8, 554-562
CrossRef151
Timothy H Rainer. (2001) Plasma DNA, prediction and post-traumatic complications. Clinica Chimica Acta 313:1-2, 81-85
CrossRef152
Kit Boye, David M. Hougaard, Peter Ebbesen, Jens Vuust, Michael Christiansen. (2001) Novel feto-specific mRNA species suitable for identification of fetal cells from the maternal circulation. Prenatal Diagnosis 21:10, 806-812
CrossRef153
ANATOLY V. LICHTENSTEIN, HOVSEP S. MELKONYAN, L. DAVID TOMEI, SAMUIL R. UMANSKY. (2001) Circulating Nucleic Acids and Apoptosis. Annals of the New York Academy of Sciences 945:1, 239-249
CrossRef154
DIANA W. BIANCHI, Y. M. DENNIS LO. (2001) Fetomaternal Cellular and Plasma DNA Trafficking. Annals of the New York Academy of Sciences 945:1, 119-131
CrossRef155
LEO L. M. POON, TSE N. LEUNG, TZE K. LAU, Y. M. DENNIS LO. (2001) Circulating Fetal RNA in Maternal Plasma. Annals of the New York Academy of Sciences 945:1, 207-210
CrossRef156
ROSSA W. K. CHIU, MICHAEL F. MURPHY, CARRIE FIDLER, JAMES S. WAINSCOAT, Y. M. DENNIS LO. (2001) Technical Optimization of RhD Zygosity Determination by Real-Time Quantitative Polymerase Chain Reaction. Annals of the New York Academy of Sciences 945:1, 156-160
CrossRef157
SINUHE HAHN, XIAO YAN ZHONG, MARTIN R. BÜRK, CAROLYN TROEGER, ANJEUNG KANG, WOLFGANG HOLZGREVE. (2001) Both Maternal and Fetal Cell-Free DNA in Plasma Fluctuate. Annals of the New York Academy of Sciences 945:1, 141-144
CrossRef158
Neil D. Avent. (2001) Molecular Biology of the Rh Blood Group System. Journal of Pediatric Hematology/Oncology 23:6, 394-402
CrossRef159
James A. Stockman, Pedro A. de Alarcon. (2001) Overview of the State of the Art of Rh Disease: History, Current Clinical Management, and Recent Progress. Journal of Pediatric Hematology/Oncology 23:6, 385-393
CrossRef160
Mahesh Choolani, Cesare Campagnoli, Philip Bennett, Irene Roberts, Nicholas M Fisk. (2001) Prenatal detection of fetal Down's syndrome. The Lancet 357:9260, 958-959
CrossRef161
M. Nelson, C. Eagle, M. Langshaw, H. Popp, H. Kronenberg. (2001) Genotyping fetal DNA by non-invasive means: extraction from maternal plasma. Vox Sanguinis 80:2, 112-116
CrossRef162
William F. Reed, Tzong-Hae Lee, Elizabeth Trachtenberg, Margaret Vinson, Michael P. Busch. (2001) Detection of microchimerism by PCR is a function of amplification strategy. Transfusion 41:1, 39-44
CrossRef163
Xiao Yan Zhong, Sinuhe Hahn, Wolfgang Holzgreve. (2001) Prenatal identification of fetal genetic traits. The Lancet 357:9252, 310
CrossRef164
Akihiko Sekizawa, Hiroshi Saito. (2001) Prenatal Screening of Single-Gene Disorders from Maternal Blood. American Journal of PharmacoGenomics 1:2, 111-117
CrossRef165
P. Invernizzi, C. De Andreis, S. M. Sirchia, P. M. Battezzati, M. Zuin, F. Rossella, F. Perego, M. Bignotto, G. Simoni, M. Podda. (2000) Blood fetal microchimerism in primary biliary cirrhosis. Clinical and Experimental Immunology 122:3, 418-422
CrossRef166
Barbara Pertl, Doris Pieber, Thomas Panzitt, Martin C. H. Haeusler, R. Winter, L. Tului, B. Brambati, M. Adinolfi. (2000) RhD genotyping by quantitative fluorescent polymerase chain reaction: a new approach. BJOG: An International Journal of Obstetrics and Gynaecology 107:12, 1498-1502
CrossRef167
Michael F. Murphy, Lorna M. Williamson. (2000) Antenatal screening for fetomaternal alloimmune thrombocytopenia: an evaluation using the criteria of the uk national screening committee. British Journal of Haematology 111:3, 726-732
CrossRef168
Leo LM Poon, Tse N Leung, Tze K Lau, YM Dennis Lo. (2000) Prenatal detection of fetal Down's syndrome from maternal plasma. The Lancet 356:9244, 1819-1820
CrossRef169
Antonio Farina, Patrizio Calderoni, Giuliana Simonazzi, Paolo Carinci, Nicola Rizzo. (2000) Survival analysis of transfused fetuses affected by Rh-alloimmunization. Prenatal Diagnosis 20:11, 881-885
CrossRef170
Xiao Yan Zhong, Martin R. B
CrossRef171
Hiroshi Saito, Akihiko Sekizawa, Taro Morimoto, Makoto Suzuki, Takumi Yanaihara. (2000) Prenatal DNA diagnosis of a single-gene disorder from maternal plasma. The Lancet 356:9236, 1170
CrossRef172
W HOLZGREVE, S HAHN. (2000) Fetal cells in cervical mucus and maternal blood. Best Practice & Research Clinical Obstetrics & Gynaecology 14:4, 709-722
CrossRef173
Xiao Yan Zhong, Wolfgang Holzgreve, Sinuhe Hahn. (2000) Detection of fetal Rhesus D and sex using fetal DNA from maternal plasma by multiplex polymerase chain reaction. BJOG: An International Journal of Obstetrics and Gynaecology 107:6, 766-769
CrossRef174
SINUHE HAHN, XIAO YAN ZHONG, MARTIN R. BÜRK, CAROLYN TROEGER, WOLFGANG HOLZGREVE. (2000) Multiplex and Real-Time Quantitative PCR on Fetal DNA in Maternal Plasma: A Comparison with Fetal Cells Isolated from Maternal Blood. Annals of the New York Academy of Sciences 906:1, 148-152
CrossRef175
Y. M. DENNIS LO. (2000) Fetal DNA in Maternal Plasma. Annals of the New York Academy of Sciences 906:1, 141-147
CrossRef176
J. ZHANG, C. FIDLER, M. F. MURPHY, P. F. CHAMBERLAIN, I. L. SARGENT, C. W. G. REDMAN, N. M. HJELM, J. S. WAINSCOAT, Y. M. D. LO. (2000) Determination of Fetal RhD Status by Maternal Plasma DNA Analysis. Annals of the New York Academy of Sciences 906:1, 153-155
CrossRef177
Cheng-Han Huang, Phillip Z Liu, Jeffrey G Cheng. (2000) Molecular biology and genetics of the Rh blood group system. Seminars in Hematology 37:2, 150-165
CrossRef178
A. L. Mellor, D. H. Munn. (2000) Immunology at the Maternal-Fetal Interface: Lessons for T Cell Tolerance and Suppression. Annual Review of Immunology 18:1, 367-391
CrossRef179
S.J. Urbaniak, M.A. Greiss. (2000) RhD haemolytic disease of the fetus and the newborn. Blood Reviews 14:1, 44-61
CrossRef180
Saade, George R., . (2000) Noninvasive Testing for Fetal Anemia. New England Journal of Medicine 342:1, 52-53
Full Text181
Akihiko Sekizawa, Osamu Samura, Dong Kai Zhen, Vincent Falco, Diana W. Bianchi. (1999) Fetal cell recycling: Diagnosis of gender and RhD genotype in the same fetal cell retrieved from maternal blood. American Journal of Obstetrics and Gynecology 181:5, 1237-1242
CrossRef182
Barbara Pertl, Diana W. Bianchi. (1999) First trimester prenatal diagnosis: Fetal cells in the maternal circulation. Seminars in Perinatology 23:5, 393-402
CrossRef183
Neil D. Avent. (1999) The rhesus blood group system: Insights from recent advances in molecular biology. Transfusion Medicine Reviews 13:4, 245-266
CrossRef184
Y DENNISLO. (1999) Du sang maternel pour le diagnostic prénatal. Biofutur 1999:185, 30-33
CrossRef185
Bowman, John M., . (1998) RhD Hemolytic Disease of the Newborn. New England Journal of Medicine 339:24, 1775-1777
Full Text
