Original Article
Obesity Associated with a Mutation in a Genetic Regulator of Adipocyte Differentiation
N Engl J Med 1998; 339:953-959October 1, 1998
- Abstract
Background
There is increasing evidence of genetic factors leading to obesity, but the exact genes involved have not been defined. Peroxisome-proliferator–activated receptor γ2 (PPARγ2) is a transcription factor that has a key role in adipocyte differentiation, and therefore mutations of the gene for this factor might predispose people to obesity.
Methods
We studied 358 unrelated German subjects, including 121 obese subjects (defined as those with a body-mass index [the weight in kilograms divided by the square of the height in meters] of more than 29). We evaluated these subjects for mutations in the gene for PPARγ2 at or near a site of serine phosphorylation at position 114 that negatively regulates the transcriptional activity of the protein, using a polymerase-chain-reaction–based assay coupled with specific endonuclease digestion. The activity of the mutation identified was analyzed by retroviral transfection and overexpression in murine fibroblasts.
Results
Four of the 121 obese subjects had a missense mutation in the gene for PPARγ2 that resulted in the conversion of proline to glutamine at position 115, as compared with none of the 237 subjects of normal weight (P=0.01). All the subjects with the mutant allele were markedly obese, with body-mass-index values ranging from 37.9 to 47.3, as compared with a mean of 33.6 in the other obese subjects. Overexpression of the mutant gene in murine fibroblasts led to the production of a protein in which the phosphorylation of serine at position 114 was defective, as well as to accelerated differentiation of the cells into adipocytes and greater cellular accumulation of triglyceride than with the wild-type PPARγ2. These effects were similar to those of an in vitro mutation created directly at the Ser114 phosphorylation site.
Conclusions
A Pro115Gln mutation in PPARγ2 accelerates the differentiation of adipocytes and may cause obesity.
Media in This Article
Figure 2
Sequence Analysis of a Cloned DNA Fragment from an Obese Subject with a Mutation in the Peroxisome-Proliferator–Activated Receptor γ2 Gene.Figure 4
Functional Analyses of Constitutively Active Mutant Peroxisome-Proliferator–Activated Receptor γ2 (PPARγ2).Article Activity
- Article
Obesity is reported to be the most common health problem in developed countries and is the second most common cause of preventable death in the United States.1-3 It results from an inbalance between energy intake and energy expenditure. This imbalance leads to a pathologic accumulation of adipose tissue; obesity therefore reflects an interaction of development and environment with genotype. The results of studies of twins and families suggest that up to 80 percent of the variance in body-mass index (defined as the weight in kilograms divided by the square of the height in meters) is attributable to genetic factors.4,5
Several single-gene mutations have been described in rodents with obesity, but the identity of the genes associated with obesity in humans is uncertain. In the best characterized of these rodents (ob/ob [obese hyperglycemic] and db/db [diabetic] mice), there are mutations in the gene for the hormone leptin or its receptor that interrupt the feedback signal between adipose mass and hypothalamic control of food intake.6-8 Recently, members of families with a mutation in the coding sequence of the leptin gene9 or the leptin-receptor gene10 have been reported. These mutations must be extremely rare, however, since thousands of obese subjects have now been screened for variations in these genes and only a few have been found to have the mutations. Mutations of genes regulating adipocyte differentiation or triglyceride storage, on the other hand, have not been associated with obesity in either rodents or humans.
Peroxisome-proliferator–activated receptors, especially peroxisome-proliferator–activated receptor γ2 (PPARγ2), are key regulators of adipocyte differentiation and energy storage.11,12 PPARγ2 is a transcription factor that directs the differentiation of preadipocytes to adipocytes. Overexpression of PPARγ2 in fibroblast cell lines through the use of retroviral vectors efficiently converts them to adipocytes.13 PPARγ2 has a reduced ability to promote the process of adipocyte differentiation when it is phosphorylated at the site of a single amino acid residue (serine at position 114 in the human PPARγ2 gene), suggesting a mechanism of negative regulation to limit adipocyte differentiation and lipid accumulation (Figure 1Figure 1
Role of Peroxisome-Proliferator–Activated Receptor γ2 (PPARγ2) and Its Regulation by Phosphorylation.).14,15 This serine phosphorylation occurs at a typical consensus site for mitogen-activated protein kinase or a related kinase and is characterized by the sequence proline–any amino acid–serine–proline. The aim of our study was to determine whether mutations in or around this phosphorylation site might be associated with obesity.Methods
Study Subjects
We studied 358 unrelated adult subjects living in the Nordrhein–Westfalen region of Germany (in the cities of Bochum and Cologne, which together have 1.6 million inhabitants). They were recruited by random selection of subjects with type 2 diabetes mellitus and their spouses or employees of the participating institutions. Anonymous blood samples were obtained and frozen at –20°C for further analysis. Sixty-one women and 60 men were characterized as obese on the basis of a body-mass index of more than 29. This group had a mean (±SD) body-mass index of 33.9±4.4 and a mean age of 57±14 years. The group of subjects of normal weight comprised 116 women and 121 men with a mean body-mass index of 25.0±2.7 and a mean age of 59±16 years. These subjects have been described in detail elsewhere.16
On the basis of the criteria of the World Health Organization for oral glucose tolerance, 186 subjects had diabetes mellitus, including 79 from the obese group and 107 from the normal-weight group. Since the subjects were originally recruited for studies on the genetics of type 2 diabetes mellitus, the high prevalence of this disease in both the obese and normal-weight groups is not representative of that in the general population. The study protocol was reviewed by the appropriate institutional review committees, and all the subjects gave informed consent for the studies. Reidentification of subjects who carried a certain genotype for further analysis (e.g., family analysis) was prohibited by the committees' regulations.
Screening for PPARγ2 Mutations
We isolated the genomic DNA of 32 subjects from peripheral-blood leukocytes and amplified it by the polymerase chain reaction (PCR) using a sense primer (5'TGCAATCAAAGTGGAGCC3') and an antisense primer (5'CAGAAGCTTTATCTCCACAGAC3') that flank the region containing the serine-phosphorylation site of PPARγ2. The PCR products were cloned, and several clones from each subject were sequenced as described elsewhere.17 On the basis of the polymorphism found in a single subject during this initial screening, a PCR-based assay for the analysis of restriction-fragment–length polymorphisms was performed on the remaining DNA samples with a modified sense primer (5'TGCAATCAAAGTGGAGCCTGCATGTC3'). The sense primer generated an additional single-base mutation (indicated in boldface type) in the modified sense primer 3 bp upstream of the expected substitution of glutamine for proline at position 115 (Pro115Gln). This mutation led to a new HindII restriction site in DNA samples from the subjects with the mutation.
Functional Analyses of PPARγ2 Mutations
Full-length PPARγ2 complementary DNA (cDNA) was amplified from first-strand cDNA taken from human fat tissue (Clontech, Palo Alto, Calif.) under conditions previously described18 and cloned. This wild-type (normal) cDNA was used for site-directed mutagenesis (QuikChange, Stratagene, La Jolla, Calif.) of amino acids at positions 114 (serine to alanine) and 115 (proline to glutamine). Previous studies have shown that the mutation of serine to alanine at position 114 (Ser114Ala) ablates in vitro phosphorylation, which increases the activity of PPARγ2 in promoting adipocyte differentiation.14,15 The Pro115Gln mutation was the one found in this study.
The three samples of cDNA (wild type, Ser114Ala, and Pro115Gln) were subcloned into the retroviral expression vector pBabePuro19 and amplified in BOSC23 cells.20 The supernatant containing the retrovirus was harvested and used to infect NIH 3T3 cells (American Type Culture Collection, Manassas, Va.) as previously described.21 The infected NIH 3T3 cells were treated with trypsin and further cultured in Dulbecco's modified Eagle's medium (4.5 g of glucose per liter) with 10 percent heat-inactivated fetal-calf serum (HyClone, Logan, Utah) and 2 μg of puromycin per milliliter (Sigma, St. Louis) to select successfully infected cells. Approximately 90 fibroblast clones of each type were isolated and pooled to obtain cell lines for further experiments.
The three pooled cell lines were grown to confluence. To promote differentiation, the medium was changed for two days to Dulbecco's modified Eagle's medium containing 10 percent fetal-calf serum, 1 μM dexamethasone (Sigma), 500 μM methylisobutylxanthine (Sigma), 0.05 μM troglitazone (Parke-Davis, Morris Plains, N.J.), and 2 μM bovine insulin (Sigma). The cells were then maintained for another seven days in Dulbecco's modified Eagle's medium with 10 percent fetal-calf serum, 0.05 μM troglitazone, and 2 μM bovine insulin. The triglyceride content of the cells at various stages of the differentiation process was determined by staining with oil red O (Sigma) after fixation with 10 percent formalin or chemically by using the GPO Trinder kit (Sigma). Protein content was determined with the Bradford assay (Bio-Rad, Hercules, Calif.).
To determine the phosphorylation status of PPARγ2, differentiated cells were processed for Western blot analysis as described elsewhere22 with use of a primary antibody against PPARγ2 obtained from Santa Cruz (Santa Cruz, Calif.).
Statistical Analysis
Statistical analyses were performed with SPSS software (release 7.5, SPSS, Chicago). The prevalence of mutations in the obese subjects as compared with the normal-weight subjects was analyzed with a two-tailed Fisher's exact test, and the pathophysiologic data were compared by the Mann–Whitney U test.
Results
As an initial approach to identify mutations at or around the Ser114 phosphorylation site of PPARγ2, we amplified the genomic DNA of 32 obese subjects by PCR, as described in the Methods section, and the product was then cloned into a plasmid for sequence analysis. Since heterozygous mutations might be missed by the sequencing of single clones, several clones of each subject were analyzed. DNA from one subject contained a missense mutation at bp 344 of PPARγ2 in about 50 percent of the clones sequenced, a finding that is consistent with heterozygosity at this site (Figure 2Figure 2
Sequence Analysis of a Cloned DNA Fragment from an Obese Subject with a Mutation in the Peroxisome-Proliferator–Activated Receptor γ2 Gene.). This mutation would change the wild-type proline at position 115 to glutamine. No mutations at Ser114 were found.In order to study more subjects and determine the prevalence of this mutation, we used a restriction-enzyme–based assay. Since the region of interest does not contain a natural restriction site, a PCR primer was constructed by changing a nucleotide 3 bp upstream of the putative mutation to introduce a new restriction site which, when coupled with the mutation, generated a site for restriction enzyme HindII when the mutant allele was present (Figure 3Figure 3
Results of Polymerase-Chain-Reaction (PCR) Screening for Mutations in Peroxisome-Proliferator–Activated Receptor γ2.). Using this assay, we studied a total of 358 subjects (121 obese subjects and 237 normal-weight subjects).In addition to the one obese subject described above, three other obese subjects, but none of the normal-weight subjects, were found to carry a heterozygous mutation at nucleotide 344. Subsequent cloning and sequencing of this region in these obese subjects confirmed the Pro115Gln mutation. The association of the mutation with obesity (defined as a body-mass index of >29) was significant (P=0.01) (Table 1Table 1
Frequency of the Pro115Gln Mutation in the PPARg2 Gene in Obese and Normal-Weight Subjects.). Three of the four subjects carrying the mutation also had type 2 diabetes. The overall prevalence of the mutation was 1.1 percent in the 358 subjects, corresponding to an allelic frequency of approximately 0.5 percent.The 4 subjects with mutant alleles were markedly more obese than the other 117 obese subjects (body-mass index, 37.9 to 47.3, as compared with a mean of 33.6±4.1; P=0.03) (Table 2Table 2
Clinical Characteristics of the Subjects with the PPARg2 Mutation and the Obese Subjects without the Mutation.). The average age of the subjects with mutations was not significantly different from that of the rest of the group. The mean serum insulin concentration while fasting was significantly lower in the obese subjects with the mutation than in the rest of the obese group, suggesting a lower level of insulin resistance (Table 2).Since Pro115 flanks Ser114 at the phosphorylation site of PPARγ2, it appeared likely that this mutation might lead to decreased serine phosphorylation and therefore increased differentiation of fibroblasts into adipocytes, as has been observed with an artificial mutation of serine at position 114.14,15 To test this hypothesis, the nonmutant (wild-type) PPARγ2, the subject-derived Pro115Gln PPARγ2, and an artificially mutated Ser114Ala PPARγ2 were each evaluated with regard to phosphorylation and support of adipocyte differentiation. The Ser114Ala mutant had more activity than the wild-type PPARγ2, because the potential negative effect of serine phosphorylation on the activity of the protein is lost owing to the substitution of alanine.14 Each construct was used for retrovirus-mediated, stable transfection of NIH 3T3 fibroblasts. These cells do not normally accumulate triglyceride but do differentiate into adipocytes when transfected with PPARγ2 and stimulated appropriately.14
PPARγ2 protein was demonstrated in extracts of all three transfected cell lines by Western blot analysis (Figure 4AFigure 4
Functional Analyses of Constitutively Active Mutant Peroxisome-Proliferator–Activated Receptor γ2 (PPARγ2).), and the expression was significantly increased as compared with the endogenous expression in nontransfected NIH 3T3 cells (data not shown). After stimulation by insulin, the mobility of wild-type PPARγ2 on sodium dodecyl sulfate–polyacrylamide gels was retarded, a finding consistent with the effect of phosphorylation of serine at position 114. This gel shift was absent in cells expressing either of the mutant proteins, indicating that neither the Pro115Gln mutant nor the Ser114Ala mutant was phosphorylated at position 114.To assess adipocyte differentiation and lipid accumulation, the transfected NIH 3T3 cells were treated with a differentiation medium that supported and maintained the cells for an additional nine days in culture. Staining with oil red O, a fat-specific dye, revealed more lipid accumulation in the cells containing either the Ser114Ala or the Pro115Gln mutants than in those containing wild-type PPARγ2 after six and nine days of differentiation (Figure 4B). This finding was confirmed by chemical analysis of both mutant cell lines, which revealed an accumulation of triglyceride in the mutant cells that was at least 2.5 times that found in the wild-type cell line, after normalization for cell protein content (Figure 4C). Thus, both the natural mutation of proline to glutamine at position 115 and the artificial mutation of serine to alanine at position 114 increased the activity of PPARγ2 and accelerated adipocyte differentiation and triglyceride accumulation.
Discussion
Obesity in humans results from a combination of environmental influences and genetic factors that affect energy storage and caloric intake. In subjects with severe obesity, this interaction is associated with an increased number (hyperplasia) and size (hypertrophy) of fat cells.1 The hyperplastic adipocytes are derived from a poorly defined precursor pool of preadipocytes, which appear to be fibroblasts on morphologic analysis. Activation of the transcription factor PPARγ2 appears to be a key element in the regulation of the process of adipocyte differentiation.11,13 The activity of PPARγ2 is decreased by phosphorylation of a single serine site at position 114.14,15
In this study, we identified a mutation that affects the serine phosphorylation of PPARγ2 and appears to contribute to the development of severe obesity. This mutation was found in approximately 3 percent of obese subjects in a German population, or about 1 percent of all subjects screened. Since neither a founder effect nor linkage disequilibrium can be fully ruled out by the methods used in this study, further studies will be needed to determine the prevalence of this mutation in other populations and in families with obesity.
As predicted by its structure and according to our functional analysis, the mutation of proline to glutamine at position 115 blocks the phosphorylation of PPARγ2 at Ser114, just adjacent to the mutation. This mutation reduces the inactivation of PPARγ2, leading to a constitutively more active protein. Since our screening technique focused on a specific mutation alone, a search for other PPARγ2 mutations should be considered in future studies of the genetics of obesity. Yen et al. recently identified a polymorphism converting serine to alanine at position 12 at the amino-terminal end of PPARγ2.23 However, the function of this site remains uncertain, and there is no evidence that this mutation is associated with obesity or that it increases PPARγ2 activity.23 By contrast, the subjects with the mutation in our study were massively obese, even as compared with the other obese subjects in the study. Also, the Pro115Gln mutation, as compared with the wild-type sequence, clearly results in increased rates of differentiation of adipocytes when transfected into NIH 3T3 cells.
Although the endogenous ligand for PPARγ2 is unknown, a new class of antidiabetic drugs called thiazolidinediones, which includes troglitazone and pioglitazone, has been found to act as a synthetic ligand for this transcription factor.24 These drugs act as insulin sensitizers, decreasing insulin resistance in patients with type 2 diabetes.25 There is no evidence that the administration of troglitazone results in greater weight gain than the administration of other antidiabetic drugs26; however, studies in rodents suggest that the long-term administration of this drug may increase the total number of adipocytes.27
Although obesity is usually associated with insulin resistance in proportion to the excess in body weight,28,29 one might predict that activating mutations of PPARγ2 might cause obesity that would be associated with less insulin resistance than expected. Although we did not measure the degree of insulin resistance in our subjects, the obese subjects with the PPARγ2 mutation had lower serum insulin concentrations while fasting than the other obese subjects, suggesting a lower degree of insulin resistance.28
In summary, the missense mutation Pro115Gln in the gene for the transcription factor PPARγ2 is associated with marked obesity. In vitro analyses showed a permanent activation of PPARγ2 that led to an accelerated rate of adipocyte differentiation and increased fat accumulation in a tissue-culture model of adipogenesis. Although the degree of obesity was pronounced, there was no association with type 2 diabetes or hyperinsulinemia, thus possibly defining a specific subclass of obesity.
Supported by a grant (DK 45935, to Dr. Kahn) from the National Institutes of Health, a Diabetes and Endocrinology Research Center grant (2 P30 DK 36836, to the Joslin Diabetes Center), a grant from the KoelnFortune program of the University of Cologne (88/97, to Dr. Ristow), and a grant from the Hermann und Lilly Schilling Stiftung (to Dr. Pfeiffer).
We are indebted to Ms. Terri-Lyn Azar for secretarial assistance, to Ms. Eleni Giannakidou and Dr. Kay Busch for technical help, and to Dr. James H. Warram for statistical advice.
Source Information
From the Joslin Diabetes Center and Harvard Medical School, Boston (M.R., C.R.K.); the Klinik II und Poliklinik für Innere Medizin, Universität zu Köln, Cologne, Germany (M.R., D.M.-W., W.K.); and the Medizinische Klinik und Poliklinik, Bergmannsheil, Ruhr-Universität Bochum, Bochum, Germany (A.P.).
Address reprint requests to Dr. Kahn at the Joslin Diabetes Center, Research Division, Section on Cellular and Molecular Physiology, 1 Joslin Pl., Boston, MA 02215.
- References
References
1
Rosenbaum M ,Leibel RL ,Hirsch J . Obesity. N Engl J Med 1997;337:396-407
Full Text | Web of Science | Medline2
Kuczmarski RJ ,Flegal KM ,Campbell SM ,Johnson CL . Increasing prevalence of overweight among US adults: the National Health and Nutrition Examination Surveys, 1960 to 1991. JAMA 1994;272:205-211
CrossRef | Web of Science | Medline3
McGinnis JM ,Foege WH . Actual causes of death in the United States. JAMA 1993;270:2207-2212
CrossRef | Web of Science | Medline4
Bouchard C, ed. Genetics of obesity. Boca Raton, Fla.: CRC Press, 1994.
5
Whitaker RC ,Wright JA ,Pepe MS ,Seidel KD ,Dietz WH . Predicting obesity in young adulthood from childhood and parental obesity. N Engl J Med 1997;337:869-873
Full Text | Web of Science | Medline6
Zhang Y ,Proenca R ,Maffei M ,Barone M ,Leopold L ,Friedman JM . Positional cloning of the mouse obese gene and its human homologue. Nature 1994;372:425-432[Erratum, Nature 1995;374:479.]
CrossRef | Web of Science | Medline7
Tartaglia LA ,Dembski M ,Weng X , et al. Identification and expression cloning of a leptin receptor, OB-R. Cell 1995;83:1263-1271
CrossRef | Web of Science | Medline8
Flier JS ,Maratos-Flier E . Obesity and the hypothalamus: novel peptides for new pathways. Cell 1998;92:437-440
CrossRef | Web of Science | Medline9
Montague CT ,Farooqi IS ,Whitehead JP , et al. Congenital leptin deficiency is associated with severe early-onset obesity in humans. Nature 1997;387:903-908
CrossRef | Web of Science | Medline10
Clement K ,Vaisse C ,Lahlou N , et al. A mutation in the human leptin receptor gene causes obesity and pituitary dysfunction. Nature 1998;392:398-401
CrossRef | Web of Science | Medline11
Spiegelman BM ,Flier JS . Adipogenesis: rounding out the big picture. Cell 1996;87:377-389
CrossRef | Web of Science | Medline12
Latruffe N ,Vamecq J . Peroxisome proliferators and peroxisome proliferator activated receptors (PPARs) as regulators of lipid metabolism. Biochimie 1997;79:81-94
CrossRef | Web of Science | Medline13
Tontonoz P ,Hu E ,Spiegelman BM . Stimulation of adipogenesis in fibroblasts by PPAR gamma 2, a lipid-activated transcription factor. Cell 1994;79:1147-1156[Erratum, Cell 1995;80:957.]
CrossRef | Web of Science | Medline14
Hu E ,Kim JB ,Sarraf P ,Spiegelman BM . Inhibition of adipogenesis through MAP kinase-mediated phosphorylation of PPARgamma. Science 1996;274:2100-2103
CrossRef | Web of Science | Medline15
Adams M ,Reginato MJ ,Shao DL ,Lazar MA ,Chatterjee VK . Transcriptional activation by peroxisome proliferator-activated receptor gamma is inhibited by phosphorylation at a consensus mitogen-activated protein kinase site. J Biol Chem 1997;272:5128-5132
CrossRef | Web of Science | Medline16
Ristow M ,Giannakidou E ,Hebinck J , et al. An association between NIDDM and a GAA trinucleotide repeat polymorphism in the X25/frataxin (Friedreich's ataxia) gene. Diabetes 1998;47:851-854
CrossRef | Web of Science | Medline17
Ristow M ,Vorgerd M ,Mohlig M ,Schatz H ,Pfeiffer A . Deficiency of phosphofructo-1-kinase/muscle subtype in humans impairs insulin secretion and causes insulin resistance. J Clin Invest 1997;100:2833-2841
CrossRef | Web of Science | Medline18
Ristow M ,Mohlig M ,Rifai M ,Schatz H ,Feldmann K ,Pfeiffer A . New isoniazid/ethionamide resistance gene mutation and screening for multidrug-resistant Mycobacterium tuberculosis strains. Lancet 1995;346:502-503
CrossRef | Web of Science | Medline19
Morgenstern JP ,Land H . Advanced mammalian gene transfer: high titre retroviral vectors with multiple drug selection markers and a complementary helper-free packaging cell line. Nucleic Acids Res 1990;18:3587-3596
CrossRef | Web of Science | Medline20
Pear WS ,Nolan GP ,Scott ML ,Baltimore D . Production of high-titer helper-free retroviruses by transient transfection. Proc Natl Acad Sci U S A 1993;90:8392-8396
CrossRef | Web of Science | Medline21
Bruning JC ,Winnay J ,Cheatham B ,Kahn CR . Differential signaling by insulin receptor substrate 1 (IRS-1) and IRS-2 in IRS-1-deficient cells. Mol Cell Biol 1997;17:1513-1521
Web of Science | Medline22
Knebel B ,Kellner S ,Kotzka J , et al. Defects of insulin and IGF-1 action at receptor and postreceptor level in a patient with type A syndrome of insulin resistance. Biochem Biophys Res Commun 1997;234:626-630
CrossRef | Web of Science | Medline23
Yen CJ ,Beamer BA ,Negri C , et al. Molecular scanning of the human peroxisome proliferator activated receptor gamma (hPPAR gamma) gene in diabetic Caucasians: identification of a Pro12Ala PPAR gamma 2 missense mutation. Biochem Biophys Res Commun 1997;241:270-274
CrossRef | Web of Science | Medline24
Lehmann JM ,Moore LB ,Smith-Oliver TA ,Wilkison WO ,Willson TM ,Kliewer SA . An antidiabetic thiazolidinedione is a high affinity ligand for peroxisome proliferator-activated receptor gamma (PPAR gamma). J Biol Chem 1995;270:12953-12956
CrossRef | Web of Science | Medline25
Saltiel AR ,Olefsky JM . Thiazolidinediones in the treatment of insulin resistance and type II diabetes. Diabetes 1996;45:1661-1669
CrossRef | Web of Science | Medline26
Schwartz S ,Raskin P ,Fonseca V ,Graveline JF . Effect of troglitazone in insulin-treated patients with type II diabetes mellitus. N Engl J Med 1998;338:861-866
Full Text | Web of Science | Medline27
Okuno A ,Tamemoto H ,Tobe K , et al. Troglitazone increases the number of small adipocytes without the change of white adipose tissue mass in obese Zucker rats. J Clin Invest 1998;101:1354-1361
CrossRef | Web of Science | Medline28
Kahn CR . Banting Lecture: insulin action, diabetogenes, and the cause of type II diabetes. Diabetes 1994;43:1066-1084
CrossRef | Web of Science | Medline29
National Diabetes Data Group. Diabetes in America. 2nd ed. Bethesda, Md.: National Institute of Diabetes and Digestive and Kidney Diseases, 1995. (NIH publication no. 95-1468.)
- Citing Articles (166)
Citing Articles
1
Neha Saraf, Promod K. Sharma, Sambhu C. Mondal, Vipin K. Garg, Avnesh K. Singh. (2011) Role of PPARg2 transcription factor in thiazolidinedione-induced insulin sensitization. Journal of Pharmacy and Pharmacologyno-no
CrossRef2
Meiling Yan, Jawahar L. Mehta, Changping Hu. (2011) LOX-1 and Obesity. Cardiovascular Drugs and Therapy 25:5, 469-476
CrossRef3
W Jurkowski, K Roomp, I Crespo, J G Schneider, A del Sol. (2011) PPARγ population shift produces disease-related changes in molecular networks associated with metabolic syndrome. Cell Death and Disease 2:8, e192
CrossRef4
G.A. Martos-Moreno, J. Argente. (2011) Obesidades pediátricas: de la lactancia a la adolescencia. Anales de Pediatría 75:1, 63.e1-63.e23
CrossRef5
2011. References. , 283-360.
CrossRef6
Yue Yuan Fan, Lin Sen Zan, Chang Zhen Fu, Wan Qiang Tian, Hong Bao Wang, Yan Yan Liu, Ya Ping Xin. (2011) Three novel SNPs in the coding region of PPARγ gene and their associations with meat quality traits in cattle. Molecular Biology Reports 38:1, 131-137
CrossRef7
Peter T.W. Cheng, Ellen Kick, Ranjan Mukherjee. 2010. Nuclear Hormone Receptor Medicinal Chemistry. .
CrossRef8
Ming-Chia Hsieh, Kun-Der Lin, Kai-Jen Tien, Shih-Te Tu, Jeng-Yueh Hsiao, Shun-Jen Chang, Shiu-Ru Lin, Shih-Jang Shing, Hung-Chun Chen. (2010) Common polymorphisms of the peroxisome proliferator-activated receptor–γ (Pro12Ala) and peroxisome proliferator-activated receptor–γ coactivator–1 (Gly482Ser) and the response to pioglitazone in Chinese patients with type 2 diabetes mellitus. Metabolism 59:8, 1139-1144
CrossRef9
D. Capaccio, A. Ciccodicola, L. Sabatino, A. Casamassimi, M. Pancione, A. Fucci, A. Febbraro, A. Merlino, G. Graziano, V. Colantuoni. (2010) A novel germline mutation in Peroxisome Proliferator-Activated Receptor γ gene associated with large intestine polyp formation and dyslipidemia. Biochimica et Biophysica Acta (BBA) - Molecular Basis of Disease 1802:6, 572-581
CrossRef10
Karani S. Vimaleswaran, Venkatesan Radha, Munuguru Gopal Jayapriya, Saurabh Ghosh, Partha P. Majumder, M. R. Sathyanarayana Rao, Viswanathan Mohan. (2010) Evidence for an association with type 2 diabetes mellitus at the PPARG locus in a South Indian population. Metabolism 59:4, 457-462
CrossRef11
Anne Bugge, Susanne Mandrup. (2010) Molecular Mechanisms and Genome-Wide Aspects of PPAR Subtype Specific Transactivation. PPAR Research 2010, 1-12
CrossRef12
Eric R. Wagner, Bai-Cheng He, Liang Chen, Guo-Wei Zuo, Wenli Zhang, Qiong Shi, Qing Luo, Xiaoji Luo, Bo Liu, Jinyong Luo, Farbod Rastegar, Connie J. He, Yawen Hu, Barrett Boody, Hue H. Luu, Tong-Chuan He, Zhong-Liang Deng, Rex C. Haydon. (2010) Therapeutic Implications of PPARγ in Human Osteosarcoma. PPAR Research 2010, 1-16
CrossRef13
Valerio Costa, Maria Assunta Gallo, Francesca Letizia, Marianna Aprile, Amelia Casamassimi, Alfredo Ciccodicola. (2010) PPARG: Gene Expression Regulation and Next-Generation Sequencing for Unsolved Issues. PPAR Research 2010, 1-17
CrossRef14
Y.-S. Tsai, L. Xu, O. Smithies, N. Maeda. (2009) Genetic variations in peroxisome proliferator-activated receptor expression affect blood pressure. Proceedings of the National Academy of Sciences 106:45, 19084-19089
CrossRef15
Samir Ben Ali, Fatma Ben Yahia, Yousra Sediri, Amani Kallel, Bochra Ftouhi, Moncef Feki, Monia Elasmi, Sameh Haj-Taieb, Omar Souheil, Haifa Sanhagi, Hedia Slimane, Riadh Jemaa, Naziha Kaabachi. (2009) Gender-specific effect of Pro12Ala polymorphism in peroxisome proliferator-activated receptor γ-2 gene on obesity risk and leptin levels in a Tunisian population. Clinical Biochemistry 42:16-17, 1642-1647
CrossRef16
Ellen H. Jeninga, Mark Gurnell, Eric Kalkhoven. (2009) Functional implications of genetic variation in human PPARγ. Trends in Endocrinology & Metabolism 20:8, 380-387
CrossRef17
Hassan Mirzaei, Seyed Mohammad Akrami, Taghi Golmohammadi, Mahmood Doosti, Ramin Heshmat, Manouchehr Nakhjavani, Parvin Amiri. (2009) Polymorphism of Pro12Ala in the Peroxisome Proliferator-Activated Receptor γ2 Gene in Iranian Diabetic and Obese Subjects. Metabolic Syndrome and Related Disorders 7:5, 453-458
CrossRef18
Victoria A. Catenacci, James O. Hill, Holly R. Wyatt. (2009) The Obesity Epidemic. Clinics in Chest Medicine 30:3, 415-444
CrossRef19
Abdul Haseeb, Mohammad Iliyas, Subhabrata Chakrabarti, Arif A. Farooqui, Sudhir R. Naik, Sudip Ghosh, Madhuri Suragani, Nasreen Z. Ehtesham. (2009) Single-nucleotide polymorphisms in peroxisome proliferator-activated receptor γ and their association with plasma levels of resistin and the metabolic syndrome in a South Indian population. Journal of Biosciences 34:3, 405-414
CrossRef20
Richard N. Redinger. (2009) Fat storage and the biology of energy expenditure. Translational Research 154:2, 52-60
CrossRef21
Mona Schaalan, Hanan S. El-Abhar, Maged Barakat, Ezzedin S. El-Denshary. (2009) Westernized-like-diet-fed rats: effect on glucose homeostasis, lipid profile, and adipocyte hormones and their modulation by rosiglitazone and glimepiride. Journal of Diabetes and its Complications 23:3, 199-208
CrossRef22
Olivier van Beekum, Veerle Fleskens, Eric Kalkhoven. (2009) Posttranslational Modifications of PPAR-γ: Fine-tuning the Metabolic Master Regulator. Obesity 17:2, 213-219
CrossRef23
Weimin He. (2009) PPARγ2Pro12Ala Polymorphism and Human Health. PPAR Research 2009, 1-15
CrossRef24
Anna Leonardini, Luigi Laviola, Sebastio Perrini, Annalisa Natalicchio, Francesco Giorgino. (2009) Cross-Talk between PPARγ and Insulin Signaling and Modulation of Insulin Sensitivity. PPAR Research 2009, 1-12
CrossRef25
G.-M. Ryu, P. Song, K.-W. Kim, K.-S. Oh, K.-J. Park, J. H. Kim. (2008) Genome-wide analysis to predict protein sequence variations that change phosphorylation sites or their corresponding kinases. Nucleic Acids Research 37:4, 1297-1307
CrossRef26
Philip A Wood. (2008) Potential of nutrigenetics in the treatment of metabolic disorders. Expert Review of Endocrinology & Metabolism 3:6, 705-713
CrossRef27
Ruth McPherson. (2008) Beyond calories: Genetic determinants of eating, satiety and metabolism underlying obesity. Canadian Journal of Cardiology 24, 15C-17C
CrossRef28
Adilson Guilherme, Joseph V. Virbasius, Vishwajeet Puri, Michael P. Czech. (2008) Adipocyte dysfunctions linking obesity to insulin resistance and type 2 diabetes. Nature Reviews Molecular Cell Biology 9:5, 367-377
CrossRef29
Annemiek M. C. P. Joosen, Arjen H. F. Bakker, Sander Kersten, Klaas R. Westerterp. (2008) The PPARγ ligand rosiglitazone influences triacylglycerol metabolism in non-obese males, without increasing the transcriptional activity of PPARγ in the subcutaneous adipose tissue. British Journal of Nutrition 99:03,
CrossRef30
María C Ochoa, Cristina Razquin, Miguel Ángel Martinez-Gonzalez, Amelia Marti, J Alfredo Martinez. (2008) Role of PPAR-γ2 polymorphisms in bodyweight regulation. Future Lipidology 3:1, 31-41
CrossRef31
Cadence E. Minge, Rebecca L. Robker, Robert J. Norman. (2008) PPAR Gamma: Coordinating Metabolic and Immune Contributions to Female Fertility. PPAR Research 2008, 1-19
CrossRef32
Ioannis Sainis, Katerina Vareli, Vasilios Karavasilis, Evangelos Briasoulis. (2008) PPARγ: The Portrait of a Target Ally to Cancer Chemopreventive Agents. PPAR Research 2008, 1-10
CrossRef33
Dorina Veliceasa, Frank Thilo Schulze-Hoëpfner, Olga V. Volpert. (2008) PPARγ and Agonists against Cancer: Rational Design of Complementation Treatments. PPAR Research 2008, 1-13
CrossRef34
Robert I. Glazer, Hongyan Yuan, Zhihui Xie, Yuzhi Yin. (2008) PPARγ and PPARδ as Modulators of Neoplasia and Cell Fate. PPAR Research 2008, 1-8
CrossRef35
ALAN M. RICE, SCOTT A. RIVKEES. 2008. Receptor Transduction of Hormone Action. , 26-73.
CrossRef36
Laura S. Inselman. 2008. Pulmonary Manifestations of Systemic Disorders. , 1053-1079.
CrossRef37
Stefan Knecht, Tanja Ellger, James A. Levine. (2008) Obesity in neurobiology. Progress in Neurobiology 84:1, 85-103
CrossRef38
Jana Barlic, Philip M. Murphy. (2007) An Oxidized Lipid–Peroxisome Proliferator-Activated Receptor γ–Chemokine Pathway in the Regulation of Macrophage-Vascular Smooth Muscle Cell Adhesion. Trends in Cardiovascular Medicine 17:8, 269-274
CrossRef39
Sharon Cresci. (2007) Pharmacogenetics of the PPAR genes and cardiovascular disease. Pharmacogenomics 8:11, 1581-1595
CrossRef40
I Dahlman, P Arner. (2007) Obesity and polymorphisms in genes regulating human adipose tissue. International Journal of Obesity 31:11, 1629-1641
CrossRef41
Cristina d'Abramo, Jean-Marc Zingg, Antonio Pizzuti, Francesca Argellati, Maria A. Pronzato, Roberta Ricciarelli. (2007) In vitro effect of PPAR-γ2 Pro12Ala polymorphism on the deposition of Alzheimer's amyloid-β peptides. Brain Research 1173, 1-5
CrossRef42
Felix Grün, Bruce Blumberg. (2007) Perturbed nuclear receptor signaling by environmental obesogens as emerging factors in the obesity crisis. Reviews in Endocrine and Metabolic Disorders 8:2, 161-171
CrossRef43
Clemens Schafmayer, Henry Völzke, Stephan Buch, Jan Egberts, Annika Spille, Huberta von Eberstein, Andre Franke, Markus Seeger, Sebastian Hinz, Abdou ElSharawy, Dieter Rosskopf, Mario Brosch, Michael Krawczak, Ulrich R. Foelsch, Anton Schafmayer, Frank Lammert, Stefan Schreiber, Fred Faendrich, Jochen Hampe, Juergen Tepel. (2007) Investigation of the Lith6 candidate genes APOBEC1 and PPARG in human gallstone disease. Liver International 27:7, 910-919
CrossRef44
Carolyn Berdanier. 2007. Nutrition-Related Genetic Diseases. , 929-947.
CrossRef45
Richard Baumgartner, Chenxi Wang, David Allison. 2007. Genetics of Human Obesity. , 833-745.
CrossRef46
Robert Roberts, Alexandre F.R. Stewart, George A. Wells, Kathryn A. Williams, Nihan Kavaslar, Ruth McPherson. (2007) Identifying genes for coronary artery disease: An idea whose time has come. Canadian Journal of Cardiology 23, 7A-15A
CrossRef47
Ruth McPherson. (2007) Genetic contributors to obesity. Canadian Journal of Cardiology 23, 23A-27A
CrossRef48
W. Ahmed, O. Ziouzenkova, J. Brown, P. Devchand, S. Francis, M. Kadakia, T. Kanda, G. Orasanu, M. Sharlach, F. Zandbergen, J. Plutzky. (2007) PPARs and their metabolic modulation: new mechanisms for transcriptional regulation?. Journal of Internal Medicine 262:2, 184-198
CrossRef49
Anke T??njes, Michael Stumvoll. (2007) The role of the Pro12Ala polymorphism in peroxisome proliferator-activated receptor ?? in diabetes risk. Current Opinion in Clinical Nutrition and Metabolic Care 10:4, 410-414
CrossRef50
Julie A. Ross. (2007) Genetic susceptibility and body mass in childhood cancer survivors. Pediatric Blood & Cancer 48:7, 731-735
CrossRef51
Atul Sahai, Rama Dwivedi, Bernard Mirkin. 2007. Molecular Genetics of Obesity Syndrome. , 115-120.
CrossRef52
Mark Gurnell. (2007) ‘Striking the Right Balance’ in Targeting PPARγ in the Metabolic Syndrome: Novel Insights from Human Genetic Studies. PPAR Research 2007, 1-14
CrossRef53
Yaacov Barak, Suyeon Kim. (2007) Genetic Manipulations of PPARs: Effects on Obesity and Metabolic Disease. PPAR Research 2007, 1-12
CrossRef54
Andries J. Gilde, Jean-Charles Fruchart, Bart Staels. (2006) Peroxisome Proliferator-Activated Receptors at the Crossroads of Obesity, Diabetes, and Cardiovascular Disease. Journal of the American College of Cardiology 48:9, A24-A32
CrossRef55
Hiroyuki KAWACHI. (2006) Micronutrients affecting adipogenesis in beef cattle. Animal Science Journal 77:5, 463-471
CrossRef56
Marcus Quinkler, Iwona J. Bujalska, Jeremy W. Tomlinson, Dave M. Smith, Paul M. Stewart. (2006) Depot-specific prostaglandin synthesis in human adipose tissue: A novel possible mechanism of adipogenesis. Gene 380:2, 137-143
CrossRef57
Xiang-Jiao Yang, Serge Grégoire. (2006) A Recurrent Phospho-Sumoyl Switch in Transcriptional Repression and Beyond. Molecular Cell 23:6, 779-786
CrossRef58
Robert Roberts, Alexandre F.R. Stewart. (2006) Personalized Genomic Medicine: A Future Prerequisite for the Prevention of Coronary Artery Disease. The American Heart Hospital Journal 4:3, 222-227
CrossRef59
Makoto Shimizu, Daisuke Yamashita, Tomohiro Yamaguchi, Fumiko Hirose, Takashi Osumi. (2006) Aspects of the regulatory mechanisms of PPAR functions: Analysis of a bidirectional response element and regulation by sumoylation. Molecular and Cellular Biochemistry 286:1-2, 33-42
CrossRef60
Annemiek M. C. P. Joosen, Arjen H. F. Bakker, Maarten J. A. Gering, Klaas R. Westerterp. (2006) The effect of the PPARγ ligand rosiglitazone on energy balance regulation. Diabetes/Metabolism Research and Reviews 22:3, 204-210
CrossRef61
Tuomo Rankinen, Aamir Zuberi, Yvon C. Chagnon, S. John Weisnagel, George Argyropoulos, Brandon Walts, Louis Pérusse, Claude Bouchard. (2006) The Human Obesity Gene Map: The 2005 Update. Obesity 14:4, 529-644
CrossRef62
Christian Freudlsperger, Ingrid Moll, Udo Schumacher, Anka Thies. (2006) Anti-proliferative effect of peroxisome proliferator-activated receptor ?? agonists on human malignant melanoma cells in vitro. Anti-Cancer Drugs 17:3, 325-332
CrossRef63
Yvon C Chagnon. 2006. Molecular Genetics of Obesity and Cardiovascular Diseases. , 177-224.
CrossRef64
T Webb, J Whittington, AJ Holland, S Soni, H Boer, D Clarke, B Horsthemke. (2006) CD36 expression and its relationship with obesity in blood cells from people with and without Prader-Willi syndrome. Clinical Genetics 69:1, 26-32
CrossRef65
Joseph M. Zmuda, Francesmary Modugno, Joel L. Weissfeld, Jane A. Cauley, Donald L. Trump, Susan P. Moffett, Robert E. Ferrell. (2006) Peroxisome Proliferator-Activated Receptor-γ Polymorphism, Body Mass and Prostate Cancer Risk: Evidence for Gene-Environment Interaction. Oncology 70:3, 185-189
CrossRef66
Alper Kepez, Ali Oto, Selcuk Dagdelen. (2006) Peroxisome Proliferator-Activated Receptor-??. BioDrugs 20:2, 121-135
CrossRef67
George A. Bray. 2006. Obesity Is a Major Health Problem: Causes and Natural History. , 1-20.
CrossRef68
Ze-Kuan XU, Neng-Guin CHEN, Chang-Yan MA, Zhuo-Xian MENG, Yu-Jie SUN, Xiao HAN. (2006) Role of Peroxisome Proliferator-Activated Receptor Gamma in Glucose-induced Insulin Secretion. Acta Biochimica et Biophysica Sinica 38:1, 1-7
CrossRef69
Mark Gurnell. (2005) Peroxisome proliferator-activated receptor γ and the regulation of adipocyte function: lessons from human genetic studies. Best Practice & Research Clinical Endocrinology & Metabolism 19:4, 501-523
CrossRef70
Sharon Cresci. (2005) The PPAR genes, cardiovascular disease and the emergence of PPAR pharmacogenetics. Expert Opinion on Pharmacotherapy 6:15, 2577-2591
CrossRef71
Susan P. Moffett, Eleanor Feingold, M. Michael Barmada, Coleen M. Damcott, Julie A. Marshall, Richard F. Hamman, Robert E. Ferrell. (2005) The C161→T polymorphism in peroxisome proliferator–activated receptor gamma, but not P12A, is associated with insulin resistance in Hispanic and non-Hispanic white women: evidence for another functional variant in peroxisome proliferator–activated receptor gamma. Metabolism 54:11, 1552-1556
CrossRef72
Usha Panchapakesan, Xin-Ming Chen, Carol A Pollock. (2005) Drug Insight: thiazolidinediones and diabetic nephropathy—relevance to renoprotection. Nature Clinical Practice Nephrology 1:1, 33-43
CrossRef73
Ricardo Uauy, Erik Díaz. (2005) Consequences of food energy excess and positive energy balance. Public Health Nutrition 8:7a,
CrossRef74
S. Sauder, H. Kölsch, D. Lütjohann, A. Schulz, K. von Bergmann, W. Maier, R. Heun. (2005) Influence of peroxisome proliferator-activated receptor γ gene polymorphism on 24S-hydroxycholesterol levels in Alzheimer’s patients. Journal of Neural Transmission 112:10, 1381-1389
CrossRef75
M. K. Moon, Y. M. Cho, H. S. Jung, Y. J. Park, K. H. Yoon, Y. A. Sung, B. L. Park, H. K. Lee, K. S. Park, H. D. Shin. (2005) Genetic polymorphisms in peroxisome proliferator-activated receptor gamma are associated with Type 2 diabetes mellitus and obesity in the Korean population. Diabetic Medicine 22:9, 1161-1166
CrossRef76
Nicholas Angelopoulos, Anastasia Goula, George Tolis. (2005) Current knowledge in the neurophysiologic modulation of obesity. Metabolism 54:9, 1202-1217
CrossRef77
V. Tavares, R. D. C. Hirata, A. C. Rodrigues, O. Monte, J. E. N. Salles, N. Scalissi, A. C. Speranza, M. H. Hirata. (2005) Association between Pro12Ala polymorphism of the PPAR-?2 gene and insulin sensitivity in Brazilian patients with type-2 diabetes mellitus. Diabetes, Obesity and Metabolism 7:5, 605-611
CrossRef78
Fumiki Oana, Hiroo Takeda, Kohichi Hayakawa, Akane Matsuzawa, Satoshi Akahane, Masayuki Isaji, Masuo Akahane. (2005) Physiological difference between obese (fa/fa) Zucker rats and lean Zucker rats concerning adiponectin. Metabolism 54:8, 995-1001
CrossRef79
A. Hammarstedt, C.X. Andersson, V. Rotter Sopasakis, U. Smith. (2005) The effect of PPARγ ligands on the adipose tissue in insulin resistance. Prostaglandins, Leukotrienes and Essential Fatty Acids 73:1, 65-75
CrossRef80
M. Barbieri, M.R. Rizzo, M. Papa, R. Acampora, L. De Angelis, F. Olivieri, F. Marchegiani, C. Franceschi, G. Paolisso. (2005) Role of interaction between variants in the PPARG and interleukin-6 genes on obesity related metabolic risk factors. Experimental Gerontology 40:7, 599-604
CrossRef81
Aline Meirhaeghe, Michael W.T. Tanck, Lluis Fajas, Caroline Janot, Nicole Helbecque, Dominique Cottel, Johan Auwerx, Philippe Amouyel, Jean Dallongeville. (2005) Study of a new PPARγ2 promoter polymorphism and haplotype analysis in a French population. Molecular Genetics and Metabolism 85:2, 140-148
CrossRef82
Laurent Gelman, Liliane Michalik, Béatrice Desvergne, Walter Wahli. (2005) Kinase signaling cascades that modulate peroxisome proliferator-activated receptors. Current Opinion in Cell Biology 17:2, 216-222
CrossRef83
C. A. Argmann, T.-A. Cock, J. Auwerx. (2005) Peroxisome proliferator-activated receptor gamma: the more the merrier?. European Journal of Clinical Investigation 35:2, 82-92
CrossRef84
Mitchell A. Lazar. (2005) PPARγ, 10 years later. Biochimie 87:1, 9-13
CrossRef85
Claire Diradourian, Jean Girard, Jean-Paul Pégorier. (2005) Phosphorylation of PPARs: from molecular characterization to physiological relevance. Biochimie 87:1, 33-38
CrossRef86
Hugh J. Freeman. (2004) Risk of gastrointestinal malignancies and mechanisms of cancer development with obesity and its treatment. Best Practice & Research Clinical Gastroenterology 18:6, 1167-1175
CrossRef87
Kil Soo Kim, Sun Mi Choi, Seung Uoo Shin, Hyun Sung Yang, Yoosik Yoon. (2004) Effects of peroxisome proliferator-activated receptor-γ2 Pro12Ala polymorphism on body fat distribution in female Korean subjects. Metabolism 53:12, 1538-1543
CrossRef88
Clifford J. Rosen, Cheryl L. Ackert-Bicknell, Martin L. Adamo, Kathy L. Shultz, Janet Rubin, Leah Rae Donahue, Lindsay G. Horton, Krista M. Delahunty, Wesley G. Beamer, Jennifer Sipos, David Clemmons, Tracy Nelson, Mary L. Bouxsein, Mark Horowitz. (2004) Congenic mice with low serum IGF-I have increased body fat, reduced bone mineral density, and an altered osteoblast differentiation program. Bone 35:5, 1046-1058
CrossRef89
Daisuke Yamashita, Tomohiro Yamaguchi, Makoto Shimizu, Nagisa Nakata, Fumiko Hirose, Takashi Osumi. (2004) The transactivating function of peroxisome proliferator-activated receptor γ is negatively regulated by SUMO conjugation in the amino-terminal domain. Genes to Cells 9:11, 1017-1029
CrossRef90
Wei Wang, Yan Yang, Ying Meng, Yanggu Shi. (2004) GDF-3 is an adipogenic cytokine under high fat dietary condition. Biochemical and Biophysical Research Communications 321:4, 1024-1031
CrossRef91
Aline Meirhaeghe, Philippe Amouyel. (2004) Impact of genetic variation of PPARγ in humans. Molecular Genetics and Metabolism 83:1-2, 93-102
CrossRef92
Yau-Sheng Tsai, Hyo-Jeong Kim, Nobuyuki Takahashi, Hyung-Suk Kim, John R. Hagaman, Jason K. Kim, Nobuyo Maeda. (2004) Hypertension and abnormal fat distribution but not insulin resistance in mice with P465L PPARγ. Journal of Clinical Investigation 114:2, 240-249
CrossRef93
Michelangela Barbieri, Massimiliano Bonafè, Maria Rosaria Rizzo, Emilia Ragno, Fabiola Olivieri, Francesca Marchegiani, Claudio Franceschi, Giuseppe Paolisso. (2004) Gender specific association of genetic variation in peroxisome proliferator-activated receptor (PPAR)γ-2 with longevity. Experimental Gerontology 39:7, 1095-1100
CrossRef94
(2004) Tissue-specific Knockout Defines Peroxisome Proliferator-activated Receptor Gamma Function in Muscle and Liver. Nutrition Reviews 62:6, 253-255
CrossRef95
Sirimon Reutrakul, Eba H. Hathout, Donald Janner, Manami Hara, Joseph Donfack, Joseph Bass, Samuel Refetoff. (2004) Familial Juvenile Autoimmune Hypothyroidism, Pituitary Enlargement, Obesity, and Insulin Resistance. Thyroid 14:4, 311-319
CrossRef96
Leif Groop, Martin Ridderstr��le. 2004. Molecular Genetics of Type 2 Diabetes-Candidate Genes. .
CrossRef97
Johanna K Wolford, Barbora Vozarova de Courten. (2004) Genetic Basis of Type 2 Diabetes Mellitus. Treatments in Endocrinology 3:4, 257-267
CrossRef98
Coleen M Damcott, Paul Sack, Alan R Shuldiner. (2003) The genetics of obesity. Endocrinology & Metabolism Clinics of North America 32:4, 761-786
CrossRef99
Maciej T. Malecki, Jakub Frey, Tomasz Klupa, Jan Skupien, Malgorzata Walus, Wojciech Mlynarski, Jacek Sieradzki. (2003) The Pro12Ala polymorphism of PPARγ2 gene and susceptibility to type 2 diabetes mellitus in a Polish population. Diabetes Research and Clinical Practice 62:2, 105-111
CrossRef100
Wojciech Placha, Dorota Gil, Aldona Dembi??ska-Kie??, Piotr Laidler. (2003) The effect of PPAR?? ligands on the proliferation and apoptosis of human melanoma cells. Melanoma Research 13:5, 447-456
CrossRef101
Rita Kohen-Avramoglu, Andre Theriault, Khosrow Adeli. (2003) Emergence of the metabolic syndrome in childhood: an epidemiological overview and mechanistic link to dyslipidemia. Clinical Biochemistry 36:6, 413-420
CrossRef102
Mark Gurnell. (2003) PPARgamma and metabolism: insights from the study of human genetic variants. Clinical Endocrinology 59:3, 267-277
CrossRef103
Andrew W. Norris, Lihong Chen, Simon J. Fisher, Ildiko Szanto, Michael Ristow, Alison C. Jozsi, Michael F. Hirshman, Evan D. Rosen, Laurie J. Goodyear, Frank J. Gonzalez, Bruce M. Spiegelman, C. Ronald Kahn. (2003) Muscle-specific PPARγ-deficient mice develop increased adiposity and insulin resistance but respond to thiazolidinediones. Journal of Clinical Investigation 112:4, 608-618
CrossRef104
Claude Bouchard, Louis P��russe. 2003. The Genetics of Human Obesity. .
CrossRef105
Maren T. Scheuner. (2003) Genetic evaluation for coronary artery disease. Genetics in Medicine 5:4, 269-285
CrossRef106
Roland Rosmond, Monique Chagnon, Claude Bouchard. (2003) ThePro12Ala PPAR?2 gene missense mutation is associated with obesity and insulin resistance in Swedish middle-aged men. Diabetes/Metabolism Research and Reviews 19:2, 159-163
CrossRef107
Teruo Kawada. (2003) Fat Cell Formation and Obesity-Related Diseases. Nutraceuticals and food 8:1, 105-112
CrossRef108
Gordon A. Francis, Elisabeth Fayard, Frédéric Picard, Johan Auwerx. (2003) N
UCLEAR RECEPTORS AND THE CONTROL OF METABOLISM . Annual Review of Physiology 65:1, 261-311
CrossRef109
Sang K. Noh, Sung I. Koo, Yongzhi Jiang. (2003) (+)-Catechin is a Potent Inhibitor of Intestinal Absorption of Cholesterol in Rats. Nutraceuticals and food 8:1, 1-6
CrossRef110
O. Vaccaro, F. P. Mancini, G. Ruffa, L. Sabatino, C. Iovine, M. Masulli, V. Colantuoni, G. Riccardi. (2002) Fasting plasma free fatty acid concentrations and Pro12Ala polymorphism of the peroxisome proliferator-activated receptor (PPAR) gamma2 gene in healthy individuals. Clinical Endocrinology 57:4, 481-486
CrossRef111
Berthold Koletzko, Jean-Philippe Girardet, William Klish, Omar Tabacco. (2002) Obesity in Children and Adolescents Worldwide: Current Views and Future Directions—Working Group Report of the First World Congress of Pediatric Gastroenterology, Hepatology, and Nutrition. Journal of Pediatric Gastroenterology and Nutrition 35, S205-S212
CrossRef112
Sunder Mudaliar, Robert R. Henry. (2002) PPAR agonists in health and disease: a pathophysiologic and clinical overview. Current Opinion in Endocrinology & Diabetes 9:4, 285-302
CrossRef113
Frédéric Picard, Johan Auwerx. (2002) PPARγ
AND GLUCOSE HOMEOSTASIS . Annual Review of Nutrition 22:1, 167-197
CrossRef114
C. Sewter, A. Vidal-Puig. (2002) PPARgamma and the thiazolidinediones: molecular basis for a treatment of 'Syndrome X'?. Diabetes, Obesity and Metabolism 4:4, 239-248
CrossRef115
James L. Kirkland, Tamara Tchkonia, Tamar Pirtskhalava, Jianrong Han, Iordanes Karagiannides. (2002) Adipogenesis and aging: does aging make fat go MAD?. Experimental Gerontology 37:6, 757-767
CrossRef116
Francesco S. Celi, Alan R. Shuldiner. (2002) The role of peroxisome proliferator-activated receptor gamma in diabetes and obesity. Current Diabetes Reports 2:2, 179-185
CrossRef117
Sander Kersten. (2002) Peroxisome proliferator activated receptors and obesity. European Journal of Pharmacology 440:2-3, 223-234
CrossRef118
Joel Berger, David E. Moller. (2002) T
HE MECHANISMS OF ACTION OF PPARS . Annual Review of Medicine 53:1, 409-435
CrossRef119
Maria M. Mercado, John C. McLenithan, Kristi D. Silver, Alan R. Shuldiner. (2002) Genetics of insulin resistance. Current Diabetes Reports 2:1, 83-95
CrossRef120
Carsten Otto, Michael Lehrke, Burkhard Göke. (2002) Novel insulin sensitizers: pharmacogenomic aspects. Pharmacogenomics 3:1, 99-116
CrossRef121
A. Brian Jones. (2001) Peroxisome proliferator-activated receptor (PPAR) modulators: Diabetes and beyond. Medicinal Research Reviews 21:6, 540-552
CrossRef122
Selma F Witchel, Carlie White, Michael E Siegel, Christopher E Aston. (2001) Inconsistent effects of the proline12 → alanine variant of the peroxisome proliferator-activated receptor-γ2 gene on body mass index in children and adolescent girls. Fertility and Sterility 76:4, 741-747
CrossRef123
Nikolaus Marx, Peter Libby, Jorge Plutzky. (2001) Journal of Cardiovascular Risk 8:4, 203-210
CrossRef124
Jassim Al Suwaidi, R. Scott WRIGHT, Joseph P. Grill, Donald D. Hensrud, Joseph G. Murphy, Ray W. Squires, Stephen L. Kopecky. (2001) Obesity is associated with premature occurrence of acute myocardial infarction. Clinical Cardiology 24:8, 542-547
CrossRef125
Felicity Kaplan, Khulood Al-Majali, D. Betteridge. (2001) Journal of Cardiovascular Risk 8:4, 211-217
CrossRef126
Darrell W. Eubank, Simon C. Williams, Elmus G. Beale. (2001) C/EBPβ Interacts with the P-enolpyruvate Carboxykinase Adipocyte-Specific Enhancer. Biochemical and Biophysical Research Communications 285:3, 811-819
CrossRef127
YouFei Guan, Matthew D Breyer. (2001) Peroxisome proliferator-activated receptors (PPARs): Novel therapeutic targets in renal disease. Kidney International 60:1, 14-30
CrossRef128
Maren T. Scheuner. (2001) Genetic predisposition to coronary artery disease. Current Opinion in Cardiology 16:4, 251-260
CrossRef129
Inés Pineda Torra, Giulia Chinetti, Caroline Duval, Jean-Charles Fruchart, Bart Staels. (2001) Peroxisome proliferator-activated receptors: from transcriptional control to clinical practice. Current Opinion in Lipidology 12:3, 245-254
CrossRef130
Timothy M. Willson, Millard H. Lambert, Steven A. Kliewer. (2001) P
EROXISOME PROLIFERATOR –ACTIVATED RECEPTOR γAND METABOLIC DISEASE . Annual Review of Biochemistry 70:1, 341-367
CrossRef131
Jacob Bar-Tana. (2001) Peroxisome proliferator-activated receptor gamma (PPARγ) activation and its consequences in humans. Toxicology Letters 120:1-3, 9-19
CrossRef132
H ZACUR. (2001) Polycystic Ovary Syndrome Hyperandrogenism, and Insulin Resistance. Obstetrics and Gynecology Clinics of North America 28:1, 21-33
CrossRef133
Sunder Mudaliar, Robert R. Henry. (2001) N
EW ORAL THERAPIES FOR TYPE 2 DIABETES MELLITUS : The Glitazones or Insulin Sensitizers 1. Annual Review of Medicine 52:1, 239-257
CrossRef134
Albert Császár, Tatjana Ábel. (2001) Receptor polymorphisms and diseases. European Journal of Pharmacology 414:1, 9-22
CrossRef135
Olavi Ukkola, Claude Bouchard. (2001) Clustering of metabolic abnormalities in obese individuals: the role of genetic factors. Annals of Medicine 33:2, 79-90
CrossRef136
Nubuyuki TAKAHASHI, Teruo KAWADA. (2001) Physiological and pharmacological function of PPARs.. Folia Pharmacologica Japonica 117:5, 319-327
CrossRef137
G.A. Bray, C. Bouchard. 2001. Obesity, Determinants of: Genetic Aspects. , 10775-10781.
CrossRef138
Gregory J Murphy, Julie C Holder. (2000) PPAR-γ agonists: therapeutic role in diabetes, inflammation and cancer. Trends in Pharmacological Sciences 21:12, 469-474
CrossRef139
A. Schaffler, N. Barth, K-D. Palitzsch, W. Drobnik, J. Scholmerich, G. Schmitz. (2000) Mutation analysis of the human adipocyte-specific apM-1 gene. European Journal of Clinical Investigation 30:10, 879-887
CrossRef140
Lee M. Kaplan. (2000) Genetics of obesity and body weight regulation. Current Opinion in Endocrinology & Diabetes 7:5, 218-224
CrossRef141
Sarah J Roberts-Thomson. (2000) Peroxisome proliferator-activated receptors in tumorigenesis: Targets of tumour promotion and treatment. Immunology and Cell Biology 78:4, 436-441
CrossRef142
Ricardo Uauy, Alfonso Valenzuela. (2000) Marine oils: the health benefits of n-3 fatty acids. Nutrition 16:7-8, 680-684
CrossRef143
Shamina M. Rangwala, Mitchell A. Lazar. (2000) T
RANSCRIPTIONAL CONTROL OF ADIPOGENESIS . Annual Review of Nutrition 20:1, 535-559
CrossRef144
Jorge Plutzky. (2000) Peroxisome proliferator-activated receptors in vascular biology and atherosclerosis: Emerging insights for evolving paradigms. Current Atherosclerosis Reports 2:4, 327-335
CrossRef145
Leif Groop. (2000) Genetics of the metabolic syndrome. British Journal of Nutrition 83:S1,
CrossRef146
Peter Arner. (2000) Obesity — a genetic disease of adipose tissue?. British Journal of Nutrition 83:S1,
CrossRef147
Deborah J. Good. (2000) How Tight Are Your Genes?. Hormones and Behavior 37:4, 284-298
CrossRef148
Ranjan Mukherjee, Jo Anne Saye, Peter R Young. (2000) Nuclear receptors in metabolic diseases. Expert Opinion on Therapeutic Targets 4:3, 377-396
CrossRef149
Martin Wabitsch. (2000) The acquisition of obesity: insights from cellular and genetic research. Proceedings of the Nutrition Society 59:02, 325-330
CrossRef150
Globerman, Zauberman, Makarov, Beamer, Yen, Shuldiner, Harel, Karnieli. (2000) Analysis of the peroxisome proliferator activated receptor gamma (PPARgamma) gene in HAIRAN syndrome with obesity. Clinical Endocrinology 52:4, 479-485
CrossRef151
Alfred Maelicke. (2000) Transkriptionskontrolle und Altersdiabetes. Nachrichten aus der Chemie 48:4, 500-503
CrossRef152
Kristina Schoonjans, Johan Auwerx. (2000) Thiazolidinediones: an update. The Lancet 355:9208, 1008-1010
CrossRef153
David Bishop-Bailey. (2000) Peroxisome proliferator-activated receptors in the cardiovascular system. British Journal of Pharmacology 129:5, 823-834
CrossRef154
Joseph Vamecq, Norbert Latruffe. (2000) Peroxisome proliferator-activated receptors (PPARs) and their implications in diseases. Current Opinion in Endocrinology & Diabetes 7:1, 8-18
CrossRef155
Ricardo Uauy, Patricia Mena, Cecilia Rojas. (2000) Essential fatty acids in early life: structural and functional role. Proceedings of the Nutrition Society 59:01, 3-15
CrossRef156
Jiro Masugi, Yoshikazu Tamori, Hiroyuki Mori, Takashi Koike, Masato Kasuga. (2000) Inhibitory Effect of a Proline-to-Alanine Substitution at Codon 12 of Peroxisome Proliferator-Activated Receptor-γ 2 on Thiazolidinedione-Induced Adipogenesis. Biochemical and Biophysical Research Communications 268:1, 178-182
CrossRef157
Jiro Masugi, Yoshikazu Tamori, Masato Kasuga. (1999) Inhibition of Adipogenesis by a COOH-Terminally Truncated Mutant of PPARγ2 in 3T3-L1 Cells. Biochemical and Biophysical Research Communications 264:1, 93-99
CrossRef158
Barry J. Goldstein. (1999) Current Views on the Mechanism of Action of Thiazolidinedione Insulin Sensitizers. Diabetes Technology & Therapeutics 1:3, 267-275
CrossRef159
Maria E. Trent, David S. Ludwig. (1999) Adolescent obesity, a need for greater awareness and improved treatment. Current Opinion in Pediatrics 11:4, 297-307
CrossRef160
Jòseph Vamecq, Norbert Latruffe. (1999) Medical significance of peroxisome proliferator-activated receptors. The Lancet 354:9173, 141-148
CrossRef161
Laurent Gelman, Johan Auwerx. (1999) Peroxisome proliferator-activated receptors: mediators of a fast food impact on gene regulation. Current Opinion in Clinical Nutrition and Metabolic Care 2:4, 307-312
CrossRef162
Sumito Ogawa, Tomohiko Urano, Takayuki Hosoi, Mariko Miyao, Shinjiro Hoshino, Masayo Fujita, Masataka Shiraki, Hajime Orimo, Yasuyoshi Ouchi, Satoshi Inoue. (1999) Association of Bone Mineral Density with a Polymorphism of the Peroxisome Proliferator-Activated Receptor γ Gene: PPARγ Expression in Osteoblasts. Biochemical and Biophysical Research Communications 260:1, 122-126
CrossRef163
Pasha Sarraf, Elisabetta Mueller, Wendy M Smith, Harold M Wright, Jennifer B Kum, Lauri A Aaltonen, Albert de la Chapelle, Bruce M Spiegelman, Charis Eng. (1999) Loss-of-Function Mutations in PPARγ Associated with Human Colon Cancer. Molecular Cell 3:6, 799-804
CrossRef164
Hedley C. Freake. (1999) A Genetic Mutation in PPARγ Is Associated with Enhanced Fat Cell Differentiation: Implications for Human Obesity. Nutrition Reviews 57:5, 154-156
CrossRef165
Antti Virkamäki, Kohjiro Ueki, C. Ronald Kahn. (1999) Protein–protein interaction in insulin signaling and the molecular mechanisms of insulin resistance. Journal of Clinical Investigation 103:7, 931-943
CrossRef166
K Clément. (1999) Leptin and the genetics of obesity. Acta Paediatrica 88:s428, 51-57
CrossRef
