Join the 200th Anniversary Celebration

Original Article

High-Level Chloramphenicol Resistance in Neisseria meningitidis

Marc Galimand, Ph.D., Guy Gerbaud, Martine Guibourdenche, Jean-Yves Riou, M.D., and Patrice Courvalin, M.D.

N Engl J Med 1998; 339:868-874September 24, 1998

Abstract

Background

Neisseria meningitidis is nearly always susceptible to the penicillins, the cephalosporins, and chloramphenicol. Between 1987 and 1996, however, chloramphenicol-resistant strains were isolated from 11 patients in Vietnam and 1 in France.

Methods

The minimal inhibitory concentration of chloramphenicol was determined for the 12 isolates. The isolates were analyzed by monoclonal-antibody–based serotyping and subtyping, pulsed-field gel electrophoresis, and multilocus enzyme electrophoresis. Bacterial DNA was analyzed by hybridization, the polymerase chain reaction, and sequencing to identify the resistance gene and determine the origin of the resistance.

Results

The isolates were resistant to chloramphenicol (minimal inhibitory concentration, ≥64 mg per liter) and produced an active chloramphenicol acetyltransferase. All 12 strains belonged to serogroup B but had a high degree of diversity, and 10 could not be typed with the use of monoclonal antibodies. The nucleotide sequence of the resistance gene and the flanking regions was identical to that of an internal portion of transposon Tn4451 that carries the catP gene in Clostridium perfringens. Moreover, this gene was located in the same genomic site in the chloramphenicol-resistant isolates.

Conclusions

The high-level chloramphenicol resistance that we describe in N. meningitidis isolates is of great concern, since in developing countries, chloramphenicol given intramuscularly is the standard therapy for meningococcal meningitis. The resistance to chloramphenicol is due to the presence of the catP gene on a truncated transposon that has lost mobility because of internal deletions, and the transformation of genetic material between strains of N. meningitidis probably played an important part in the dissemination of the gene.

Media in This Article

Figure 1Analysis of Genomic DNA from Clinical Isolates of N. meningitidis by Pulsed-Field Gel Electrophoresis (Panel A) and Hybridization (Panel B).
Figure 2Analysis of the Genomic Region of the catP Gene in N. meningitidis by PCR.
Article

Neisseria meningitidis can cause a spectrum of diseases ranging from transient fever and bacteremia to meningitis and fulminant septicemia. Meningitis is spread by airborne droplets or direct contact with discharge from the nose or throat of an infected person. Meningococcal infections are common in both temperate and subtropical climates, with sporadic cases throughout the year.

N. meningitidis is differentiated into serogroups on the basis of the composition of the polysaccharide capsule. Serogroup A causes widespread epidemics in sub-Saharan Africa, where a 600-km-wide meningitis belt extends from the Gambia in the west to Ethiopia in the east. Outbreaks of serogroup A meningitis have occurred in the Middle East and in southern and eastern Asia. Serogroup B meningococci are the cause of most cases of meningococcal disease in developed countries, but the attack rates are substantially lower than those for serogroup A. During the late 1970s, a serogroup B clone (serotype 15, electrophoretic type 5) emerged in northwestern Europe. Intercontinental spread of this clone has been documented, with outbreaks in Cuba (in 1980), Chile (in 1985), and Brazil (in 1987). Strains of this type were also isolated from patients in the United States in 1988. Cases caused by serogroup B organisms began to decline slowly after 1988, whereas those caused by serogroup C organisms increased in several European countries and in the United States.1 There are vaccines against serogroups A, C, W-135, and Y, but no effective vaccine against group B meningococci is available.

Among the bacteria that cause serious infections, N. meningitidis is one of the least problematic in terms of antibiotic resistance.2 Resistance to penicillin G, sulfonamides, rifampin, and tetracyclines has been reported, but high-level resistance to penicillins through β-lactamase production is still extremely rare. Low-level resistance to penicillins due to an alteration in penicillin-binding protein–2 is widespread.2 Sulfonamides have been used extensively, and resistance caused by a mutation in the chromosomal gene for the dihydropteroate synthase is common.3 High-level resistance to rifampin is due to mutations in the gene for the β subunit of RNA polymerase (rpoB)4 and low-level resistance to a decrease in membrane permeability.5 The plasmid-borne tet(M) gene confers resistance to tetracyclines in genital and anorectal isolates of N. meningitidis. 6,7 In addition, the development of drug resistance in isolates of N. gonorrhoeae, a closely related organism, has led to concern about the almost inevitable progression of resistance in N. meningitidis isolates.

We report high-level resistance to chloramphenicol in epidemiologically unrelated clinical isolates of N. meningitidis through the production of a chloramphenicol acetyltransferase. This observation is clinically important because intramuscular administration of chloramphenicol is standard therapy for meningococcal meningitis in developing countries.

Methods

Patients and Strains

The properties of the chloramphenicol-resistant N. meningitidis strains isolated from cerebrospinal fluid are listed in Table 1Table 1Properties of the Bacterial Strains Studied.. N. meningitidis LNP11890 was isolated from a two-year-old girl at the Hôpital de Metz (Metz, France) in July 1993. The patient, who had never been to Southeast Asia, presented with fever, vomiting, meningeal signs, and cloudy cerebrospinal fluid. She was treated with cefotaxime for eight days and recovered.

We could obtain clinical information for only 4 of the 11 strains isolated between 1987 and 1996 in Vietnam and identified at the Institut Pasteur in Ho Chi Minh City. Strain LNP13943 was isolated in January 1987 from a 10-month-old girl in the Song Be region. The patient presented with high-grade fever but without vomiting or convulsions. The cerebrospinal fluid was cloudy. She was treated with penicillin G and chloramphenicol for 12 days and recovered.

Strain LNP14610 was isolated on May 10, 1996, from a nine-year-old boy living in Ho Chi Minh City. The patient presented with high-grade fever, vomiting, headache, meningeal signs, petechial lesions, and cloudy cerebrospinal fluid. He recovered after treatment with three daily intravenous injections of cefotaxime (6 g per day) for eight days, followed by penicillin G (1,250,000 units per day) for five days.

Strain LNP14608 was isolated on May 31, 1996, from a two-year-old girl living in the same district of Ho Chi Minh City where the nine-year-old boy lived. The strain was isolated at the same hospital. The patient presented with fever, vomiting, meningeal signs, and cloudy cerebrospinal fluid. Treatment included intramuscular injections of gentamicin (0.08 g per day) twice a day for 7 days and intravenous injections of cephradine (4 g per day) four times a day for 10 days. The patient recovered after two weeks.

Strain LNP14609 was isolated in June 1996 from a five-year-old girl living outside Ho Chi Minh City; the strain was isolated at a different hospital from that where strains LNP14610 and LNP14608 were isolated. The patient presented with fever, headache, vomiting, and cloudy cerebrospinal fluid. She was treated with intravenous injections of penicillin G (400,000 units per kilogram of body weight per day) for 10 days and recovered.

Nine chloramphenicol-susceptible strains (minimal inhibitory concentration, 1 mg per liter) with various antigenic characteristics were used as controls in polymerase-chain-reaction (PCR) studies: LNP14299, LNP14308, and LNP14371 in serogroup A; LNP15339, LNP15340, and LNP15341 in serogroup B; and LNP15345, LNP15346, and LNP15347 in serogroup C.

Mediums and Resistance Studies

The strains were grown on GC-base agar (Difco) containing supplements, as described by Kellogg et al.,11 and were incubated at 37°C with 5 percent carbon dioxide. The minimal inhibitory concentrations of antibiotics were determined by the E test on supplement G–containing agar medium (Sanofi Diagnostics Pasteur). Chloramphenicol acetyltransferase and aminoglycoside-modifying enzymes were assayed in supernatants (centrifuged at 100,000×g) after ultrasonic disintegration.12,13 With Escherichia coli JM83, the following antibiotics were used: chloramphenicol (10 mg per liter) for cloning the resistance gene and kanamycin (20 mg per liter) for cloning the PCR product.14 With neisseriae, the following antibiotics were used: chloramphenicol (10 mg per liter), nalidixic acid (20 mg per liter), and tetracycline (2 mg per liter). The transformation of N. meningitidis BM4376 (a nalidixic acid–resistant derivative of N. meningitidis 8013,15 serogroup C, kindly provided by X. Nassif) and BM4377 (a recA::tet(M) tetracycline-resistant derivative of N. meningitidis 8013) with total DNA from chloramphenicol-resistant N. meningitidis LNP13947 was performed as described elsewhere.15

Antigenic Classification of N. meningitidis Isolates

The strains were serogrouped with the use of monoclonal antibodies and the agglutination technique, as described elsewhere.8 Isolates were typed and subtyped with the use of the whole-cell enzyme-linked immunosorbent assay of Abdillahi and Poolman.9

Multilocus Enzyme Electrophoresis

Protein extraction and selective enzyme staining were carried out as described by Caugant et al.10 Every isolate was characterized according to the combination of its alleles at the 13 enzyme loci, and distinctive multilocus genotypes were designated as electrophoretic types.16

Nucleic-Acid Techniques

Isolation of DNA, cleavage by restriction endonucleases, and purification of DNA fragments from low-temperature-gelling agarose type VII (Sigma Chemical) were performed as described elsewhere.17 Large restriction fragments were separated by pulsed-field gel electrophoresis in 0.5× TRIS–borate buffer in a CHEF-DRIII system (Bio-Rad). Purified DNA fragments to be used as probes were labeled with [α-32P]deoxycytidine triphosphate by nick translation. Hybridization was carried out under highly stringent conditions.17 The PCR assay was performed with a DNA thermal cycler (model 2400, Perkin–Elmer Cetus). Sequencing of double-stranded DNA was performed by the dideoxynucleotide chain-termination method18 with a modified T7 DNA polymerase and [α-35S]deoxyadenosine triphosphate.

Nucleotide-Sequence Accession Number

The nucleotide sequence of the catP gene and flanking regions from N. meningitidis LNP13947 has been deposited in the GenBank under accession number AF031037.

Results

Bacterial Identification

The minimal inhibitory concentrations of chloramphenicol against the 12 isolates, determined by the E test, ranged from 64 to 192 mg per liter (Table 1). Disk-agar diffusion tests showed that all 12 were also resistant to streptomycin and sulfonamides but remained susceptible to penicillins, cephalosporins, tetracyclines, macrolides, rifampin, and quinolones (data not shown). All strains belonged to serogroup B, and most could not be serotyped with the use of monoclonal antibodies. The antigenic characterization of each strain is shown in Table 1.

The strains were quite diverse. Pulsed-field gel electrophoresis after digestion with the BglII restriction endonuclease identified nine chromosomal profiles19 (Figure 1AFigure 1Analysis of Genomic DNA from Clinical Isolates of N. meningitidis by Pulsed-Field Gel Electrophoresis (Panel A) and Hybridization (Panel B).), and multilocus enzyme electrophoresis identified eight electrophoretic types16 (Table 1). Taken together, these results indicate that the chloramphenicol-resistant isolates were not clonally related. In particular, strains LNP14608, LNP14609, and LNP14610, which were isolated in 1996 and for which clinical information was available, differed from one another on the basis of both multilocus enzyme electrophoresis (Table 1) and pulsed-field gel electrophoresis (Figure 1A, lanes 11, 12, and 13).

Characterization of the Chloramphenicol-Resistance Gene

Total DNA from N. meningitidis strain LNP13947 and pUC18 DNA digested with Sau3A and BamHI, respectively, were mixed, ligated, and introduced into E. coli JM83 (minimal inhibitory concentration of chloramphenicol, 2 mg per liter). The resulting transformed isolates (transformants) were selected on the basis of their resistance to chloramphenicol, and the smallest hybrid plasmid, pAT447, was found to contain a 6.5-kb insert. Subcloning was accomplished by introducing the 4.6-kb EcoRI–HindIII fragment of the insert into pUC18, which generated pAT448. The latter construct conferred high levels of resistance to the new host (minimal inhibitory concentration, >256 mg per liter) by synthesis of a chloramphenicol acetyltransferase, as determined by an enzyme assay (data not shown).

The sequence of a 1.5-kb DNA segment in the cloned fragment from N. meningitidis LNP13947 was determined. The sequence of the resistance gene and of the flanking regions was identical to approximately 1 kb of DNA (nucleotides 257 to 1243; numbering according to GenBank accession number AF031037) present within the 6.3-kb plasmid-borne transposon Tn4451 from Clostridium perfringens (nucleotides 2721 to 3707; numbering according to GenBank accession number U15027), which carries the catP gene.20,21 Two primers (primer A, 5'ATTCAGAGTTTAGGACGG3', and primer B, 5'ATCAAATAATCAATCC3') designed from the sequence of catP allowed amplification of a fragment of total DNA with the predicted size of 300 bp from all the resistant isolates but not from chloramphenicol-susceptible strains LNP14299 (serogroup A), LNP15339 (serogroup B), and LNP15345 (serogroup C) (data not shown).

After susceptible strains of N. meningitidis had been independently transformed with chromosomal DNA from N. meningitidis LNP13947, four randomly selected chloramphenicol-resistant transformants were studied further: BM4378 and BM4379, obtained from BM4376, and BM4380 and BM4381, obtained from BM4377.

Genomic Region of the catP Gene

The probe made from the 300-bp fragment internal to catP from N. meningitidis LNP13947 hybridized to a BglII fragment of approximately 100 kb in the 12 chloramphenicol-resistant isolates (Figure 1B, lanes 2 through 13). The 45-kb difference in the size of the BglII fragment in transformants BM4378 and BM4380 (Figure 1B, lanes 15 and 16, respectively) was due to the presence of a BglII site within the tetracycline-resistance determinant15 in BM4377. To investigate the junctions between the DNA of the truncated transposon and that of the host, two primers were designed on the basis of the 5' and 3' meningococcal sequences flanking the Tn4451-like insertion (primer C, 5'CTAAATCAATAATAATATTCCC3', and primer D, 5'ACCCCAGGTAGAATACAATGAA3').

These primers, which allow amplification of a 1206-bp fragment with the insertion of pAT448 as a template (Figure 2Figure 2Analysis of the Genomic Region of the catP Gene in N. meningitidis by PCR., lane 6), gave rise to products of approximately 1200 bp in the chloramphenicol-resistant isolates (Figure 2, lanes 7 through 18) and to products of approximately 200 bp in the susceptible N. meningitidis strains belonging to serogroup A (three strains), B (three strains), and C (four strains) (Figure 2, lanes 3, 4, and 5). The predicted size of the PCR product corresponding to the target site before the acquisition of transposon sequences was 218 bp, on the assumption that there was no deletion in the adjacent meningococcal DNA. Moreover, with the use of the same primers, a 1200-bp product was also obtained from the four independent resistant transformants (Figure 2, lanes 20 and 21) as opposed to a 200-bp product from the chloramphenicol-susceptible corresponding strains (Figure 2, lane 19). Taken together, these results indicate that the catP gene was located in the same genomic region in all the resistant N. meningitidis strains.

Insertion Site of the catP Gene into the N. meningitidis Chromosome

The sequence of the catP gene and flanking regions from transposon Tn4451, from the pAT448 insert, and from the 1200-bp PCR products obtained from the transformants was compared with that of the 200-bp product obtained from susceptible N. meningitidis strains (Figure 3Figure 3Site of Insertion of the catP Gene into Chromosomal DNA of N. meningitidis. ). Insertion of the catP gene occurred at the same site in a region with a large proportion of adenosine and thymidine (77 percent, as compared with 50 percent under normal conditions).22 Two thymidines are present in the meningococcal DNA and at the 3' end of the truncated transposon, indicating that there is a 1-bp or 2-bp deletion in the target DNA or no loss of meningococcal DNA in the transformants (Figure 3).

Resistance to Sulfonamides and Streptomycin

The entire gene for the dihydropteroate synthase from two sulfonamide-susceptible strains (LNP14299 and LNP15339) and two sulfonamide-resistant strains (LNP13943 and LNP14610) was amplified by PCR with the use of specific primers23 and sequenced. The resistant strains had a substitution of guanosine for thymidine at position 92 (N. meningitidis numbering), resulting in the replacement of the conserved phenylalanine by a leucine at position 31 and a 6-bp insertion (TCCGGC) resulting in two extra amino acids (serine at position 195 and glycine at position 196) in a highly conserved region of the enzyme.23 Each of these mutations has been shown to be associated with sulfonamide resistance in N. meningitidis strains.23

DNA from the 12 streptomycin-resistant isolates did not hybridize with probes specific for the streptomycin–adenylyltransferase ant(3")(9) gene and the streptomycin–phosphotransferase aph(3")-I and aph(6)-I genes. No streptomycin adenylyltransferase or phosphotransferase activity was detected in crude extracts from these strains. In other bacterial genera, streptomycin resistance can also result from mutations in the gene for ribosomal protein S12 (rpsL), leading to the substitution of lysine at positions 43 and 88 (E. coli numbering),24 or in the portions of the rrs gene that correspond to the highly conserved 530-loop and 912 region of 16S ribosomal RNA.25 Sequencing of the rpsL gene (from position 75 to position 300) and the rrs gene (from 368 to 979) in susceptible strains (LNP14299 and LNP15399) and resistant strains (LNP13943 and LNP14610) did not reveal any mutation.

Discussion

N. meningitidis is one of the few bacterial species that causes serious infections for which penicillin G and chloramphenicol are still routinely recommended in developing countries. Strains of N. meningitidis with high levels of resistance to chloramphenicol were isolated from cerebrospinal fluid in Vietnam and in France between 1987 and 1996. In Vietnam, chloramphenicol and penicillin G were used for the treatment of meningococcal meningitis in the 1980s, and penicillin G and cephalosporins were used in the 1990s, whereas cephalosporins were used in France during that period. The isolates were also resistant to streptomycin and sulfonamides but remained susceptible to penicillins, cephalosporins, tetracyclines, rifampin, and quinolones; quinolones are used for the treatment of meningococcal disease and also as prophylaxis to reduce nasopharyngeal carriage of meningococci.26 The resistance of the N. meningitidis isolates to sulfonamides was due to the production of an altered dihydropteroate synthase, but the mechanism of streptomycin resistance remains unknown.

The resistance of the N. meningitidis isolates to chloramphenicol was due to the presence, at a unique site, of the catP gene as part of a truncated copy of transposon Tn4451 from C. perfringens. Although it has been shown that excision of Tn4451 from C. perfringens and from the E. coli chromosome is precise,27 no intact copy of the transposon was found in N. meningitidis. Deletions within transposons have been reported, in particular in N. meningitidis, N. gonorrhoeae, 28 and commensal neisseria species.29 In the chloramphenicol-resistant strains, there were large deletions in Tn4451, accounting for approximately 80 percent of the transposon, that included the genes responsible for excision and made the transposon immobile.

The initial acquisition of chloramphenicol resistance by N. meningitidis could have occurred by transformation or conjugation, raising the possibility of a transfer of genetic information from a strict anaerobe to a strict aerobe. For conjugation, a meeting point between C. perfringens and N. meningitidis is not mandatory, since — although it was first detected in the former species — a Tn4451-related element could also be present in an aerobic–anaerobic bacterium that acted as a donor. Unlike conjugation, transformation does not require physical contact between the donor and recipient cells and can therefore occur between microorganisms in different ecosystems.

Even if these two possible mechanisms cannot be inferred with certainty from the primary transfer event, the subsequent spread of chloramphenicol resistance in N. meningitidis strains can be envisioned, given the extreme transformability of this species. Transformation has been shown to be responsible for the dissemination of other genetic traits30,31 in this naturally competent species and can easily be reproduced under laboratory conditions. As mentioned above, because of deletions, the truncated transposon is a stable component of the N. meningitidis genome. Resistance can therefore easily be transferred by transformation and integration of the incoming DNA through homologous recombination between the flanking regions and the corresponding portion of the chromosome of the recipient and insertion of the heterologous catP gene. This process would account for the observation that an identical fragment of foreign DNA was inserted at the same site in all the transformants.

The emergence of high-level chloramphenicol resistance in N. meningitidis isolates is of great concern, since intramuscular administration of chloramphenicol in oil is the standard treatment for meningococcal meningitis in developing countries.

Supported in part by a Bristol-Myers Squibb Unrestricted Biomedical Research Grant in Infectious Diseases.

Source Information

From the National Reference Center for Antibiotics and the Unité des Agents Antibactériens (M. Galimand, G.G., P.C.) and the National Reference Center for Meningococci (M. Guibourdenche, J.-Y.R.), Institut Pasteur, Paris.

Address reprint requests to Dr. Galimand at the Unité des Agents Antibactériens, Institut Pasteur, 28 Rue du Dr. Roux, 75724 Paris CEDEX 15, France.

References

References

  1. 1

    Achtman M. Global epidemiology of meningococcal disease. In: Cartwright K, ed. Meningococcal disease. Chichester, England: John Wiley, 1995:159-76.

  2. 2

    Oppenheim BA. Antibiotic resistance in Neisseria meningitidis. Clin Infect Dis 1997;24:Suppl 1:S98-S101
    CrossRef | Web of Science | Medline

  3. 3

    Kristiansen B-E, Radstrom P, Jenkins A, Ask E, Facinelli B, Skold O. Cloning and characterization of a DNA fragment that confers sulfonamide resistance in a serogroup B, serotype 15 strain of Neisseria meningitidis. Antimicrob Agents Chemother 1990;34:2277-2279
    Web of Science | Medline

  4. 4

    Nolte O. Rifampicin resistance in Neisseria meningitidis: evidence from a study of sibling strains, description of new mutations and notes on population genetics. J Antimicrob Chemother 1997;39:747-755
    CrossRef | Web of Science | Medline

  5. 5

    Abadi FJ, Carter PE, Cash P, Pennington TH. Rifampin resistance in Neisseria meningitidis due to alterations in membrane permeability. Antimicrob Agents Chemother 1996;40:646-651
    Web of Science | Medline

  6. 6

    Gascoyne-Binzi DM, Heritage J, Hawkey PM, Sprott MS. Characterization of a tet(M)-carrying plasmid from Neisseria meningitidis. J Antimicrob Chemother 1994;34:1015-1023
    CrossRef | Web of Science | Medline

  7. 7

    Winterscheid KK, Whittington WL, Roberts MC, Schwebke JR, Holmes KK. Decreased susceptibility to penicillin G and Tet M plasmids in genital and anorectal isolates of Neisseria meningitidis. Antimicrob Agents Chemother 1994;38:1661-1663
    Web of Science | Medline

  8. 8

    Vedros NA. Serology of the meningococcus. In: Bergan T, Norris JR, eds. Methods in microbiology. Vol. 10. London: Academic Press, 1978:293-314.

  9. 9

    Abdillahi H, Poolman JT. Whole-cell ELISA for typing Neisseria meningitidis with monoclonal antibodies. FEMS Microbiol Lett 1987;48:367-371
    CrossRef | Web of Science

  10. 10

    Caugant DA, Froholm LO, Bovre K, et al. Intercontinental spread of a genetically distinctive complex of clones of Neisseria meningitidis causing epidemic disease. Proc Natl Acad Sci U S A 1986;83:4927-4931
    CrossRef | Web of Science | Medline

  11. 11

    Kellogg DS Jr, Peacock WL, Deacon WE, Brown L, Pirkle CI. Neisseria gonorrhoeae. I. Virulence genetically linked to clonal variation. J Bacteriol 1963;85:1274-1279
    Web of Science | Medline

  12. 12

    Shaw WV. Chloramphenicol acetyltransferase from chloramphenicol-resistant bacteria. Methods Enzymol 1975;43:737-755
    CrossRef | Medline

  13. 13

    Haas MJ, Dowding JE. Aminoglycoside-modifying enzymes. Methods Enzymol 1975;43:611-628
    CrossRef | Medline

  14. 14

    Yanisch-Perron C, Vieira J, Messing J. Improved M13 phage cloning vectors and host strains: nucleotide sequences of the M13mp18 and pUC19 vectors. Gene 1985;33:103-119
    CrossRef | Web of Science | Medline

  15. 15

    Nassif X, Puaoi D, So M. Transposition of the Tn1545-Δ3 in the pathogenic Neisseriae: a genetic tool for mutagenesis. J Bacteriol 1991;173:2147-2154
    Web of Science | Medline

  16. 16

    Caugant DA, Mocca LF, Frasch CE, Froholm LO, Zollinger WD, Selander RK. Genetic structure of Neisseria meningitidis populations in relation to serogroup, serotype, and outer membrane protein pattern. J Bacteriol 1987;169:2781-2792
    Web of Science | Medline

  17. 17

    Sambrook J, Fritsch EF, Maniatis T. Molecular cloning: a laboratory manual. 2nd ed. Plainview, N.Y.: Cold Spring Harbor Laboratory Press, 1989.

  18. 18

    Sanger F, Nicklen S, Coulson AR. DNA sequencing with chain-terminating inhibitors. Proc Natl Acad Sci U S A 1977;74:5463-5467
    CrossRef | Web of Science | Medline

  19. 19

    Tenover FC, Arbeit RD, Goering RV, et al. Interpreting chromosomal DNA restriction patterns produced by pulsed-field gel electrophoresis: criteria for bacterial strain typing. J Clin Microbiol 1995;33:2233-2239
    Web of Science | Medline

  20. 20

    Steffen C, Matzura H. Nucleotide sequence analysis and expression studies of a chloramphenicol-acetyltransferase-coding gene from Clostridium perfringens. Gene 1989;75:349-354
    CrossRef | Web of Science | Medline

  21. 21

    Bannam TL, Crellin PK, Rood JI. Molecular genetics of the chloramphenicol-resistance transposon Tn4451 from Clostridium perfringens: the TnpX site-specific recombinase excises a circular transposon molecule. Mol Microbiol 1995;16:535-551
    CrossRef | Web of Science | Medline

  22. 22

    Hoke C, Vedros NA. Taxonomy of the Neisseriae: deoxyribonucleic acid base composition, interspecific transformation, and deoxyribonucleic acid hybridization. Int J Syst Bacteriol 1982;32:57-66
    CrossRef

  23. 23

    Fermer C, Kristiansen B-E, Skold O, Swedberg G. Sulfonamide resistance in Neisseria meningitidis as defined by site-directed mutagenesis could have its origin in other species. J Bacteriol 1995;177:4669-4675
    Web of Science | Medline

  24. 24

    Funatsu G, Wittmann HG. Location of amino acid replacements in protein S12 isolated from Escherichia coli mutants resistant to streptomycin. J Mol Biol 1975;68:547-550
    CrossRef | Web of Science

  25. 25

    Moazed D, Noller HF. Interaction of antibiotics with functional sites in 16S ribosomal RNA. Nature 1987;327:389-394
    CrossRef | Web of Science | Medline

  26. 26

    Knapp JS, Rice RJ. Neisseria and Branhamella. In: Murray PR, ed. Manual of clinical microbiology. 6th ed. Washington, D.C.: American Society for Microbiology Press, 1995:324-40.

  27. 27

    Abraham LJ, Rood JI. The Clostridium perfringens chloramphenicol resistance transposon Tn4451 excises precisely in Escherichia coli. Plasmid 1988;19:164-168
    CrossRef | Web of Science | Medline

  28. 28

    Swartley JS, McAllister CF, Hajjeh RA, Heinrich DW, Stephens DS. Deletions of Tn916-like transposons are implicated in tetM-mediated resistance in pathogenic Neisseria. Mol Microbiol 1993;10:299-310
    CrossRef | Web of Science | Medline

  29. 29

    Roberts MC. Characterization of the Tet M determinants in urogenital and respiratory bacteria. Antimicrob Agents Chemother 1990;34:476-478
    Web of Science | Medline

  30. 30

    Bowler LD, Zhang QY, Riou JY, Spratt BG. Interspecies recombination between the penA genes of Neisseria meningitidis and commensal Neisseria species during the emergence of penicillin resistance in N. meningitidis: natural events and laboratory simulation. J Bacteriol 1994;176:333-337
    Web of Science | Medline

  31. 31

    Radstrom P, Fermer C, Kristiansen B-E, Jenkins A, Skold O, Swedberg G. Transformational exchanges in the dihydropteroate synthase gene of Neisseria meningitidis: a novel mechanism for acquisition of sulfonamide resistance. J Bacteriol 1992;174:6386-6393
    Web of Science | Medline

Citing Articles (33)

Citing Articles

  1. 1

    Maria Cecília O. Gorla, Maria Vaneide de Paiva, Vivian C. Salgueiro, Ana Paula S. Lemos, Angela P. Brandão, Julio A. Vázquez, Maria Cristina C. Brandileone. (2011) Antimicrobial susceptibility of Neisseria meningitidis strains isolated from meningitis cases in Brazil from 2006 to 2008. Enfermedades Infecciosas y Microbiología Clínica 29:2, 85-89
    CrossRef

  2. 2

    Paola Stefanelli. (2011) Emerging resistance in Neisseria meningitidis and Neisseria gonorrhoeae - Retracted. Expert Review of Anti-infective Therapy 9:2, 237-244
    CrossRef

  3. 3

    Sara Thulin Hedberg, Per Olcén, Hans Fredlund, Magnus Unemo. (2010) Antibiotic susceptibility of invasive Neisseria meningitidis isolates from 1995 to 2008 in Sweden—the meningococcal population remains susceptible. Scandinavian Journal of Infectious Diseases 42:1, 61-64
    CrossRef

  4. 4

    Yuliya Nudelman, Allan R. Tunkel. (2009) Bacterial Meningitis. Drugs 69:18, 2577-2596
    CrossRef

  5. 5

    Muhamed-Kheir Taha, Jean-Michel Alonso. (2008) Molecular epidemiology of infectious diseases: the example of meningococcal disease. Research in Microbiology 159:1, 62-66
    CrossRef

  6. 6

    Georgina Tzanakaki, Paola Mastrantonio. (2007) Aetiology of bacterial meningitis and resistance to antibiotics of causative pathogens in Europe and in the Mediterranean region. International Journal of Antimicrobial Agents 29:6, 621-629
    CrossRef

  7. 7

    D. S. Burgess, C. R. Frei, J. S. Lewis II, K. R. Fiebelkorn, J. H. Jorgensen. (2007) The contribution of pharmacokinetic?pharmacodynamic modelling with Monte Carlo simulation to the development of susceptibility breakpoints for Neisseria meningitidis. Clinical Microbiology and Infection 13:1, 33-39
    CrossRef

  8. 8

    Allan R. Tunkel. (2006) Use of ceftriaxone during epidemics in patients with suspected meningococcal meningitis. Current Infectious Disease Reports 8:4, 291-292
    CrossRef

  9. 9

    2006. Chloramphenicol. , 706-713.
    CrossRef

  10. 10

    Sharat Johri, SP Gorthi, AC Anand. (2005) Meningococcal meningitis. Medical Journal Armed Forces India 61:4, 369-374
    CrossRef

  11. 11

    Ram Yogev, Judith Guzman-Cottrill. (2005) Bacterial Meningitis in Children. Drugs 65:8, 1097-1112
    CrossRef

  12. 12

    MUHAMED-KHEIR TAHA, PER OLCEN. (2004) Molecular genetic methods in diagnosis and direct characterization of acute bacterial central nervous system infections. APMIS 112:11-12, 753-770
    CrossRef

  13. 13

    Stefan Schwarz, Corinna Kehrenberg, Benoit Doublet, Axel Cloeckaert. (2004) Molecular basis of bacterial resistance to chloramphenicol and florfenicol. FEMS Microbiology Reviews 28:5, 519-542
    CrossRef

  14. 14

    Scott W Sinner, Allan R Tunkel. (2004) Antimicrobial agents in the treatment of bacterial meningitis. Infectious Disease Clinics of North America 18:3, 581-602
    CrossRef

  15. 15

    Keith S Kaye, John J Engemann, Henry S Fraimow, Elias Abrutyn. (2004) Pathogens resistant to antimicrobial agents: Epidemiology, molecular mechanisms, and clinical management. Infectious Disease Clinics of North America 18:3, 467-511
    CrossRef

  16. 16

    Dena Lyras, Vicki Adams, Isabelle Lucet, Julian I. Rood. (2004) The large resolvase TnpX is the only transposon-encoded protein required for transposition of the Tn4451/3 family of integrative mobilizable elements. Molecular Microbiology 51:6, 1787-1800
    CrossRef

  17. 17

    A. Antignac, M. Ducos-Galand, A. Guiyoule, R. Pires, J.-M. Alonso, M.-K. Taha. (2003) Neisseria meningitidis Strains Isolated from Invasive Infections in France (1999-2002): Phenotypes and Antibiotic Susceptibility Patterns. Clinical Infectious Diseases 37:7, 912-920
    CrossRef

  18. 18

    Huovinen, Pentti, . (2002) Macrolide-Resistant Group A Streptococcus — Now in the United States. New England Journal of Medicine 346:16, 1243-1245
    Full Text

  19. 19

    Muhamed-Kheir Taha. (2002) Molecular detection and characterization of Neisseria meningitidis. Expert Review of Molecular Diagnostics 2:2, 143-150
    CrossRef

  20. 20

    Z. A. Memish. (2002) Meningococcal Disease and Travel. Clinical Infectious Diseases 34:1, 84-90
    CrossRef

  21. 21

    Simone S. Wildes, Allan R. Tunkel. (2002) Meningococcal Vaccines. BioDrugs 16:5, 321-329
    CrossRef

  22. 22

    Allan R. Tunkel, W. Michael Scheld. (2002) Treatment of bacterial meningitis. Current Infectious Disease Reports 4:1, 7-16
    CrossRef

  23. 23

    M. A. Diggle, G. F. S. Edwards, S. C. Clarke. (2001) Developments in the diagnosis of meningococcal disease and the characterization of Neisseria meningitidis. Reviews in Medical Microbiology 12:4, 211-217
    CrossRef

  24. 24

    Rosenstein, Nancy E., Perkins, Bradley A., Stephens, David S., Popovic, Tanja, Hughes, James M., . (2001) Meningococcal Disease. New England Journal of Medicine 344:18, 1378-1388
    Full Text

  25. 25

    Julio A. Vázquez. (2001) The resistance of Neisseria meningitidis to the antimicrobial agents: an issue still in evolution. Reviews in Medical Microbiology 12:1, 39-45
    CrossRef

  26. 26

    Keith S. Kaye, Donald Kaye. (2000) Multidrug-resistant pathogens: Mechanisms of resistance and epidemiology. Current Infectious Disease Reports 2:5, 391-398
    CrossRef

  27. 27

    Anna Skoczyńska, Paula Kriz, Helle Bossen Konradsen, Waleria Hryniewicz. (2000) Characteristics of the Major Etiologic Agents of Bacterial Meningitis Isolated in Poland in 1997–1998. Microbial Drug Resistance 6:2, 147-153
    CrossRef

  28. 28

    Mashiul H. Chowdhury, Allan R. Tunkel. (2000) ANTIBACTERIAL AGENTS IN INFECTIONS OF THE CENTRAL NERVOUS SYSTEM. Infectious Disease Clinics of North America 14:2, 391-408
    CrossRef

  29. 29

    David H. Spach, Lisa A. Jackson. (1999) BACTERIAL MENINGITIS. Neurologic Clinics 17:4, 711-735
    CrossRef

  30. 30

    Keith P. Klugman, Shabir A. Madhi. (1999) EMERGENCE OF DRUG RESISTANCE. Infectious Disease Clinics of North America 13:3, 637-646
    CrossRef

  31. 31

    Brian Greenwood. (1999) Meningococcal meningitis in Africa. Transactions of the Royal Society of Tropical Medicine and Hygiene 93:4, 341-353
    CrossRef

  32. 32

    Hans-Walter Pfister, Uwe Koedel, Robert Paul. (1999) Acute meningitis. Current Infectious Disease Reports 1:2, 153-159
    CrossRef

  33. 33

    Shaw, William V., . (1998) Chloramphenicol Resistance in Meningococci. New England Journal of Medicine 339:13, 917-918
    Full Text