Original Article
Relation between Mutations of the Cystic Fibrosis Gene and Idiopathic Pancreatitis
N Engl J Med 1998; 339:653-658September 3, 1998
- Abstract
Background
It is unknown whether genetic factors predispose patients to idiopathic pancreatitis. In patients with cystic fibrosis, mutations of the cystic fibrosis transmembrane conductance regulator (CFTR ) gene typically cause pulmonary and pancreatic insufficiency while rarely causing pancreatitis. We examined whether idiopathic pancreatitis is associated with CFTR mutations in persons who do not have lung disease of cystic fibrosis.
Methods
We studied 27 patients (mean age at diagnosis, 36 years), 22 of whom were female, who had been referred for an evaluation of idiopathic pancreatitis. DNA was tested for 17 CFTR mutations and for the 5T allele in intron 8 of the CFTR gene. The 5T allele reduces the level of functional CFTR and is associated with an inherited form of infertility in males. Patients with two abnormal CFTR alleles were further evaluated for unrecognized cystic fibrosis–related lung disease, and both base-line and CFTR-mediated ion transport were measured in the nasal mucosa.
Results
Ten patients with idiopathic chronic pancreatitis (37 percent) had at least one abnormal CFTR allele. Eight CFTR mutations were detected (prevalence ratio, 11:1; 95 percent confidence interval, 5 to 23; P<0.001). In three patients both alleles were affected (prevalence ratio, 80:1; 95 percent confidence interval, 17 to 379; P<0.001). These three patients did not have lung disease typical of cystic fibrosis on the basis of sweat testing, spirometry, or base-line nasal potential-difference measurements. Nonetheless, each had abnormal nasal cyclic AMP–mediated chloride transport.
Conclusions
In a group of patients referred for evaluation of idiopathic pancreatitis, there was a strong association between mutations in the CFTR gene and pancreatitis. The abnormal CFTR genotypes in these patients with pancreatitis resemble those associated with male infertility.
Media in This Article
Figure 1
Allele-Specific Polymerase-Chain-Reaction Analysis of the PolyT Sequence of Intron 8 of the CF TR Gene.Table 1
Characteristics of 27 Patients with Idiopathic Pancreatitis.Article Activity
- Article
Chronic pancreatitis is a potentially life-threatening disease1; the most common types are alcohol related and idiopathic. Susceptibility to pancreatitis varies widely.2 Even though pancreatitis rarely results from recognized genetic defects,3,4 it is unknown whether hereditary factors increase the likelihood of the two predominant forms.
The most common inherited disease of the exocrine pancreas is cystic fibrosis.5-8 In cystic fibrosis, mutations of the cystic fibrosis transmembrane conductance regulator (CF TR) gene lead to dysfunction of the lung, sweat glands, vas deferens, and pancreas. Lung disease accounts for most of the complications and deaths related to cystic fibrosis. In persons with normal lung function, CF TR mutations cause one type of male infertility, congenital (bilateral) absence of the vas deferens.9-12
The association of abnormal CF TR genotypes with congenital absence of the vas deferens led us to consider whether the gene has a role in idiopathic chronic pancreatitis. Even though the pancreatic disease in patients with cystic fibrosis does not usually resemble pancreatitis clinically, two factors suggested that CF TR has a role. First, both conditions are often associated with abnormal sweat electrolyte values.13,14 Second, in both conditions, the earliest pathological finding is pancreatic ductal obstruction due to inspissated secretions,15,16 and the ducts are normally the predominant site of CFTR protein in the pancreas.17 Because pancreatitis occasionally occurs in patients with cystic fibrosis5,18 and because CF TR mutations are common, we examined whether abnormal CF TR genotypes are predisposing factors for idiopathic pancreatitis.
Methods
Selection of Patients
The records of all white patients who were referred to Duke University Medical Center in North Carolina from 1991 to 1996 for an evaluation of chronic pancreatitis were reviewed. Among 32 patients with idiopathic pancreatitis, 27 provided written informed consent and participated in the study. The study protocol was approved by the medical center's institutional review board. Each patient had had at least two episodes of pancreatitis at least six months apart. Each episode met at least two of the three criteria: abdominal pain typical of pancreatitis, an elevation of serum amylase or lipase (more than three times the upper limit of the normal range), and evidence of pancreatitis on abdominal computed tomography. Exclusion criteria included the ingestion of more than 15 alcoholic drinks per week at any time; the presence of hyperlipidemia, pancreatic cancer, pancreas divisum, or dysfunction of the sphincter of Oddi; and the onset of pancreatitis after the age of 65 years. Patients were also excluded if their pancreatitis was related to trauma, gallstones, drugs, or autosomal dominant pancreatitis. Twenty-two of the patients were female (81 percent); this preponderance may have resulted from the exclusion of many male patients because of alcohol use. The mean age at the diagnosis of pancreatitis was 36 years (range, 12 to 65). Pancreatograms were assessed for the severity of chronic pancreatitis according to published criteria by a reviewer who was unaware of the patients' histories (Table 1Table 1
Characteristics of 27 Patients with Idiopathic Pancreatitis.).19 DNA Studies
We extracted DNA from blood samples20 and tested for 16 CF TR mutations — ΔF508, W1282X, R117H, 621+1(G→T), R334W, R347P, A455E, ΔI507, 1717–1(G→A), G542X, S549N, G551D, R553X, R560T, N1303K, and 3849+10Kb(C→T) — using reverse dot blot strips (Roche Molecular Systems, Alameda, Calif.). DNA was also tested for the G85E mutation.21 The length of the sequence of thymidines in intron 8 of the CF TR gene was determined with three allele-specific polymerase chain reactions per sample. The common forward primer was 5'TAATGGATCATGGGCCATGT3'. The reverse primers were 5'CCCCAAATCCCTGTTAAAAAC3', 5'CCCCAAATCCCTGTTAAAAAAAC3', and 5'CCCCAAATCCCTGTTAAAAAAAAAC3' for the 5T, 7T, and 9T alleles, respectively. For each reaction, the dystrophin gene (exon 16) was used as an internal amplification control.22 A sequence of five thymidines in the polyT region is associated with low levels of normal CFTR messenger RNA (mRNA).
Tests of the Transepithelial Nasal Potential Difference
The transepithelial nasal potential difference was assessed to evaluate CFTR-mediated chloride transport in vivo.23 Briefly, bioelectric responses were measured during perfusion with solutions containing amiloride, gluconate plus amiloride, and isoproterenol, gluconate, and amiloride to determine the combined effect of removing chloride and activating intracellular cyclic AMP.
Statistical Analysis
Differences between groups were compared with the Wilcoxon rank-sum test.24 All P values are two-tailed. Differences between the expected and observed frequencies of mutations or genotypes were evaluated with a binomial distribution for 54 alleles or 27 patients. This analysis depends on the reliability of data on the prevalence of CF TR alleles. The expected frequency of various abnormal alleles was estimated as follows. The frequency of cystic fibrosis among U.S. whites is 1 in 3003.6 Among the 2200 white persons who have been genotyped at our medical center, consisting of patients with cystic fibrosis and carriers, the 17 mutations that we tested for in the current study accounted for 75 percent of all alleles causing cystic fibrosis, and half of all patients with cystic fibrosis were homozygous for ΔF508.25 The frequency of the 5T allele is 5 percent among whites tested at our medical center22 and elsewhere.10-12 Thus, the expected frequency of genotypes consisting of one of the tested mutations on one chromosome and the 5T allele on the other chromosome is 1 in 731 (2 × 3003–0.5 × 0.75 × 0.05). Finally, patients who were homozygous for ΔF508 would have been excluded from this study because this genotype almost invariably causes clinically significant lung disease. Thus, the expected frequency of genotypes affecting both alleles (carriers of a CF TR mutation on one chromosome and the 5T allele on the other [1/731] plus subjects who are homozygous and compound heterozygotes for the tested mutations [0.752/3003] minus those who are homozygous for ΔF508 [0.5/3003]) is 1 in 720 (1/731 + 0.752/3003 – 1/6006).
Results
Table 1 summarizes the CF TR genotypes for the 27 patients with idiopathic pancreatitis. Three different mutations were detected: ΔF508 in five patients, R117H in two, and N1303K in one, for a total of eight. Thus, CF TR mutations were found at 11 times the expected frequency (95 percent confidence interval, 5 to 23; P<0.001) (Table 2Table 2
Association of Abnormal CF TR Genotypes with Idiopathic Pancreatitis.).Patients were also tested for the 5T allele (Figure 1Figure 1
Allele-Specific Polymerase-Chain-Reaction Analysis of the PolyT Sequence of Intron 8 of the CF TR Gene.), and it was present in 5 of the 27 patients. This variant reduces the efficiency of exon 9 splicing and thereby reduces the expression of functional CFTR in patients who have a mutation that causes cystic fibrosis on one chromosome and the 5T allele on the other chromosome.26,27 Patients with these genotypes resemble patients with cystic fibrosis in that they have congenital absence of the vas deferens, but differ because they do not have lung disease. By contrast, when the 7T or 9T allele is present, there are sufficient levels of properly spliced CFTR and these alleles do not cause congenital absence of the vas deferens.A total of 10 patients had CF TR mutations or the 5T allele or both (Table 1). None had lung disease typical of cystic fibrosis on the basis of a clinical history or a recent chest film. These 10 patients were 33 years of age on average when pancreatitis was diagnosed and were hospitalized for pancreatitis a total of 116 times (approximately 12 times per patient) during a mean observation period of five years after diagnosis. Nine of the 10 had abnormal findings on pancreatography consistent with a diagnosis of chronic pancreatitis.19 Four of the 10 (Patients 1, 6, 7, and 8 in Table 1) required pancreatic surgery for pain management. The other 17 patients were similar to these 10 with respect to the age at diagnosis and the severity of pancreatitis.
In three patients both CF TR alleles were affected, a frequency that was 80 times the expected rate (95 percent confidence interval, 17 to 379; P<0.001) (Table 2). The genotypes of these three patients (ΔF508/wild type, 9T/5T in two and ΔF508/R117H, 9T/7T in one) are the two most common in patients with congenital absence of the vas deferens.10-12,27 These genotypes do not typically cause lung disease. In contrast, lung disease is present in patients with a genotype of ΔF508/R117H, 9T/5T. 28
The three patients with abnormalities of both CF TR alleles were further evaluated to determine whether they had unrecognized cystic fibrosis–related lung disease (Table 3Table 3
Characteristics of Three Patients with Idiopathic Pancreatitis and Two Abnormal CF TR Alleles.). None had sweat chloride values diagnostic of cystic fibrosis in adults. Their base-line nasal potential-difference values ranged from –24 to –21 mV, values similar to the mean value of –22 mV in normal adults.23 Two patients reported no chronic pulmonary symptoms and had normal results on spirometry. In the third patient, the forced expiratory volume in one second was 58 percent of the predicted value. Her sputum contained normal flora, and the abnormal value for forced expiratory volume in one second seemed most consistent with a diagnosis of chronic obstructive pulmonary disease due to cigarette use (2 packs per day). Thus, none of the patients fulfilled traditional diagnostic criteria for the classic cystic fibrosis phenotype.5,7,8 However, one of the three patients had congenital absence of the vas deferens, and his sputum contained smooth Pseudomonas aeruginosa during an episode of acute bronchitis. (Recovery of either smooth or mucoid strains of P. aeruginosa from sputum is unusual during episodes of acute bronchitis in persons who do not have cystic fibrosis; however, the mucoid strain is specifically associated with cystic fibrosis.) Taken together with his genotype, this constellation of findings is suggestive of an atypical cystic fibrosis phenotype.5,8 To assess CFTR-mediated ion transport more directly, we measured the nasal potential-difference responses in these three patients. The combined response to the chloride-free maneuver and stimulation by isoproterenol may be a more accurate indicator of CFTR function than the sweat test.23 The changes in values were +4.5, +1.5, and –5.0 mV in the three patients. These values differed significantly from those measured in 20 normal adults (range, –16 to –44 mV; mean, –31 mV; P<0.01) and resembled the values in 23 adults with cystic fibrosis (range, –3 to +12 mV; mean, +5 mV).23
Discussion
We found a strong association between chronic pancreatitis and CF TR mutations among 27 patients who were referred for endoscopic evaluation of idiopathic chronic pancreatitis. In these patients, the frequency of a single CF TR mutation was 11 times the expected frequency and the frequency of two abnormal alleles was 80 times the expected frequency.
In three patients, both copies of the CF TR gene were affected. These patients had the CF TR genotypes that are most commonly seen in patients with congenital absence of the vas deferens. In such patients, CFTR function is reduced by roughly 90 percent, leading to abnormal nasal chloride transport and congenital absence of the vas deferens but not pancreatic insufficiency, lung disease, or sweat-duct abnormalities.7,11 Data on our three patients with idiopathic pancreatitis and these CF TR genotypes suggest that their phenotype is similar to that of patients with congenital absence of the vas deferens and these genotypes. Specifically, nasal potential-difference responses of each patient showed defective CFTR-mediated ion transport even though none had sweat chloride values diagnostic of cystic fibrosis or evidence of lung disease. Taken together, these findings suggest that in this group of patients, abnormal CF TR genotypes cause pancreatitis as one component of an inherited syndrome affecting multiple epithelial tissues and that such patients should be examined for congenital absence of the vas deferens9-12 and sinusitis,22,29 which are not typical of pancreatitis.
Seven patients had an abnormality in only one copy of the CF TR gene. This finding requires cautious interpretation because DNA samples were tested for only 17 of the more than 500 CF TR mutations associated with cystic fibrosis.30 Therefore, it is possible that more comprehensive DNA testing (e.g., with single-strand conformation polymorphism analysis) might detect additional mutations. If so, the true magnitude of the association between CF TR mutations and pancreatitis was underestimated by our data. Moreover, it is possible that some of the seven patients may actually be compound heterozygotes with a second mutation that was not detected. Thus, on the basis of our data, we could not determine whether having one copy of an abnormal CF TR allele (as is found in carriers of cystic fibrosis) is sufficient to predispose persons to pancreatitis.
Our study calls attention to the relation between CF TR genotypes and pancreatitis. Pancreatitis occurs in 1 to 2 percent of patients with cystic fibrosis, with progression to chronic pancreatitis in a minority of these patients.5,18 The absence of clinical pancreatitis in most patients with cystic fibrosis is in agreement with the histopathological findings in such patients: there is extensive fibrosis without prominent inflammation.16 When pancreatitis does develop in patients with cystic fibrosis, lung disease is usually evident. Nonetheless, there have been occasional reports of pancreatitis in patients with cystic fibrosis before the onset of lung disease.18,31-34 Pancreatitis occurred before the age of 23 years in each instance, suggesting that pancreatitis may herald the diagnosis of cystic fibrosis in young adults.8 Our findings suggest that unexplained pancreatitis in older adults may also be an indicator of mutations in the CF TR gene.
Emerging data indicate that cystic fibrosis affects different organs to a varying but predictable extent, depending on the CF TR genotype.7,8 Genotypes that result in a reduction of functional CFTR to 1 percent of normal values cause classic cystic fibrosis consisting of pancreatic insufficiency, lung disease, abnormal sweat chloride concentrations, and congenital absence of the vas deferens. Genotypes that result in a reduction of functional CFTR to 5 percent of normal values cause cystic fibrosis without pancreatic insufficiency, consisting of lung disease, abnormal sweat chloride concentrations, and congenital absence of the vas deferens. Genotypes that result in a reduction of functional CFTR to 10 percent of normal values cause congenital absence of the vas deferens alone. Thus, one can infer that each manifestation of cystic fibrosis is associated with a reduction of CFTR levels below a tissue-specific threshold value (10 percent of normal levels in the case of vas deferens abnormalities, 5 percent in the case of lung and sweat-gland abnormalities, and 1 percent in the case of abnormalities of the exocrine pancreas).
Our data expand on these findings in two respects. First, they suggest that the pancreas and the vas deferens are both relatively susceptible to injury resulting from reduced CFTR levels. Thus, pancreatitis and congenital absence of the vas deferens are clinical manifestations of genotypes that cause relatively mild impairment of CFTR function. Second, they indicate that the pancreas differs from the lung, sweat gland, and vas deferens in that it is affected in qualitatively different ways depending on the degree to which CFTR function is impaired. Severe impairment causes pancreatic insufficiency, and less severe impairment causes pancreatitis. Available evidence suggests that the main role of CFTR in the normal human pancreas is to promote the dilution and alkalinization of pancreatic juice.17 Thus, depending on the extent to which CFTR function is reduced, either of these two distinct patterns of pancreatic dysfunction can develop.
Our study has implications for the pathogenesis and classification of pancreatitis. It raises the remote possibility that CF TR mutations may increase the risk of pancreatitis after exposure to alcohol or certain drugs, and it identifies a subgroup of patients with idiopathic pancreatitis who have abnormalities of both CF TR alleles. Since pancreatitis in these patients apparently results from defective CFTR function, genetic testing to identify patients at risk may be useful and may increase our understanding of the clinical course of these patients and their response to therapy.
Supported in part by grants from the National Institutes of Health (RR0006, HL34322, and DK40701), the Department of Veterans Affairs, and the Cystic Fibrosis Foundation.
We are indebted to C.Q. Lee, Z. Zhou, J. Kole, and L. Chien for technical assistance.
Source Information
From the Department of Medicine, Veterans Affairs and Duke University Medical Centers, Durham, N.C. (J.A.C., P.S.J.); and the Departments of Pathology and Laboratory Medicine (K.J.F., L.M.S.) and the Department of Medicine (P.G.N., M.R.K.), University of North Carolina, Chapel Hill.
Address reprint requests to Dr. Cohn at Box 3378, Duke University Medical Center, Durham, NC 27710.
- References
References
1
Steer ML ,Waxman I ,Freedman S . Chronic pancreatitis. N Engl J Med 1995;332:1482-1490
Full Text | Web of Science | Medline2
Haber P ,Wilson J ,Apte M ,Korsten M ,Pirola R . Individual susceptibility to alcoholic pancreatitis: still an enigma. J Lab Clin Med 1995;125:305-312
Medline3
Whitcomb DC ,Gorry MC ,Preston RA , et al. Hereditary pancreatitis is caused by a mutation in the cationic trypsinogen gene. Nat Genet 1996;14:141-145
CrossRef | Web of Science | Medline4
Liddle RA, Cohn JA. Hereditary diseases of the pancreas. In: Yamada T, Alpers DH, Owyang C, Powell DW, Silverstein FE, eds. Textbook of gastroenterology. 3rd ed. New York: J.B. Lippincott (in press).
5
Welsh MJ, Tsui L-C, Boat TF, Beaudet AL. Cystic fibrosis. In: Scriver CR, Beaudet AL, Sly WS, Valle D, eds. The metabolic and molecular bases of inherited disease. 7th ed. Vol. 3. New York: McGraw-Hill, 1995:3799-876.
6
Hamosh A ,FitzSimmons SC ,Macek M Jr , et al. New CF incidence data and phenotype-genotype comparison of African-American and Caucasian CF patients. Pediatr Pulmonol 1996;22:Suppl 13:104-1057
Davis PB ,Drumm M ,Konstan MW . Cystic fibrosis. Am J Respir Crit Care Med 1996;154:1229-1256
Web of Science | Medline8
Stern RC . The diagnosis of cystic fibrosis. N Engl J Med 1997;336:487-491
Full Text | Web of Science | Medline9
Anguiano A ,Oates RD ,Amos JA , et al. Congenital bilateral absence of the vas deferens: a primarily genital form of cystic fibrosis. JAMA 1992;267:1794-1797
CrossRef | Web of Science | Medline10
Costes B ,Girodon E ,Ghanem N , et al. Frequent occurrence of the CFTR intron 8 (TG)n 5T allele in men with congenital bilateral absence of the vas deferens. Eur J Hum Genet 1995;3:285-293
Web of Science | Medline11
Chillon M ,Casals T ,Mercier B , et al. Mutations in the cystic fibrosis gene in patients with congenital absence of the vas deferens. N Engl J Med 1995;332:1475-1480
Full Text | Web of Science | Medline12
Dumur V ,Gervais R ,Rigot JM , et al. Congenital bilateral absence of the vas deferens (CBAVD) and cystic fibrosis transmembrane regulator (CFTR): correlation between genotype and phenotype. Hum Genet 1996;97:7-10
CrossRef | Web of Science | Medline13
Bank S ,Marks IN ,Novis B . Sweat electrolytes in chronic pancreatitis. Am J Dig Dis 1978;23:178-181
CrossRef | Medline14
Hanawa M ,Takebe T ,Takahashi S ,Koizumi M ,Endo K . The significance of the sweat test in chronic pancreatitis. Tohoku J Exp Med 1978;125:59-69
CrossRef | Web of Science | Medline15
De Angelis C ,Valente G ,Spaccapietra M , et al. Histological study of alcoholic, nonalcoholic, and obstructive chronic pancreatitis. Pancreas 1992;7:193-196
CrossRef | Web of Science | Medline16
Oppenheimer EH ,Esterly JR . Pathology of cystic fibrosis: review of the literature and comparison with 146 autopsied cases. Perspect Pediatr Pathol 1975;2:241-278
Medline17
Marino CR ,Matovcik LM ,Gorelick FS ,Cohn JA . Localization of the cystic fibrosis transmembrane conductance regulator in pancreas. J Clin Invest 1991;88:712-716
CrossRef | Web of Science | Medline18
Shwachman H ,Lebenthal E ,Khaw KT . Recurrent acute pancreatitis in patients with cystic fibrosis with normal pancreatic enzymes. Pediatrics 1975;55:86-95
Web of Science | Medline19
Axon ATR ,Classen M ,Cotton PB ,Cremer M ,Freeny PC ,Lees WR . Pancreatography in chronic pancreatitis: international definitions. Gut 1984;25:1107-1112
CrossRef | Web of Science | Medline20
Miller SA ,Dykes DD ,Polesky HF . A simple salting out procedure for extracting DNA from human nucleated cells. Nucleic Acids Res 1988;16:1215-1215
CrossRef | Web of Science | Medline21
Zielenski J ,Bozon D ,Kerem BS , et al. Identification of mutations in exons 1 through 8 of the cystic fibrosis transmembrane conductance regulator (CFTR) gene. Genomics 1991;10:229-235
CrossRef | Web of Science | Medline22
Friedman KJ ,Heim RA ,Knowles MR ,Silverman LM . Rapid characterization of the variable length polythymidine tract in the cystic fibrosis (CFTR) gene: association of the 5T allele with selected CFTR mutations and its incidence in atypical sinopulmonary disease. Hum Mutat 1997;10:108-115
CrossRef | Web of Science | Medline23
Knowles MR ,Paradiso AM ,Boucher RC . In vivo nasal potential difference: techniques and protocols for assessing efficacy of gene transfer in cystic fibrosis. Hum Gene Ther 1995;6:445-455
CrossRef | Web of Science | Medline24
Diem K, Lentner C. Scientific tables. 7th ed. Basel, Switzerland: Ciba-Geigy, 1970.
25
Population variation of common cystic fibrosis mutations: the Cystic Fibrosis Genetic Analysis Consortium
CrossRef | Web of Science | Medline26
Chu CS ,Trapnell BC ,Curristin S ,Cutting GR ,Crystal RG . Genetic basis of variable exon 9 skipping in cystic fibrosis transmembrane conductance regulator mRNA. Nat Genet 1993;3:151-156
CrossRef | Web of Science | Medline27
Rave-Harel N ,Kerem E ,Nissim-Rafinia M , et al. The molecular basis of partial penetrance of splicing mutations in cystic fibrosis. Am J Hum Genet 1997;60:87-94
Web of Science | Medline28
Kiesewetter S ,Macek M Jr ,Davis C , et al. A mutation in CFTR produces different phenotypes depending on chromosomal background. Nat Genet 1993;5:274-278
CrossRef | Web of Science | Medline29
Kerem E ,Rave-Harel N ,Augarten A , et al. A cystic fibrosis transmembrane conductance regulator splice variant with partial penetrance associated with variable cystic fibrosis presentations. Am J Respir Crit Care Med 1997;155:1914-1920
Web of Science | Medline30
Zielenski J ,Tsue LC . Cystic fibrosis: genotypic and phenotypic variation. Annu Rev Genet 1995;29:777-807
CrossRef | Web of Science | Medline31
Masaryk TJ ,Achkar E . Pancreatitis as initial presentation of cystic fibrosis in young adults: a report of two cases. Dig Dis Sci 1983;28:874-878
CrossRef | Web of Science | Medline32
Gross V ,Schoelmerich J ,Denzel K ,Gerok W . Relapsing pancreatitis as initial manifestation of cystic fibrosis in a young man without pulmonary disease. Int J Pancreatol 1989;4:221-228
Medline33
Atlas AB ,Orenstein SR ,Orenstein DM . Pancreatitis in young children with cystic fibrosis. J Pediatr 1992;120:756-759
CrossRef | Web of Science | Medline34
Blustein PK ,Gaskin K ,Filler R ,Ho CS ,Connon J . Endoscopic retrograde cholangiopancreatography in pancreatitis in children and adolescents. Pediatrics 1981;68:387-393
Web of Science | Medline
- Citing Articles (264)
Citing Articles
1
Matthew J DiMagno, Eugene P DiMagno. (2012) Editorial: Pancreas Divisum Does Not Cause Pancreatitis, But Associates With CFTR Mutations. The American Journal of Gastroenterology 107:2, 318-320
CrossRef2
Caroline Bertin, Anne-Laure Pelletier, Marie Pierre Vullierme, Thierry Bienvenu, Vinciane Rebours, Olivia Hentic, Frédérique Maire, Pascal Hammel, Valérie Vilgrain, Philippe Ruszniewski, Philippe Lévy. (2011) Pancreas Divisum Is Not a Cause of Pancreatitis by Itself But Acts as a Partner of Genetic Mutations. The American Journal of Gastroenterology
CrossRef3
Yuk Cheung Chan, Po Sing Leung. (2011) The Renin–Angiotensin System and Reactive Oxygen Species: Implications in Pancreatitis. Antioxidants & Redox Signaling 15:10, 2743-2755
CrossRef4
David C. Whitcomb. (2011) Going MAD: Development of a “Matrix Academic Division” to Facilitate Translating Research to Personalized Medicine. Academic Medicine 86:11, 1353-1359
CrossRef5
Jessica LaRusch, David C. Whitcomb. (2011) Genetics of pancreatitis. Current Opinion in Gastroenterology 27:5, 467-474
CrossRef6
James R. Lupski, John W. Belmont, Eric Boerwinkle, Richard A. Gibbs. (2011) Clan Genomics and the Complex Architecture of Human Disease. Cell 147:1, 32-43
CrossRef7
David W. Rittenhouse, Vanessa A. Talbott, Zafia Anklesaria, Jonathan R. Brody, Agneszkia K. Witkiewicz, Charles J. Yeo. (2011) Subject Review: Pancreatic Ductal Adenocarcinoma in the Setting of Mutations in the Cystic Fibrosis Transmembrane Conductance Regulator Gene: Case Report and Review of the Literature. Journal of Gastrointestinal Surgery
CrossRef8
Jiayi Zhou, Miklós Sahin-Tóth. (2011) Chymotrypsin C mutations in chronic pancreatitis. Journal of Gastroenterology and Hepatology 26:8, 1238-1246
CrossRef9
A. Sojo Aguirre, N. Martínez Ezquerra, C. Bousoño García, M.D. García Novo, S. Heredia González, J. Manzanares López-Manzanares, F. Baranda García, C. Vázquez Cordero. (2011) Pancreatitis en la fibrosis quística: correlación con el genotipo y estado pancreático. Anales de Pediatría
CrossRef10
Shigeru B.H. Ko, Akiko Yamamoto, Sakiko Azuma, Haizhen Song, Kaori Kamimura, Miyuki Nakakuki, Michael A. Gray, Frédéric Becq, Hiroshi Ishiguro, Hidemi Goto. (2011) Effects of CFTR gene silencing by siRNA or the luminal application of a CFTR activator on fluid secretion from guinea-pig pancreatic duct cells. Biochemical and Biophysical Research Communications 410:4, 904-909
CrossRef11
Benjamin T. Kopp, Matthew T. Pastore, Amy C. Sturm, Melissa J. Holtzlander, Judith A. Westman. (2011) A Novel Exon Duplication of the Cystic Fibrosis Transmembrane Conductance Regulator in a Patient Presenting With Adult-Onset Recurrent Pancreatitis. Pancreas 40:5, 773-777
CrossRef12
C. Bombieri, M. Claustres, K. De Boeck, N. Derichs, J. Dodge, E. Girodon, I. Sermet, M. Schwarz, M. Tzetis, M. Wilschanski, C. Bareil, D. Bilton, C. Castellani, H. Cuppens, G.R. Cutting, P. Drevínek, P. Farrell, J.S. Elborn, K. Jarvi, B. Kerem, E. Kerem, M. Knowles, M. Macek, A. Munck, D. Radojkovic, M. Seia, D.N. Sheppard, K.W. Southern, M. Stuhrmann, E. Tullis, J. Zielenski, P.F. Pignatti, C. Ferec. (2011) Recommendations for the classification of diseases as CFTR-related disorders. Journal of Cystic Fibrosis 10, S86-S102
CrossRef13
Bimaljit Sandhu, Patrik Vitazka, Andrea Ferreira-Gonzalez, Arti Pandya, Ravi Vachhani, Doumit Bouhaidar, Alvin Zfass, Arun Sanyal. (2011) Presence of SPINK-1 variant alters the course of chronic pancreatitis. Journal of Gastroenterology and Hepatology 26:6, 965-969
CrossRef14
Matthew J. DiMagno, Erik-Jan Wamsteker. (2011) Pancreas Divisum. Current Gastroenterology Reports 13:2, 150-156
CrossRef15
D Nageshwar Reddy, S Siva Prasad. (2011) Genetic basis of chronic pancreatitis in Asia Pacific region. Journal of Gastroenterology and Hepatology 26, 2-5
CrossRef16
Gregory A. Coté, Dhiraj Yadav, Adam Slivka, Robert H. Hawes, Michelle A. Anderson, Frank R. Burton, Randall E. Brand, Peter A. Banks, Michele D. Lewis, James A. Disario, Timothy B. Gardner, Andres Gelrud, Stephen T. Amann, John Baillie, Mary E. Money, Michael O'Connell, David C. Whitcomb, Stuart Sherman. (2011) Alcohol and Smoking as Risk Factors in an Epidemiology Study of Patients With Chronic Pancreatitis. Clinical Gastroenterology and Hepatology 9:3, 266-273
CrossRef17
Chee Y. Ooi, Ruslan Dorfman, Marco Cipolli, Tanja Gonska, Carlo Castellani, Katherine Keenan, Steven D. Freedman, Julian Zielenski, Yves Berthiaume, Mary Corey, Susanne Schibli, Elizabeth Tullis, Peter R. Durie. (2011) Type of CFTR Mutation Determines Risk of Pancreatitis in Patients With Cystic Fibrosis. Gastroenterology 140:1, 153-161
CrossRef18
Joachim Mössner. (2011) Update Lecture: Benign Diseases of the Exocrine Pancreas. Digestive Diseases 29:s1, 9-16
CrossRef19
Luca Frulloni, Massimo Falconi, Armando Gabbrielli, Ezio Gaia, Rossella Graziani, Raffaele Pezzilli, Generoso Uomo, Angelo Andriulli, Gianpaolo Balzano, Luigi Benini, Lucia Calculli, Donata Campra, Gabriele Capurso, Giulia Martina Cavestro, Claudio De Angelis, Luigi Ghezzo, Riccardo Manfredi, Alberto Malesci, Alberto Mariani, Massimiliano Mutignani, Maurizio Ventrucci, Giuseppe Zamboni, Antonio Amodio, Italo Vantini. (2010) Italian consensus guidelines for chronic pancreatitis. Digestive and Liver Disease 42, S381-S406
CrossRef20
Bret T. Petersen. 2010. Functional Gall-Bladder and Sphincter of Oddi Disorders. , 365-373.
CrossRef21
R. Graziani, R. Manfredi, C. Cicero, A. Contro, A. Brandalise, M. Tapparelli, L. Frulloni, I. Vantini, A. Megibow, R. Pozzi Mucelli. (2010) Role of multislice computed tomography in the diagnosis of gene-mutation-associated pancreatitis (GMAP). La radiologia medica 115:6, 875-888
CrossRef22
2010. Mendelian Inheritance. , 22-65.
CrossRef23
Hyun Woo Park, Joo Hyun Nam, Joo Young Kim, Wan Namkung, Jae Seok Yoon, Jung–Soo Lee, Kyung Sik Kim, Viktoria Venglovecz, Michael A. Gray, Kyung Hwan Kim, Min Goo Lee. (2010) Dynamic Regulation of CFTR Bicarbonate Permeability by [Cl−]i and Its Role in Pancreatic Bicarbonate Secretion. Gastroenterology 139:2, 620-631
CrossRef24
Ranjit Unnikrishnan, Viswanathan Mohan. 2010. Pancreatic Diseases and Diabetes. , 298-309.
CrossRef25
Shin Koyano, Yoshiki Hirano, Tsunehisa Nagamori, Satoshi Tanno, Koichi Murono, Kenji Fujieda. (2010) A Rare Mutation in Cystic Fibrosis Transmembrane Conductance Regulator Gene in a Recurrent Pancreatitis Patient Without Respiratory Symptoms. Pancreas 39:5, 686-687
CrossRef26
Monique H.M. Derikx, Joost P.H. Drenth. (2010) Genetic factors in chronic pancreatitis; implications for diagnosis, management and prognosis. Best Practice & Research Clinical Gastroenterology 24:3, 251-270
CrossRef27
Chee Y. Ooi, Tanja Gonska, Peter R. Durie, Steven D. Freedman. (2010) Genetic Testing in Pancreatitis. Gastroenterology 138:7, 2202-2206.e1
CrossRef28
Shigeru B.H. Ko, Nobumasa Mizuno, Yasushi Yatabe, Toshiyuki Yoshikawa, Hiroshi Ishiguro, Akiko Yamamoto, Sakiko Azuma, Satoru Naruse, Kenji Yamao, Shmuel Muallem, Hidemi Goto. (2010) Corticosteroids Correct Aberrant CFTR Localization in the Duct and Regenerate Acinar Cells in Autoimmune Pancreatitis. Gastroenterology 138:5, 1988-1996.e3
CrossRef29
Valeria Faa′, Alessandra Coiana, Federica Incani, Lucy Costantino, Antonio Cao, Maria Cristina Rosatelli. (2010) A Synonymous Mutation in the CFTR Gene Causes Aberrant Splicing in an Italian Patient Affected by a Mild Form of Cystic Fibrosis. The Journal of Molecular Diagnostics 12:3, 380-383
CrossRef30
Emmanuelle Masson, Sumit Paliwal, Seema Bhaskar, Soami Prakash, Virginie Scotet, D. Nageshwar Reddy, Cédric Le Maréchal, Giriraj Ratan Chandak, Jian-Min Chen, Claude Férec. (2010) Genetic Analysis of the Glycoprotein 2 Gene in Patients With Chronic Pancreatitis. Pancreas 39:3, 353-358
CrossRef31
Arnaud Boulling, Gérald Le Gac, Gwendal Dujardin, Jian-Min Chen, Claude Férec. (2010) The c.1275A>G putative chronic pancreatitis-associated synonymous polymorphism in the glycoprotein 2 (GP2) gene decreases exon 9 inclusion. Molecular Genetics and Metabolism 99:3, 319-324
CrossRef32
Dhiraj Yadav, David C. Whitcomb. (2010) The role of alcohol and smoking in pancreatitis. Nature Reviews Gastroenterology & Hepatology 7:3, 131-145
CrossRef33
Heiko Witt, Jonas Rosendahl, René H.M. te Morsche, Sundaresan Santhosh, Ashok Chacko, Hans-Ulrich Schulz, Olfert Landt, Niels Teich, Volker Keim, Joachim Mössner, Thomas M. Gress, Johann Ockenga, Hartmut Schmidt, Peter Kovacs, Matthias Blüher, Michael Stumvoll, Andreas Kage, David Alexander Groneberg, Jan B.M.J. Jansen, Renate Nickel, Joost P.H. Drenth. (2010) Mutational Analysis of the Gene Encoding the Zymogen Granule Membrane Glycoprotein 2 (GP2) in Patients With Chronic Pancreatitis. Pancreas 39:2, 188-192
CrossRef34
Rafael de Cid, Maria D. Ramos, Luís Aparisi, Cecilia García, Josefina Mora, Xavier Estivill, Antoni Farré, Teresa Casals. (2010) Independent Contribution of Common CFTR Variants to Chronic Pancreatitis. Pancreas 39:2, 209-215
CrossRef35
Katsuya Maruyama, Shoji Harada, Akira Yokoyama, Satoshi Mizukami, Satoru Naruse, Masahiko Hirota, Isao Nishimori, Makoto Otsuki. (2010) Association Analyses of Genetic Polymorphisms of GSTM1, GSTT1, NQO1, NAT2, LPL, PRSS1, PSTI, and CFTR With Chronic Alcoholic Pancreatitis in Japan. Alcoholism: Clinical and Experimental Research 34, S34-S38
CrossRef36
Elie Aoun, Venkata Muddana, Georgios I Papachristou, David C Whitcomb. (2010) SPINK1 N34S Is Strongly Associated With Recurrent Acute Pancreatitis but Is Not a Risk Factor for the First or Sentinel Acute Pancreatitis Event. The American Journal of Gastroenterology 105:2, 446-451
CrossRef37
Heiko Witt. (2010) Genetics of Pancreatitis: A Guide for Clinicians. Digestive Diseases 28:6, 702-708
CrossRef38
Joachim Mössner. (2010) New Advances in Cell Physiology and Pathophysiology of the Exocrine Pancreas. Digestive Diseases 28:6, 722-728
CrossRef39
Giulia Martina Cavestro, Raffaella Alessia Zuppardo, Simone Bertolini, Giuliana Sereni, Luca Frulloni, Stefano Okolicsanyi, Cristina Calzolari, Satish K Singh, Mario Sianesi, Paolo Del Rio, Gioacchino Leandro, Angelo Franzè, Francesco Di Mario. (2010) Connections Between Genetics and Clinical Data: Role of MCP-1, CFTR, and SPINK-1 in the Setting of Acute, Acute Recurrent, and Chronic Pancreatitis. The American Journal of Gastroenterology 105:1, 199-206
CrossRef40
Henrique J. Fernandez, Jamie S. Barkin. 2010. Chronic Pancreatitis. , 274-281.
CrossRef41
M. Kraft, P. Simon, A. Aghdassi, C. D. Heidecke, G. Sauter, J.-P. Kühn, F. U. Weiss, M. M. Lerch, J. Mayerle. (2009) Diagnostic workup of patients with pancreatic diseases. European Surgery 41:6, 268-279
CrossRef42
Nusrat Shafiq, Surinder Rana, Deepak Bhasin, Promila Pandhi, Puja Srivastava, Surjit S Sehmby, Raj Kumar, Samir Malhotra, Samir Malhotra. 2009. Pancreatic enzymes for chronic pancreatitis. .
CrossRef43
Pramod Kumar Garg, Rajni Khajuria, Madhulika Kabra, Shivaram S. Shastri. (2009) Association of SPINK1 Gene Mutation and CFTR Gene Polymorphisms in Patients With Pancreas Divisum Presenting With Idiopathic Pancreatitis. Journal of Clinical Gastroenterology 43:9, 848-852
CrossRef44
Tomas Hucl, Marja-Leena Kylanpää, Beat Künzli, Heiko Witt, Marko Lempinen, Alexander Schneider, Esko Kemppainen, Matthias Löhr, Stephan L. Haas, Helmut Friess, Johann Ockenga, Jonas Rosendahl, Hans-Ulrich Schulz, Thomas Gress, Manfred V. Singer, Roland H. Pfützer. (2009) Angiotensin-converting enzyme insertion/deletion polymorphism in patients with acute and chronic pancreatitis. European Journal of Gastroenterology & Hepatology 21:9, 1032-1035
CrossRef45
Jian-Min Chen, Claude Férec. (2009) Chronic Pancreatitis: Genetics and Pathogenesis. Annual Review of Genomics and Human Genetics 10:1, 63-87
CrossRef46
Ian Gooding, Emma Bradley, Joanne Puleston, Khin-Ma Gyi, Margaret Hodson, David Westaby. (2009) Symptomatic Pancreatitis in Patients With Cystic Fibrosis. The American Journal of Gastroenterology 104:6, 1519-1523
CrossRef47
Johann Ockenga, Sebastian Strunck, Cora Post, Hans-Ulrich Schulz, Juliane Halangk, Roland H. Pfützer, Matthias Löhr, Helmut Oettle, Andreas Kage, Jonas Rosendahl, Volker Keim, Joost P.H. Drenth, Jan B.M.J. Jansen, Herbert Lochs, Heiko Witt. (2009) The Role of Epoxide Hydrolase Y113H Gene Variant in Pancreatic Diseases. Pancreas 38:4, e97-e101
CrossRef48
L. Frulloni, A. Gabbrielli, R. Pezzilli, A. Zerbi, G.M. Cavestro, F. Marotta, M. Falconi, E. Gaia, G. Uomo, A. Maringhini, M. Mutignani, P. Maisonneuve, V. Di Carlo, G. Cavallini. (2009) Chronic pancreatitis: Report from a multicenter Italian survey (PanCroInfAISP) on 893 patients. Digestive and Liver Disease 41:4, 311-317
CrossRef49
Richard Szmola, David C Whitcomb. 2009. Molecular Genetics of Chronic Pancreatitis. .
CrossRef50
G. Rajesh, E. M. Elango, V. Vidya, V. Balakrishnan. (2009) Genotype-phenotype correlation in 9 patients with tropical pancreatitis and identified gene mutations. Indian Journal of Gastroenterology 28:2, 68-71
CrossRef51
Hyoung-Chul Oh, Myung-Hwan Kim, Kwi-Sook Choi, Sung-Hoon Moon, Do Hyun Park, Sang Soo Lee, Dong Wan Seo, Sung Koo Lee, Han Wook Yoo, Goo Hwan Kim. (2009) Analysis of PRSS1 and SPINK1 Mutations in Korean Patients With Idiopathic and Familial Pancreatitis. Pancreas 38:2, 180-183
CrossRef52
Stefano Landi. (2009) Genetic predisposition and environmental risk factors to pancreatic cancer: A review of the literature. Mutation Research/Reviews in Mutation Research 681:2-3, 299-307
CrossRef53
BRUCE M. WENIG, CLARA S. HEFFESS. 2009. Inflammatory, Infectious, and Other Non-neoplastic Disorders of the Pancreas. , 877-907.
CrossRef54
Els Dequeker, Manfred Stuhrmann, Michael A Morris, Teresa Casals, Carlo Castellani, Mireille Claustres, Harry Cuppens, Marie des Georges, Claude Ferec, Milan Macek, Pier-Franco Pignatti, Hans Scheffer, Marianne Schwartz, Michal Witt, Martin Schwarz, Emmanuelle Girodon. (2009) Best practice guidelines for molecular genetic diagnosis of cystic fibrosis and CFTR-related disorders – updated European recommendations. European Journal of Human Genetics 17:1, 51-65
CrossRef55
Shruti M. Paranjape, Pamela L. Zeitlin. (2008) Atypical Cystic Fibrosis and CFTR-Related Diseases. Clinical Reviews in Allergy & Immunology 35:3, 116-123
CrossRef56
Neeraj Sharma, Meenu Singh, Naveen Acharya, Shrawan K. Singh, Babu R. Thapa, Gurjeet Kaur, Rajendra Prasad. (2008) Implication of the Cystic Fibrosis Transmembrane Conductance Regulator Gene in Infertile Family Members of Indian CF Patients. Biochemical Genetics 46:11-12, 847-856
CrossRef57
Samuel M. Moskowitz, James F. Chmiel, Darci L. Sternen, Edith Cheng, Ronald L. Gibson, Susan G. Marshall, Garry R. Cutting. (2008) Clinical practice and genetic counseling for cystic fibrosis and CFTR-related disorders. Genetics in Medicine 10:12, 851-868
CrossRef58
Luca Frulloni, Chiara Scattolini, Rossella Graziani, Giulia Martina Cavestro, Cecilia Pravadelli, Antonio Amodio, Riccardo Manfredi, Aldo Scarpa, Italo Vantini. (2008) Clinical and Radiological Outcome of Patients Suffering From Chronic Pancreatitis Associated With Gene Mutations. Pancreas 37:4, 371-376
CrossRef59
Miklós Sahin-Tóth, Péter Hegyi, Miklós Tóth. (2008) Genetikai kockázati tényezők krónikus pancreatitisben. Orvosi Hetilap 149:36, 1683-1688
CrossRef60
Marie-Pierre Audrezet, Aurélia Dabricot, Cédric Le Marechal, Claude Ferec. (2008) Validation of High-Resolution DNA Melting Analysis for Mutation Scanning of the Cystic Fibrosis Transmembrane Conductance Regulator (CFTR) Gene. The Journal of Molecular Diagnostics 10:5, 424-434
CrossRef61
Heiko Witt, Eesh Bhatia. (2008) Genetic aspects of tropical calcific pancreatitis. Reviews in Endocrine and Metabolic Disorders 9:3, 213-226
CrossRef62
Idit Segal, Yasmin Yaakov, Samuel N. Adler, Hannah Blau, Efrat Broide, Moshe Santo, Yaakov Yahav, Aharon Klar, Aaron Lerner, Micha Aviram, Ian Ellis, Roger Mountford, Eyal Shteyer, Eitan Kerem, Michael Wilschanski. (2008) Cystic Fibrosis Transmembrane Conductance Regulator Ion Channel Function Testing in Recurrent Acute Pancreatitis. Journal of Clinical Gastroenterology 42:7, 810-814
CrossRef63
Lucio Gullo, Luigi Laghi, Marina Migliori, Laura Lucrezio, Paolo Bianchi, Ann E. Randolph, Vilma Mantovani, Luciana Bastagli, Raffaele Pezzilli, Alberto Malesci. (2008) SPINK1 and PRSS1 Mutations in Benign Pancreatic Hyperenzymemia. Pancreas 37:1, 31-35
CrossRef64
Michael Wilschanski. (2008) Patterns of gastrointestinal disease associated with mutations of CFTR. Current Gastroenterology Reports 10:3, 316-323
CrossRef65
Victoria Sánchez Hellín, Félix Gutiérrez Rodero. (2008) Toxicogenética del tratamiento antirretroviral (y II): neurotoxicidad, hepatotoxicidad, acidosis láctica, daño renal y otros efectos adversos del tratamiento antirretroviral. Enfermedades Infecciosas y Microbiología Clínica 26, 24-33
CrossRef66
C. Castellani, H. Cuppens, M. Macek, J.J. Cassiman, E. Kerem, P. Durie, E. Tullis, B.M. Assael, C. Bombieri, A. Brown, T. Casals, M. Claustres, G.R. Cutting, E. Dequeker, J. Dodge, I. Doull, P. Farrell, C. Ferec, E. Girodon, M. Johannesson, B. Kerem, M. Knowles, A. Munck, P.F. Pignatti, D. Radojkovic, P. Rizzotti, M. Schwarz, M. Stuhrmann, M. Tzetis, J. Zielenski, J.S. Elborn. (2008) Consensus on the use and interpretation of cystic fibrosis mutation analysis in clinical practice. Journal of Cystic Fibrosis 7:3, 179-196
CrossRef67
Matthias Treiber, Christoph Schlag, Roland M. Schmid. (2008) Genetics of pancreatitis: A guide for clinicians. Current Gastroenterology Reports 10:2, 122-127
CrossRef68
Gerd Schmitz, Thomas Langmann. 2008. Human ABC Transporters: Function, Expression, and Regulation. .
CrossRef69
Arie Augarten, Amir Ben Tov, Igal Madgar, Asher Barak, Hanna Akons, Joseph Laufer, Ori Efrati, Micha Aviram, Lea Bentur, Hannah Blau, Gideon Paret, Michael Wilschanski, Bat-Sheva Kerem, Yaakov Yahav. (2008) The changing face of the exocrine pancreas in cystic fibrosis: the correlation between pancreatic status, pancreatitis and cystic fibrosis genotype. European Journal of Gastroenterology & Hepatology 20:3, 164-168
CrossRef70
A. Telenti, U. M. Zanger. (2008) Pharmacogenetics of Anti-HIV Drugs. Annual Review of Pharmacology and Toxicology 48:1, 227-256
CrossRef71
Niels Teich, Joachim Mössner. (2008) Hereditary chronic pancreatitis. Best Practice & Research Clinical Gastroenterology 22:1, 115-130
CrossRef72
Peter Felderbauer, Elias Karakas, Volker Fendrich, Kerem Bulut, Tilman Horn, Rainer Lebert, Tim Holland-Letz, Frank Schmitz, Detlef Bartsch, Wolfgang E. Schmidt. (2008) Pancreatitis Risk in Primary Hyperparathyroidism: Relation to Mutations in the SPINK1 Trypsin Inhibitor (N34S) and the Cystic Fibrosis Gene. The American Journal of Gastroenterology 103:2, 368-374
CrossRef73
Charles R. Esther, Margaret W. Leigh. 2008. Genetics and Disease Mechanisms. , 859-870.
CrossRef74
Stuart Sherman. 2008. Idiopathic Acute Pancreatitis: Role of ERCP in Diagnosis and Therapy. , 435-445.
CrossRef75
Matthew J DiMagno, Eugene P DiMagno. (2007) New advances in acute pancreatitis. Current Opinion in Internal Medicine 6:6, 592-599
CrossRef76
Mohammed Elfar, Lillian W. Gaber, Omaima Sabek, Craig P. Fischer, A. Osama Gaber. (2007) The Inflammatory Cascade in Acute Pancreatitis: Relevance to Clinical Disease. Surgical Clinics of North America 87:6, 1325-1340
CrossRef77
Satoshi Kono, Hitoshi Suzuki, Toshiaki Oda, Kentaro Shirakawa, Yoshitomo Takahashi, Masatoshi Kitagawa, Hiroaki Miyajima. (2007) Cys-881 is essential for the trafficking and secretion of truncated mutant ceruloplasmin in aceruloplasminemia. Journal of Hepatology 47:6, 844-850
CrossRef78
Stephen W. Behrman, Eric S. Fowler. (2007) Pathophysiology of Chronic Pancreatitis. Surgical Clinics of North America 87:6, 1309-1324
CrossRef79
Heinz Zoller, Margit Egg, Ivo Graziadei, Marc Creus, Andreas R. Janecke, Judith Löffler-Ragg, Wolfgang Vogel. (2007) CFTR gene mutations in pancreatitis: Frequency and clinical manifestations in an Austrian patient cohort. Wiener klinische Wochenschrift 119:17-18, 527-533
CrossRef80
Tomas Hucl, Marja-Leena Kylanp????-B??ck, Heiko Witt, Beat K??nzli, Marko Lempinen, Alexander Schneider, Esko Kemppainen, Matthias L??hr, Helmut Friess, Johann Ockenga, Jonas Rosendahl, Hans-Ulrich Schulz, Thomas Gress, Manfred V. Singer, Roland H. Pf??tzer. (2007) HFE genotypes in patients with chronic pancreatitis and pancreatic adenocarcinoma. Genetics in Medicine 9:7, 479-483
CrossRef81
Erin N. Fink, Jeffrey A. Kant, David C. Whitcomb. (2007) Genetic Counseling for Nonsyndromic Pancreatitis. Gastroenterology Clinics of North America 36:2, 325-333
CrossRef82
Steven D. Strausbaugh, Pamela B. Davis. (2007) Cystic Fibrosis: A Review of Epidemiology and Pathobiology. Clinics in Chest Medicine 28:2, 279-288
CrossRef83
Ming-Chu Chang, Yu-Ting Chang, Shu-Chen Wei, Yu-Wen Tien, Po-Chin Liang, I-Shiow Jan, Yi-Ning Su, Jau-Min Wong. (2007) Spectrum of mutations and variants/haplotypes of CFTR and genotype-phenotype correlation in idiopathic chronic pancreatitis and controls in Chinese by complete analysis. Clinical Genetics 71:6, 530-539
CrossRef84
L. Landoni, M. Falconi, R. Salvia, P. Capelli, R. Bettini, P. Pederzoli. (2007) A case of intraductal papillary mucinous tumour following recurrent attacks of pancreatitis lasting 26 years. Digestive and Liver Disease 39:6, 585-588
CrossRef85
Dhiraj Yadav, Georgios I. Papachristou, David C. Whitcomb. (2007) Alcohol-Associated Pancreatitis. Gastroenterology Clinics of North America 36:2, 219-238
CrossRef86
Carmen A Sánchez-Ramírez, Alfredo Larrosa-Haro, Silvia Flores-Martínez, José Sánchez-Corona, Alejandra Villa-Gómez, Rocío Macías-Rosales. (2007) Acute and recurrent pancreatitis in children: etiological factors. Acta Paediatrica 96:4, 534-537
CrossRef87
Heiko Witt, Minoti V. Apte, Volker Keim, Jeremy S. Wilson. (2007) Chronic Pancreatitis: Challenges and Advances in Pathogenesis, Genetics, Diagnosis, and Therapy. Gastroenterology 132:4, 1557-1573
CrossRef88
Alexander Schneider, J. Matthias Löhr, Manfred V. Singer. (2007) The M-ANNHEIM classification of chronic pancreatitis: introduction of a unifying classification system based on a review of previous classifications of the disease. Journal of Gastroenterology 42:2, 101-119
CrossRef89
Satoru Naruse, Kotoyo Fujiki, Hiroshi Ishiguro. (2007) Is genetic analysis helpful for diagnosing chronic pancreatitis in its early stage?. Journal of Gastroenterology 42:S17, 60-65
CrossRef90
Atsushi Masamune, Kiyoshi Kume, Tooru Shimosegawa. (2007) Differential roles of the SPINK1 gene mutations in alcoholic and nonalcoholic chronic pancreatitis. Journal of Gastroenterology 42:S17, 135-140
CrossRef91
Julia Mayerle, Markus M. Lerch. (2007) Is it necessary to distinguish between alcoholic and nonalcoholic chronic pancreatitis?. Journal of Gastroenterology 42:S17, 127-130
CrossRef92
Kevin W. Southern. (2007) Cystic Fibrosis and Formes Frustes of CFTR-Related Disease. Respiration 74:3, 241-251
CrossRef93
Evan L. Fogel, Tamas G. Toth, Glen A. Lehman, Matthew J. DiMagno, Eugene P. DiMagno. (2007) Does Endoscopic Therapy Favorably Affect the Outcome of Patients Who Have Recurrent Acute Pancreatitis and Pancreas Divisum?. Pancreas 34:1, 21-45
CrossRef94
Matthew J DiMagno, Eugene P DiMagno. (2006) Chronic pancreatitis. Current Opinion in Internal Medicine 5:6, 566-576
CrossRef95
Matthias Treiber, Hans-Ulrich Schulz, Olfert Landt, Joost PH Drenth, Carlo Castellani, Francisco X. Real, Nejat Akar, Rudolf W. Ammann, Mario Bargetzi, Eesh Bhatia, Andrew Glenn Demaine, Cinzia Battagia, Andrew Kingsnorth, Derek O’Reilly, Kaspar Truninger, Monika Koudova, Julius Spicak, Milos Cerny, Hans-Jürgen Menzel, Pedro Moral, Pier Franco Pignatti, Maria Grazia Romanelli, Olga Rickards, Gian Franco De Stefano, Narcis Octavian Zarnescu, Gourdas Choudhuri, Sadiq S. Sikora, Jan B. M. J. Jansen, Frank Ulrich Weiss, Matthias Pietschmann, Niels Teich, Thomas M. Gress, Johann Ockenga, Hartmut Schmidt, Andreas Kage, Juliane Halangk, Jonas Rosendahl, David Alexander Groneberg, Renate Nickel, Heiko Witt. (2006) Keratin 8 sequence variants in patients with pancreatitis and pancreatic cancer. Journal of Molecular Medicine 84:12, 1015-1022
CrossRef96
Kamil Obideen, Mohammad Wehbi, Maarouf Hoteit, Qiang Cai. (2006) Nocturnal Hydration—An Effective Modality to Reduce Recurrent Abdominal Pain and Recurrent Pancreatitis in Patients with Adult-Onset Cystic Fibrosis. Digestive Diseases and Sciences 51:10, 1744-1748
CrossRef97
Tooru Shimosegawa, Kiyoshi Kume, Atsushi Masamune. (2006) SPINK1 gene mutations and pancreatitis in Japan. Journal of Gastroenterology and Hepatology 21:s3, S47-S51
CrossRef98
David C Whitcomb. (2006) Gene–environment factors that contribute to alcoholic pancreatitis in humans. Journal of Gastroenterology and Hepatology 21:s3, S52-S55
CrossRef99
Keith J. Lindley. (2006) Chronic pancreatitis. The Indian Journal of Pediatrics 73:10, 907-912
CrossRef100
Steven Keiles, Anja Kammesheidt. (2006) Identification of CFTR, PRSS1, and SPINK1 Mutations in 381 Patients With Pancreatitis. Pancreas 33:3, 221-227
CrossRef101
S. Giannattasio, A. Bobba, V. Jurgelevičius, R.A. Vacca, P. Lattanzio, R.S. Merafina, A. Utkus, V. Kučinskas, E. Marra. (2006) Molecular Basis of Cystic Fibrosis in Lithuania: Incomplete CFTR Mutation Detection by PCR-Based Screening Protocols. Genetic Testing 10:3, 169-173
CrossRef102
Agnieszka Sobczy??ska-Tomaszewska, Daniel B??k, Beata Oralewska, Grzegorz Oracz, Aleksandra Norek, Kamila Czerska, Tadeusz Mazurczak, Miko??aj Teisseyre, Jerzy Socha, Marek Zagulski, Jerzy Bal. (2006) Analysis of CFTR, SPINK1, PRSS1 and AAT Mutations in Children With Acute or Chronic Pancreatitis. Journal of Pediatric Gastroenterology and Nutrition 43:3, 299-306
CrossRef103
Valeria Faà, Pietro Pellegrini Bettoli, Maria Demurtas, Maurizio Zanda, Vincenzina Ferri, Antonio Cao, Maria Cristina Rosatelli. (2006) A New Insertion/Deletion of the Cystic Fibrosis Transmembrane Conductance Regulator Gene Accounts for 3.4% of Cystic Fibrosis Mutations in Sardinia: Implications for Population Screening. The Journal of Molecular Diagnostics 8:4, 499-503
CrossRef104
Saturo Naruse, Hiroshi Ishiguro, Keiichi Shirota, Miyuki Nakakuki, Akiko Yamamoto, Takaharu Kondo. (2006) Sweat Chloride Measurement With a Highly Sensitive Electrode. Pancreas 33:1, 100
CrossRef105
Weimin Sun, Ben Anderson, Joy Redman, Aubrey Milunsky, Arlene Buller, Matthew J. McGinniss, Franklin Quan, Arturo Anguiano, Stephen Huang, Feras Hantash, Charles Strom. (2006) CFTR 5T variant has a low penetrance in females that is partially attributable to its haplotype. Genetics in Medicine 8:6, 339-345
CrossRef106
Leena Kandula, David C. Whitcomb, Mark E. Lowe. (2006) Genetic issues in pediatric pancreatitis. Current Gastroenterology Reports 8:3, 248-253
CrossRef107
Louis J. Vitone, William Greenhalf, Christopher D. McFaul, Paula Ghaneh, John P. Neoptolemos. (2006) The inherited genetics of pancreatic cancer and prospects for secondary screening. Best Practice & Research Clinical Gastroenterology 20:2, 253-283
CrossRef108
Moises Guelrud, Leonel Rodriguez. (2006) Sphincter of oddi dysfunction in children. Current Gastroenterology Reports 8:2, 168-171
CrossRef109
Andy Nydegger, Richard T L Couper, Mark R Oliver. (2006) Childhood pancreatitis. Journal of Gastroenterology and Hepatology 21:3, 499-509
CrossRef110
Eun Hwa Choi, Mary Ehrmantraut, Charles B. Foster, Joel Moss, Stephen J. Chanock. (2006) Association of Common Haplotypes of Surfactant Protein A1 and A2 (SFTPA1 andSFTPA2) Genes with Severity of Lung Disease in Cystic Fibrosis. Pediatric Pulmonology 41:3, 255-262
CrossRef111
Jerry A Nick, David M Rodman. (2006) Manifestations of cystic fibrosis diagnosed in adulthood. Current Opinion in Internal Medicine 5:1, 68-73
CrossRef112
Hiroshi ISHIGURO, Satoru NARUSE, Takaharu KONDO, Akiko YAMAMOTO. (2006) Dysfunction of pancreatic HCO3- secretion and pathogenesis of cystic fibrosis/chronic pancreatitis. Suizo 21:1, 13-25
CrossRef113
Alexander Schneider, Janette Lamb, M. Michael Barmada, Anthony Cuneo, Mary E. Money, David C. Whitcomb. (2006) Keratin 8 Mutations Are Not Associated with Familial, Sporadic and Alcoholic Pancreatitis in a Population from the United States. Pancreatology 6:1-2, 103-108
CrossRef114
Michele D. Bishop, Steven D. Freedman, Julian Zielenski, Najma Ahmed, Annie Dupuis, Sheelagh Martin, Lynda Ellis, Julie Shea, Isobel Hopper, Mary Corey, Paul Kortan, Gregory Haber, Christine Ross, John Tzountzouris, Leslie Steele, Peter N. Ray, Lap-Chee Tsui, Peter R. Durie. (2005) The cystic fibrosis transmembrane conductance regulator gene and ion channel function in patients with idiopathic pancreatitis. Human Genetics 118:3-4, 372-381
CrossRef115
Pietro Stanziale, Maria Savino, Patrizia De Bonis, Matteo Granatiero, Leopoldo Zelante, Luigi Bisceglia. (2005) Indirect CFTR Mutation Identification by PCR/OLA Anomalous Electropherograms. Genetic Testing 9:4, 285-291
CrossRef116
Xavier Dray, Dominique Hubert, Anne Munck, Jacques Moreau, Philippe Marteau. (2005) Manifestations digestives de la mucoviscidose de l’adulte. Gastroentérologie Clinique et Biologique 29:12, 1279-1285
CrossRef117
Lucio Gullo, Vilma Mantovani, Marco Manca, Marina Migliori, Luciana Bastagli, Raffaele Pezzilli. (2005) Mutations of the CFTR Gene in Idiopathic Pancreatic Hyperenzymemia. Pancreas 31:4, 350-352
CrossRef118
Jonathan A. Cohn, John P. Neoptolemos, Jinong Feng, Jin Yan, Zefei Jiang, William Greenhalf, Christopher McFaul, Roger Mountford, Steve S. Sommer. (2005) Increased risk of idiopathic chronic pancreatitis in cystic fibrosis carriers. Human Mutation 26:4, 303-307
CrossRef119
Kwang Hyuck Lee, Ji Kon Ryu, Won Jae Yoon, Jun Kyu Lee, Yong-tae Kim, Yong Bum Yoon. (2005) Mutation Analysis of SPINK1 and CFTR Gene in Korean Patients with Alcoholic Chronic Pancreatitis. Digestive Diseases and Sciences 50:10, 1852-1856
CrossRef120
Marion M Schuierer, Thomas Langmann. (2005) Molecular diagnosis of ATP-binding cassette transporter-related diseases. Expert Review of Molecular Diagnostics 5:5, 755-767
CrossRef121
Matthew J DiMagno, Eugene P DiMagno. (2005) Chronic pancreatitis. Current Opinion in Gastroenterology 21:5, 544-554
CrossRef122
Samuel M. Moskowitz, Ronald L. Gibson, Eric L. Effmann. (2005) Cystic fibrosis lung disease: genetic influences, microbial interactions, and radiological assessment. Pediatric Radiology 35:8, 739-757
CrossRef123
Matthew J. Dimagno, Sae-Hong Lee, Yibai Hao, Shi-Yi Zhou, Barbara J. McKenna, Chung Owyang. (2005) A Proinflammatory, Antiapoptotic Phenotype Underlies the Susceptibility to Acute Pancreatitis in Cystic Fibrosis Transmembrane Regulator (−/−) Mice. Gastroenterology 129:2, 665-681
CrossRef124
Masaki Ohmuraya, Masahiko Hirota, Masatake Araki, Noboru Mizushima, Makoto Matsui, Takao Mizumoto, Kyoko Haruna, Shoen Kume, Motohiro Takeya, Michio Ogawa, Kimi Araki, Ken—ichi Yamamura. (2005) Autophagic Cell Death of Pancreatic Acinar Cells in Serine Protease Inhibitor Kazal Type 3—Deficient Mice. Gastroenterology 129:2, 696-705
CrossRef125
Sakhawat Hussain Rahman, Chaddha Nanny, Khadija Ibrahim, Derek O’reilly, Michael Larvin, Andrew J. Kingsnorth, Michael J. McMAHON. (2005) Genetic Polymorphisms of GSTT1, GSTM1, GSTP1, MnSOD, and Catalase in Nonhereditary Chronic Pancreatitis: Evidence of Xenobiotic Stress and Impaired Antioxidant Capacity. Digestive Diseases and Sciences 50:7, 1376-1383
CrossRef126
Frédérique Maire. (2005) Quand demander un bilan génétique devant une pancréatite aiguë ou une pancréatite chronique ?. Gastroentérologie Clinique et Biologique 29:6-7, 715-723
CrossRef127
Rowe, Steven M., Miller, Stacey, Sorscher, Eric J., . (2005) Cystic Fibrosis. New England Journal of Medicine 352:19, 1992-2001
Full Text128
Jonathan A Cohn. (2005) Reduced CFTR Function and the Pathobiology of Idiopathic Pancreatitis. Journal of Clinical Gastroenterology 39:Supplement 2, S70-S77
CrossRef129
Lucio Gullo, Marina Migliori, Maria Angela Brunetti. (2005) Alcoholic pancreatitis: New insights into an old disease. Current Gastroenterology Reports 7:2, 96-100
CrossRef130
Peter Draganov, Chris E. Forsmark. (2005) “Idiopathic” pancreatitis. Gastroenterology 128:3, 756-763
CrossRef131
L. Guarner. (2005) Fisiopatología, diagnóstico y tratamiento de la insuficiencia pancreática exocrina en el paciente con fibrosis quística. Gastroenterología y Hepatología 28, 29-32
CrossRef132
N. Teich, V. Keim, J. M
ssner. (2005) Chronische Pankreatitis. Der Internist 46:2, 123-130
CrossRef133
Jaroslaw Walkowiak, Sanda Nousia-Arvanitakis, Jobst Henker, Martin Stern, Maarten Sinaasappel, John A. Dodge. (2005) Indirect Pancreatic Function Tests in Children. Journal of Pediatric Gastroenterology and Nutrition 40:2, 107-114
CrossRef134
Alexander Schneider, Manfred V. Singer. (2005) Alcoholic Pancreatitis. Digestive Diseases 23:3-4, 222-231
CrossRef135
Kiyoshi Kume, Atsushi Masamune, Hiroya Mizutamari, Kenzo Kaneko, Kazuhiro Kikuta, Masahiro Satoh, Kennichi Satoh, Kenji Kimura, Noriaki Suzuki, Yutaka Nagasaki, Akira Horii, Tooru Shimosegawa. (2005) Mutations in the Serine Protease Inhibitor Kazal Type 1 (<i>SPINK1</i>) Gene in Japanese Patients with Pancreatitis. Pancreatology 5:4-5, 354-360
CrossRef136
Georg Lamprecht, Ulrike A. Mau, Christian Kortüm, Armin Raible, Martin Stern, Olaf Rieβ, Michael Gregor. (2005) Relapsing Pancreatitis due to a Novel Compound Heterozygosity in the CFTR Gene Involving the Second Most Common Mutation in Central and Eastern Europe [CFTRdele2,3(21 kb)]. Pancreatology 5:1, 92-96
CrossRef137
David C. Whitcomb. (2005) Genetic Polymorphisms in Alcoholic Pancreatitis. Digestive Diseases 23:3-4, 247-254
CrossRef138
Stephan A. Hahn, Detlef K. Bartsch. (2004) Genetics of hereditary pancreatic carcinoma. Gastroenterology Clinics of North America 33:4, 919-934
CrossRef139
Alexander Schneider. (2004) Serine protease inhibitor Kazal type 1 mutations and pancreatitis. Gastroenterology Clinics of North America 33:4, 789-806
CrossRef140
Jonathan A. Cohn, R. Michael Mitchell, Paul S. Jowell. (2004) The role of cystic fibrosis gene mutations in determining susceptibility to chronic pancreatitis. Gastroenterology Clinics of North America 33:4, 817-837
CrossRef141
Ian Ellis. (2004) Genetic counseling for hereditary pancreatitis – the role of molecular genetics testing for the cationic trypsinogen gene, cystic fibrosis and serine protease inhibitor Kazal type 1. Gastroenterology Clinics of North America 33:4, 839-854
CrossRef142
Rodger A. Liddle. (2004) Susceptibility to pancreatitis related to PSTI/SPINK1 expression. Gastroenterology Clinics of North America 33:4, 807-816
CrossRef143
David C Whitcomb. (2004) Mechanisms of Disease: advances in understanding the mechanisms leading to chronic pancreatitis. Nature Clinical Practice Gastroenterology & Hepatology 1:1, 46-52
CrossRef144
Matthew J. DiMagno, Eugene P. DiMagno. (2004) Chronic pancreatitis. Current Opinion in Gastroenterology 20:5, 444-451
CrossRef145
PRAMOD KUMAR GARG, RAKESH KUMAR TANDON. (2004) Survey on chronic pancreatitis in the Asia-Pacific region. Journal of Gastroenterology and Hepatology 19:9, 998-1004
CrossRef146
Andres Gelrud, Sunil Sheth, Subhas Banerjee, Deborah Weed, Julie Shea, Ram Chuttani, Douglas A. Howell, Jennifer J. Telford, David L. Carr-Locke, Meredith M. Regan, Lynda Ellis, Peter R. Durie, Steven D. Freedman. (2004) Analysis of Cystic Fibrosis Gener Product (CFTR) Function in Patients with Pancreas Divisum and Recurrent Acute Pancreatitis. The American Journal of Gastroenterology 99:8, 1557-1562
CrossRef147
Christian Felley, Michael A Morris, Ambroise Wonkam, Bernard Hirschel, Markus Flepp, Katja Wolf, Hansjakob Furrer, Manuel Battegay, Enos Bernasconi, Amalio Telenti, Jean-Louis Frossard. (2004) The role of CFTR and SPINK-1 mutations in pancreatic disorders in HIV-positive patients. AIDS 18:11, 1521-1527
CrossRef148
C.P. Choudari, Thomas F. Imperiale, Stuart Sherman, Evan Fogel, Glen A. Lehman. (2004) Risk of Pancreatitis with Mutation of the Cystic Fibrosis Gene. The American Journal of Gastroenterology 99:7, 1358-1363
CrossRef149
Patrick Maisonneuve, Preston Campbell, Peter Durie, Albert B. Lowenfels. (2004) Pancreatitis in hispanic patients with cystic fibrosis carrying the R334W mutation. Clinical Gastroenterology and Hepatology 2:6, 504-509
CrossRef150
Teresa Casals, Lu??s Aparisi, Cecilia Mart??nez-Costa, Javier Gim??nez, Maria D. Ramos, Josefina Mora, Juan Diaz, Jaume Boadas, Xavier Estivill, Antoni Farr??. (2004) Different CFTR Mutational Spectrum in Alcoholic and Idiopathic Chronic Pancreatitis?. Pancreas 28:4, 374-379
CrossRef151
Satoru Naruse, Hiroshi Ishiguro, Yasufumi Suzuki, Kotoyo Fujiki, Shigeru B.H. Ko, Nobumasa Mizuno, Toshihiro Takemura, Akiko Yamamoto, Toshiyuki Yoshikawa, Chunxiang Jin, Ryujiro Suzuki, Motoji Kitagawa, Takao Tsuda, Takaharu Kondo, Tetsuo Hayakawa. (2004) A Finger Sweat Chloride Test for the Detection of a High-Risk Group of Chronic Pancreatitis. Pancreas 28:3, e80-e85
CrossRef152
Atsushi Masamune, Hiroya Mizutamari, Kiyoshi Kume, Tooru Asakura, Kennichi Satoh, Tooru Shimosegawa. (2004) Hereditary Pancreatitis as the Premalignant Disease. Pancreas 28:3, 305-310
CrossRef153
Stefano Del Prato, Alberto Coppelli, Antonio Tiengo. 2004. Diabetes Secondary to Acquired Disease to the Pancreas. .
CrossRef154
Freedman, Steven D., Blanco, Paola G., Zaman, Munir M., Shea, Julie C., Ollero, Mario, Hopper, Isabel K., Weed, Deborah A., Gelrud, Andres, Regan, Meredith M., Laposata, Michael, Alvarez, Juan G., O'Sullivan, Brian P., . (2004) Association of Cystic Fibrosis with Abnormalities in Fatty Acid Metabolism. New England Journal of Medicine 350:6, 560-569
Full Text155
Anne Kerr. (2004) Giving up on geneticization: a comment on Hedgecoe's 'Expansion and uncertainty: cystic fibrosis, classification and genetics'. Sociology of Health and Illness 26:1, 102-106
CrossRef156
Satoru NARUSE. (2004) Do CFTR Gene Polymorphisms Determine the Susceptibility to Alcoholic Chronic Pancreatitis?. Internal Medicine 43:12, 1093-1094
CrossRef157
Rakesh K. Tandon, Pramod K. Garg. (2004) Tropical Pancreatitis. Digestive Diseases 22:3, 258-266
CrossRef158
Yuji NAKAMURA, Tomohiro OHMORI, Akiko ISHIKAWA, Yasunori KOBAYASHI, Hiromi IMAZEKI, Susumu HIGUCHI, Katsuya MARUYAMA. (2004) Homozygous (TG)11 Allele in Intron 8 of the Cystic Fibrosis Transmembrane Conductance Regulator (CFTR) Gene has a Protective Role against Bicarbonate Decrease in Pure Pancreatic Juice among Japanese Male Alcoholics. Internal Medicine 43:12, 1131-1137
CrossRef159
David C. Whitcomb. (2003) Genetic Predisposition to Alcoholic Chronic Pancreatitis. Pancreas 27:4, 321-326
CrossRef160
Helen Beranek, Niels Teich, Heiko Witt, Hans-Ulrich Schulz, Joachim M??ssner, Volker Keim. (2003) Analysis of tumour necrosis factor alpha and interleukin 10 promotor variants in patients with chronic pancreatitis. European Journal of Gastroenterology & Hepatology 15:11, 1223-1227
CrossRef161
John P Tazelaar, Jeffrey A Kant. (2003) Genetic testing in chronic pancreatitis. Expert Review of Molecular Diagnostics 3:6, 799-809
CrossRef162
Raffaele Pezzilli, Antonio Maria Morselli-Labate, Vilma Mantovani, Elisabetta Romboli, Paola Selva, Marina Migliori, Roberto Corinaldesi, Lucio Gullo. (2003) Mutations of the CFTR Gene in Pancreatic Disease. Pancreas 27:4, 332-336
CrossRef163
Michael P. Boyle. (2003) Nonclassic cystic fibrosis and CFTR-related diseases. Current Opinion in Pulmonary Medicine 9:6, 498-503
CrossRef164
Hyun Jun Kim, Myung-Hwan Kim, Jong-Seok Bae, Sang-Soo Lee, Dong Wan Seo, Sung Koo Lee. (2003) Idiopathic Acute Pancreatitis. Journal of Clinical Gastroenterology 37:3, 238-250
CrossRef165
Rebecca K. Rowntree, Ann Harris. (2003) The Phenotypic Consequences of CFTR Mutations. Annals of Human Genetics 67:5, 471-485
CrossRef166
Véronique Morinville, Jean Perrault. (2003) Genetic disorders of the pancreas. Gastroenterology Clinics of North America 32:3, 763-787
CrossRef167
Matthew J. DiMagno, Eugene P. DiMagno. (2003) Chronic pancreatitis. Current Opinion in Gastroenterology 19:5, 451-457
CrossRef168
T.M Neri, G.M Cavestro, P Seghini, P.F Zanelli, A Zanetti, M Savi, M Podda, M Zuin, M Colombo, A Floreani, F Rosina, G Bianchi Porro, M Strazzabosco, L Okolicsanyi. (2003) Novel association of HLA-haplotypes with primary sclerosing cholangitis (PSC) in a southern European population. Digestive and Liver Disease 35:8, 571-576
CrossRef169
Fukashi Ochi, Masatoshi Fujii, Toshiyuki Sakai, Masahiko Sugano, Kiyoshi Oshiro, Yoshinori Okabayashi, Masaki Mita, Yoshiaki Kido. (2003) A Case of Acute Pancreatitis Associated With Cationic Trypsinogen N29T Mutation. Pancreas 27:2, 199-201
CrossRef170
Alphonso Brown. (2003) Pediatric Acute Pancreatitis—Deciphering the Black Box. Journal of Clinical Gastroenterology 37:2, 100-102
CrossRef171
Christoph Hanck, Alexander Schneider, David C Whitcomb. (2003) Genetic polymorphisms in alcoholic pancreatitis. Best Practice & Research Clinical Gastroenterology 17:4, 613-623
CrossRef172
William M. Steinberg, Suresh T. Chari, Chris E. Forsmark, Stuart Sherman, Howard A. Reber, Edward L. Bradley,, Eugene DiMagno. (2003) Controversies in Clinical Pancreatology. Pancreas 27:2, 103-117
CrossRef173
Beryl J. Rosenstein. (2003) Nonclassic cystic fibrosis: A clinical conundrum. Pediatric Pulmonology 36:1, 10-12
CrossRef174
Johann Ockenga, Arndt Vogel, Niels Teich, Volker Keim, Michael P Manns, Christian P Strassburg. (2003) UDP glucuronosyltransferase (UGT1A7) gene polymorphisms increase the risk of chronic pancreatitis and pancreatic cancer. Gastroenterology 124:7, 1802-1808
CrossRef175
G.M Cavestro, L Frulloni, A Nouvenne, T.M Neri, B Calore, B Ferri, P Bovo, L Okolicsanyi, F Di Mario, G Cavallini. (2003) Association of keratin 8 gene mutation with chronic pancreatitis. Digestive and Liver Disease 35:6, 416-420
CrossRef176
Giulia M. Cavestro, Luca Frulloni, Tauro M. Neri, Pietro Seghini, Antonio Nouvenne, Adele Zanetti, Paolo Bovo, Francesco Di Mario, Lajos Okolicsanyi, Giorgio Cavallini. (2003) Association of HLA-DRB1*0401 Allele with Chronic Pancreatitis. Pancreas 26:4, 388-391
CrossRef177
Jian-Min Chen, Cedric Le Maréchal, Danièle Lucas, Odile Raguénès, Claude Férec. (2003) “Loss of function” mutations in the cationic trypsinogen gene (PRSS1) may act as a protective factor against pancreatitis. Molecular Genetics and Metabolism 79:1, 67-70
CrossRef178
Dov Virgilis, Luis Rivkin, Arnon Samueloff, Elie Picard, Shmuel Goldberg, Joseph Faber, Eitan Kerem, Michael Wilschanski. (2003) Cystic Fibrosis, Pregnancy, and Recurrent, Acute Pancreatitis. Journal of Pediatric Gastroenterology and Nutrition 36:4, 486-488
CrossRef179
RMS Mitchell, MF Byrne, J Baillie. (2003) Pancreatitis. The Lancet 361:9367, 1447-1455
CrossRef180
Reuben Jackson, Paul B Pencharz. (2003) Cystic fibrosis. Best Practice & Research Clinical Gastroenterology 17:2, 213-235
CrossRef181
James H. Grendell. (2003) Genetic factors in pancreatitis. Current Gastroenterology Reports 5:2, 105-109
CrossRef182
Alexander Schneider, Kay Pogue-Geile, M. Michael Barmada, Erica Myers-Fong, Bryan S. Thompson, David C. Whitcomb. (2003) Hereditary, familial, and idiopathic chronic pancreatitis are not associated with polymorphisms in the tumor necrosis factor α (TNF-α) promoter region or the TNF receptor 1 (TNFR1) gene. Genetics in Medicine 5:2, 120-125
CrossRef183
Virmeet V. Singh, Phillip P. Toskes. (2003) Medical therapy for chronic pancreatitis pain. Current Gastroenterology Reports 5:2, 110-116
CrossRef184
L Frulloni, C Castellani, P Bovo, B Vaona, B Calore, C Liani, G Mastella, G Cavallini. (2003) Natural history of pancreatitis associated with cystic fibrosis gene mutations. Digestive and Liver Disease 35:3, 179-185
CrossRef185
Tetsuo Hayakawa, Satoru Naruse, Kyung Hwan Kim, Vay Liang W. Go. (2003) 2nd International Symposium: Frontiers in Pancreatic Research—From Basics to Clinic and Exocrine Glands, Japan–Korea. Pancreas 26:1, e1-e11
CrossRef186
Steven P. Conway, Daniel G. Peckham, Carol E. Chu, Lucy A. Ellis, Mushtaq Ahmed, Graham R. Taylor. (2002) Cystic fibrosis presenting as acute pancreatitis and obstructive azoospermia in a young adult male with a novel mutation in the CFTR gene. Pediatric Pulmonology 34:6, 491-495
CrossRef187
Z HASSAN, V MOHAN, L ALI, R ALLOTEY, K BARAKAT, M FARUQUE, R DEEPA, M MCDERMOTT, A JACKSON, P CASSELL. (2002) SPINK1 Is a Susceptibility Gene for Fibrocalculous Pancreatic Diabetes in Subjects from the Indian Subcontinent. The American Journal of Human Genetics 71:4, 964-968
CrossRef188
Mark E. Lowe, Nadia Ameen, Stephen Freedman, Andrew E. Mulberg, Steven L. Werlin. (2002) Research Agenda for Pediatric Gastroenterology, Hepatology and Nutrition: Cystic Fibrosis and Pancreatic Diseases: Report of the North American Society for Pediatric Gastroenterology, Hepatology and Nutrition for the Children's Digestive Health and Nutrition Foundation. Journal of Pediatric Gastroenterology and Nutrition 35, S258-S262
CrossRef189
Alexander Schneider, Roland Pfützer, David C. Whitcomb. (2002) Genetics and pancreatic disease. Current Opinion in Gastroenterology 18:5, 545-551
CrossRef190
Jinong Feng, Jin Yan, Carolyn H Buzin, Jeffrey A Towbin, Steve S Sommer. (2002) Mutations in the dystrophin gene are associated with sporadic dilated cardiomyopathy. Molecular Genetics and Metabolism 77:1-2, 119-126
CrossRef191
Groman, Joshua D., Meyer, Michelle E., Wilmott, Robert W., Zeitlin, Pamela L., Cutting, Garry R., . (2002) Variant Cystic Fibrosis Phenotypes in the Absence of CFTR Mutations. New England Journal of Medicine 347:6, 401-407
Full Text192
Michael O. Stormon, Peter R. Durie. (2002) Pathophysiologic Basis of Exocrine Pancreatic Dysfunction in Childhood. Journal of Pediatric Gastroenterology and Nutrition 35:1, 8-21
CrossRef193
John M. Petersen. (2002) Tropical Pancreatitis. Journal of Clinical Gastroenterology 35:1, 61-66
CrossRef194
J Andrieux, MP Audrézet, I Frachon, C Leroyer, C Roge, V Scotet, C Férec. (2002) Quantification of CFTR splice variants in adults with disseminated bronchiectasis, using the TaqMan fluorogenic detection system. Clinical Genetics 62:1, 60-67
CrossRef195
Satoru Naruse*, Motoji Kitagawa, Hiroshi Ishiguro, Kotoyo Fujiki, Tetsuo Hayakawa. (2002) Cystic fibrosis and related diseases of the pancreas. Best Practice & Research Clinical Gastroenterology 16:3, 511-526
CrossRef196
Antony E Shrimpton. (2002) Molecular diagnosis of cystic fibrosis. Expert Review of Molecular Diagnostics 2:3, 240-256
CrossRef197
Rakesh Kumar Tandon, Nobuhiro Sato, Pramod Kumar Garg, . (2002) Chronic pancreatitis: Asia-Pacific consensus report. Journal of Gastroenterology and Hepatology 17:4, 508-518
CrossRef198
Jonathan E. Clain, Randall K. Pearson. (2002) Evidence-based approach to idiopathic pancreatitis. Current Gastroenterology Reports 4:2, 128-134
CrossRef199
C.J Taylor, N Aswani. (2002) The pancreas in cystic fibrosis. Paediatric Respiratory Reviews 3:1, 77-81
CrossRef200
Niels Teich, Nadine Bauer, Joachim Mossner, Volker Keim. (2002) Mutational screening of patients with nonalcoholic chronic pancreatitis: identification of further trypsinogen variants1. The American Journal of Gastroenterology 97:2, 341-346
CrossRef201
Heiko Witt, Michael Becker. (2002) Genetics of Chronic Pancreatitis. Journal of Pediatric Gastroenterology and Nutrition 34:2, 125-136
CrossRef202
Federica Sangiuolo, Maria Rosaria D’Apice, Emanuela Bruscia, Vincenzina Lucidi, Giuseppe Novelli. (2002) Towards the pharmacogenomics of cystic fibrosis. Pharmacogenomics 3:1, 75-87
CrossRef203
Eugene P. DiMagno. (2001) Gene mutations and idiopathic chronic pancreatitis: Clinical implications and testing. Gastroenterology 121:6, 1508-1512
CrossRef204
Peadar G. Noone, Zhaoqing Zhou, Lawrence M. Silverman, Paul S. Jowell, Michael R. Knowles, Jonathan A. Cohn. (2001) Cystic fibrosis gene mutations and pancreatitis risk: Relation to epithelial ion transport and trypsin inhibitor gene mutations. Gastroenterology 121:6, 1310-1319
CrossRef205
Ania Manson, Clare Huxley. (2001) Skipping of Exon 9 of Human CFTR in YAC-Transgenic Mice. Genomics 77:3, 127-134
CrossRef206
Lehel Somogyi, Stephen P. Martin, Charles D. Ulrich. (2001) Recurrent acute pancreatitis. Current Treatment Options in Gastroenterology 4:5, 361-368
CrossRef207
Lee-Jun C. Wong, Jianjun Wang, Ying-Hua Zhang, Evelyn Hsu, Ruth A. Heim, C. Michael Bowman, Marlyn S. Woo. (2001) Improved detection ofCFTR mutations in Southern California Hispanic CF patients. Human Mutation 18:4, 296-307
CrossRef208
C. Castellani, C. Quinzii, S. Altieri, G. Mastella, B.M. Assael. (2001) A Pilot Survey of Cystic Fibrosis Clinical Manifestations in CFTR Mutation Heterozygotes. Genetic Testing 5:3, 249-254
CrossRef209
M. Ravnik-Glavač, N. Svetina, B. Zorn, B. Peterlin, D. Glavač. (2001) Involvement of CFTR Gene Alterations in Obstructive and Nonobstructive Infertility in Men. Genetic Testing 5:3, 243-247
CrossRef210
Atsushi Tsuji, Tetsu Nishikawa, Masayuki Mori, Koichi Suda, Isao Nishimori, Masahiko Nishimura. (2001) Quantitative Trait Locus Analysis for Chronic Pancreatitis and Diabetes Mellitus in the WBN/Kob Rat. Genomics 74:3, 365-369
CrossRef211
C.S. Pitchumoni. (2001) Pathogenesis of Alcohol-Induced Chronic Pancreatitis. Surgical Clinics of North America 81:2, 379-390
CrossRef212
Heiko Witt, Hans Christian Hennies, Michael Becker. (2001) SPINK1 mutations in chronic pancreatitis. Gastroenterology 120:4, 1060-1061
CrossRef213
Jm Chen, A Piepoli Bis, L Le Bodic, P Ruszniewski, M Robaszkiewicz, Ph Deprez, O Raguenes, I Quere, A Andriulli, C Ferec. (2001) Mutational screening of the cationic trypsinogen gene in a large cohort of subjects with idiopathic chronic pancreatitis. Clinical Genetics 59:3, 189-193
CrossRef214
Raj K. Rolston, Jeffrey A. Kant. (2001) Genetic testing in acute and chronic pancreatitis. Current Gastroenterology Reports 3:2, 115-120
CrossRef215
M R Lankisch, M Imoto, P Layer, E P DiMagno. (2001) The effect of small amounts of alcohol on the clinical course of chronic pancreatitis.. Mayo Clinic Proceedings 76:3, 242-251
CrossRef216
A. Lowenfels, P. Maisonneuve, B. Palys. (2001) Re: Ockenga et al.-mutations of cystic fibrosis gene in patients with pancreatitis. The American Journal of Gastroenterology 96:2, 614-615
CrossRef217
Kaspar Truninger, Josef K??ck, Hans-Peter Wirth, Beat Muellhaupt, Christian Arnold, Fritz von Weizs??cker, Burkhardt Seifert, Rudolf W. Ammann, Hubert E. Blum. (2001) Trypsinogen Gene Mutations in Patients with Chronic or Recurrent Acute Pancreatitis. Pancreas 22:1, 18-23
CrossRef218
Lee R. Choo-Kang, Pamela L. Zeitlin. (2000) Type I, II, III, IV, and V cystic fibrosis transmembrane conductance regulator defects and opportunities for therapy. Current Opinion in Pulmonary Medicine 6:6, 521-529
CrossRef219
Lehel Somogyi, Miriam Cintron, Phillip P. Toskes. (2000) Synthetic Porcine Secretin Is Highly Accurate in Pancreatic Function Testing in Individuals with Chronic Pancreatitis. Pancreas 21:3, 262-265
CrossRef220
Kristin G. Monaghan, Charles E. Jackson, Debra L. KuKuruga, Gerald L. Feldman. (2000) Mutation analysis of the cystic fibrosis and cationic trypsinogen genes in patients with alcohol-related pancreatitis. American Journal of Medical Genetics 94:2, 120-124
CrossRef221
Andrzej J. Janecki. (2000) Why should a clinician care about the molecular biology of transport?. Current Gastroenterology Reports 2:5, 378-386
CrossRef222
Andrew Bush, Colin Wallis. (2000) Time to think again: Cystic fibrosis is not an ?all or none? disease. Pediatric Pulmonology 30:2, 139-144
CrossRef223
Mami Imoto, Eugene P. DiMagno. (2000) Cigarette Smoking Increases the Risk of Pancreatic Calcification in Late-Onset But Not Early-Onset Idiopathic Chronic Pancreatitis. Pancreas 21:2, 115-119
CrossRef224
C. Arduino, E. Gaia. (2000) Genetics of chronic pancreatitis. Biomedicine & Pharmacotherapy 54:7, 394-399
CrossRef225
Julie C. Shea, Isabel K. Hopper, Paola G. Blanco, Steven D. Freedman. (2000) Advances in nutritional management of chronic pancreatitis. Current Gastroenterology Reports 2:4, 323-326
CrossRef226
Cabot, Richard C.Scully, Robert E., Mark, Eugene J., McNeely, William F., Ebeling, Sally H.Ellender, Stacey M.Peters, Christine C., Katz, Aubrey J.Graeme-Cook, Fiona M.. (2000) Case 19-2000. New England Journal of Medicine 342:25, 1893-1900
Full Text227
Charles D. Ulrich. (2000) Bicarbonate secretion and CFTR: Continuing the paradigm shift. Gastroenterology 118:6, 1258-1261
CrossRef228
D.F. McAuley, J.S. Elborn. (2000) Cystic fibrosis: basic science. Paediatric Respiratory Reviews 1:2, 93-100
CrossRef229
Jonathan A. Cohn, Jeffrey D. Bornstein, Paul S. Jowell. (2000) CYSTIC FIBROSIS MUTATIONS AND GENETIC PREDISPOSITION TO IDIOPATHIC CHRONIC PANCREATITIS. Medical Clinics of North America 84:3, 621-631
CrossRef230
Steven D. Freedman, Paola Blanco, Julie C. Shea, Juan G. Alvarez. (2000) MECHANISMS TO EXPLAIN PANCREATIC DYSFUNCTION IN CYSTIC FIBROSIS. Medical Clinics of North America 84:3, 657-664
CrossRef231
David C. Whitcomb. (2000) GENETIC PREDISPOSITIONS TO ACUTE AND CHRONIC PANCREATITIS. Medical Clinics of North America 84:3, 531-547
CrossRef232
Jean Perrault. (2000) HEREDITARY PANCREATITIS. Medical Clinics of North America 84:3, 519-529
CrossRef233
Charles D. Ulrich. (2000) GROWTH FACTORS, RECEPTORS, AND MOLECULAR ALTERATIONS IN PANCREATIC CANCER. Medical Clinics of North America 84:3, 697-705
CrossRef234
John E. Mickle, Garry R. Cutting. (2000) GENOTYPE-PHENOTYPE RELATIONSHIPS IN CYSTIC FIBROSIS. Medical Clinics of North America 84:3, 597-607
CrossRef235
Kim E. Barrett, Stephen J. Keely. (2000)
Chloride Secretion by the Intestinal Epithelium : Molecular Basis and Regulatory Aspects. Annual Review of Physiology 62:1, 535-572
CrossRef236
M. Stuhrmann, T. Dork. (2000) CFTR gene mutations and male infertility. Andrologia 32:2, 71-83
CrossRef237
Jean Feigelson, Yvette Pécau, Myriam Poquet, Patricia Terdjman, Jacqueline Carrère, Jean-Pierre Chazalette, Claude Ferec. (2000) Imaging Changes in the Pancreas in Cystic Fibrosis: A Retrospective Evaluation of 55 Cases Seen Over a Period of 9 Years. Journal of Pediatric Gastroenterology and Nutrition 30:2, 145-151
CrossRef238
Emmanuelle Girodon-Boulandet, C
CrossRef239
Brugge, William R., Van Dam, Jacques, . (1999) Pancreatic and Biliary Endoscopy. New England Journal of Medicine 341:24, 1808-1816
Full Text240
Judy Cho. (1999) Genetic aspects of inflammatory bowel disease: How far have we come, and where are we heading?. Current Gastroenterology Reports 1:6, 491-495
CrossRef241
Roland H. Pfützer, David C. Whitcomb. (1999) Trypsinogen mutations in chronic pancreatitis. Gastroenterology 117:6, 1507-1508
CrossRef242
C Arduino, M Gallo, A Brusco, S Garnerone, Mr Piana, S Di Maggio, G Gerbino Promis, M Ferrone, A Angeli, E Gaia. (1999) Polyvariant mutant CFTR genes in patients with chronic pancreatitis. Clinical Genetics 56:5, 401-405
CrossRef243
Stephen T. Amann. (1999) Chronic pancreatitis. Current Treatment Options in Gastroenterology 2:5, 401-408
CrossRef244
Albert B. Lowenfels, Patrick Maisonneuve, Paul Georg Lankisch. (1999) CHRONIC PANCREATITIS AND OTHER RISK FACTORS FOR PANCREATIC CANCER. Gastroenterology Clinics of North America 28:3, 673-685
CrossRef245
Sharon Y. Kang, Vay Liang W. Go. (1999) PANCREATIC EXOCRINE-ENDOCRINE INTERRELATIONSHIP. Gastroenterology Clinics of North America 28:3, 551-569
CrossRef246
Suresh T. Chari, Eugene P. DiMagno. (1999) Chronic pancreatitis. Current Opinion in Gastroenterology 15:5, 398
CrossRef247
C.P. Choudari, Glen A. Lehman, Stuart Sherman. (1999) PANCREATITIS AND CYSTIC FIBROSIS GENE MUTATIONS. Gastroenterology Clinics of North America 28:3, 543-549
CrossRef248
Michele D. Bishop, Steven D. Freedman. (1999) Cystic fibrosis and pancreatic disease. Current Treatment Options in Gastroenterology 2:4, 289-293
CrossRef249
Peter Layer, Eugene P. DiMagno. (1999) EARLY AND LATE ONSET IN IDIOPATHIC AND ALCOHOLIC CHRONIC PANCREATITIS. Surgical Clinics of North America 79:4, 847-860
CrossRef250
Jonathan A. Cohn, Paul S. Jowell. (1999) ARE MUTATIONS IN THE CYSTIC FIBROSIS GENE IMPORTANT IN CHRONIC PANCREATITIS?. Surgical Clinics of North America 79:4, 723-731
CrossRef251
Jonathan E. Clain, Randall K. Pearson. (1999) DIAGNOSIS OF CHRONIC PANCREATITIS. Surgical Clinics of North America 79:4, 829-845
CrossRef252
Heiko Witt, Werner Luck, Michael Becker. (1999) A signal peptide cleavage site mutation in the cationic trypsinogen gene is strongly associated with chronic pancreatitis. Gastroenterology 117:1, 7-10
CrossRef253
C. Castellani, A. Bonizzato, R. Rolfini, L. Frulloni, G. C. Cavallini, G. Mastella. (1999) Increased Prevalence of Mutations of the Cystic Fibrosis Gene in Idiopathic Chronic and Recurrent Pancreatitis. The American Journal of Gastroenterology 94:7, 1993-1995
CrossRef254
Noah F Shroyer, Richard Alan Lewis, Rando Allikmets, Nanda Singh, Michael Dean, Mark Leppert, James R Lupski. (1999) The rod photoreceptor ATP-binding cassette transporter gene, ABCR, and retinal disease: from monogenic to multifactorial. Vision Research 39:15, 2537-2544
CrossRef255
(1999) Correction: Mutations of the Cystic Fibrosis Gene in Patients with Chronic Pancreatitis. New England Journal of Medicine 340:20, 1592-1593
Full Text256
Eugene P. DiMagno. (1999) Toward understanding (and management) of painful chronic pancreatitis. Gastroenterology 116:5, 1252-1257
CrossRef257
Phillip P. Toskes. (1999) Update on diagnosis and management of chronic pancreatitis. Current Gastroenterology Reports 1:2, 145-153
CrossRef258
Charles D. Ulrich. (1999) Invited Commentary. Current Gastroenterology Reports 1:2, 87-88
CrossRef259
Jeffrey D. Bornstein, Jonathan A. Cohn. (1999) Cystic fibrosis in the pancreas: Recent advances provide new insights. Current Gastroenterology Reports 1:2, 161-165
CrossRef260
Laurence J. Miller. (1999) Advances in molecular genetics for the pancreatologist. Current Gastroenterology Reports 1:2, 132-133
CrossRef261
Albert B. Lowenfels, Patrick Maisonneuve, Harish Grover, Eric Gerber, Mark A. Korsten, Maria Teresa Antunes, Antonio Marques, C.S. Pitchumoni. (1999) Racial factors and the risk of chronic pancreatitis. The American Journal of Gastroenterology 94:3, 790-794
CrossRef262
Paul S. Haber, Murray D. Norris, Minoti V. Apte, Sally C. Rodgers, Ian D. Norton, Romano C. Pirola, Ian C. Roberts-Thomson, Jeremy S. Wilson. (1999) Alcoholic Pancreatitis and Polymorphisms of the Variable Length Polythymidine Tract in the Cystic Fibrosis Gene. Alcoholism: Clinical and Experimental Research 23:3, 509-512
CrossRef263
(1999) Mutations of the Cystic Fibrosis Gene and Pancreatitis. New England Journal of Medicine 340:3, 238-239
Full Text264
Durie, Peter R., . (1998) Pancreatitis and Mutations of the Cystic Fibrosis Gene. New England Journal of Medicine 339:10, 687-688
Full Text
