Original Article
Micrometastases and Survival in Stage II Colorectal Cancer
N Engl J Med 1998; 339:223-228July 23, 1998
- Abstract
Background
Standard treatment of colorectal cancer includes adjuvant chemotherapy for patients with stage III disease (defined by the presence of lymph-node metastases), but not for patients with stage II tumors (who have no lymph-node metastases). However, 20 percent of patients with stage II tumors die of recurrent disease. We investigated whether the detection of micrometastases can be used to identify patients with stage II disease who are at high risk for recurrence.
Methods
We analyzed 192 lymph nodes from 26 consecutive patients with stage II colorectal cancer, using a carcinoembryonic antigen–specific nested reverse-transcriptase polymerase chain reaction. Five-year follow-up information was obtained on all patients. Observed and adjusted survival rates were assessed in the patients with and the patients without micrometastases.
Results
Micrometastases were detected in one or more lymph nodes from 14 of 26 patients (54 percent). The adjusted five-year survival rate (for which only cancer-related deaths were considered) was 50 percent in this group, whereas in the 12 patients without micrometastases, the survival rate was 91 percent (P=0.02 by the log-rank test). The observed five-year survival rates were 36 percent and 75 percent, respectively (P=0.03). The groups were similar with respect to age, sex, tumor side (location in relation to the flexura lienalis), degree of tumor differentiation (grade), and diameter of the primary tumor.
Conclusions
Molecular detection of micrometastases is a prognostic tool in stage II colorectal cancer.
Media in This Article
Figure 2
Kaplan–Meier Life-Table Analysis of the Observed and Adjusted Survival of Patients with Stage II Colorectal Cancer According to the Presence or Absence of Micrometastases.Figure 1
Nested Polymerase-Chain-Reaction (PCR) Assay for Carcinoembryonic Antigen and Hypoxanthine Phosphoribosyltransferase.Article Activity
- Article
Dissemination to locoregional lymph nodes is an important prognostic factor in colorectal cancer. Five-year survival rates drop from 80 percent in patients with tumor–node–metastasis (TNM) stage II disease (who have no lymph-node metastases) to 45 to 50 percent in those with TNM stage III disease (in which lymph-node metastases are present).1 Surgery and adjuvant chemotherapy are standard treatments for stage III disease but not for stage II disease, in which adjuvant therapy is recommended only in the setting of a clinical trial.2-4 Better assessment of prognosis in patients with stage II colorectal cancer could allow the selective use of adjuvant therapy and prevent unnecessary treatment.
It is known from immunohistochemical studies that some histopathologically negative lymph nodes draining colorectal tumors and other carcinomas contain minute amounts of tumor.5-11 However, the prognostic relevance of this phenomenon is not clear. Technical advances now permit the detection of micrometastases at the molecular level. For example, somatic mutations in oncogenes or tumor-suppressor genes that occur in the primary tumor are also detectable in lymph-node DNA. Detection of micrometastases by this method is not possible, however, in tumors that lack a genetic alteration suitable for amplification by the polymerase chain reaction (PCR). A more general method is the amplification of cancer-specific RNA from lymph nodes. Carcinoembryonic antigen is present in the vast majority of colorectal tumors but not in normal tissues12 and is therefore a suitable marker of micrometastases in colorectal cancer. The development of the reverse-transcriptase–PCR assay for carcinoembryonic antigen messenger RNA (mRNA) has made it possible to detect micrometastases in the lymph nodes and bone marrow of patients with colorectal cancer.13,14 We used this method to evaluate whether the presence of micrometastases can be used to identify patients with stage II colorectal cancer who are at high risk for metastatic disease.
Methods
Patients
We studied 246 lymph nodes from 26 patients with TNM stage II colorectal cancer.15 The lymph nodes were obtained consecutively from curative resections performed at the surgical department of the Leiden University Medical Center between January 1990 and February 1992. Preoperative and perioperative examinations showed no evidence of metastatic disease. Follow-up was carried out in accordance with the department's protocol and was based on periodic evaluations of the patient. The follow-up findings were confirmed in all the patients as of November 1, 1997.
Tissue and RNA Isolation
Half of each resected node was fixed with formalin and embedded in paraffin for routine histopathological examination. The other half was snap-frozen in liquid nitrogen and stored at –80°C until the time of RNA isolation. Total cellular RNA was isolated from 50-μm sections of the lymph nodes. These sections were sandwiched between two series of 5-μm frozen sections that were used as controls for staining with hematoxylin and eosin and immunohistochemical staining with antibodies against cytokeratin and carcinoembryonic antigen. The RNA was extracted with the use of Trizol (Life Technologies, Gaithersburg, Md.) in a single-step method as described previously.16 The RNA was assessed spectrophotometrically and by electrophoresis on a 0.8 percent agarose gel to determine its integrity and quantity.
Reverse-Transcriptase PCR
Nested PCR was performed according to the method described by Gerhard et al.13 Briefly, complementary DNA (cDNA) was generated with avian myeloblastosis virus reverse transcriptase (Boehringer Mannheim, Mannheim, Germany) with the use of 2 μg of total RNA and primer B in a reaction volume of 20 μl. For the first round of PCR, 100-μl reactions were prepared with 15 μl of the cDNA preparation and primers A and B.13 Reaction tubes were placed in a thermocycler and preheated at the denaturing temperature; after initial denaturing at 95°C for 7 minutes, 20 cycles of amplification were performed at 95°C (for 1 minute) and 72°C (for 2 minutes), with a final extension step for 10 minutes. All mixtures were prepared on ice in a PCR workstation (CBS Scientific, Del Mar, Calif.).
For the second round of PCR, the reaction mixture containing primer A and an internal primer C13 was prepared, and 96.5 μl was dispensed into each tube. The tubes were overlaid with mineral oil and taken to another room, where 3.5 μl of the first reaction mixture was pipetted through the oil with the use of self-sealing sterile filter tips (Biozyme, Landgraaf, the Netherlands) to prevent cross-contamination.
Fifteen more cycles of amplification were performed under the same conditions, except that 69°C (for one minute) was chosen as the annealing temperature. The PCR products were separated on a 2 percent agarose gel and stained with ethidium bromide. The negative control samples that were coamplified in every PCR procedure did not yield any product when this protocol was used. However, a very faint band could be detected in some negative control samples when 20 or 25 cycles were used in the second PCR analysis. Consequently, we concluded that 15 cycles were adequate in our assay.
Efficient amplification of the RNA was monitored by a control PCR of hypoxanthine phosphoribosyltransferase (HPRT) cDNA with the use of primer H1 (5'ACCGGCTTCCTCCTCCTGAGCAGTC3') and primer H2 (5'AGGACTCCAGATGTTTCCAAACTCAACTT3'). Seven lymph nodes from two patients, one treated for an ischemic ulcer and the other for a tubulovillous adenoma, were used as negative controls. Furthermore, we performed a negative control reaction using a confirmed metastatic lymph node by omitting the addition of reverse transcriptase to check for possible contamination of genomic DNA.
Statistical Analysis
The primary end point was survival, measured from the date of surgery to the time of the last follow-up or death. Kaplan–Meier survival curves were constructed.17 For overall survival, all deaths, irrespective of cause, were considered events. For adjusted survival, only cancer-related deaths were considered; data on the patients who died from other causes or who were still alive at the end of our study were censored. The rates of recurrence were calculated from the time of surgery to the time of relapse with the same methods. The comparison of the survival curves for the patients with and the patients without micrometastases was performed with the use of the log-rank test. We used a Cox regression analysis to estimate the simultaneous prognostic effect of the variables.18 Fisher's exact test was used to evaluate the numbers of patients with events according to various covariates; the Mann–Whitney U test was used to compare means. All tests were two-sided, and a P value of less than 0.05 was considered to indicate statistical significance.
Results
Expression of Carcinoembryonic Antigen–Specific mRNA
Intact RNA was isolated from 192 lymph nodes resected from 26 patients. Fifty-four additional lymph nodes from 17 of these 26 patients were excluded from our analysis. Most of these lost nodes were too small to be divided into two parts, and the others did not yield sufficient amounts of intact RNA, on the basis of the control PCR from the HPRT gene. A 131-bp PCR product was amplified from a lymph node with histopathologically confirmed metastasis and from tumor samples. Direct sequencing of the PCR product confirmed that the 3' end of the carcinoembryonic antigen gene had been amplified (data not shown). The control samples repeatedly failed to be amplified when 15 cycles were used in the second PCR (Figure 1Figure 1
Nested Polymerase-Chain-Reaction (PCR) Assay for Carcinoembryonic Antigen and Hypoxanthine Phosphoribosyltransferase.).Overall, micrometastases were present in 36 of 192 lymph nodes (19 percent). Staining with hematoxylin and eosin and immunohistochemical staining with antibodies against cytokeratin and carcinoembryonic antigen failed to identify micrometastases in any of these lymph nodes. Fourteen patients (54 percent) had one or more nodes that were positive in our assay. Table 1Table 1
Molecular Detection of Micrometastasis and Outcomes of Patients with Stage II Colorectal Cancer. presents the findings in the lymph nodes and the clinical outcomes of the 26 patients.Characteristics of the Patients
Table 2Table 2
Clinical Characteristics of 26 Patients with Histopathologically Negative Lymph Nodes Analyzed for the Presence of Carcinoembryonic-Antigen Messenger RNA. shows the clinical characteristics of the 26 patients whose lymph nodes were analyzed for the presence of micrometastases. The mean age was 68 years at the time of diagnosis. The mean age of the patients with micrometastases was 73 years, as compared with 63 years for the patients without nodal spread (P=0.17). There was no significant difference in the frequency of micrometastases between tumors on the left and right sides. The histologic grade of the primary tumors did not differ significantly between the patients with and the patients without micrometastases (P=0.54). The depth of invasion was not a statistically significant factor. Lymphatic invasion was observed in four patients, all of whom had evidence of micrometastatic spread of disease. Analysis of the diameter and growth pattern of the primary tumor and preoperative serum carcinoembryonic antigen levels in both groups did not show any significant differences.Micrometastatic Disease and Survival
By the end of our study, seven cancer-related deaths had occurred in the 14 patients with evidence of micrometastases (50 percent) whereas only one cancer-related death was observed in the 12 patients without evidence of nodal spread (8 percent). No patients were lost to follow-up, and the mean length of follow-up for the patients who were still alive was 73 months (range, 66 to 85). The mean (±SE) observed five-year survival rate was 54±10 percent and the adjusted five-year survival rate was 70±10 percent.
At the end of follow-up, 9 of the 12 patients without micrometastases were still alive, as compared with 4 of the 14 patients with micrometastases. Figure 2Figure 2
Kaplan–Meier Life-Table Analysis of the Observed and Adjusted Survival of Patients with Stage II Colorectal Cancer According to the Presence or Absence of Micrometastases. shows the Kaplan–Meier curves for both groups, with observed and adjusted survival. For both end points, the patients with micrometastases had a significantly worse survival rate than the patients without micrometastases. The five-year observed survival rate for the patients with micrometastases was 36 percent, as compared with 75 percent for the patients without micrometastases (P=0.03); the five-year adjusted survival rate was 50 percent, as compared with 91 percent (P=0.02 by the log-rank test), respectively.Among the 12 patients without micrometastases, 1 had a recurrence at 15 months (8 percent); thereafter, there were no recurrences in this group. By contrast, in the group with micrometastases the recurrence rates at 36 and 60 months were 49 percent and 58 percent, respectively. According to the log-rank test, this difference was statistically significant (P=0.02).
Micrometastases and Other Prognostic Variables
Analysis of micrometastases together with age, pT (pathologically confirmed tumor) category, and the presence or absence of lymphatic invasion with the Cox regression analysis showed that the differences in observed and adjusted survival were completely attributable to the presence of micrometastatic disease. Age, pT category, and lymphatic invasion were not independent prognostic factors. The relative risk of death from any cause that was associated with the presence of micrometastases was 5.0 (P=0.03); for cancer-related death, it was 11.7 (P=0.03).
Discussion
Our study demonstrates that the detection of micrometastases by reverse-transcriptase–PCR amplification of carcinoembryonic antigen mRNA in lymph nodes from patients with stage II colorectal cancer may have clinical value. We found that such micrometastases were associated with a significant reduction in the five-year survival rate, from 91 percent in patients without micrometastases to 50 percent in patients with micrometastatic disease in one or more lymph nodes.
There is a substantial literature on occult metastatic disease in colorectal cancer.5-8 Most studies show that micrometastases do occur, but they disagree about the prognostic significance of such a finding. In most studies, antibodies against cytokeratins and carcinoembryonic antigen were used to detect micrometastases. The differences in the choice of antibody, staining procedures, and interpretation may explain in part the discrepant results. Recent technical advances permit the detection of micrometastases at the DNA or RNA level. Known oncogenic mutations in the primary tumor can be used to detect very small amounts of tumor in lymph nodes, bone marrow aspirates, and surgical-resection margins.20-22 Using this method, Hayashi et al. found micrometastases in lymph nodes of 52 percent of patients with Dukes' stage A and stage B tumors, in which lymph-node metastases are undetectable by routine methods.23 However, they failed to detect mutations suitable for amplification by PCR in 49 of 120 patients, making this method unsuitable for use in a clinical setting.
A second method uses the reverse-transcriptase PCR to detect cancer-specific mRNA in tissues.13,24-27 Amplification of carcinoembryonic antigen mRNA has been used to detect minute amounts of tumor in the lymph nodes and bone marrow of patients with gastrointestinal tumors (at concentrations as low as 10 tumor cells in 5 × 107 normal bone marrow cells).26 Our study examined whether the results of this sensitive method correlate with clinical outcome.
Our data on survival are strikingly similar to those in recent studies of the loss of heterozygosity of chromosome 18q and the expression of the DCC (deleted in colorectal cancer) protein in stage II and stage III colorectal tumors.28,29 Survival decreased from 93 percent to 54 percent in patients with stage II tumors with loss of heterozygosity and from 94 percent to 61 percent in patients with stage II tumors with loss of DCC expression. Although these findings are clinically relevant, the biologic basis for them is unknown. The similarity of the prognostic information obtained by the analysis of DCC and the detection of micrometastases by reverse-transcriptase PCR suggests that the inactivation of the gene for DCC or an additional gene on chromosome 18q results in the early dissemination of tumor cells to locoregional lymph nodes. This idea is compatible with the association of loss of chromosome 18q with distant metastases.30 In any case, it seems clear that patients with TNM stage II colorectal cancer are a heterogeneous group. Fifty percent have an excellent prognosis, whereas in the other half the prognosis is similar to that of patients with stage III disease. It is possible that these groups can be distinguished by an analysis of micrometastatic disease in lymph nodes.
Source Information
From the Department of Surgery (G.-J.L., C.J.H.V., R.A.E.M.T.), the Department of Pathology (A.-M.C.-J., J.H.J.M.K., C.J.C.), and the Department of Medical Statistics (J.H.), Leiden University Medical Center, Leiden, the Netherlands.
Address reprint requests to Dr. Tollenaar at the Department of Surgery K6R, Leiden University Medical Center, P.O. Box 9600, 2300 RC, Leiden, the Netherlands.
- References
References
1
Hermanek P . pTNM and residual tumor classifications: problems of assessment and prognostic significance. World J Surg 1995;19:184-190
CrossRef | Web of Science | Medline2
Moertel CG . Chemotherapy for colorectal cancer. N Engl J Med 1994;330:1136-1142
Full Text | Web of Science | Medline3
Moertel CG ,Fleming TR ,Macdonald JS , et al. Intergroup study of fluorouracil plus levamisole as adjuvant therapy for stage II/Dukes' B2 colon cancer. J Clin Oncol 1995;13:2936-2943
Web of Science | Medline4
O'Connell MJ ,Mailliard JA ,Kahn MJ , et al. Controlled trial of fluorouracil and low-dose leucovorin given for 6 months as postoperative adjuvant therapy for colon cancer. J Clin Oncol 1997;15:246-250
Web of Science | Medline5
Greenson JK ,Isenhart CE ,Rice R ,Mojzisik C ,Houchens D ,Martin EW Jr . Identification of occult micrometastases in pericolic lymph nodes of Dukes' B colorectal cancer patients using monoclonal antibodies against cytokeratin and CC49. Cancer 1994;73:563-569
CrossRef | Web of Science | Medline6
Jeffers MD ,O'Dowd GM ,Mulcahy H ,Stagg M ,O'Donoghue DP ,Toner M . The prognostic significance of immunohistochemically detected lymph node micrometastases in colorectal carcinoma. J Pathol 1994;172:183-187
CrossRef | Web of Science | Medline7
Cutait R ,Alves VAF ,Lopes LC , et al. Restaging of colorectal cancer based on the identification of lymph node micrometastases through immunoperoxidase staining of CEA and cytokeratins. Dis Colon Rectum 1991;34:917-920
CrossRef | Web of Science | Medline8
Adell G ,Boeryd B ,Franlund B ,Sjodahl R ,Hakansson L . Occurrence and prognostic importance of micrometastases in regional lymph nodes in Dukes' B colorectal carcinoma: an immunohistochemical study. Eur J Surg 1996;162:637-642
Medline9
International (Ludwig) Breast Cancer Study Group
Web of Science | Medline10
Passlick B ,Izbicki JR ,Kubuschok B , et al. Immunohistochemical assessment of individual tumor cells in lymph nodes of patients with non-small-cell lung cancer. J Clin Oncol 1994;12:1827-1832
Web of Science | Medline11
Izbicki JR ,Hosch SB ,Pichlmeier U , et al. Prognostic value of immunohistochemically identifiable tumor cells in lymph nodes of patients with completely resected esophageal cancer. N Engl J Med 1997;337:1188-1194
Full Text | Web of Science | Medline12
Shively JE ,Beatty JD . CEA-related antigens: molecular biology and clinical significance. Crit Rev Oncol Hematol 1985;2:355-399
CrossRef | Web of Science | Medline13
Gerhard M ,Juhl H ,Kalthoff H ,Schreiber HW ,Wagener C ,Neumaier M . Specific detection of carcinoembryonic antigen-expressing tumor cells in bone marrow aspirates by polymerase chain reaction. J Clin Oncol 1994;12:725-729
Web of Science | Medline14
Mori M ,Mimori K ,Inoue H , et al. Detection of cancer micrometastases in lymph nodes by reverse transcriptase-polymerase chain reaction. Cancer Res 1995;55:3417-3420
Web of Science | Medline15
Sobin LH, Wittekind C, eds. TNM classification of malignant tumours. 5th ed. New York: Wiley-Liss, 1997.
16
Chomczynski P ,Sacchi N . Single-step method of RNA isolation by acid guanidinium thiocyanate-phenol-chloroform extraction. Anal Biochem 1987;162:156-159
CrossRef | Web of Science | Medline17
Kaplan EL ,Meier P . Nonparametric estimation from incomplete observations. J Am Stat Assoc 1958;53:457-481
CrossRef | Web of Science18
Cox DR . Regression models and life-tables. J R Stat Soc [B] 1972;34:187-22019
Jass JR ,Atkin WS ,Cuzick J , et al. The grading of rectal cancer: historical perspectives and a multivariate analysis of 447 cases. Histopathology 1986;10:437-459
CrossRef | Web of Science | Medline20
Hayashi N ,Arakawa H ,Nagase H , et al. Genetic diagnosis identifies occult lymph node metastases undetectable by the histopathological method. Cancer Res 1994;54:3853-3856
Web of Science | Medline21
Nakamori S ,Kameyama M ,Furukawa H , et al. Genetic detection of colorectal cancer cells in circulation and lymph nodes. Dis Colon Rectum 1997;40:Suppl:S29-S36
CrossRef | Web of Science | Medline22
Brennan JA ,Mao L ,Hruban RH , et al. Molecular assessment of histopathological staging in squamous-cell carcinoma of the head and neck. N Engl J Med 1995;332:429-435
Full Text | Web of Science | Medline23
Hayashi N ,Ito I ,Yanagisawa A , et al. Genetic diagnosis of lymph-node metastasis in colorectal cancer. Lancet 1995;345:1257-1259
CrossRef | Web of Science | Medline24
Smith B ,Selby P ,Southgate J ,Pittman K ,Bradley C ,Blair GE . Detection of melanoma cells in peripheral blood by means of reverse transcriptase and polymerase chain reaction. Lancet 1991;338:1227-1229
CrossRef | Web of Science | Medline25
Schoenfeld A ,Luqmani Y ,Smith D , et al. Detection of breast cancer micrometastases in axillary lymph nodes by using polymerase chain reaction. Cancer Res 1994;54:2986-2990
Web of Science | Medline26
Neumaier M ,Gerhard M ,Wagener C . Diagnosis of micrometastases by the amplification of tissue-specific genes. Gene 1995;159:43-47
CrossRef | Web of Science | Medline27
Gunn J ,McCall JL ,Yun K ,Wright PA . Detection of micrometastases in colorectal cancer patients by K19 and K20 reverse-transcription polymerase chain reaction. Lab Invest 1996;75:611-616
Web of Science | Medline28
Shibata D ,Reale MA ,Lavin P , et al. The DCC protein and prognosis in colorectal cancer. N Engl J Med 1996;335:1727-1732
Full Text | Web of Science | Medline29
Jen J ,Kim H ,Piantadosi S , et al. Allelic loss of chromosome 18q and prognosis in colorectal cancer. N Engl J Med 1994;331:213-221
Full Text | Web of Science | Medline30
Kern SE ,Fearon ER ,Tersmette KWF , et al. Clinical and pathological associations with allelic loss in colorectal carcinoma. JAMA 1989;261:3099-3103[Erratum, JAMA 1989;262:1952.]
CrossRef | Web of Science | Medline
- Citing Articles (217)
Citing Articles
1
Wendy Kelder, Ardalan Ebrahimi, Veronique-Isabelle Forest, Kan Gao, Rajmohan Murali, Jonathan R. Clark. (2012) Cutaneous Head and Neck Squamous Cell Carcinoma with Regional Metastases: The Prognostic Importance of Soft Tissue Metastases and Extranodal Spread. Annals of Surgical Oncology 19:1, 274-279
CrossRef2
Terry Hyslop, David S. Weinberg, Stephanie Schulz, Alan Barkun, Scott A. Waldman. (2012) Analytic lymph node number establishes staging accuracy by occult tumor burden in colorectal cancer. Journal of Surgical Oncologyn/a-n/a
CrossRef3
Scott S. Short, Alexander Stojadinovic, Aviram Nissan, Zev Wainberg, Deepti Dhall, Kathy Yao, Anton Bilchik. (2012) Adjuvant treatment of early colon cancer with micrometastases: Results of a national survey. Journal of Surgical Oncologyn/a-n/a
CrossRef4
Celalettin Camci, Akif Şahin, Alper Sevinc, Mehmet E. Kalender, Serdar Öztuzcu, Özlem N. Sever, Esma Özkara, Abdullah T. Demiryürek. (2011) Peripheral blood guanylyl cyclase c (GCC) expressions are associated with prognostic parameters and response to therapy in colorectal cancer patients. Tumor Biology 32:6, 1265-1270
CrossRef5
Daniel J. Sargent, Murray B. Resnick, Michael O. Meyers, Atoussa Goldar-Najafi, Thomas Clancy, Sharlene Gill, Gary O. Siemons, Qian Shi, Brian M. Bot, Tsung-Teh Wu, Guillaume Beaudry, Jean-François Haince, Yves Fradet. (2011) Evaluation of Guanylyl Cyclase C Lymph Node Status for Colon Cancer Staging and Prognosis. Annals of Surgical Oncology 18:12, 3261-3270
CrossRef6
Wilson I Gonsalves, Swapna Kanuri, Tsewang Tashi, Ibrahim Aldoss, Ashwin Sama, Islam Al-Howaidi, Ashwin Ganta, Mudappa Kalaiah, Ramya Thota, Jairam Krishnamurthy, Xiang Fang, Peter Townley, Apar K. Ganti, Shanmuga Subbiah, Peter T. Silberstein. (2011) Clinicopathologic factors associated with lymph node retrieval in resectable colon cancer: A veterans' affairs central cancer registry (VACCR) database analysis. Journal of Surgical Oncology 104:6, 667-671
CrossRef7
M. Ankersmit, M. H. G. M. van der Pas, D. A. van Dam, W. J. H. J. Meijerink. (2011) Near infrared fluorescence lymphatic laparoscopy of the colon and mesocolon. Colorectal Disease 13, 70-73
CrossRef8
Barresi Valeria, Reggiani Bonetti Luca, Vitarelli Enrica, Di Gregorio Carmela, Ponz de Leon Maurizio, Barresi Gaetano. (2011) Immunohistochemical Assessment of Lymphovascular Invasion in Stage I Colorectal Carcinoma. The American Journal of Surgical Pathology1
CrossRef9
Boukje Koebrugge, Koop Bosscha, Gerrit-Jan Liefers, Daan J Lips, Cornelis van de Velde. (2011) Can micrometastases be used to predict colon cancer prognosis? Hopes for the EnRoute+ study. Expert Review of Gastroenterology & Hepatology 5:5, 559-561
CrossRef10
Tao Liu, Chao Zhang, PeiWu Yu, Jun Chen, Dongzhu Zeng, Lu Gan, Wei Lv, LiYe Liu, Xiaochu Yan. (2011) Laparoscopic Radical Correction Combined With Extensive Lymphadenectomy and Pelvic Autonomic Nerve Preservation for Mid-to-Low Rectal Cancer. Clinical Colorectal Cancer 10:3, 183-187
CrossRef11
S. M. Retter, G. Herrmann, T. H. K. Schiedeck. (2011) Clinical value of sentinel node mapping in carcinoma of the colon. Colorectal Disease 13:8, 855-859
CrossRef12
Jacek Zielinski, Radoslaw Jaworski, Pawel Kabata, Robert Rzepko, Wiesław Janusz Kruszewski, Janusz Jaskiewicz. (2011) Sentinel lymph node in colorectal cancer — 5 years follow up. Central European Journal of Medicine 6:3, 271-278
CrossRef13
Martijn HGM van der Pas, Sybren Meijer, Otto S Hoekstra, Ingid I Riphagen, Henrica CW de Vet, Dirk L Knol, Nicole CT van Grieken, Wilhelmus JHJ Meijerink. (2011) Sentinel-lymph-node procedure in colon and rectal cancer: a systematic review and meta-analysis. The Lancet Oncology 12:6, 540-550
CrossRef14
Saad Sirop, Mohammed Kanaan, Alpesh Korant, David Wiese, David Eilender, Sunil Nagpal, Madan Arora, Trevor Singh, Sukamal Saha. (2011) Detection and prognostic impact of micrometastasis in colorectal cancer. Journal of Surgical Oncology 103:6, 534-537
CrossRef15
Merlijn Hutteman, Hak Soo Choi, J. Sven D. Mieog, Joost R. Vorst, Yoshitomo Ashitate, Peter J. K. Kuppen, Marian C. Groningen, Clemens W. G. M. Löwik, Vincent T. H. B. M. Smit, Cornelis J. H. Velde, John V. Frangioni, Alexander L. Vahrmeijer. (2011) Clinical Translation of Ex Vivo Sentinel Lymph Node Mapping for Colorectal Cancer Using Invisible Near-Infrared Fluorescence Light. Annals of Surgical Oncology 18:4, 1006-1014
CrossRef16
Yung-Sung Yeh, Hwei-Ming Wang, Shiu-Ru Lin, Jaw-Yuan Wang. (2011) Prognostic and Molecular Factors in Stage II Colorectal Cancer. Genomic Medicine, Biomarkers, and Health Sciences 3:1, 2-8
CrossRef17
Arne E. Faerden, Ole H. Sjo, Ida R. K. Bukholm, Solveig Norheim Andersen, Aud Svindland, Arild Nesbakken, Arne Bakka. (2011) Lymph Node Micrometastases and Isolated Tumor Cells Influence Survival in Stage I and II Colon Cancer. Diseases of the Colon & Rectum 54:2, 200-206
CrossRef18
Tai Young Oh, Sun Mi Moon, Ui Sup Shin, Hyang Ran Lee, Sun Hoo Park. (2011) Impact on Prognosis of Lymph Node Micrometastasis and Isolated Tumor Cells in Stage II Colorectal Cancer. Journal of the Korean Society of Coloproctology 27:2, 71
CrossRef19
Terry Hyslop, David S. Weinberg, Stephanie Schulz, Alan Barkun, Scott A. Waldman. (2011) Occult tumor burden contributes to racial disparities in stage-specific colorectal cancer outcomes. Cancern/a-n/a
CrossRef20
Fania S. Doekhie, Wilma E. Mesker, Peter J. Kuppen, Gijs A. van Leeuwen, Hans Morreau, Geertruida H. de Bock, Hein Putter, Hans J. Tanke, Cornelis J. van de Velde, Rob A. Tollenaar. (2010) Detailed examination of lymph nodes improves prognostication in colorectal cancer. International Journal of CancerNA-NA
CrossRef21
S. Partelli, S. Mukherjee, K. Mawire, R.R. Hutchins, A.T. Abraham, S. Bhattacharya, H.M. Kocher. (2010) Larger hepatic metastases are more frequent with N0 colorectal tumours and are associated with poor prognosis: Implications for surveillance. International Journal of Surgery 8:6, 453-457
CrossRef22
Alex Mejia, Stephanie Schulz, Terry Hyslop, David S Weinberg, Scott A Waldman. (2009) GUCY2C reverse transcriptase PCR to stage pN0 colorectal cancer patients. Expert Review of Molecular Diagnostics 9:8, 777-785
CrossRef23
Steven J. Hughes, Liqiang Xi, William E. Gooding, David J. Cole, Michael Mitas, John Metcalf, Rohit Bhargava, David Dabbs, Jesus Ching, Lynn Kozma, William McMillan, Tony E. Godfrey. (2009) A Quantitative Reverse Transcription-PCR Assay for Rapid, Automated Analysis of Breast Cancer Sentinel Lymph Nodes. The Journal of Molecular Diagnostics 11:6, 576-582
CrossRef24
Trevor M. Yeung, Neil J. Mortensen. (2009) Colorectal Cancer Stem Cells. Diseases of the Colon & Rectum 52:10, 1788-1796
CrossRef25
Qi Wang, Zhi-Guo Chen, Chang-Zheng Du, Hong-Wei Wang, Li Yan, Jin Gu. (2009) Cancer stem cell marker CD133+ tumour cells and clinical outcome in rectal cancer. Histopathology 55:3, 284-293
CrossRef26
Ronan A. Cahill, Andreas Bembenek, Saad Sirop, Deirdre F. Waterhouse, Wolfgang Schneider, Joel Leroy, David Wiese, Thomas Beutler, Anton Bilchik, Sukamal Saha, Peter M. Schlag. (2009) Sentinel Node Biopsy for the Individualization of Surgical Strategy for Cure of Early-Stage Colon Cancer. Annals of Surgical Oncology 16:8, 2170-2180
CrossRef27
Anthony G Douglas-Jones, Victoria Woods. (2009) Molecular assessment of sentinel lymph node in breast cancer management. Histopathology 55:1, 107-113
CrossRef28
Young-Wan Kim, Nam-Kyu Kim, Byung-Soh Min, Kang-Young Lee, Seung-Kook Sohn, Chang-Hwan Cho, Hoguen Kim, Ki-Chang Keum, Jung-Bai Ahn. (2009) The prognostic impact of the number of lymph nodes retrieved after neoadjuvant chemoradiotherapy with mesorectal excision for rectal cancer. Journal of Surgical Oncology 100:1, 1-7
CrossRef29
Alejandro Martínez-Fernandez, Xabier García-Albeniz, Estela Pineda, Laura Visa, Rosa Gallego, Jordi Codony-Servat, Josep Maria Augé, Raquel Longarón, Pere Gascón, Antonio Lacy, Antoni Castells, Joan Maurel. (2009) Serum Matrilysin Levels Predict Outcome in Curatively Resected Colorectal Cancer Patients. Annals of Surgical Oncology 16:5, 1412-1420
CrossRef30
P.M. van Schaik, E. Hermans, J.C. van der Linden, J.R.M. Pruijt, M.F. Ernst, K. Bosscha. (2009) Micro-metastases in stages I and II colon cancer are a predictor of the development of distant metastases and worse disease-free survival. European Journal of Surgical Oncology (EJSO) 35:5, 492-496
CrossRef31
Wendy Kelder, Bas Inberg, Michael Schaapveld, Arend Karrenbeld, Joris Grond, Theo Wiggers, John T. Plukker. (2009) Impact of the Number of Histologically Examined Lymph Nodes on Prognosis in Colon Cancer. Diseases of the Colon & Rectum 52:2, 260-267
CrossRef32
J Harder, V Engelstaedter, H Usadel, S Lassmann, M Werner, P Baier, F Otto, M Varbanova, E Schaeffner, M Olschewski, H E Blum, O G Opitz. (2009) CpG-island methylation of the ER promoter in colorectal cancer: analysis of micrometastases in lymph nodes from UICC stage I and II patients. British Journal of Cancer 100:2, 360-365
CrossRef33
Peter Scheunemann, Nikolas H. Stoecklein, Kai Hermann, Alexander Rehders, Claus F. Eisenberger, Wolfram T. Knoefel, Stefan B. Hosch. (2009) Occult disseminated tumor cells in lymph nodes of patients with gastric carcinoma. A critical appraisal of assessment and relevance. Langenbeck's Archives of Surgery 394:1, 105-113
CrossRef34
Ahud Sternberg. (2008) Carcinoma of the colon: Margins of resection. Journal of Surgical Oncology 98:8, 603-606
CrossRef35
Jan Franko, Steven A. Fassler, Masoud Rezvani, Brendan G. O’Connell, Steven G. Harper, Joseph H. Nejman, D. Mark Zebley. (2008) Conversion of laparoscopic colon resection does not affect survival in colon cancer. Surgical Endoscopy 22:12, 2631-2634
CrossRef36
Carlos E. Bosch Roig, Ester Roselló-Sastre, Sonia Alonso Hernández, Daniel Almenar Cubells, Enrique Grau Cardona, Natalia Camarasa Lillo, Daniel Bautista, Carmen Molins Palau. (2008) Prognostic value of the detection of lymph node micrometastases in colon cancer. Clinical and Translational Oncology 10:9, 572-578
CrossRef37
Alex Mejia, Scott A Waldman. (2008) Previstage™ GCC test for staging patients with colorectal cancer. Expert Review of Molecular Diagnostics 8:5, 571-578
CrossRef38
Y DELPECH, C COUTANT, E DARAI, E BARRANGER. (2008) Sentinel lymph node evaluation in endometrial cancer and the importance of micrometastases. Surgical Oncology 17:3, 237-245
CrossRef39
Yih-Huei Uen, Chien-Yu Lu, Hsiang-Lin Tsai, Fang-Jung Yu, Ming-Yii Huang, Tian-Lu Cheng, Shiu-Ru Lin, Jaw-Yuan Wang. (2008) Persistent Presence of Postoperative Circulating Tumor Cells is a Poor Prognostic Factor for Patients with Stage I–III Colorectal Cancer after Curative Resection. Annals of Surgical Oncology 15:8, 2120-2128
CrossRef40
Yuqiu Jiang, Graham Casey, Ian C. Lavery, Yi Zhang, Dmitri Talantov, Michelle Martin-McGreevy, Marek Skacel, Elena Manilich, Abhijit Mazumder, David Atkins, Conor P. Delaney, Yixin Wang. (2008) Development of a Clinically Feasible Molecular Assay to Predict Recurrence of Stage II Colon Cancer. The Journal of Molecular Diagnostics 10:4, 346-354
CrossRef41
Peter Scheunemann, Nikolas H. Stoecklein, Alexander Rehders, Minu Bidde, Sylvia Metz, Matthias Peiper, Claus F. Eisenberger, Jan Schulte am Esch, Wolfram T. Knoefel, Stefan B. Hosch. (2008) Occult tumor cells in lymph nodes as a predictor for tumor relapse in pancreatic adenocarcinoma. Langenbeck's Archives of Surgery 393:3, 359-365
CrossRef42
W. Kelder, B. Inberg, J.T.M. Plukker, H. Groen, P.C. Baas, A.T.M.G. Tiebosch. (2008) Effect of modified Davidson's fixative on examined number of lymph nodes and TNM-stage in colon carcinoma. European Journal of Surgical Oncology (EJSO) 34:5, 525-530
CrossRef43
Takeshi Toyoshima, Eleftherios Vairaktaris, Emeka Nkenke, Karl Andreas Schlegel, Friedrich Wilhelm Neukam, Jutta Ries. (2008) Cytokeratin 17 mRNA expression has potential for diagnostic marker of oral squamous cell carcinoma. Journal of Cancer Research and Clinical Oncology 134:4, 515-521
CrossRef44
J. Wind, F.J.W. ten Kate, J.J.S. Kiewiet, S.M. Lagarde, J.F.M. Slors, J.J.B. van Lanschot, W.A. Bemelman. (2008) The prognostic significance of extracapsular lymph node involvement in node positive patients with colonic cancer. European Journal of Surgical Oncology (EJSO) 34:4, 390-396
CrossRef45
Hiroya Takeuchi, Masaki Kitajima, Yuko Kitagawa. (2008) Sentinel lymph node as a target of molecular diagnosis of lymphatic micrometastasis and local immunoresponse to malignant cells. Cancer Science 99:3, 441-450
CrossRef46
Sun Jin Park, Kil Yeon Lee, Si Young Kim. (2008) Clinical Significance of Lymph Node Micrometastasis in Stage I and II Colon Cancer. Cancer Research and Treatment 40:2, 75
CrossRef47
Sushil Rekhraj, Omer Aziz, Shirish Prabhudesai, Emmanouil Zacharakis, Franziska Mohr, Thanos Athanasiou, Ara Darzi, Paul Ziprin. (2008) Can intra-operative intraperitoneal free cancer cell detection techniques identify patients at higher recurrence risk following curative colorectal cancer resection: a meta-analysis. Annals of Surgical Oncology 15:1, 60-68
CrossRef48
Hyung Jin Kim, In Kyu Lee, Yoon Suk Lee, Won Kyung Kang, Chang Hyeok Ahn, Seong Taek Oh. (2008) Ex-vivo Sentinel Lymph-node Mapping in Colorectal Cancer. Journal of the Korean Society of Coloproctology 24:1, 39
CrossRef49
Douglas Iddings, Anton Bilchik. (2007) The biologic significance of micrometastatic disease and sentinel lymph node technology on colorectal cancer. Journal of Surgical Oncology 96:8, 671-677
CrossRef50
Jan Friederichs, Ralf Gertler, Robert Rosenberg, Michael Dahm, Hjalmar Nekarda, Bernhard Holzmann, Jörg Rüdiger Siewert. (2007) Correlation of CK-20-Positive Cells in Peripheral Venous Blood with Serum CEA Levels in Patients with Colorectal Carcinoma. World Journal of Surgery 31:12, 2329-2334
CrossRef51
Daniel G. Nicastri, John T. Doucette, Tony E. Godfrey, Steven J. Hughes. (2007) Is Occult Lymph Node Disease in Colorectal Cancer Patients Clinically Significant?. The Journal of Molecular Diagnostics 9:5, 563-571
CrossRef52
Sergio Sandrucci, Baudolino Mussa, Matteo Goss, Massimiliano Mistrangelo, Maria Antonietta Satolli, Anna Sapino, Marilena Bellò, Gianni Bisi, Antonio Mussa. (2007) Lymphoscintigraphic localization of sentinel node in early colorectal cancer: Results of a monocentric study. Journal of Surgical Oncology 96:6, 464-469
CrossRef53
Jussuf T Kaifi, Uta Reichelt, Alexander Quaas, Paulus G Schurr, Robin Wachowiak, Emre F Yekebas, Tim Strate, Claus Schneider, Klaus Pantel, Melitta Schachner, Guido Sauter, Jakob R Izbicki. (2007) L1 is associated with micrometastatic spread and poor outcome in colorectal cancer. Modern Pathology 20:11, 1183-1190
CrossRef54
Wendy Kelder, Andries E. Braat, Arend Karrenbeld, Joris A. K. Grond, Johannes E. Vries, J. Wolter A. Oosterhuis, Peter C. Baas, John T. M. Plukker. (2007) The sentinel node procedure in colon carcinoma: a multi-centre study in The Netherlands. International Journal of Colorectal Disease 22:12, 1509-1514
CrossRef55
Anton J. Bilchik, Dave S. B. Hoon, Sukamal Saha, Roderick R. Turner, David Wiese, Maggie DiNome, Kazuo Koyanagi, Martin McCarter, Perry Shen, Douglas Iddings, Steven L. Chen, Maria Gonzalez, David Elashoff, Donald L. Morton. (2007) Prognostic Impact of Micrometastases in Colon Cancer. Annals of Surgery 246:4, 568-577
CrossRef56
M. Schenck, F. Dorp, C. Boergermann, Y. Busch, A. Carpinteiro, B. Wilker, S. Keitsch, K.W. Schmid, M. Groneberg, M. Stuschke, H. Ruebben, E. Gulbins. (2007) Gründung einer Arbeitsgruppe „Lymphknotenmetastasierung“ am Westdeutschen Tumorzentrum (WTZE), Universitätsklinikum Essen. Der Urologe 46:9, 1257-1260
CrossRef57
Claudia Hriesik, Ramesh K. Ramanathan, Steven J. Hughes. (2007) Update for Surgeons: Recent and Noteworthy Changes in Therapeutic Regimens for Cancer of the Colon and Rectum. Journal of the American College of Surgeons 205:3, 468-478.e1
CrossRef58
Paolo Pietro Bianchi, Chiara Ceriani, Matteo Rottoli, Guido Torzilli, Massimo Roncalli, Antonino Spinelli, Marco Montorsi. (2007) Laparoscopic lymphatic mapping and sentinel lymph node detection in colon cancer: technical aspects and preliminary results. Surgical Endoscopy 21:9, 1567-1571
CrossRef59
Erkki Lotspeich, Markus Schoene, Heinz Gerngroß, Roland Schmidt, Reinhard Steinmann, Marco Ramadani, Susanne Gansauge. (2007) Detection of disseminated tumor cells in the lymph nodes of colorectal cancer patients using a real-time polymerase chain reaction assay. Langenbeck's Archives of Surgery 392:5, 559-566
CrossRef60
A.W. Wu, J. Gu, J. Wang, S.W. Ye, Q. An, Y.F. Yao, T.C. Zhan. (2007) Results after change of treatment policy for rectal cancer – report from a single hospital in China. European Journal of Surgical Oncology (EJSO) 33:6, 718-723
CrossRef61
Charles Coutant, Olivier Morel, Yann Delpech, Serge Uzan, Emile Daraï, Emmanuel Barranger. (2007) Laparoscopic Sentinel Node Biopsy in Cervical Cancer Using a Combined Detection: 5–Years Experience. Annals of Surgical Oncology 14:8, 2392-2399
CrossRef62
Paul M. van Schaik, Ewout A. Kouwenhoven, Robert J. Bolhuis, Bonne Biesma, Koop Bosscha. (2007) Pulmonary Resection for Metastases from Colorectal Cancer. Journal of Thoracic Oncology 2:7, 652-656
CrossRef63
Alexander Stojadinovic, Aviram Nissan, Mladjan Protic, Carol F. Adair, Diana Prus, Slavica Usaj, Robin S. Howard, Dragan Radovanovic, Milan Breberina, Craig D. Shriver, Ronit Grinbaum, Jeffery M. Nelson, Tommy A. Brown, Herbert R. Freund, John F. Potter, Tamar Peretz, George E. Peoples. (2007) Prospective Randomized Study Comparing Sentinel Lymph Node Evaluation With Standard Pathologic Evaluation for the Staging of Colon Carcinoma. Annals of Surgery 245:6, 846-857
CrossRef64
C. Wang, Z.-G. Zhou, Y.-Y. Yu, Y. Li, W.-Z. Lei, Z. Cheng, Z.-X. Chen. (2007) Patterns of lateral pelvic lymph node metastases and micrometastases for patients with lower rectal cancer. European Journal of Surgical Oncology (EJSO) 33:4, 463-467
CrossRef65
Young Min Kim, Jae Hee Suh, Hee Jeong Cha, Se J. Jang, Mi-Jung Kim, Sunoch Yoon, Baekhui Kim, Heejin Chang, Youngmee Kwon, Eun Kyung Hong, Jae Y. Ro. (2007) Additional lymph node examination from entire submission of residual mesenteric tissue in colorectal cancer specimens may not add clinical and pathologic relevance. Human Pathology 38:5, 762-767
CrossRef66
Robbert J. Haas, Dennis A. Wicherts, Monique G. G. Hobbelink, Inne H. M. Borel Rinkes, Marguerite E. I. Schipper, Joke-Afke Zee, Richard Hillegersberg. (2007) Sentinel Lymph Node Mapping in Colon Cancer: Current Status. Annals of Surgical Oncology 14:3, 1070-1080
CrossRef67
Anton J. Bilchik. (2007) Current and emerging trends in the treatment of early-stage colorectal cancer: importance of a multidisciplinary approach. Hematology/Oncology Clinics of North America 21, 8-18
CrossRef68
S. Gretschel, A. Bembenek, T. Schulze, W. Kemmner, P. M. Schlag. (2006) Minimalresiduale Tumorerkrankung bei gastrointestinalen Karzinomen. Der Chirurg 77:12, 1104-1117
CrossRef69
Hideaki Yano, Yukio Saito, Yujiro Kirihara, Junya Takashima. (2006) Tumor Invasion of Lymph Node Capsules in Patients with Dukes C Colorectal Adenocarcinoma. Diseases of the Colon & Rectum 49:12, 1867-1877
CrossRef70
Khaled M. Madbouly, Anthony J. Senagore, Abir Mukerjee, Conor P. Delaney, Jason Connor, Victor W. Fazio. (2006) Does immunostaining effectively upstage colorectal cancer by identifying micrometastatic nodal disease?. International Journal of Colorectal Disease 22:1, 39-48
CrossRef71
Douglas Iddings, Aziz Ahmad, David Elashoff, Anton Bilchik. (2006) The Prognostic Effect of Micrometastases in Previously Staged Lymph Node Negative (N0) Colorectal Carcinoma: A Meta-analysis. Annals of Surgical Oncology 13:11, 1386-1392
CrossRef72
Kunitomo Miyake, Akiyoshi Seshimo, Shingo Kameoka. (2006) Assessment of lymph node micrometastasis in early gastric cancer in relation to sentinel nodes. Gastric Cancer 9:3, 197-202
CrossRef73
Wendy Kelder, Geke A P Hospers, John T M Plukker. (2006) Effects of 5-fluorouracil adjuvant treatment of colon cancer. Expert Review of Anticancer Therapy 6:5, 785-794
CrossRef74
Stefan Thorban, Robert Rosenberg, Matthias Maak, Jan Friederichs, Ralf Gertler, Jörg-Rüdiger Siewert. (2006) Impact of disseminated tumor cells in gastrointestinal cancer. Expert Review of Molecular Diagnostics 6:3, 333-343
CrossRef75
Jenni Smith, Hamish Hwang, Kevin W. Wiseman, Douglas Filipenko, P. Terry Phang. (2006) Ex vivo sentinel lymph node mapping in colon cancer: improving the accuracy of pathologic staging?. The American Journal of Surgery 191:5, 665-668
CrossRef76
F.S. Doekhie, P.J.K. Kuppen, K.C.M.J. Peeters, W.E. Mesker, R.A. van Soest, H. Morreau, C.J.H. van de Velde, H.J. Tanke, R.A.E.M. Tollenaar. (2006) Prognostic relevance of occult tumour cells in lymph nodes in colorectal cancer. European Journal of Surgical Oncology (EJSO) 32:3, 253-258
CrossRef77
Richard Douard, Philippe Wind, Jean-Patrick Sales, Bruno Landi, Anne Berger, Joseph Benichou, François Gayral, Sylvain Loric, Paul-Henri Cugnenc. (2006) Long-term prognostic value of detection of circulating colorectal cancer cells using CGM2 reverse transcriptase-polymerase chain reaction assay. Surgery 139:4, 556-562
CrossRef78
Stephen A. Bustin, Reinhold Mueller. (2006) Real-time reverse transcription PCR and the detection of occult disease in colorectal cancer. Molecular Aspects of Medicine 27:2-3, 192-223
CrossRef79
Steven J. Hughes, Liqiang Xi, Siva Raja, William Gooding, David J. Cole, William E. Gillanders, Keidi Mikhitarian, Kenneth McCarty, Susan Silver, Jesus Ching, William McMillan, James D. Luketich, Tony E. Godfrey. (2006) A Rapid, Fully Automated, Molecular-Based Assay Accurately Analyzes Sentinel Lymph Nodes for the Presence of Metastatic Breast Cancer. Annals of Surgery 243:3, 389-398
CrossRef80
G. Kesava Reddy, Carlos Becerra, Edward Chu. (2006) Prognostic Significance of Increasing Lymph Node Count in Stage III Colorectal Cancer. Clinical Colorectal Cancer 5:6, 403-404
CrossRef81
Carsten T. Viehl, Ulrich Guller, Christian T. Hamel, Hans-Martin Riehle, Christian Plaass, Walter R. Marti, Daniel Oertli, Markus Zuber. (2006) Carbon Dye Staining of Sentinel Lymph Nodes Facilitates Microstaging of Colon Cancer Patients. World Journal of Surgery 30:3, 453-456
CrossRef82
Giuliana Giribaldi, Simone Procida, Daniela Ulliers, Franca Mannu, Roberta Volpatto, Giorgia Mandili, Laura Fanchini, Oscar Bertetto, Gianruggero Fronda, Luigi Simula, Elena Rimini, Giovanni Cherchi, Lisa Bonello, Milena Maria Maule, Francesco Turrini. (2006) Specific Detection of Cytokeratin 20-Positive Cells in Blood of Colorectal and Breast Cancer Patients by a High Sensitivity Real-Time Reverse Transcriptase-Polymerase Chain Reaction Method. The Journal of Molecular Diagnostics 8:1, 105-112
CrossRef83
Mike S.L. Liem, Omgo E. Nieweg, Gerrit-Jan Liefers. (2006) Commentary. Journal of Surgical Oncology 93:1, 18-19
CrossRef84
Sonja Kappel, Daniela Kandioler, Rudolf Steininger, Friedrich L??ngle, Friedrich Wrba, Martin Ploder, Gabriela Berlakovich, Thomas Soliman, Hubert Hetz, Susanne Rockenschaub, Erich Roth, Ferdinand M??hlbacher. (2006) Genetic Detection of Lymph Node Micrometastases: A Selection Criterion for Liver Transplantation in Patients with Liver Metastases after Colorectal Cancer. Transplantation 81:1, 64-70
CrossRef85
Min Ro Lee, Chang Won Hong, Sang Nam Yoon, Seok-Byung Lim, Kyu Joo Park, Min Jin Lee, Woo Ho Kim, Jae-Gahb Park. (2006) Isolated tumor cells in lymph nodes are not a prognostic marker for patients with stage I and stage II colorectal cancer. Journal of Surgical Oncology 93:1, 13-18
CrossRef86
Sotaro Sadahiro, Toshiyuki Suzuki, Kenji Ishikawa, Takeshi Saguchi, Yuji Maeda, Seiei Yasuda, Hiroyasu Makuuchi, Satoshi Yurimoto, Chieko Murayama. (2005) Detection of Carcinoembryonic Antigen Messenger RNA–Expressing Cells in Portal and Peripheral Blood During Surgery Does Not Influence Relapse in Colorectal Cancer. Annals of Surgical Oncology 12:12, 988-994
CrossRef87
A. E. Braat, J. W. A. Oosterhuis, F. C. P. Moll, J. E. de Vries, T. Wiggers. (2005) Sentinel node detection after preoperative short-course radiotherapy in rectal carcinoma is not reliable. British Journal of Surgery 92:12, 1533-1538
CrossRef88
Satyajit Bhattacharya, Ronald Ghossein, Hikmat Al-Ahmadie. 2005. Molecular Detection and Characterization of Circulating Tumor Cells and Micrometastases in Solid Tumors. , 203-228.
CrossRef89
Pavel Hlad??k, Jaroslav Vizd??a, Dimitar Hadzi Nikolov, Josef Dvo????k, Zbyn??k Vobo??il. (2005) Radio-guided sentinel node detection during the surgical treatment of rectal cancer. Nuclear Medicine Communications 26:11, 977-982
CrossRef90
Fabian Wolfrum, Ilka Vogel, Fred Fändrich, Holger Kalthoff. (2005) Detection and clinical implications of minimal residual disease in gastro-intestinal cancer. Langenbeck's Archives of Surgery 390:5, 430-441
CrossRef91
Glen S Frick, Giovanni M Pitari, David S Weinberg, Terry Hyslop, Stephanie Schulz, Scott A Waldman. (2005) Guanylyl cyclase C: a molecular marker for staging and postoperative surveillance of patients with colorectal cancer. Expert Review of Molecular Diagnostics 5:5, 701-713
CrossRef92
Rodrigo Oliva Perez, Angelita Habr-Gama, Sidney Tomyo Nishida Arazawa, Viviane Rawet, Sheila Aparecida Coelho Siqueira, Desidério Roberto Kiss, Joaquim José Gama-Rodrigues. (2005) Lymph node micrometastasis in stage II distal rectal cancer following neoadjuvant chemoradiation therapy. International Journal of Colorectal Disease 20:5, 434-439
CrossRef93
C. S. McArdle, R. F. McKee, I. G. Finlay, H. Wotherspoon, D. J. Hole. (2005) Improvement in survival following surgery for colorectal cancer. British Journal of Surgery 92:8, 1008-1013
CrossRef94
Alexander Stojadinovic, Peter J. Allen, Mladjan Protic, John F. Potter, Craig D. Shriver, Jeffrey M. Nelson, George E. Peoples. (2005) Colon Sentinel Lymph Node Mapping: Practical Surgical Applications. Journal of the American College of Surgeons 201:2, 297-313
CrossRef95
S.R. Martinez, A.J. Bilchik. (2005) Quality control issues in the management of colon cancer patients. European Journal of Surgical Oncology (EJSO) 31:6, 616-629
CrossRef96
Salvatore Pasquale Prete, Lorena Rossi, Pier Paolo Correale, Mario Turriziani, Susanne Baier, Giuliana Tamburrelli, Liana De Vecchis, Enzo Bonmassar, Angelo Aquino. (2005) Combined effects of protein kinase inhibitors and 5-fluorouracil on CEA expression in human colon cancer cells. Pharmacological Research 52:2, 167-173
CrossRef97
J.H.J.M. van Krieken, I.D. Nagtegaal. (2005) Pathological quality assurance in gastro-intestinal cancer. European Journal of Surgical Oncology (EJSO) 31:6, 675-680
CrossRef98
L. Pomorski, Krzysztof Kaczka, S. Piaskowski, I. Wójcik, P. Rieske, M. Matejkowska, K. Kuzdak. (2005) Detection of lymph node metastases of papillary thyroid cancer—comparison of the results of histopathology, immunohistochemistry and reverse transcription-polymerase chain reaction—a preliminary report. Langenbeck's Archives of Surgery 390:3, 209-215
CrossRef99
Myung-Jin Kim, Koo-Young Lim, Jong-Won Kim, Il-Woo Nam, Jong-Ho Lee, Hoon Myoung. (2005) Stage and mRNA expression of survivin in lymph node as prognostic indicators in patients with oral squamous cell carcinoma. Cancer Letters 224:2, 253-261
CrossRef100
Pierangelo Marchiolè, Annie Buénerd, Mehdi Benchaib, Karima Nezhat, Daniel Dargent, Patrice Mathevet. (2005) Clinical significance of lympho vascular space involvement and lymph node micrometastases in early-stage cervical cancer: A retrospective case-control surgico-pathological study. Gynecologic Oncology 97:3, 727-732
CrossRef101
Fraser McLean Smith, John Calvin Coffey, Nurul Mod Khasri, Miriam Fiona Walsh, Nollaig Parfrey, Eoin Gaffney, Richard Stephens, M. John Kennedy, William Kirwan, H. Paul Redmond. (2005) Sentinel Nodes Are Identifiable in Formalin-Fixed Specimens After Surgeon-Performed Ex Vivo Sentinel Lymph Node Mapping in Colorectal Cancer. Annals of Surgical Oncology 12:6, 504-509
CrossRef102
M. Schenck, G. Lümmen, M. Stuschke, K. W. Schmid, H. Rübben. (2005) Prinzipielle Probleme der Lymphknotenchirurgie. Der Urologe, Ausgabe A 44:6, 605-607
CrossRef103
K. Dahl, J. Westlin, W. Kraaz, O. Winqvist, L. Bergkvist, M. Thörn. (2005) Identification of sentinel nodes in patients with colon cancer. European Journal of Surgical Oncology (EJSO) 31:4, 381-385
CrossRef104
Jan Friederichs, Ralf Gertler, Robert Rosenberg, Jörg Nahrig, Katrin Führer, Bernhard Holzmann, Hans-Joachim Dittler, Michael Dahm, Stefan Thorban, Hjalmar Nekarda, Jörg Rüdiger Siewer. (2005) Prognostic Impact of CK-20-positive Cells in Peripheral Venous Blood of Patients with Gastrointestinal Carcinoma. World Journal of Surgery 29:4, 422-428
CrossRef105
Michael Fulmes, Sebouh Setrakian, Prasanta K. Raj, Brent M. Bogard. (2005) Cancer biology and necrotic changes in metastatic lymph nodes and survival of colon cancer patients. The American Journal of Surgery 189:3, 364-368
CrossRef106
Jae Hong Seo, Chul Won Choi, Byung Soo Kim, Sang Won Shin, Yeul Hong Kim, Jae Sun Kim, Sang Woo Lee, Jae Hyun Choi, Yung Tae Park, Young Jae Mok, Chong Suk Kim, Jun Suk Kim. (2005) Follow-up Study of Peripheral Blood Carcinoembryonic Antigen mRNA Using Reverse Transcription???Polymerase Chain Reaction as an Early Marker of Clinical Recurrence in Patients With Curatively Resected Gastric Cancer. American Journal of Clinical Oncology 28:1, 24-29
CrossRef107
Ruth Birbe, Juan P. Palazzo, Rhonda Walters, David Weinberg, Stephanie Schulz, Scott A. Waldman. (2005) Guanylyl cyclase C is a marker of intestinal metaplasia, dysplasia, and adenocarcinoma of the gastrointestinal tract. Human Pathology 36:2, 170-179
CrossRef108
S.J. Oosterling, G.J. van der Bij, M. van Egmond, J.R.M. van der Sijp. (2005) Surgical trauma and peritoneal recurrence of colorectal carcinoma. European Journal of Surgical Oncology (EJSO) 31:1, 29-37
CrossRef109
So Yeon Park, Gheeyoung Choe, Hye Seung Lee, Seung-Young Jung, Jae-Gahb Park, Woo Ho Kim. (2005) Tumor Budding as an Indicator of Isolated Tumor Cells in Lymph Nodes From Patients With Node-Negative Colorectal Cancer. Diseases of the Colon & Rectum 48:2, 292-302
CrossRef110
A. E. Braat, J. W. A. Oosterhuis, J. E. de Vries, R. A. E. M. Tollenaar. (2005) Lymphatic Staging in Colorectal Cancer: Pathologic, Molecular, and Sentinel Node Techniques. Diseases of the Colon & Rectum 48:2, 371-383
CrossRef111
M.E. de Noo, G.J. Liefers, R.A.E.M. Tollenaar. (2005) Translational Research in Prognostic Profiling in Colorectal Cancer. Digestive Surgery 22:4, 276-281
CrossRef112
A. Bembenek, U. Schneider, S. Gretschel, C. Ulmer, P. M. Schlag. (2005) Optimierung des Staging beim Kolonkarzinom durch Sentinel-Lymphknoten-Biopsie. Der Chirurg 76:1, 58-67
CrossRef113
Thomas E. Read, James W. Fleshman, Philip F. Caushaj. (2005) Sentinel Lymph Node Mapping for Adenocarcinoma of the Colon Does Not Improve Staging Accuracy. Diseases of the Colon & Rectum 48:1, 80-85
CrossRef114
J.-J. Tuech, P. Pessaux, N. Regenet, R. Bergamaschi, A. Colson. (2004) Sentinel lymph node mapping in colon cancer. Surgical Endoscopy 18:12, 1721-1729
CrossRef115
Hiromichi Sonoda, Kazuo Yamamoto, Ryoji Kushima, Hidetoshi Okabe, Tohru Tani. (2004) Detection of lymph node micrometastasis in gastric cancer by MUC2 RT-PCR: Usefulness in pT1 cases. Journal of Surgical Oncology 88:2, 63-70
CrossRef116
T. Schulze, A. Bembenek, P. M. Schlag. (2004) Sentinel lymph node biopsy progress in surgical treatment of cancer. Langenbeck's Archives of Surgery 389:6, 532-550
CrossRef117
Umberto Cillo, Filippo Navaglia, Alessandro Vitale, Alfiero Molari, Daniela Basso, Marco Bassanello, Alberto Brolese, Giacomo Zanus, Umberto Montin, Francesco D'Amico, Francesco Antonio Ciarleglio, Amedeo Carraro, Alessio Bridda, Patrizia Burra, Paolo Carraro, Mario Plebani, Davide Francesco D'Amico. (2004) Clinical significance of alpha-fetoprotein mRNA in blood of patients with hepatocellular carcinoma. Clinica Chimica Acta 347:1-2, 129-138
CrossRef118
ke N.V.
CrossRef119
Takaaki Ishii, Yoshiyuki Fujiwara, Satoru Ohnaka, Toshinori Hayashi, Hirokazu Taniguchi, Shuji Takiguchi, Takushi Yasuda, Masahiko Yano, Morito Monden. (2004) Rapid Genetic Diagnosis With the Transcription?Reverse Transcription Concerted Reaction System for Cancer Micrometastasis. Annals of Surgical Oncology 11:8, 778-785
CrossRef120
A.E Braat, J.W.A Oosterhuis, F.C.P Moll, J.E de Vries. (2004) Successful sentinel node identification in colon carcinoma using Patent Blue V. European Journal of Surgical Oncology (EJSO) 30:6, 633-637
CrossRef121
Jan H. Wong, D.Scott Johnson, Thomas Namiki, Pamela Tauchi-Nishi. (2004) Validation of Ex Vivo Lymphatic Mapping in Hematoxylin-Eosin Node-Negative Carcinoma of the Colon and Rectum. Annals of Surgical Oncology 11:8, 772-777
CrossRef122
Sukamal Saha, Adrian G Dan, Thomas Beutler, David Wiese, Elie Schochet, Julio Badin, Timothy Branigan, Peter Ng, Nader Bassily, Doina David. (2004) Sentinel lymph node mapping technique in colon cancer. Seminars in Oncology 31:3, 374-381
CrossRef123
L. F. Onate-Ocana. (2004) Identification of Patients with High-risk Lymph Node-negative Colorectal Cancer and Potential Benefit from Adjuvant Chemotherapy. Japanese Journal of Clinical Oncology 34:6, 323-328
CrossRef124
Lane C. Patten, David H. Berger, Miguel Rodriguez-Bigas, Paul Mansfield, Ebrahim Delpassand, Karen R. Cleary, Shawn P. Fagan, Steven A. Curley, Kelly K. Hunt, Barry W. Feig. (2004) A prospective evaluation of radiocolloid and immunohistochemical staining in colon carcinoma lymphatic mapping. Cancer 100:10, 2104-2109
CrossRef125
Feng Wu, Zhi-Biao Wang, Cheng-Bing Jin, Jun-Ping Zhang, Wen-Zhi Chen, Jin Bai, Jian-Zhong Zou, Hui Zhu. (2004) Circulating tumor cells in patients with solid malignancy treated by high-intensity focused ultrasound. Ultrasound in Medicine & Biology 30:4, 511-517
CrossRef126
Margitta Retz, Jan Lehmann, Celine Szysnik, Stephanie Zwank, Thorsten Venzke, Christian Röder, Holger Kalthoff, Carol Basbaum, Michael Stöckle. (2004) Detection of Occult Tumor Cells in Lymph Nodes from Bladder Cancer Patients by MUC7 Nested RT-PCR. European Urology 45:3, 314-319
CrossRef127
Fania S. Doekhie, Koen C. M. J. Peeters, Rob A. E. M. Tollenaar, Cornelis J. H. Velde. (2004) Minimal residual disease assessment in sentinel nodes of breast and gastrointestinal cancer: A plea for standardization. Annals of Surgical Oncology 11:S3, 236S-241S
CrossRef128
Stephen A. Bustin, Shahab Siddiqi, Shafi Ahmed, Rebecca Hands, Sina Dorudi. (2004) Quantification of cytokeratin 20, carcinoembryonic antigen and guanylyl cyclase C mRNA levels in lymph nodes may not predict treatment failure in colorectal cancer patients. International Journal of Cancer 108:3, 412-417
CrossRef129
Monica Bertagnolli, Brent Miedema, Mark Redston, Jeannette Dowell, Donna Niedzwiecki, James Fleshman, Jiri Bem, Robert Mayer, Michael Zinner, Carolyn Compton. (2004) Sentinel Node Staging of Resectable Colon Cancer. Transactions of the ... Meeting of the American Surgical Association CXXII:&NA;, 222-228
CrossRef130
Nigel P.S. Crawford, Daniel W. Colliver, Susan Galandiuk. (2003) Tumor markers and colorectal cancer: Utility in management. Journal of Surgical Oncology 84:4, 239-248
CrossRef131
I.R.K Bukholm, J Bondi, P Wiik, J.M Nesland, S.N Andersen, A Bakka, G Bukholm. (2003) Presence of isolated tumour cells in mesenteric lymph nodes predicts poor prognosis in patients with stage II colon cancer. European Journal of Surgical Oncology (EJSO) 29:10, 862-866
CrossRef132
Jesus Gonzalez Bosquet, Gary L Keeney, Andrea Mariani, Maurice J Webb, William A Cliby. (2003) Cytokeratin staining of resected lymph nodes may improve the sensitivity of surgical staging for endometrial cancer
. Gynecologic Oncology 91:3, 518-525
CrossRef133
Michael Conzelmann, Christoph P. Dieterle, Ulrich Linnemann, Martin R. Berger. (2003) Cytokeratin 20 and guanylyl cyclase C mRNA is largely present in lymph node and liver specimens of colorectal cancer patients. International Journal of Cancer 107:4, 617-628
CrossRef134
Calvin H.L. Law, Frances C. Wright, Theodore Rapanos, Mohamed Alzahrani, Sherif S. Hanna, Mahmoud Khalifa, Andrew J. Smith. (2003) Impact of lymph node retrieval and pathological ultra-staging on the prognosis of stage II colon cancer. Journal of Surgical Oncology 84:3, 120-126
CrossRef135
P LUNAPEREZ. (2003) Prognostic significance of retrieved lymph nodes per specimenin resected rectal adenocarcinoma after preoperative chemoradiation therapy. Archives of Medical Research 34:4, 281-286
CrossRef136
Virginia Davids, Susan H Kidson, Gideon S Hanekom. (2003) Melanoma patient staging. Melanoma Research 13:3, 313-324
CrossRef137
J. Mulsow, D. C. Winter, J. C. O'Keane, P. R. O'Connell. (2003) Sentinel lymph node mapping in colorectal cancer. British Journal of Surgery 90:6, 659-667
CrossRef138
SHINGO ASHIDA, MUTSUO FURIHATA, MASANOBU TANIMURA, OSAMU SUGITA, MOTOYUKI YAMASHITA, TAKESHI MIURA, MASATOSHI MORIYAMA, TARO SHUIN. (2003) Molecular Detection of Von Hippel-Lindau Gene Mutations in Urine and Lymph Node Samples in Patients with Renal Cell Carcinoma: Potential Biomarkers for Early Diagnosis and Postoperative Metastatic Status. The Journal of Urology 169:6, 2089-2093
CrossRef139
Natalie E. Joseph, Elin R. Sigurdson, Alexandra L. Hanlon, Hao Wang, Robert J. Mayer, John S. MacDonald, Paul J. Catalano, Daniel G. Haller. (2003) Accuracy of Determining Nodal Negativity in Colorectal Cancer on the Basis of the Number of Nodes Retrieved on Resection. Annals of Surgical Oncology 10:3, 213-218
CrossRef140
Anton Bilchik. (2003) More (Nodes) + More (Analysis) = Less (Mortality): Challenging the Therapeutic Equation for Early-Stage Colon Cancer. Annals of Surgical Oncology 10:3, 203-205
CrossRef141
Xavier Bessa, Virgínia Piñol, Sergi Castellví-Bel, Elena Piazuelo, Antonio M. Lacy, J. Ignasi Elizalde, Josep M. Piqué, Antoni Castells. (2003) Prognostic Value of Postoperative Detection of Blood Circulating Tumor Cells in Patients With Colorectal Cancer Operated on For Cure. Annals of Surgery 237:3, 368-375
CrossRef142
ADRIAN M. JUBB, PHIL QUIRKE, ADAM J. OATES. (2003) DNA Methylation, a Biomarker for Colorectal Cancer. Annals of the New York Academy of Sciences 983:1, 251-267
CrossRef143
R. T. Palma, J. Waisberg, S. H. Bromberg, A. B. Simao, A. C. Godoy. (2003) Micrometastasis in regional lymph nodes of extirpated colorectal carcinoma: immunohistochemical study using anti-cytokeratin antibodies AE1/AE3. Colorectal Disease 5:2, 164-168
CrossRef144
Ulrich Guller, Brent A. Blumenstein. (2003) Trends in clinical trials in surgical oncology: Implications for outcomes research. Clinical Therapeutics 25:2, 684-698
CrossRef145
H.K. van Halteren. (2003) Colorectal cancer in 2003: old principles, new strategies. Anti-Cancer Drugs 14:2, 97-102
CrossRef146
Wolfgang Janni, Florian Hepp, Barbara Strobl, Brigitte Rack, Dorothea Rjosk, Christina Kentenich, Christian Schindlbeck, Peer Hantschmann, Klaus Pantel, Harald Sommer, Stephan Braun. (2003) Patterns of disease recurrence influenced by hematogenous tumor cell dissemination in patients with cervical carcinoma of the uterus. Cancer 97:2, 405-411
CrossRef147
Robert J. Feezor, Edward M. Copeland, Steven N. Hochwald. (2002) Significance of micrometastases in colorectal cancer. Annals of Surgical Oncology 9:10, 944-953
CrossRef148
Ulrich Guller, Paul Zajac, Annelies Schnider, Beatrix Bösch, Stefan Vorburger, Markus Zuber, Giulio Cesare Spagnoli, Daniel Oertli, Robert Maurer, Urs Metzger, Felix Harder, Michael Heberer, Walter Richard Marti. (2002) Disseminated Single Tumor Cells as Detected by Real-Time Quantitative Polymerase Chain Reaction Represent a Prognostic Factor in Patients Undergoing Surgery for Colorectal Cancer. Annals of Surgery 236:6, 768-776
CrossRef149
Gregory Broderick-Villa, Albert Ko, Theodore X OʼConnell, J. Michael Guenther, Tarek Danial, L. Andrew DiFronzo. (2002) Does Tumor Burden Limit the Accuracy of Lymphatic Mapping and Sentinel Lymph Node Biopsy in Colorectal Cancer?. The Cancer Journal 8:6, 445-450
CrossRef150
Anne Demols, Jean-Luc Laethem. (2002) Adjuvant chemotherapy for colorectal cancer. Current Gastroenterology Reports 4:5, 420-426
CrossRef151
József Tímár, Orsolya Csuka, Zsolt Orosz, Andres Jeney, László Kopper. (2002) Molecular pathology of tumor metastasis. Pathology & Oncology Research 8:3, 204-219
CrossRef152
Thomas E Read, Matthew G Mutch, Benjamin W Chang, Michael S McNevin, James W Fleshman, Elisa H Birnbaum, Robert D Fry, Philip F Caushaj, Ira J Kodner. (2002) Locoregional recurrence and survival after curative resection of adenocarcinoma of the colon1 1No competing interests declared.. Journal of the American College of Surgeons 195:1, 33-40
CrossRef153
Setsuko Yoshioka, Yoshiyuki Fujiwara, Yurika Sugita, Yoshihiro Okada, Masahiko Yano, Shigeyuki Tamura, Takushi Yasuda, Shuji Takiguchi, Hitoshi Shiozaki, Morito Monden. (2002) Real-time rapid reverse transcriptase-polymerase chain reaction for intraoperative diagnosis of lymph node micrometastasis: Clinical application for cervical lymph node dissection in esophageal cancers. Surgery 132:1, 34-40
CrossRef154
Anton J. Bilchik, Dean T. Nora. (2002) Lymphatic mapping of nodal micrometastasis in colon cancer: Putting the cart before the horse?. Annals of Surgical Oncology 9:6, 529-531
CrossRef155
Femke Vlems, Richie Soong, Heleen Diepstra, Cornelis Punt, Theo Wobbes, Karim Tabiti, Goos van Muijen. (2002) Effect of Blood Sample Handling and Reverse Transcriptase–Polymerase Chain Reaction Assay Sensitivity on Detection of CK20 Expression in Healthy Donor Blood. Diagnostic Molecular Pathology 11:2, 90-97
CrossRef156
G. Tsavellas, A. Huang, T. G. Allen-Mersh. (2002) Does sentinel lymph node biopsy have a role in colorectal cancer?. Colorectal Disease 4:3, 158-161
CrossRef157
T.L. Fitzgerald, M.A. Khalifa, M. Al Zahrani, C.H.L. Law, A.J. Smith. (2002) Ex vivo sentinel lymph node biopsy in colorectal cancer: A feasibility study. Journal of Surgical Oncology 80:1, 27-32
CrossRef158
M. Ducreux, V. Boige. (2002) Adjuvant chemotherapy for colon cancer. Best Practice & Research Clinical Gastroenterology 16:2, 283-298
CrossRef159
David Sidransky. (2002) Emerging molecular markers of cancer. Nature Reviews Cancer 2:3, 210-219
CrossRef160
Eric G. Davis, Celia Chao, Kelly M. McMasters. (2002) Polymerase Chain Reaction in the Staging of Solid Tumors. The Cancer Journal 8:2, 135-143
CrossRef161
David G. Bragg, Philip Rubin, Hedvig Hricak. 2002. Imaging Strategies for Oncologic Diagnosis and Multidisciplinary Treatment. , 3-20.
CrossRef162
Philippe O Van Trappen, Michael S Pepper. (2002) Lymphatic dissemination of tumour cells and the formation of micrometastases. The Lancet Oncology 3:1, 44-52
CrossRef163
Giacomo di, D. Altomare, G. Guanti. (2002) Micrometastatis in colorectal cancer. Acta chirurgica iugoslavica 49:2, 63-66
CrossRef164
Barry W Feig, Steven Curley, Anthony Lucci, Kelly K Hunt, J.Nicolas Vauthey, Paul F Mansfield, Karen Cleary, Stanley Hamilton, Vicki Ellis, Michelle Brame, David H Berger. (2001) A caution regarding lymphatic mapping in patients with colon cancer. The American Journal of Surgery 182:6, 707-712
CrossRef165
G. Burdy, Y. Panis, A. Alves, J. Nemeth, A. Lavergne-Slove, P. Valleur. (2001) Identifying patients with T3-T4 node-negative colon cancer at high risk of recurrence. Diseases of the Colon & Rectum 44:11, 1682-1688
CrossRef166
Yoshihiro Okada, Yoshiyuki Fujiwara, Hirofumi Yamamoto, Yurika Sugita, Takushi Yasuda, Yuichiro Doki, Shigeyuki Tamura, Masahiko Yano, Hitoshi Shiozaki, Nariaki Matsuura, Morito Monden. (2001) Genetic detection of lymph node micrometastases in patients with gastric carcinoma by multiple-marker reverse transcriptase-polymerase chain reaction assay. Cancer 92:8, 2056-2064
CrossRef167
Klaus Pantel, Marcus Otte. (2001) Occult micrometastasis: enrichment, identification and characterization of single disseminated tumour cells. Seminars in Cancer Biology 11:5, 327-337
CrossRef168
Antonio Marchetti, Fiamma Buttitta, Gloria Bertacca, Katia Zavaglia, Generoso Bevilacqua, Domenico Angelucci, Paolo Viacava, Antonio Naccarato, Angelo Bonadio, Fabio Barassi, Lara Felicioni, Simona Salvatore, Felice Mucilli. (2001) mRNA markers of breast cancer nodal metastases: comparison between mammaglobin and carcinoembryonic antigen in 248 patients. The Journal of Pathology 195:2, 186-190
CrossRef169
Richard J. Gray, Charles E. Cox, Douglas S. Reintgen. (2001) Importance of Missed Axillary Micrometastases in Breast Cancer Patients. The Breast Journal 7:5, 303-307
CrossRef170
Takeo Fukagawa, Mitsuru Sasako, Gregory Bruce Mann, Takeshi Sano, Hitoshi Katai, Keiichi Maruyama, Yukihiro Nakanishi, Tadakazu Shimoda. (2001) Immunohistochemically detected micrometastases of the lymph nodes in patients with gastric carcinoma. Cancer 92:4, 753-760
CrossRef171
(2001) ADASP Recommendations for Processing and Reporting Lymph Node Specimens Submitted for Evaluation of Metastatic Disease. The American Journal of Surgical Pathology 25:7, 961-963
CrossRef172
Dragos G. Iorgulescu, George K. Kiroff. (2001) Minimal residual marrow disease: Detection and significance of isolated tumour cells in bone marrow. ANZ Journal of Surgery 71:6, 365-376
CrossRef173
Stefan B. Hosch, Peter Scheunemann, Jakob R. Izbicki. (2001) Minimal residual disease in non-small-cell lung cancer. Seminars in Surgical Oncology 20:4, 278-281
CrossRef174
Stephan Braun, Robert Rosenberg, Stefan Thorban, Nadia Harbeck. (2001) Implications of occult metastatic cells for systemic cancer treatment in patients with breast or gastrointestinal cancer. Seminars in Surgical Oncology 20:4, 334-346
CrossRef175
Salvatore Andreola, Ermanno Leo, Filiberto Belli, Gianfrancesco Gallino, Grazia Sirizzotti, Giuseppe Sampietro. (2001) Adenocarcinoma of the Lower Third of the Rectum: Metastases in Lymph Nodes Smaller Than 5 mm and Occult Micrometastases; Preliminary Results on Early Tumor Recurrence. Annals of Surgical Oncology 8:5, 413-417
CrossRef176
Steven Esser, Terence W. Reilly, Lee B. Riley, Camille Eyvazzadeh, Stephen Arcona. (2001) The role of sentinel lymph node mapping in staging of colon and rectal cancer. Diseases of the Colon & Rectum 44:6, 850-854
CrossRef177
Peter Kienle, Moritz Koch. (2001) Minimal residual disease in gastrointestinal cancer. Seminars in Surgical Oncology 20:4, 282-293
CrossRef178
(2001) Recommendations for Processing and Reporting of Lymph Node Specimens Submitted for Evaluation of Metastatic Disease. American Journal of Clinical Pathology 115:6, 799-801
CrossRef179
Henk K. van Halteren, Herman M. Peters, J. Han J. M. van Krieken, Jan-Willem W. Coebergh, Rudi M. H. Roumen, Erik van der Worp, J. Theo Wagener, Gerard Vreugdenhil. (2001) Tumor growth pattern and thymidine phosphorylase expression are related with the risk of hematogenous metastasis in patients with Astler Coller B1/B2 colorectal carcinoma. Cancer 91:9, 1752-1757
CrossRef180
D Hawes, A Munro Neville, R.J Cote. (2001) Occult metastasis. Biomedicine & Pharmacotherapy 55:4, 229-242
CrossRef181
Jan H. Wong, Susan Steineman, Christiano Calderia, Jason Bowles, Thomas Namiki. (2001) Ex Vivo Sentinel Node Mapping in Carcinoma of the Colon and Rectum. Annals of Surgery 233:4, 515-521
CrossRef182
Xavier Bessa, J. Ignasi Elizalde, Loreto Boix, Virgínia Piñol, Antonio M. Lacy, Joan Saló, Josep M. Piqué, Antoni Castells. (2001) Lack of prognostic influence of circulating tumor cells in peripheral blood of patients with colorectal cancer. Gastroenterology 120:5, 1084-1092
CrossRef183
Paul J. van Diest, Hans Torrenga, Sybren Meijer, Chris J.L.M. Meijer. (2001) Pathologic analysis of sentinel lymph nodes. Seminars in Surgical Oncology 20:3, 238-245
CrossRef184
P. Scheuemann, S. B. Hosch, J. R. Izbicki. (2001) Cytokeratins and other sensitive markers for esophageal cancer and metastases*. Diseases of the Esophagus 14:2, 85-90
CrossRef185
B Böckmann. (2001) Molecular characterization of minimal residual cancer cells in patients with solid tumors. Biomolecular Engineering 17:3, 95-111
CrossRef186
Thomas F. Wood, Sukamal Saha, Donald L. Morton, George J. Tsioulias, Decio Rangel, William Hutchinson, Leland J. Foshag, Anton J. Bilchik. (2001) Validation of Lymphatic Mapping in Colorectal Cancer: In Vivo, Ex Vivo, and Laparoscopic Techniques. Annals of Surgical Oncology 8:2, 150-157
CrossRef187
Paolo Morgagni, Luca Saragoni, Secondo Folli, Michele Gaudio, Emanuela Scarpi, Francesca Bazzocchi, Gian Angelo Marra, Antonio Vio. (2001) Lymph Node Micrometastases in Patients With Early Gastric Cancer: Experience With 139 Patients. Annals of Surgical Oncology 8:2, 170-174
CrossRef188
Shaji K. Kumar, Richard M. Goldberg. (2001) Adjuvant chemotherapy for colon cancer. Current Oncology Reports 3:2, 94-101
CrossRef189
Ilka Vogel, Helga Francksen, Edlyn Soeth, Doris Henne-Bruns, Bernd Kremer, Hartmut Juhl. (2001) The carcinoembryonic antigen and its prognostic impact on immunocytologically detected intraperitoneal colorectal cancer cells. The American Journal of Surgery 181:2, 188-193
CrossRef190
Philippe O Van Trappen, Valerie G Gyselman, David G Lowe, Andy Ryan, David H Oram, Peter Bosze, Anthony R Weekes, John H Shepherd, Sina Dorudi, Stephen A Bustin, Ian J Jacobs. (2001) Molecular quantification and mapping of lymph-node micrometastases in cervical cancer. The Lancet 357:9249, 15-20
CrossRef191
Sharon A. Keene, Michael J. Demeure. (2001) The clinical significance of micrometastases and molecular metastases. Surgery 129:1, 1-5
CrossRef192
Sukamal Saha, Dean Nora, Jan H. Wong, David Weise. (2000) SENTINEL LYMPH NODE MAPPING IN COLORECTAL CANCER—A REVIEW. Surgical Clinics of North America 80:6, 1811-1819
CrossRef193
G. Bruce Mann, Malcolm Buchanan, John P. Collins, Meir Lichtenstein. (2000) High Incidence of Micrometastases in Breast Cancer Sentinel Nodes. ANZ Journal of Surgery 70:11, 786-790
CrossRef194
Lee M. Ellis. (2000) A Perspective on Sentinel Lymph Node Biopsy in Colorectal Cancer: The Race Between Surgical Technology and Molecular Oncology. Annals of Surgical Oncology 7:7, 475-476
CrossRef195
Barbara R. Rose, Carol H. Thompson, Martin H. Tattersall, Christopher J. O'Brien, Yvonne E. Cossart. (2000) Squamous Carcinoma Of The Head And Neck: Molecular Mechanisms And Potential Biomarkers. ANZ Journal of Surgery 70:8, 601-606
CrossRef196
R Ghossein. (2000) Molecular detection and characterisation of circulating tumour cells and micrometastases in solid tumours. European Journal of Cancer 36:13, 1681-1694
CrossRef197
Mary E. Barcus, Andrea Ferreira-Gonzalez, Arlene M. Buller, David S. Wilkinson, Carleton T. Garrett. (2000) Genetic changes in solid tumors. Seminars in Surgical Oncology 18:4, 358-370
CrossRef198
Alyssa Gelmann, Rodwige Desnoyers, Burt Cagir, David Weinberg, Bruce M Boman, Scott A Waldman. (2000) Colorectal cancer staging and adjuvant chemotherapy. Expert Opinion on Pharmacotherapy 1:4, 737-755
CrossRef199
Heriot, Kumar. (2000) Rectal cancer recurrence: factors and mechanisms. Colorectal Disease 2:3, 126-136
CrossRef200
CO McDonnell, ADK Hill, DA McNamara, TN Walsh, DJ Bouchier-Hayes. (2000) REVIEWS — Tumour micrometastases: the influence of angiogenesis. European Journal of Surgical Oncology (EJSO) 26:2, 105-115
CrossRef201
Tomohiko Aihara, Yoshiyuki Fujiwara, Yasuhiro Miyake, Jiro Okami, Yoshihiro Okada, Kyoko Iwao, Yurika Sugita, Naohiro Tomita, Masato Sakon, Hitoshi Shiozaki, Morito Monden. (2000) Mammaglobin B gene as a novel marker for lymph node micrometastasis in patients with abdominal cancers. Cancer Letters 150:1, 79-84
CrossRef202
David M. Ota. (2000) Is Intraoperative Lymph Node Mapping and Sentinel Lymph Node Biopsy for Colorectal Carcinoma Necessary?. Annals of Surgical Oncology 7:2, 82-84
CrossRef203
Dawas, Loizidou, Taylor. (2000) Recent trials in colorectal cancer. Colorectal Disease 2:1, 45-49
CrossRef204
Klaus Pantel, Magnus von Knebel Doeberitz. (2000) Detection and clinical relevance of micrometastatic cancer cells. Current Opinion in Oncology 12:1, 95-101
CrossRef205
Paul Hermanek, Robert V. P. Hutter, Leslie H. Sobin, Christian Wittekind. (1999) Classification of isolated tumor cells and micrometastasis. Cancer 86:12, 2668-2673
CrossRef206
A Bremers. (1999) Cancer surgery: the last 25 years. Cancer Treatment Reviews 25:6, 333-353
CrossRef207
RJ Cote, H Fpeterson, B Chaiwun, RD Gelber, A Goldhirsch, M Castiglione-Gertsch, B Gusterson, AM Neville. (1999) Role of immunohistochemical detection of lymph-node metastases in management of breast cancer. The Lancet 354:9182, 896-900
CrossRef208
Mary F. Mulcahy, Al B. Benson. (1999) The role of carcinoembryonic antigen monitoring in management of colorectal cancer. Current Oncology Reports 1:2, 168-172
CrossRef209
MICHAEL G. OEFELEIN, JEFFREY M. IGNATOFF, J. QUENTIN CLEMENS, WILLIAM WATKIN, KAREN L. KAUL. (1999) CLINICAL AND MOLECULAR FOLLOWUP AFTER RADICAL RETROPUBIC PROSTATECTOMY. The Journal of Urology 162:2, 307-310
CrossRef210
K. Pantel, R. J. Cote, O. Fodstad. (1999) Detection and Clinical Importance of Micrometastatic Disease. JNCI Journal of the National Cancer Institute 91:13, 1113-1124
CrossRef211
Futoshi Miyazono, Sonshin Takao, Shoji Natsugoe, Keiichirou Uchikura, Fumio Kijima, Kuniaki Aridome, Hiroyuki Shinchi, Takashi Aikou. (1999) Molecular detection of circulating cancer cells during surgery in patients with biliary-pancreatic cancer. The American Journal of Surgery 177:6, 475-479
CrossRef212
Liefers, Tollenaar, Cleton-Jansen. (1999) Molecular detection of minimal residual disease in colorectal and breast cancer. Histopathology 34:5, 385-390
CrossRef213
Paul Cairns, David Sidransky. (1999) Molecular methods for the diagnosis of cancer1Oncor, Inc. provided research funding for the study described in this paper. Under an agreement between Oncor and the Johns Hopkins University, Dr. Sidransky is entitled to a share of sales royalty received by the University from Oncor. Under that agreement, the University and Dr. Sidransky also have received Oncor stock which, under University policy, cannot be traded until two years after the first commercial sales of the products related to this research. The terms of this arrangement have been reviewed and approved by the University in accordance with its conflict of interest policies.1. Biochimica et Biophysica Acta (BBA) - Reviews on Cancer 1423:2, C11-C18
CrossRef214
Peter L. Fielding. (1999) Invited editorial. Diseases of the Colon & Rectum 42:2, 154-158
CrossRef215
(1998) Detection of Carcinoembryonic Antigen Messenger RNA in Lymph Nodes from Patients with Colorectal Cancer. New England Journal of Medicine 339:22, 1642-1644
Full Text216
Lindblom, Annika, . (1998) Improved Tumor Staging in Colorectal Cancer. New England Journal of Medicine 339:4, 264-265
Full Text217
W. O. Bechstein. (1998) Editorial. European Surgery 30:4, 204-205
CrossRef
- Letters
