Original Article
Brief Report
Male Hypogonadism Due to a Mutation in the Gene for the β-Subunit of Follicle-Stimulating Hormone
N Engl J Med 1998; 338:1729-1732June 11, 1998
- Article
Normal pubertal development and fertility depend on the intricate interplay of hypothalamic, pituitary, and gonadal factors. Crucial in this respect are normal secretory patterns of follicle-stimulating hormone and luteinizing hormone. These hormones stimulate the production of estrogen and ovulation in women and the production of testosterone and spermatogenesis in men. Secreted from common gonadotroph cells, the hormones are heterodimers composed of a common α-subunit and a specific β-subunit, each encoded by a separate gene. Specificity of action depends on the recognition of these hormones by specific receptors on the surface of gonadal cells.
Various genetic defects of the hypothalamic–pituitary–gonadal axis that cause hypogonadism have been identified.1 At the level of the hypothalamus, secretion of gonadotropin-releasing hormone is disturbed by mutations in the KAL gene,2 leading to Kallmann's syndrome, and in the DAX-1 gene,3 causing X-linked adrenal hypoplasia and hypogonadotropic hypogonadism. At the pituitary level, mutations in the gene for the β-subunit of luteinizing hormone4 cause hypogonadotropic hypogonadism, and at the gonadal level, loss-of-function mutations in the genes that encode the receptors for follicle-stimulating hormone and luteinizing hormone cause hypergonadotropic hypogonadism.5,6 Specifically, mutations in the gene for luteinizing hormone receptors result in Leydig-cell hypoplasia and undermasculinization in genetic males,5,7,8 whereas mutations in the gene for follicle-stimulating hormone receptors cause primary gonadal failure and hypergonadotropic hypogonadism in genetic females.6
Two female patients with follicle-stimulating hormone deficiency caused by mutations in the gene for the β-subunit of follicle-stimulating hormone have been described. One presented with primary amenorrhea and infertility,9 and the other with delayed puberty.10 In this report, we describe a man with impaired secretion of follicle-stimulating hormone caused by a homozygous mutation in the gene for the β-subunit of follicle-stimulating hormone, as well as two asymptomatic heterozygous male members of his family.
Methods
Subjects
The proband was referred to our center at the age of 18 years for evaluation of delayed puberty. He reported normal erections and ejaculatory orgasms. He had a prepubertal physique and underdeveloped muscles. He was 178 cm tall (69th percentile) and weighed 59 kg. He had pubic hair (Tanner stage 4), scant axillary hair, and no facial hair. No breast tissue was palpated. The scrotum was thin, and two small, soft testicles (testicular volume, 1 to 2 ml) were palpated. There was no family history of consanguinity, infertility, or delayed puberty.
Laboratory studies revealed low serum testosterone and follicle-stimulating hormone concentrations and high serum luteinizing hormone concentrations (Table 1Table 1
Serum Hormone Values in a Man with Follicle-Stimulating Hormone Deficiency Caused by a Mutation in the Gene for the b-Subunit of Follicle-Stimulating Hormone.). Serum thyrotropin, prolactin, and cortisol concentrations were normal. Chromosomal analysis revealed a 46,XY karyotype. After intravenous administration of 100 μg of gonadotropin-releasing hormone, the patient's serum luteinizing hormone concentration increased from 24.5 mIU per milliliter to 66.6, 73.3, 74.5, and 70.2 mIU per milliliter at 15, 30, 45, and 60 minutes, respectively. Serum follicle-stimulating hormone concentrations were less than 0.5 mIU per milliliter before and after the administration of gonadotropin-releasing hormone. Semen analysis on two occasions showed white ejaculates (2.5 and 2.9 ml) with no sperm. Bone age was 16 years, and the findings on magnetic resonance imaging of the brain and pituitary were normal.The proband's 17-year-old brother was 179 cm tall with Tanner stage 5 pubic hair. His testicular volume was 25 ml bilaterally. He had normal libido, with normal erections and ejaculations. His serum follicle-stimulating hormone, luteinizing hormone, and testosterone concentrations were 3.3 mIU per milliliter, 5.7 mIU per milliliter, and 1020 ng per deciliter (35.4 nmol per liter), respectively.
The father, who was 41 years old, had normal libido and sexual function. His pubic hair was Tanner stage 5, and his testicular volume was 25 ml bilaterally. His serum follicle-stimulating hormone, luteinizing hormone, and testosterone concentrations were 3.9 mIU per milliliter, 4.7 mIU per milliliter, and 990 ng per deciliter (34.3 nmol per liter), respectively. The mother's age at menarche was 12.5 years. She had given birth to three children: the brothers described above and a three-year-old girl from a second marriage. She had chronic autoimmune thyroiditis, which was treated with thyroxine.
The study protocol was reviewed and approved by the hospital review committee, and informed consent was obtained from all the subjects.
DNA Analysis
DNA was extracted from peripheral-blood leukocytes by standard methods. All three exons of the gene for the β-subunit of follicle-stimulating hormone were amplified by a polymerase-chain-reaction (PCR) assay with the use of primer pairs designed to amplify the exons and the exon–intron junctions on the basis of the gene sequence.13 The primers used were FSH-1-F 5'AATTTGAGAAGGTAAAGGAG3' and FSH-1-R 5'GCATAAATTTCCTACACAAC3' for exon 1, FSH-2-F 5'GGCTTCATTGTTTGCTTCC3' and FSH-2-R 5'AAACCCCGGTAATACAGAC3' for exon 2, and FSH-3-F 5'AACTTCCACAATACCATAACC3' and FSH-3-R 5'CAGACTTTTTGAATATCTTGG3' for exon 3. FSH-3-R2 5'ACAGTACAATCAGTGCTGTCG3' was used instead of FSH-3-R for analyses of single-strand conformation polymorphisms and restriction analyses.
The PCR assay was performed with 2.5 mM magnesium chloride, 0.2 mM deoxynucleoside triphosphate, 0.5 μM of each primer, and 1 unit of Taq polymerase (MBI Fermentas, Vilnius, Lithuania) with the manufacturer's buffer. Cycling conditions were as follows: one minute at 94°C, one minute at the annealing temperature, and one minute at 72°C for 30 cycles, followed by five minutes at 72°C. Annealing temperatures were 45°C for the first exon and 55°C or 52°C for the second and third exons. PCR products were purified with the Quiaquick gel-extraction kit (Quiagen, Hilden, Germany), and 3 μg of DNA from three separate PCR reactions (1 μg of DNA from each) were combined and subjected to sequencing with the use of DNA sequencer ABI 310 (Perkin Elmer, Foster City, Calif.) on both strands. Analysis of single-strand conformation polymorphisms was performed as previously described.14
For restriction analysis, TspRI (New England Biolabs, Beverly, Mass.) was used as recommended by the manufacturer. Products were separated on 4 percent agarose gels (3 percent NuSieve GTG and 1 percent SeaKem LE [FMC Bioproducts, Rockland, Me.]) in parallel with a 1-kb-ladder marker (Boehringer Mannheim, Mannheim, Germany) and visualized by staining with ethidium bromide (Sigma, St. Louis).
Results
No changes in sequence were found in exons 1 and 2 of the patient's gene for the β-subunit of follicle-stimulating hormone. Sequencing of exon 3 revealed that the patient was homozygous for a deletion of the second and third nucleotides (thymidine and guanine) in codon 61 (Figure 1AFigure 1
Characterization of the Mutation in the Gene for the β-Subunit of Follicle-Stimulating Hormone in a Man with Hypogonadism.). This mutation would be expected to lead to a frame shift in transcription so that the β-subunit of follicle-stimulating hormone would contain the first 60 amino acids of the third exon and 26 amino acids in a frame shift until the stop codon (TGA) was reached; the last 51 amino acids of the β-subunit would be missing.To verify the source of the mutation, PCR products of exon 3 from the patient, his brother, and his parents were analyzed for single-strand conformation polymorphism. As expected from the sequencing results, the patient's DNA migrated as a single band, indicating homozygosity, whereas DNA from his parents and brother migrated as two bands, indicating heterozygosity (Figure 1B). The deletion of two base pairs in codon 61 was predicted to eliminate one of the two TspRI restriction sites in exon 3. As expected, the amplified PCR fragment of exon 3 from the patient was digested by TspRI into two fragments (Figure 1C).
Discussion
Normal adolescent development begins with an increased amplitude of pulsatile gonadotropin-releasing hormone leading to increased secretion of luteinizing hormone and follicle-stimulating hormone. In men, follicle-stimulating hormone supports the growth and proliferation of seminiferous tubules and spermatogenesis, whereas luteinizing hormone mainly affects the production of testosterone by testicular Leydig cells.
We report a case of secondary hypogonadism associated with an isolated deficiency of follicle-stimulating hormone in a young man. The hormonal deficiency was due to a two-nucleotide deletion in the coding sequence for the β-subunit of follicle-stimulating hormone, resulting in a truncated polypeptide lacking the last 51 amino acids at the C-terminal end of the subunit. Layman et al. recently described a teenage girl with delayed puberty, hypogonadism, and isolated follicle-stimulating hormone deficiency due to compound heterozygous mutations in the gene for the β-subunit, including the deletion of thymidine and guanine in codon 61, as noted in our patient.10 In the study by Layman et al., transfection of the patient's β-subunit DNA and α-subunit DNA resulted in the production of follicle-stimulating hormone with no immunoreactive or biologic activity.
The severe deficiency of follicle-stimulating hormone in our patient provided an opportunity to evaluate this hormone's action on male sexual maturation and fertility. The patient had bilaterally descended small, soft testes; clinical evidence of androgen deficiency; high serum luteinizing hormone concentrations and low serum total and free testosterone concentrations; high-normal serum sex hormone–binding globulin concentrations; low serum inhibin B concentrations; and azoospermia on two occasions.
There have been several reports of males with isolated follicle-stimulating hormone deficiency diagnosed by biochemical methods. Some of the patients had associated disorders, such as cryptorchidism, hypospadias, omphalocele, deafness, the olfactory–genital dysplasia syndrome, chromosomal alterations, or short stature.15-17 Others had a normal habitus without any malformations or chromosomal alterations.18 In all male patients previously described, basal serum luteinizing hormone and testosterone concentrations were normal. The variable phenotypes and other disorders may represent additional disorders or a partial rather than total deficiency of follicle-stimulating hormone. It is also conceivable that another mutation in the coding or regulatory sequences of the gene for the β-subunit of follicle-stimulating hormone leads to low serum follicle-stimulating hormone concentrations or to undetectable yet partially bioactive hormone, resulting in a different phenotype. Mutations in the gene for the follicle-stimulating hormone receptor also lead to various degrees of oligospermia and normal-to-elevated serum luteinizing hormone concentrations, representing different phenotypes with the same genotype.19
The low serum total and free testosterone concentrations and high serum luteinizing hormone concentrations in our patient are curious findings. Leydig cells do not have follicle-stimulating hormone receptors, and the low serum testosterone concentrations are therefore not readily explained. Supernatants of Sertoli cells incubated with follicle-stimulating hormone stimulate testosterone secretion by Leydig cells and testicular explants from rats,20,21 hamsters,22 and humans.23,24 These findings suggest that our patient's low serum testosterone concentrations may have been due to the absence of a Leydig-cell–stimulating substance that is normally produced by Sertoli cells when they are stimulated by follicle-stimulating hormone. The patient's serum luteinizing hormone concentration was high because of the impaired testosterone secretion. His low serum inhibin B concentrations were probably due to Sertoli-cell hypofunction.25
The prevalence of mutations in the gene for the β-subunit of follicle-stimulating hormone remains to be determined. Ours is the third report of the same mutation in the β-subunit gene; the other two reports involved women, one from the United Kingdom9 and the other from the United States.10 Our finding of the same mutation in two additional nonconsanguineous subjects, our patient's parents, suggests that this mutation may be more prevalent than previously suspected.
Source Information
From the Pediatric Diagnostic and Therapeutic Center (M.P., Y.S.), the Endocrine Clinic (J.E.A.), and the Genetic Institute (R.P.), Soroka Medical Center and Faculty of Health, Ben Gurion University of the Negev, Beer Sheva, Israel.
Address reprint requests to Prof. Phillip at Schneider Children's Medical Center of Israel, 14 Kaplan St., Petah-Tikva 49202, Israel.
- References
References
1
Jameson JL . Inherited disorders of the gonadotropin hormones. Mol Cell Endocrinol 1996;125:143-149
CrossRef | Web of Science | Medline2
Hardelin JP ,Levilliers J ,Blanchard S , et al. Heterogeneity in the mutations responsible for X chromosome-linked Kallmann syndrome. Hum Mol Genet 1993;2:373-377
CrossRef | Web of Science | Medline3
Muscatelli F ,Strom TM ,Walker AP , et al. Mutations in the DAX-1 gene give rise to both X-linked adrenal hypoplasia congenita and hypogonadotropic hypogonadism. Nature 1994;372:672-676
CrossRef | Web of Science | Medline4
Weiss J ,Axelrod L ,Whitcomb RW ,Harris PE ,Crowley WF ,Jameson JL . Hypogonadism caused by a single amino acid substitution in the β subunit of luteinizing hormone. N Engl J Med 1992;326:179-183
Full Text | Web of Science | Medline5
Laue L ,Wu SM ,Kudo M , et al. A nonsense mutation of the human luteinizing hormone receptor gene in Leydig cell hypoplasia. Hum Mol Genet 1995;4:1429-1433
CrossRef | Web of Science | Medline6
Aittomaki K ,Lucena JL ,Pakarinen P , et al. Mutation in the follicle-stimulating hormone receptor gene causes hereditary hypergonadotropic ovarian failure. Cell 1995;82:959-968
CrossRef | Web of Science | Medline7
Kremer H ,Kraaij R ,Toledo SP , et al. Male pseudohermaphroditism due to a homozygous missense mutation of the luteinizing hormone receptor gene. Nat Genet 1995;9:160-164
CrossRef | Web of Science | Medline8
Latronico AC ,Anasti J ,Arnhold IJP , et al. Testicular and ovarian resistance to luteinizing hormone caused by inactivating mutations of the luteinizing hormone-receptor gene. N Engl J Med 1996;334:507-512
Full Text | Web of Science | Medline9
Matthews CH ,Borgato S ,Beck-Peccoz P , et al. Primary amenorrhoea and infertility due to a mutation in the beta-subunit of follicle-stimulating hormone. Nat Genet 1993;5:83-86
CrossRef | Web of Science | Medline10
Layman LC ,Lee E-J ,Peak DB , et al. Delayed puberty and hypogonadism caused by mutations in the follicle-stimulating hormone β-subunit gene. N Engl J Med 1997;337:607-611
Full Text | Web of Science | Medline11
Manni A ,Pardridge WM ,Cefalu W , et al. Bioavailability of albumin-bound testosterone. J Clin Endocrinol Metab 1985;61:705-710
CrossRef | Web of Science | Medline12
Somjen D ,Tordjman K ,Kohen F , et al. Combined βFSH and βLH response to TRH in patients with clinically non-functioning pituitary adenomas. Clin Endocrinol (Oxf) 1997;46:555-562
CrossRef | Web of Science | Medline13
Jameson JL ,Becker CB ,Lindell CM ,Habener JF . Human follicle-stimulating hormone beta-subunit gene encodes multiple messenger ribonucleic acids. Mol Endocrinol 1988;2:806-815
CrossRef | Web of Science | Medline14
Parvari R ,Moses S ,Shen J ,Hershkovitz E ,Lerner A ,Chen Y-T . A single-base deletion in the 3'-coding region of glycogen-debranching enzyme is prevalent in glycogen storage disease type IIIa in a population of North African Jewish patients. Eur J Hum Genet 1997;5:266-270
Web of Science | Medline15
Mozaffarian GA ,Higley M ,Paulsen CA . Clinical studies in an adult male patient with “isolated follicle stimulating hormone (FSH) deficiency.“ J Androl 1983;4:393-398
Web of Science | Medline16
Kjessler B ,Lundberg PO . Dysfunction of the neuroendocrine system in nine males with aspermia. Fertil Steril 1974;25:1007-1017
Web of Science | Medline17
Rabinowitz D ,Cohen MM ,Rosenmann E , et al. Chromatin-positive Klinefelter's syndrome with undetectable peripheral FSH levels. Am J Med 1975;59:584-590
CrossRef | Web of Science | Medline18
Al-Ansari AA ,Khalil TH ,Kelani Y ,Mortimer CH . Isolated follicle-stimulating hormone deficiency in men: successful long-term gonadotropin therapy. Fertil Steril 1984;42:618-626
Web of Science | Medline19
Tapanainen JS ,Aittomaki K ,Min J ,Vaskivuo T ,Huhtaniemi IT . Men homozygous for an inactivating mutation of the follicle-stimulating hormone (FSH) receptor gene present variable suppression of spermatogenesis and fertility. Nat Genet 1997;15:205-206
CrossRef | Web of Science | Medline20
Wu N ,Murono EP . A Sertoli cell-secreted paracrine factor(s) stimulates proliferation and inhibits steroidogenesis of rat Leydig cells. Mol Cell Endocrinol 1994;106:99-109
CrossRef | Web of Science | Medline21
Lecerf L ,Rouiller-Fabre V ,Levacher C ,Gautier C ,Saez JM ,Habert R . Stimulatory effect of follicle-stimulating hormone on basal and luteinizing hormone-stimulated testosterone secretions by the fetal rat testis in vitro. Endocrinology 1993;133:2313-2318
CrossRef | Web of Science | Medline22
Sinha Hikim AP ,Chandrashekar V ,Bartke A ,Russell LD . Sentinelsof Leydig cell structural and functional changes in golden hamsters in early testicular regression and recrudescence. Int J Androl 1993;16:324-342
CrossRef | Web of Science | Medline23
Carreau S . Paracrine control of human Leydig cell and Sertoli cell functions. Folia Histochem Cytobiol 1996;34:111-119
Web of Science | Medline24
Rivarola MA ,Belgorosky A ,Berensztein E ,de Davila MT . Human prepubertal testicular cells in culture: steroidogenic capacity, paracrine and hormone control. J Steroid Biochem Mol Biol 1995;53:119-125
CrossRef | Web of Science | Medline25
Anawalt BD ,Bebb RA ,Matsumoto AM , et al. Serum inhibin B levels reflect Sertoli cell function in normal men and men with testicular dysfunction. J Clin Endocrinol Metab 1996;81:3341-3345
CrossRef | Web of Science | Medline
- Citing Articles (61)
Citing Articles
1
Livio Casarini, Elisa Pignatti, Manuela Simoni. (2011) Effects of polymorphisms in gonadotropin and gonadotropin receptor genes on reproductive function. Reviews in Endocrine and Metabolic Disorders 12:4, 303-321
CrossRef2
Alberto Ferlin, Cinzia Vinanzi, Riccardo Selice, Andrea Garolla, Anna Chiara Frigo, Carlo Foresta. (2011) Toward a pharmacogenetic approach to male infertility: polymorphism of follicle-stimulating hormone beta-subunit promoter. Fertility and Sterility
CrossRef3
W. S. Layman, E. A. Hurd, D. M. Martin. (2011) Reproductive dysfunction and decreased GnRH neurogenesis in a mouse model of CHARGE syndrome. Human Molecular Genetics 20:16, 3138-3150
CrossRef4
Mohammad Reza Safarinejad, Nayyer Shafiei, Saba Safarinejad. (2011) Evaluating the role of the FSH receptor gene Thr307-Ala and Asn680-Ser polymorphisms in male infertility and their association with semen quality and reproductive hormones. BJU International 108:2b, E117-E125
CrossRef5
Maria D Lalioti. (2011) Impact of follicle stimulating hormone receptor variants in fertility. Current Opinion in Obstetrics and Gynecology 23:3, 158-167
CrossRef6
Alejandro Martinez-Aguayo, Mehul T Dattani, John C Achermann. 2011. Gonadotropin Hormones: Disorders. .
CrossRef7
Ursula B. Kaiser. 2011. Gonadotropin Hormones. , 205-260.
CrossRef8
Ying Zhao, Ting Chen, Yuxun Zhou, Kai Li, Junhua Xiao. (2010) An association study between the genetic polymorphisms within GnRHI, LHβ and FSHβ genes and central precocious puberty in Chinese girls. Neuroscience Letters 486:3, 188-192
CrossRef9
Liina Nagirnaja, Kristiina Rull, Liis Uusküla, Pille Hallast, Marina Grigorova, Maris Laan. (2010) Genomics and genetics of gonadotropin beta-subunit genes: Unique FSHB and duplicated LHB/CGB loci. Molecular and Cellular Endocrinology 329:1-2, 4-16
CrossRef10
Daniel J. Bernard, Jérôme Fortin, Ying Wang, Pankaj Lamba. (2010) Mechanisms of FSH synthesis: what we know, what we don't, and why you should care. Fertility and Sterility 93:8, 2465-2485
CrossRef11
Mei-Tsz Su, Chien-Hsiun Chen, Po-Hsiu Kuo, Chao-Chin Hsu, I-Wen Lee, Hisan-An Pan, Ying-Ting Chen, Pao-Lin Kuo. (2010) Polymorphisms of estrogen-related genes jointly confer susceptibility to human spermatogenic defect. Fertility and Sterility 93:1, 141-149
CrossRef12
M. L. Kottler, N. Richard, O. Chabre, S. Alain, J. Young. (2009) FSHβ gene mutation in a female with delayed puberty and hypogonadism: response to recombinant human FSH. Folia Histochemica et Cytobiologica 47:5, S55-S58
CrossRef13
Peter Y. Liu, Johannes D. Veldhuis. 2009. The Hypothalamo-Pituitary Unit, Testes, and Male Accessory Organs. , 283-298.
CrossRef14
Mario Ascoli, David Puett. 2009. The Gonadotropin Hormones and Their Receptors. , 35-55.
CrossRef15
Selma Feldman Witchel, Tony M. Plant. 2009. PubertyGonadarche and Adrenarche. , 395-431.
CrossRef16
Bing Yao, Jian Wang, Wei Liang, Ying-Xia Cui, Yi-Feng Ge. (2008) Follicle-stimulating hormone autoantibody is involved in idiopathic spermatogenic dysfunction. Asian Journal of Andrology 10:6, 915-921
CrossRef17
Koji Murao, Hitomi Imachi, Tomie Muraoka, Mako Fujiwara, Yoshio Kushida, Reiji Haba, Toshihiko Ishida. (2008) Isolated follicle-stimulating hormone (FSH) deficiency without mutation of the FSHβ gene and successful treatment with human menopausal gonadotropin. Fertility and Sterility 90:5, 2012.e17-2012.e19
CrossRef18
Adriana Lofrano-Porto, Luiz Augusto Casulari, Paula P. Nascimento, Leonardo Giacomini, Luciana A. Naves, Lucilia Domingues Casulari da Motta, Lawrence C. Layman. (2008) Effects of follicle-stimulating hormone and human chorionic gonadotropin on gonadal steroidogenesis in two siblings with a follicle-stimulating hormone β subunit mutation. Fertility and Sterility 90:4, 1169-1174
CrossRef19
M. Grigorova, M. Punab, K. Ausmees, M. Laan. (2008) FSHB promoter polymorphism within evolutionary conserved element is associated with serum FSH level in men. Human Reproduction 23:9, 2160-2166
CrossRef20
Howard H. Kim, Peter N. Schlegel. (2008) Endocrine Manipulation in Male Infertility. Urologic Clinics of North America 35:2, 303-318
CrossRef21
Hyung-Goo Kim, Balasubramanian Bhagavath, Lawrence C. Layman. (2008) Clinical Manifestations of Impaired GnRH Neuron Development and Function. Neurosignals 16:2-3, 165-182
CrossRef22
G. Meduri, A. Bachelot, M.P. Cocca, C. Vasseur, P. Rodien, F. Kuttenn, P. Touraine, M. Misrahi. (2008) Molecular pathology of the FSH receptor: New insights into FSH physiology. Molecular and Cellular Endocrinology 282:1-2, 130-142
CrossRef23
Ericka Barbosa Trarbach, Leticia Gontijo Silveira, Ana Claudia Latronico. (2007) Genetic insights into human isolated gonadotropin deficiency. Pituitary 10:4, 381-391
CrossRef24
Lofrano-Porto, Adriana, Barra, Gustavo Barcelos, Giacomini, Leonardo AbdalaNascimento, Paula PiresLatronico, Ana Claudia, Casulari, Luiz Augusto, da Rocha Neves, Francisco de Assis, . (2007) Luteinizing Hormone Beta Mutation and Hypogonadism in Men and Women. New England Journal of Medicine 357:9, 897-904
Full Text25
Ilpo Huhtaniemi, Maria Alevizaki. (2007) Mutations along the hypothalamic–pituitary–gonadal axis affecting male reproduction. Reproductive BioMedicine Online 15:6, 622-632
CrossRef26
Ilpo Huhtaniemi, Maria Alevizaki. (2006) Gonadotrophin resistance. Best Practice & Research Clinical Endocrinology & Metabolism 20:4, 561-576
CrossRef27
Ilpo Huhtaniemi. (2006) Mutations along the pituitary–gonadal axis affecting sexual maturation: Novel information from transgenic and knockout mice. Molecular and Cellular Endocrinology 254-255, 84-90
CrossRef28
John C Achermann, J Larry Jameson. 2006. Gonadotropin Hormones: Disorders. .
CrossRef29
Karina Berger, Haroldo Souza, Vinicius Nahime Brito, Catarina Brasil d'Alva, Berenice Bilharinho Mendonca, Ana Claudia Latronico. (2005) Clinical and hormonal features of selective follicle-stimulating hormone (FSH) deficiency due to FSH beta-subunit gene mutations in both sexes. Fertility and Sterility 83:2, 466-470
CrossRef30
Moshe Phillip, Liora Lazar. (2005) Precocious Puberty: Growth and Genetics. Hormone Research 64:2, 56-61
CrossRef31
Valdes-Socin, Hernán, Salvi, Roberto, Daly, Adrian F., Gaillard, Rolf C., Quatresooz, Pascale, Tebeu, Pierre-Marie, Pralong, François P., Beckers, Albert, . (2004) Hypogonadism in a Patient with a Mutation in the Luteinizing Hormone Beta-Subunit Gene. New England Journal of Medicine 351:25, 2619-2625
Full Text32
Jacques C Giltay, Marjolein Deege, Rien A Blankenstein, Peter M.M Kastrop, Cisca Wijmenga, Tycho T.W.T Lock. (2004) Apparent primary follicle-stimulating hormone deficiency is a rare cause of treatable male infertility. Fertility and Sterility 81:3, 693-696
CrossRef33
Antti Perheentupa, Ilpo Huhtaniemi. (2004) Male contraception - quo vadis?. Acta Obstetricia et Gynecologica Scandinavica 83:2, 131-137
CrossRef34
Ettore Caroppo, Craig Niederberger, Giovanni Michele Vizziello, Giuseppe D'Amato. (2003) Recombinant human follicle-stimulating hormone as a pretreatment for idiopathic oligoasthenoteratozoospermic patients undergoing intracytoplasmic sperm injection. Fertility and Sterility 80:6, 1398-1403
CrossRef35
PAUL G. McDONOUGH. (2003) Molecular Abnormalities of FSH and LH Action. Annals of the New York Academy of Sciences 997:1, 22-34
CrossRef36
Lawrence C Layman. (2003) Genetic causes of human infertility. Endocrinology & Metabolism Clinics of North America 32:3, 549-572
CrossRef37
John K. Amory, William J. Bremner. (2003) Regulation of testicular function in men: implications for male hormonal contraceptive development. The Journal of Steroid Biochemistry and Molecular Biology 85:2-5, 357-361
CrossRef38
C GRACIA, D DRISCOLL. (2003) Molecular basis of pubertal abnormalities. Obstetrics and Gynecology Clinics of North America 30:2, 261-277
CrossRef39
Andrew D Clark, Lawrence C Layman. (2003) Analysis of the Cys82Arg mutation in follicle-stimulating hormone beta (FSHβ) using a novel FSH expression vector. Fertility and Sterility 79:2, 379-385
CrossRef40
Cathy Hay, Frederick Wu. (2002) Genetics and hypogonadotrophic hypogonadism. Current Opinion in Obstetrics and Gynecology 14:3, 303-308
CrossRef41
K. Asatiani, J. Gromoll, S. V. Eckardstein, M. Zitzmann, E. Nieschlag, M. Simoni. (2002) Distribution and function of FSH receptor genetic variants in normal men. Andrologia 34:3, 172-176
CrossRef42
Ilpo T. Huhtaniemi. (2002) The role of mutations affecting gonadotrophin secretion and action in disorders of pubertal development. Best Practice & Research Clinical Endocrinology & Metabolism 16:1, 123-138
CrossRef43
Taneli Raivio, Leo Dunkel. (2002) Inhibins in childhood and puberty. Best Practice & Research Clinical Endocrinology & Metabolism 16:1, 43-52
CrossRef44
Carlo Foresta, Andrea Bettella, Maurizio Merico, Andrea Garolla, Alberto Ferlin, Marco Rossato. (2002) Use of recombinant human follicle-stimulating hormone in the treatment of male factor infertility. Fertility and Sterility 77:2, 238-244
CrossRef45
M Sairam. (2001) The Role of Follicle-Stimulating Hormone in Spermatogenesis Lessons from Knockout Animal Models. Archives of Medical Research 32:6, 601-608
CrossRef46
Polani B. Seshagiri. (2001) Molecular insights into the causes of male infertility. Journal of Biosciences 26:4, 429-435
CrossRef47
John K. Amory, William Bremner. (2001) Endocrine regulation of testicular function in men: implications for contraceptive development. Molecular and Cellular Endocrinology 182:2, 175-179
CrossRef48
René Habert, Hervé Lejeune, José M Saez. (2001) Origin, differentiation and regulation of fetal and adult Leydig cells. Molecular and Cellular Endocrinology 179:1-2, 47-74
CrossRef49
John C Achermann, Jeffrey Weiss, Eun-Jig Lee, J.Larry Jameson. (2001) Inherited disorders of the gonadotropin hormones. Molecular and Cellular Endocrinology 179:1-2, 89-96
CrossRef50
Richard G. Bribiescas. (2001) Reproductive ecology and life history of the human male. American Journal of Physical Anthropology 116:S33, 148-176
CrossRef51
Sophie Christin-Maitre, Claudine Vasseur, Bart Fauser, Philippe Bouchard. (2000) Bioassays of Gonadotropins. Methods 21:1, 51-57
CrossRef52
de Kretser, O'Bryan, Cram, McLachlan. (2000) Expanding our understanding of spermatogenesis: the future genetic tests for infertility. International Journal of Andrology 23:S2, 30-33
CrossRef53
C Foresta, A Bettella, M Merico, A Garolla, M Plebani, A Ferlin, M Rossato. (2000) FSH in the treatment of oligozoospermia. Molecular and Cellular Endocrinology 161:1-2, 89-97
CrossRef54
Lawrence C Layman, Paul G McDonough. (2000) Mutations of follicle stimulating hormone-β and its receptor in human and mouse: genotype/phenotype. Molecular and Cellular Endocrinology 161:1-2, 9-17
CrossRef55
M Zitzmann, E Nieschlag. (2000) Hormone substitution in male hypogonadism. Molecular and Cellular Endocrinology 161:1-2, 73-88
CrossRef56
Lawrence C. Layman. (1999) Genetics of human hypogonadotropic hypogonadism. American Journal of Medical Genetics 89:4, 240-248
CrossRef57
J Levallet. (1999) Follicle-Stimulating Hormone Ligand and Receptor Mutations, and Gonadal Dysfunction. Archives of Medical Research 30:6, 486-494
CrossRef58
Lawrence C. Layman. (1999) The Molecular Basis of Human Hypogonadotropic Hypogonadism. Molecular Genetics and Metabolism 68:2, 191-199
CrossRef59
E. Nieschlag, M. Simoni, J. Gromoll, G. F. Weinbauer. (1999) Role of FSH in the regulation of spermatogenesis: clinical aspects. Clinical Endocrinology 51:2, 139-146
CrossRef60
I. Huhtaniemi, M. Jiang, C. Nilsson, K. Pettersson. (1999) Mutations and polymorphisms in gonadotropin genes. Molecular and Cellular Endocrinology 151:1-2, 89-94
CrossRef61
Lawrence C Layman. (1999) Mutations in human gonadotropin genes and their physiologic significance in puberty and reproduction. Fertility and Sterility 71:2, 201-218
CrossRef
