Original Article
Association of Mutations in the Apolipoprotein B Gene with Hypercholesterolemia and the Risk of Ischemic Heart Disease
N Engl J Med 1998; 338:1577-1584May 28, 1998
- Abstract
Background
Familial hypercholesterolemia leads to premature ischemic heart disease and is often caused by mutations in the gene for the low-density lipoprotein receptor. Mutations in the apolipoprotein B gene, which encodes a ligand for this receptor, may also result in this phenotype.
Methods
We studied the genotypes of 9255 women and men from the general population, 948 patients with ischemic heart disease, and 36 patients with familial hypercholesterolemia, all from Denmark, for three mutations in the apolipoprotein B gene: Arg3500Gln, Arg3531Cys, and Arg3500Trp.
Results
The prevalence of heterozygotes in the general population was 0.08 percent (95 percent confidence interval, 0.03 to 0.16 percent) for both the Arg3500Gln and the Arg3531Cys mutations, and 0.00 percent (95 percent confidence interval, 0.00 to 0.18 percent) for the Arg3500Trp mutation. Among carriers of the Arg3500Gln mutation, cholesterol levels were significantly higher than among noncarriers in the general population — by 100 mg per deciliter (2.6 mmol per liter) among carriers in the general population, 154 mg per deciliter (4.0 mmol per liter) among patients with ischemic heart disease, and 172 mg per deciliter (4.5 mmol per liter) among patients with familial hypercholesterolemia. Heterozygous carriers of the Arg3500Gln mutation were significantly more common among patients with ischemic heart disease (odds ratio, 7.0; 95 percent confidence interval, 2.2 to 22; P=0.003) and patients with familial hypercholesterolemia (odds ratio, 78; 95 percent confidence interval, 16 to 388; P=0.001) than in the general population. Heterozygous carriers of the Arg3531Cys mutation in the general population did not have higher-than-normal plasma cholesterol levels or an increased risk of ischemic heart disease (odds ratio; 1.4; 95 percent confidence interval, 0.2 to 11; P=0.54).
Conclusions
The Arg3500Gln mutation in the apolipoprotein B gene, which is responsible for familial defective apolipoprotein B-100 and is present in approximately 1 in 1000 persons in Denmark, causes severe hypercholesterolemia and increases the risk of ischemic heart disease.
Media in This Article
Figure 1
Mean Percentiles for Plasma Lipids, Lipoproteins, Apolipoproteins, and Age in Heterozygous Carriers of Arg3500Gln or Arg3531Cys in the General Population.Table 1
Characteristics of the Subjects Who Were Heterozygous for Arg3500Gln or Arg3531Cys.Article Activity
- Article
Elevated plasma low-density lipoprotein (LDL) cholesterol levels are causally related to ischemic heart disease,1,2 and a reduction in these levels reduces the incidence of ischemic heart disease3-5 and the associated mortality rate.3,4 Elevated LDL cholesterol levels may be caused by decreased removal of LDL from plasma, as a result of either mutations in the LDL-receptor gene, as in classic familial hypercholesterolemia,6 or mutations in the apolipoprotein B (APOB) gene that affect the binding of LDL to the LDL receptor. Apolipoprotein B is the chief protein component of LDL and serves as the ligand for the removal of LDL from the circulation by the LDL receptor.
Despite intensive research in this field,7-15 only three such mutations in APOB have been identified: Arg3500Gln, which is responsible for familial defective apolipoprotein B-1007,10; Arg3531Cys8; and Arg3500Trp.9 However, since familial defective apolipoprotein B-100 has with few exceptions been identified only among patients with hyperlipidemia or familial hypercholesterolemia11-13 and not in the general population, the estimate of the frequency of this mutation in the adult general population is only approximate, the effect of the mutation on cholesterol levels is probably overestimated, and the risk of ischemic heart disease associated with this mutation is not known. Neither the frequencies of Arg3531Cys8,14,15 and Arg3500Trp9 in the general population nor their effect on hyperlipidemia and the risk of ischemic heart disease is known.
From a practical point of view, in order to be of clinical value for screening, a mutation in APOB must be both relatively frequent and associated with hypercholesterolemia, and thus with an increased risk of ischemic heart disease. We studied the three mutations in APOB to see whether they fulfill these criteria.
Methods
Subjects
To obtain subjects from the general population, we recruited 5121 women and 4134 men who had participated in the Copenhagen City Heart Study from 1991 through 1994.16-18 We screened participants for manifestations of ischemic heart disease by reviewing all hospital admissions and diagnoses entered in the Danish National Hospital Discharge Register. The diagnoses were based on the International Classification of Diseases, eighth revision (ischemic heart disease codes 410 through 414).
Patients with ischemic heart disease were identified among 992 consecutive female and male patients from the greater Copenhagen area who were referred for coronary angiography from 1991 through 1993.16,17 All patients were evaluated by experienced cardiologists at Rigshospitalet, National University Hospital, Copenhagen. Among these, 948 patients (248 women and 700 men) had ischemic heart disease with characteristic symptoms of stable angina according to the guidelines of the European Society of Cardiology19 on the basis of the location, character, and duration of pain and the relation of pain to exercise, plus at least one of the following: severe stenosis on coronary angiography (≥70 percent stenosis of at least one coronary artery or ≥50 percent stenosis of the left main coronary artery), a previous myocardial infarction, or a positive exercise electrocardiography test.
Thirty-six apparently unrelated patients (4 women and 32 men) with a clinical diagnosis of familial hypercholesterolemia were selected from a larger population of patients attending the lipid clinic at Rigshospitalet. The diagnosis was based on the following criteria: a plasma total cholesterol level above 309 mg per deciliter (8.0 mmol per liter) and a plasma LDL cholesterol level above 232 mg per deciliter (6.0 mmol per liter), tendinous xanthomas in the patient or a first-degree relative, and a history of hypercholesterolemia, ischemic heart disease, or both in a first-degree relative before the age of 60 years.
In all groups, more than 99 percent were white and nearly 99 percent were of Danish descent. All the participants gave informed consent. The studies were approved by the relevant ethics committees.
DNA Analyses
The Arg3500Gln and Arg3531Cys mutations are caused by the substitution of adenine for guanine at position 10,699 of complementary DNA20 and thymine for cytosine at position 10,791, respectively, in exon 26 of the APOB gene.7,8 The presence of either mutation was determined in pooled samples21 by the polymerase chain reaction (PCR): there was a common band of 334 bp and a mutation-specific band of 167 bp in the case of Arg3500Gln and 111 bp in the case of Arg3531Cys.
Three primers were used in the PCR for the detection of Arg3500Gln (5'GACCACAAGCTTAGCTTGG3', 1 μmol per liter; 5'GGGTGGCTTTGCTTGTATG3', 0.025 μmol per liter; and 5'TGCAGCTTCACTGAACACT3', 1 μmol per liter) and Arg3531Cys (5'GACCACAAGCTTAGCTTGG3', 0.025 μmol per liter; 5'GGGTGGCTTTGCTTGTATG3', 1 μmol per liter; and 5'GAGAAGCCACACTCAAAT3', 1 μmol per liter); mutations in allele-specific primers are printed in italic, and mismatches in primers are underlined. Annealing temperatures for the two procedures were 48°C and 55°C, respectively, and all reactions were performed in a total volume of 50 μl, with the concentrations of primers as indicated, 1 U of Taq polymerase, 200 μmol of each deoxynucleoside triphosphate per liter, 1.5 mmol of magnesium chloride per liter, 1× buffer (200 mM TRIS–hydrochloride, pH 8.4, and 500 mM potassium chloride), and 0.1 to 0.2 μg of DNA. When a mutation was identified in a pooled sample, DNA from each of the 20 subjects in the sample was again subjected to PCR, followed by digestion with MspI 22 or NsiI, to confirm the diagnosis and to determine zygosity. The Arg3500Trp mutation is caused by the substitution of thymine for cytosine at position 10,69820 in exon 26 of the APOB gene.9 Two primers were used in the PCR (5'GTGTCAGTGGCAAAAACCACA3', 1 μmol per liter; and 5'CAGAGGGAATATATGCGTTGG3', 1 μmol per liter), and the annealing temperature was 57°C. The other reagents and conditions of the PCR were as described above. All patients with familial hypercholesterolemia or ischemic heart disease, as well as the 2021 subjects from the general population who had plasma cholesterol and apolipoprotein B levels above the 70th percentile for age and sex, were screened for the Arg3500Trp mutation. PCR, followed by digestion with Hsp92II, revealed common bands of 108 bp and 314 bp and a mutation-specific band of 206 bp.
Other Analyses
Colorimetric and turbidimetric assays were used to measure plasma levels of total cholesterol, high-density lipoprotein (HDL) cholesterol, triglycerides, and apolipoproteins B and AI (all Boehringer Mannheim, Mannheim, Germany) and lipoprotein(a) (DAKO, Glostrup, Denmark); LDL cholesterol levels were calculated with the equation of Friedewald et al.23
Statistical Analysis
Prevalence estimates of the three mutations were expressed as percentages with exact binomial 95 percent confidence intervals.24 Remaining data were analyzed with the SPSS program.25 To examine the effect of the Arg3500Gln and Arg3531Cys mutations on the phenotype in carriers identified in the general population, we converted values for continuous variables for carriers to their respective percentiles11 and compared them with the values for the general population as a whole, using z-scores, as described previously.21,26 In the general-population sample, phenotypes of subjects who were heterozygous for either Arg3500Gln or Arg3531Cys were compared by the Mann–Whitney U test with an exact two-tailed probability. Categorical variables were compared by Fisher's exact test. We calculated the absolute increase in a given variable in heterozygotes by subtracting the 50th percentile value for age and sex in the general population from the value for the individual subject; the median increases or decreases were compared by the Mann–Whitney U test with an exact two-tailed probability. The ability of the presence of the mutations to predict ischemic heart disease and familial hypercholesterolemia was expressed as an odds ratio with approximated 95 percent confidence intervals; Fisher's exact test was used as the test of independence. All P values were two-sided. A P value of less than 0.05 was considered to indicate statistical significance.
Results
Frequencies of APOB Mutations
The Arg3500Gln and Arg3531Cys mutations were each identified in 7 of the 9255 subjects in the general population (carrier frequency, 0.08 percent). All 14 subjects were heterozygous for the mutations. Five patients with ischemic heart disease and two patients with familial hypercholesterolemia were heterozygous for the Arg3500Gln mutation, and one patient with ischemic heart disease was heterozygous for the Arg3531Cys mutation. The Arg3500Trp mutation was not identified among the 2021 subjects with hypercholesterolemia in the general population, the 948 patients with ischemic heart disease, or the 36 patients with familial hypercholesterolemia.
Phenotypic Characteristics of Heterozygous Carriers of APOB Mutations in the General Population
The characteristics of the 22 heterozygous carriers of Arg3500Gln or Arg3531Cys are shown in Table 1Table 1
Characteristics of the Subjects Who Were Heterozygous for Arg3500Gln or Arg3531Cys.. Figure 1Figure 1Mean Percentiles for Plasma Lipids, Lipoproteins, Apolipoproteins, and Age in Heterozygous Carriers of Arg3500Gln or Arg3531Cys in the General Population. shows the age-adjusted and sex-adjusted percentiles of lipid, lipoprotein, and apolipoprotein values for heterozygous subjects in the general population. Subjects who were heterozygous for Arg3500Gln had significantly higher plasma cholesterol levels (mean percentile, 93rd; 95 percent confidence interval, 84th to 100th), LDL cholesterol levels (mean percentile, 95th; 95 percent confidence interval, 89th to 100th), and apolipoprotein B levels (mean percentile, 95th; 95 percent confidence interval, 88th to 100th) than either the general population as a whole (P<0.001 for all comparisons) or carriers of the Arg3531Cys mutation (P=0.001, P=0.001, and P=0.003, respectively). Although the percentiles for HDL cholesterol (P=0.09) and apolipoprotein AI (P=0.10) tended to be lower among Arg3500Gln heterozygotes than in the general population, the percentiles for triglycerides, lipoprotein(a), and age (Figure 1) as well as the mean fibrinogen levels, glucose levels, body-mass index, and ratio of waist to hip circumference (data not shown) in this group were not significantly different from values in the general population.Subjects from the general population who were heterozygous for the Arg3500Gln mutation had a significantly increased frequency of ischemic heart disease (odds ratio, 13; 95 percent confidence interval, 3 to 56; P=0.005), hypertension (odds ratio, 10; 95 percent confidence interval, 2 to 51; P=0.005), and peripheral arterial disease (odds ratio, 10; 95 percent confidence interval, 2 to 43; P=0.01) as compared with noncarriers in the general population, whereas sex distribution, smoking habits, frequencies of xanthelasma and arcus corneae, diabetes mellitus, and ischemic stroke were similar in the two groups (data not shown).
There were no significant differences in any of the above-mentioned variables, continuous or categorical, between carriers of Arg3531Cys in the general population sample and noncarriers (Figure 1, Table 1, and data not shown).
Phenotypic Characteristics of Heterozygous Carriers of APOB Mutations in the General Population and of the Patients
Heterozygous carriers of the Arg3500Gln mutation in the general population had higher median plasma cholesterol, LDL cholesterol, and apolipoprotein B levels, by 100 mg per deciliter (2.6 mmol per liter), 82 mg per deciliter (2.1 mmol per liter), and 43 mg per deciliter, respectively, than mutation noncarriers of the same age and sex (Table 2Table 2
Effect of the Arg3500Gln and Arg3531Cys Mutations on Cholesterol, LDL Cholesterol, and Apolipoprotein B Levels in Heterozygous Carriers.). Median plasma cholesterol levels were even higher in patients with ischemic heart disease or familial hypercholesterolemia who had the mutation than in carriers in the general population (P=0.03). A similar trend was observed for LDL cholesterol levels (P=0.16).There was no such increase in plasma cholesterol, LDL cholesterol, or apolipoprotein B levels in carriers of Arg3531Cys in the general population (Table 2). However, the one patient with ischemic heart disease with this mutation had increases in plasma cholesterol and LDL cholesterol that were similar to those of carriers of Arg3500Gln.
APOB Mutations and the Risk of Ischemic Heart Disease and Familial Hypercholesterolemia
The Arg3500Gln mutation was significantly more frequent among patients with ischemic heart disease than in the general population (odds ratio, 7.0; 95 percent confidence interval, 2.2 to 22; P=0.003) (Table 3Table 3
Frequencies of and Odds Ratios for Ischemic Heart Disease and Familial Hypercholesterolemia among Subjects Heterozygous for Arg3500Gln, Arg3500Trp, or Arg3531Cys.) and, as mentioned above, was also significantly more common among patients with ischemic heart disease in the general-population sample than in those without ischemic heart disease in the general population. The odds ratio for familial hypercholesterolemia for the same mutation was also significant (odds ratio, 78; 95 percent confidence interval, 16 to 388; P=0.001) (Table 3).The Arg3531Cys mutation was not more frequent among patients with ischemic heart disease than in the general population sample (odds ratio, 1.4; 95 percent confidence interval, 0.2 to 11; P=0.54) (Table 3) and was not identified among subjects with ischemic heart disease in the general-population sample or among patients with familial hypercholesterolemia.
Discussion
Among Danes, as among most other white populations, the frequency of clinically diagnosed heterozygous familial hypercholesterolemia is about 0.2 percent.6,27 Approximately 6 percent of patients with clinical familial hypercholesterolemia are carriers of the Arg3500Gln mutation (Table 3),11 which is responsible for familial defective apolipoprotein B-100,10 whereas the rest have different LDL-receptor mutations.6 Our data indicate that Arg3500Gln occurs at a frequency of 0.08 percent (approximately 1 in 1000) in a general population of whites, and is associated with considerably higher than normal plasma cholesterol levels (by 100 mg per deciliter), and an increased risk of ischemic heart disease (odds ratio, 7.0). In contrast, the Arg3531Cys mutation, which is just as common, is not in itself associated with hypercholesterolemia or an increased risk of ischemic heart disease.
Arg3500Gln
The frequency of Arg3500Gln was slightly lower in our study than in studies of patients with familial hypercholesterolemia or type IIa hyperlipidemia.11,13 In probands in the general population sample, the average effect of this substitution on plasma cholesterol and LDL cholesterol levels after correction for the effect of age and sex was substantial: the respective levels were 100 and 82 mg per deciliter higher than in the general population. These values were similar to those reported in carriers identified among patients with moderate hypercholesterolemia from the United States, Canada, and Austria,28 though lower than the value of 116 mg per deciliter (3 mmol per liter) for both variables reported earlier, which were measured in 135 carriers identified mainly among patients with hypercholesterolemia from eight countries.13 This finding is in keeping with further results of our study, which suggest that the effect of this mutation on cholesterol levels was overestimated among patients with ischemic heart disease and familial hypercholesterolemia — most likely reflecting the fact that high cholesterol levels are a risk factor for ischemic heart disease as well as one of the clinical criteria used in the diagnosis of familial hypercholesterolemia. Thus, as a consequence of the study design, carriers identified in a group of patients with ischemic heart disease and familial hypercholesterolemia may have higher cholesterol levels than carriers identified in the general population.
We also found that the risk of ischemic heart disease in carriers of Arg3500Gln was seven times that of subjects in the general population as a whole. This finding was substantiated by the finding of a greatly increased risk of ischemic heart disease in Arg3500Gln carriers (odds ratio, 13), when the frequencies of this mutation in subjects with ischemic heart disease and those without it in the general-population sample were compared. In addition, carriers had an increased risk of peripheral arterial disease (odds ratio, 10) and hypertension (odds ratio, 10) when carriers and noncarriers in the general population were compared. A possible explanation of the increased risk of hypertension in carriers could be the presence of widespread atherosclerosis.
Arg3531Cys
The Arg3531Cys mutation has previously been identified in eight subjects,8,14,15 six of whom had hypercholesterolemia. However, all eight carriers were identified among either patients with hyperlipidemia who were attending lipid clinics8,15 or patients with coronary artery disease14; therefore, the presence of hyperlipidemia could be a consequence of the study design. In support of this theory is the fact that there was an absence of simple cosegregation of this mutation with the hypercholesterolemia in two of the studies8,15; no family data were available in the third study.14 The one patient in our study who had ischemic heart disease and the Arg3531Cys mutation, a 77-year-old man, was the only one of eight carriers who also had hypercholesterolemia. He did not have a family history of either hypercholesterolemia or premature ischemic heart disease. It therefore seems likely that this patient may have had another cause of hypercholesterolemia. Taken together, the absence of simple cosegregation in families, the absence of a family history in our patient with coronary artery disease, and the complete absence of hypercholesterolemia in any carriers in the general population in our study suggest that this mutation is not sufficient to cause hypercholesterolemia.
Although a previous study suggested a borderline overrepresentation of the Arg3531Cys mutation in patients with coronary artery disease as compared with healthy controls,15 our results suggest that this mutation, in keeping with the absence of an association with hypercholesterolemia, is also not associated with an increased risk of ischemic heart disease. However, it is possible that this mutation, when present with other factors such as hypertension, low HDL cholesterol levels, the apolipoprotein E ε4 allele, and hypertriglyceridemia or factors affecting the binding of apolipoprotein B to the LDL receptor, slightly increases susceptibility to hypercholesterolemia and ischemic heart disease.
Arg3500Trp
The Arg3500Trp mutation has been identified in 2 of 907 subjects with hyperlipidemia who were attending a lipid clinic.9 We did not identify this mutation among 36 patients with familial hypercholesterolemia, 948 patients with ischemic heart disease, or 2021 subjects in the general population with cholesterol and apolipoprotein B levels above the 70th percentile for age and sex. This implies that in Denmark this mutation is not a common cause of either hypercholesterolemia or ischemic heart disease.
A potential limitation of our study was that all the subjects from the general population were 20 years of age or older; any effect of the mutations on early mortality would therefore bias the results toward a lower prevalence of a given mutation and thus perhaps lead to an underestimate of the odds ratio for ischemic heart disease. Such an effect does not seem very likely for the Arg3500Gln mutation, since the frequency of 0.08 percent in this study is very similar to the frequency of 5 in 5000 reported in Danish newborns.29 Given that the other two mutations studied have a similar9 or much less severe8,14 effect on apolipoprotein B dysfunction in vitro than the Arg3500Gln mutation and that neither segregates with cholesterol levels in families, an effect on early mortality of these mutations seems very unlikely.
In most white populations, the estimated frequency of Arg3500Gln ranges from 1 in 500 to 1 in 1000 and has been associated with hypercholesterolemia in studies both in vitro and in vivo.11,13 The generalizability of our data on Arg3531Cys and Arg3500Trp to other white populations is not completely clear. The available data suggest that the frequency of Arg3531Cys is similar to that in the general population in our study and that this mutation is not associated with hypercholesterolemia, whereas Arg3500Trp is probably very rare and also not associated with hypercholesterolemia.8,9,11,14,15,30
Most studies searching for new mutations in the APOB gene potentially associated with hypercholesterolemia have concentrated on screening the presumed receptor-binding region8,9,14,15,30 in patients with hyperlipidemia and have used either reduced binding to the LDL receptor or other in vitro measures of apolipoprotein B dysfunction as an indicator of probable hypercholesterolemia in vivo. With the use of these methods only three such rare mutations have been identified, and these are the ones we studied. It is possible that mutations contributing to defective binding of apolipoprotein B may lie elsewhere in the gene or that there are common genetic variations in APOB that have only relatively small effects on cholesterol levels and are not detectable by these methods.
In conclusion, our results suggest that the Arg3500Gln mutation is at present the only known APOB mutation worth screening for in white patients with hypercholesterolemia or ischemic heart disease and their relatives.
Supported by the Danish Heart Foundation and by Chief Physician Johan Boserup and Lise Boserup's Fund.
Source Information
From the Department of Clinical Biochemistry, Herlev University Hospital, University of Copenhagen, Herlev (A.T.-H., B.G.N.); and the Department of Medicine B, Division of Cardiology (R.S., H.M.), and the Copenhagen City Heart Study (A.T.-H., P.S., B.G.N.), Rigshospitalet, National University Hospital, University of Copenhagen, Copenhagen — both in Denmark.
Address reprint requests to Dr. Tybjærg-Hansen at the Department of Clinical Biochemistry 54M1, Herlev University Hospital, Herlev Ringvej 75, DK-2730 Herlev, Denmark.
- References
References
1
Carleton RA ,Dwyer J ,Finberg L , et al. Report of the Expert Panel on Population Strategies for Blood Cholesterol Reduction: a statement from the National Cholesterol Education Program, National Heart, Lung, and Blood Institute, National Institutes of Health. Circulation 1991;83:2154-2232
Web of Science | Medline2
Pyorala K ,De Backer G ,Graham I ,Poole-Wilson P ,Wood D . Prevention of coronary heart disease in clinical practice: recommendations of the Task Force of the European Society of Cardiology, European Atherosclerosis Society and European Society of Hypertension. Eur Heart J 1994;15:1300-1331
Web of Science | Medline3
Scandinavian Simvastatin Survival Study Group
Web of Science | Medline4
Shepherd J ,Cobbe SM ,Ford I , et al. Prevention of coronary heart disease with pravastatin in men with hypercholesterolemia. N Engl J Med 1995;333:1301-1307
Full Text | Web of Science | Medline5
Sacks FM ,Pfeffer MA ,Moye LA , et al. The effect of pravastatin on coronary events after myocardial infarction in patients with average cholesterol levels. N Engl J Med 1996;335:1001-1009
Full Text | Web of Science | Medline6
Goldstein JL, Hobbs HH, Brown MS. Familial hypercholesterolemia. In: Scriver CR, Beaudet AL, Sly WS, Valle D, eds. The metabolic and molecular bases of inherited disease. 7th ed. Vol. 2. New York: McGraw-Hill, 1995:1981-2030.
7
Soria LF ,Ludwig EH ,Clarke HRG ,Vega GL ,Grundy SM ,McCarthy BJ . Association between a specific apolipoprotein B mutation and familial defective apolipoprotein B-100. Proc Natl Acad Sci U S A 1989;86:587-591
CrossRef | Web of Science | Medline8
Pullinger CR ,Hennessy LK ,Chatterton JE , et al. Familial ligand-defective apolipoprotein B: identification of a new mutation that decreases LDL receptor binding affinity. J Clin Invest 1995;95:1225-1234
CrossRef | Web of Science | Medline9
Gaffney D ,Reid JM ,Cameron IM , et al. Independent mutations at codon 3500 of the apolipoprotein B gene are associated with hyperlipidemia. Arterioscler Thromb Vasc Biol 1995;15:1025-1029
CrossRef | Web of Science | Medline10
Innerarity TL ,Weisgraber KH ,Arnold KS , et al. Familial defective apolipoprotein B-100: low density lipoproteins with abnormal receptor binding. Proc Natl Acad Sci U S A 1987;84:6919-6923
CrossRef | Web of Science | Medline11
Tybjaerg-Hansen A ,Humphries SE . Familial defective apolipoprotein B-100: a single mutation that causes hypercholesterolemia and premature coronary artery disease. Atherosclerosis 1992;96:91-107
CrossRef | Web of Science | Medline12
Myant NB . Familial defective apolipoprotein B-100: a review, including some comparisons with familial hypercholesterolaemia. Atherosclerosis 1993;104:1-18
CrossRef | Web of Science | Medline13
Tybjaerg-Hansen A . Rare and common mutations in hyperlipidemia and atherosclerosis: with special reference to familial defective apolipoprotein B-100. Scand J Clin Lab Invest Suppl 1995;220:57-76
Medline14
Ludwig EH ,Hopkins PN ,Allen A , et al. Association of genetic variations in apolipoprotein B with hypercholesterolemia, coronary artery disease, and receptor binding of low density lipoproteins. J Lipid Res 1997;38:1361-1373
Web of Science | Medline15
Wenham PR ,Henderson BG ,Penney MD ,Ashby JP ,Rae PWH ,Walker SW . Familial ligand-defective apolipoprotein B-100: detection, biochemical features and haplotype analysis of the R3531C mutation in the UK. Atherosclerosis 1997;129:185-192
CrossRef | Web of Science | Medline16
Wittrup HH ,Tybjaerg-Hansen A ,Abildgaard S ,Steffensen R ,Schnohr P ,Nordestgaard BG . A common substitution (Asn291Ser) in lipoprotein lipase is associated with increased risk of ischemic heart disease. J Clin Invest 1997;99:1606-1613
CrossRef | Web of Science | Medline17
Agerholm-Larsen B ,Nordestgaard BG ,Steffensen R ,Sorensen TIA ,Jensen G ,Tybjaerg-Hansen A . ACE gene polymorphism: ischemic heart disease and longevity in 10,150 individuals: a case-referent and retrospective cohort study based on the Copenhagen City Heart Study. Circulation 1997;95:2358-2367
Web of Science | Medline18
Tybjaerg-Hansen A ,Agerholm-Larsen B ,Humphries SE ,Abild-gaard S ,Schnohr P ,Nordestgaard BG . A common mutation (G-455→A) in the β-fibrinogen promoter is an independent predictor of plasma fibrinogen, but not of ischemic heart disease: a study of 9,127 individuals based on the Copenhagen City Heart Study. J Clin Invest 1997;99:3034-3039
CrossRef | Web of Science | Medline19
Management of stable angina pectoris: recommendations of the Task Force of the European Society of Cardiology
Web of Science | Medline20
Cladaras C ,Hadzopoulou-Cladaras M ,Nolte RT ,Atkinson D ,Zannis VI . The complete sequence and structural analysis of human apolipoprotein B-100: relationship between apoB-100 and apoB-48 forms. EMBO J 1986;5:3495-3507
Web of Science | Medline21
Nordestgaard BG ,Abildgaard S ,Wittrup HH ,Steffensen R ,Jensen G ,Tybjaerg-Hansen A . Heterozygous lipoprotein lipase deficiency: frequency in the general population, effect on plasma lipid levels, and risk of ischemic heart disease. Circulation 1997;96:1737-1744
Web of Science | Medline22
Hansen PS ,Rudiger N ,Tybjaerg-Hansen A ,Faergeman O ,Greger-sen N . Detection of the apoB-3500 mutation (glutamine for arginine) by gene amplification and cleavage with MspI. J Lipid Res 1991;32:1229-1233
Web of Science | Medline23
Friedewald WT ,Levy RI ,Fredrickson DS . Estimation of the concentration of low-density lipoprotein cholesterol in plasma, without use of the preparative ultracentrifuge. Clin Chem 1972;18:499-502
Web of Science | Medline24
StatMate, version 1.0. San Diego, Calif.: GraphPad Software, 1995.
25
SPSS base 7.0 for Windows user's guide. Chicago: SPSS, 1996.
26
Armitage P, Berry G. Statistical methods in medical research. 2nd ed. Oxford, England: Blackwell Scientific, 1987:67-72, 506-7.
27
Andersen GE ,Lous P ,Friis-Hansen B . Screening for hyperlipoproteinemia in 10,000 Danish newborns: follow-up studies in 522 children with elevated cord serum VLDL-LDL-cholesterol. Acta Paediatr Scand 1979;68:541-545
CrossRef | Web of Science | Medline28
Innerarity TL ,Mahley RW ,Weisgraber KH , et al. Familial defective apolipoprotein B-100: a mutation of apolipoprotein B that causes hypercholesterolemia. J Lipid Res 1990;31:1337-1349
Web of Science | Medline29
Hansen PS ,Norgaard-Petersen B ,Meinertz H , et al. Incidence of the apolipoprotein B-3500 mutation in Denmark. Clin Chim Acta 1994;230:101-104
CrossRef | Web of Science | Medline30
Talmud PJ ,Tamplin OJ ,Heath K ,Gaffney D ,Day INM ,Humphries SE . Rapid testing for three mutations causing familial defective apolipoprotein B100 in 562 patients with familial hypercholesterolaemia. Atherosclerosis 1996;125:135-137
CrossRef | Web of Science | Medline
- Citing Articles (55)
Citing Articles
1
Fathimath Faiz, Amanda J. Hooper, Frank M. van Bockxmeer. (2012) Molecular pathology of familial hypercholesterolemia, related dyslipidemias and therapies beyond the statins. Critical Reviews in Clinical Laboratory Sciences1-17
CrossRef2
Rosanne M Crooke, Mark J Graham. (2011) Therapeutic potential of antisense oligonucleotides for the management of dyslipidemia. Clinical Lipidology 6:6, 675-692
CrossRef3
Brandon Ason, Jose Castro-Perez, Samnang Tep, Alice Stefanni, Marija Tadin-Strapps, Thomas Roddy, Thomas Hankemeier, Brian Hubbard, Alan B. Sachs, W. Michael Flanagan, Nelly A. Kuklin, Lyndon J. Mitnaul. (2011) ApoB siRNA-induced Liver Steatosis is Resistant to Clearance by the Loss of Fatty Acid Transport Protein 5 (Fatp5). Lipids 46:11, 991-1003
CrossRef4
Karel Kotaska, Jitka Kolarova, Katerina Kotrcova, Jana Cepova, Richard Prusa. (2011) Correlation Between Common Genetic Variants and Risk Factors Associated with Prediction of Cardiovascular Diseases in Dyslipidemic Patients. Genetic Testing and Molecular Biomarkers110915133845007
CrossRef5
Børge G Nordestgaard, Anne Tybjærg-Hansen. (2011) Genetic determinants of LDL, lipoprotein(a), triglyceride-rich lipoproteins and HDL: concordance and discordance with cardiovascular disease risk. Current Opinion in Lipidology 22:2, 113-122
CrossRef6
Michael V. Holmes, Seamus Harrison, Philippa J. Talmud, Aroon D. Hingorani, Steve E. Humphries. (2011) Utility of genetic determinants of lipids and cardiovascular events in assessing risk. Nature Reviews Cardiology 8:4, 207-221
CrossRef7
M. Benn, A. Tybjaerg-Hansen, S. Stender, R. Frikke-Schmidt, B. G. Nordestgaard. (2011) Low-Density Lipoprotein Cholesterol and the Risk of Cancer: A Mendelian Randomization Study. JNCI Journal of the National Cancer Institute 103:6, 508-519
CrossRef8
B. G. Nordestgaard, M. J. Chapman, K. Ray, J. Boren, F. Andreotti, G. F. Watts, H. Ginsberg, P. Amarenco, A. Catapano, O. S. Descamps, E. Fisher, P. T. Kovanen, J. A. Kuivenhoven, P. Lesnik, L. Masana, Z. Reiner, M.-R. Taskinen, L. Tokgozoglu, A. Tybjaerg-Hansen, . (2010) Lipoprotein(a) as a cardiovascular risk factor: current status. European Heart Journal 31:23, 2844-2853
CrossRef9
Irene LAMBRINOUDAKI, Eleni ARMENI, George J. KAPAROS, George E. CHRISTODOULAKOS, Theodor N. SERGENTANIS, Andreas ALEXANDROU, Maria CREATSA, Evangelia KOUSKOUNI. (2010) The frequency of early, spontaneous miscarriage associated with the leu33pro polymorphism of Glycoprotein IIIa: A pilot study. Australian and New Zealand Journal of Obstetrics and Gynaecology 50:5, 485-490
CrossRef10
S. Yazdanyar, B. G. Nordestgaard. (2010) NOD2/CARD15 genotype, cardiovascular disease and cancer in 43 600 individuals from the general population. Journal of Internal Medicine 268:2, 162-170
CrossRef11
Maartje E Visser, John JP Kastelein, Erik SG Stroes. (2010) Apolipoprotein B synthesis inhibition: results from clinical trials. Current Opinion in Lipidology 21:4, 319-323
CrossRef12
Christopher Newton-Cheh, J. Gustav Smith. (2010) What Can Human Genetics Teach Us About the Causes of Cardiovascular Disease?
Editorials published in the Journal of the American College of Cardiology reflect the views of the authors and do not necessarily represent the views of JACC or the American College of Cardiology.. Journal of the American College of Cardiology 55:25, 2843-2845
CrossRef13
K. T. Love, K. P. Mahon, C. G. Levins, K. A. Whitehead, W. Querbes, J. R. Dorkin, J. Qin, W. Cantley, L. L. Qin, T. Racie, M. Frank-Kamenetsky, K. N. Yip, R. Alvarez, D. W. Y. Sah, A. de Fougerolles, K. Fitzgerald, V. Koteliansky, A. Akinc, R. Langer, D. G. Anderson. (2010) Lipid-like materials for low-dose, in vivo gene silencing. Proceedings of the National Academy of Sciences 107:5, 1864-1869
CrossRef14
Ruth Frikke-Schmidt. (2010) Genetic variation in the ABCA1 gene, HDL cholesterol, and risk of ischemic heart disease in the general population. Atherosclerosis 208:2, 305-316
CrossRef15
Tiffany Thomas, Henry Ginsberg. (2010) Development of Apolipoprotein B Antisense Molecules as a Therapy for Hyperlipidemia. Current Atherosclerosis Reports 12:1, 58-65
CrossRef16
Marianne Benn. (2009) Apolipoprotein B levels, APOB alleles, and risk of ischemic cardiovascular disease in the general population, a review. Atherosclerosis 206:1, 17-30
CrossRef17
Irene Lambrinoudaki, George Kaparos, Demetrios Rizos, Fotini Galapi, Andreas Alexandrou, Theodoros N. Sergentanis, Maria Creatsa, George Christodoulakos, E. Kouskouni, D. Botsis. (2009) Apolipoprotein E and Paraoxonase 1 polymorphisms are associated with lower serum thyroid hormones in postmenopausal women. Clinical Endocrinology 71:2, 284-290
CrossRef18
Joanna Nelken, Reza Meshkani, Nita Chahal, Brian McCrindle, Khosrow Adeli. (2008) Detection of familial defective apoB (FDB) mutations in hypercholesterolemic children and adolescents by denaturing high performance liquid chromatography (DHPLC). Clinical Biochemistry 41:6, 395-399
CrossRef19
Shah Ebrahim, George Davey Smith. (2008) Mendelian randomization: can genetic epidemiology help redress the failures of observational epidemiology?. Human Genetics 123:1, 15-33
CrossRef20
M Varret, M Abifadel, J-P Rabès, C Boileau. (2008) Genetic heterogeneity of autosomal dominant hypercholesterolemia. Clinical Genetics 73:1, 1-13
CrossRef21
Juraj Gašparovič, Zuzana Bašistová, L’ubomíra Fábryová, Ladislava Wsólová, Branislav Vohnout, Katarína Rašlová. (2007) Familial defective apolipoprotein B-100 in Slovakia. Atherosclerosis 194:2, e95-e107
CrossRef22
Greg Dyson, Ruth Frikke-Schmidt, Børge G. Nordestgaard, Anne Tybjærg-Hansen, Charles F. Sing. (2007) An application of the patient rule-induction method for evaluating the contribution of theApolipoprotein E andLipoprotein Lipase genes to predicting ischemic heart disease. Genetic Epidemiology 31:6, 515-527
CrossRef23
Fatima Akdim, Erik SG Stroes, John JP Kastelein. (2007) Antisense apolipoprotein B therapy: where do we stand?. Current Opinion in Lipidology 18:4, 397-400
CrossRef24
Fatima Akdim, Karim El Harchaoui, Erik SG Stroes, John JP Kastelein. (2007) Antisense apolipoprotein B-100 as novel treatment for hypercholesterolemia: focus on ISIS 301012. Future Lipidology 2:4, 387-393
CrossRef25
Anne K Soutar, Rossi P Naoumova. (2007) Mechanisms of Disease: genetic causes of familial hypercholesterolemia. Nature Clinical Practice Cardiovascular Medicine 4:4, 214-225
CrossRef26
Şerif Yılmaz, Kadim Bayan, Yekta Tüzün, Sabri Batun, Abdullah Altıntaş. (2006) A comprehensive analysis of 12 thrombophilic mutations and related parameters in patients with inflammatory bowel disease: data from Turkey. Journal of Thrombosis and Thrombolysis 22:3, 205-212
CrossRef27
Klai-upsorn S. Pongrapeeporn, Manit Nuinoon, Pikun Thepsuriyanont, Bantita Kasemsuk, Patthamawadee Charoensuk, Ruechakorn Chantawee, Uchanee Wongmanee, Wilairat Nuchpramool. (2006) Detection of a known mutation M412T in the LDL receptor in a Chinese Thai FH family. Clinica Chimica Acta 365:1-2, 211-216
CrossRef28
L ROBLESOSORIO, A HUERTAZEPEDA, M ORDONEZ, S CANIZALESQUINTEROS, A DIAZVILLASENOR, R GUTIERREZAGUILAR, L RIBA, A HUERTASVAZQUEZ, M RODRIGUEZTORRES, R GOMEZDIAZ. (2006) Genetic Heterogeneity of Autosomal Dominant Hypercholesterolemia in Mexico. Archives of Medical Research 37:1, 102-108
CrossRef29
Livia Pisciotta, Laura Calabresi, Graziana Lupattelli, Donatella Siepi, Massimo Raffaele Mannarino, Elsa Moleri, Antonella Bellocchio, Alfredo Cantafora, Patrizia Tarugi, Sebastiano Calandra, Stefano Bertolini. (2005) Combined monogenic hypercholesterolemia and hypoalphalipoproteinemia caused by mutations in LDL-R and LCAT genes. Atherosclerosis 182:1, 153-159
CrossRef30
Rosanne M Crooke. (2005) Antisense oligonucleotides as therapeutics for hyperlipidaemias. Expert Opinion on Biological Therapy 5:7, 907-917
CrossRef31
Vanessa A. Diaz, Arch G. Mainous, Richelle J. Koopman, Peter J. Carek, Mark E. Geesey. (2005) Race and diet in the overweight: association with cardiovascular risk in a nationally representative sample. Nutrition 21:6, 718-725
CrossRef32
Mahmoud Alawadhi, George Thanassoulis, Michel Marcil, Jacques Genest. (2005) Genetic lipoprotein disorders and coronary atherosclerosis. Current Atherosclerosis Reports 7:3, 196-203
CrossRef33
Muhidien Soufi, Alexander M Sattler, Winfried Maerz, Alexander Starke, Matthias Herzum, Bernhard Maisch, Juergen R Schaefer. (2004) A new but frequent mutation of apoB-100—apoB His3543Tyr. Atherosclerosis 174:1, 11-16
CrossRef34
Jan WA Smit, Michaela Diamant. (2004) Genetically defined hyperlipidemia. Pharmacogenomics 5:3, 295-304
CrossRef35
Toni I Pollin, Wen-Chi Hsueh, Nanette I Steinle, Soren Snitker, Alan R Shuldiner, Braxton D Mitchell. (2004) A genome-wide scan of serum lipid levels in the Old Order Amish. Atherosclerosis 173:1, 89-96
CrossRef36
Stig E. Bojesen, Klaus Juul, Peter Schnohr, Anne Tybjærg-Hansen, Børge G. Nordestgaard. (2003) Platelet glycoprotein IIb/IIIa PlA2/PlA2 homozygosity associated with risk of ischemic cardiovascular disease and myocardial infarction in young men. Journal of the American College of Cardiology 42:4, 661-667
CrossRef37
Maren T. Scheuner. (2003) Genetic evaluation for coronary artery disease. Genetics in Medicine 5:4, 269-285
CrossRef38
DLS Rios, AF Vargas, MR Torres, AJ Zago, SM Callegari-Jacques, MH Hutz. (2003) Interaction between SREBP-1a and APOB polymorphisms influences total and low-density lipoprotein cholesterol levels in patients with coronary artery disease. Clinical Genetics 63:5, 380-385
CrossRef39
Ursula Loggen, Anja Boden, Heike Baron, Herbert Schuster, Ralf Tolle, Ulrike Netwich, Cecile Dupon, Bertram Müller-Myhsok, Heike Baron, Friedrich C. Luft. (2003) Apolipoprotein B-100 gene mutations and cholesterol control in German patients. Atherosclerosis 166:2, 411-412
CrossRef40
L Robles-Osorio. (2003) Familial Hypercholesterolemia Due to Ligand-Defective Apolipoprotein B100. First Case Report in a Mexican Family. Archives of Medical Research 34:1, 70-75
CrossRef41
Hans H. Wittrup, Børge G. Nordestgaard, Rolf Steffensen, Gorm Jensen, Anne Tybjærg-Hansen. (2002) Effect of gender on phenotypic expression of the S447X mutation in LPL. Atherosclerosis 165:1, 119-126
CrossRef42
Melissa A. Austin, Ron L. Zimmern, Steve E. Humphries. (2002) High ???population attributable fraction??? for coronary heart disease mortality among relatives in monogenic familial hypercholesterolemia. Genetics in Medicine 4:4, 275-278
CrossRef43
Sheila Viola, Pascale Benlian, Alain Morali, Dries Dobbelaere, Florence Lacaille, Daniel Rieu, Jean Louis Ginies, Chantal Maurage, Martine Meyer, Alain Lachaux, Michel Larchet, Catherine Lenearts, Olivier Goulet, Jacques Sarles, Olivier Mouterde, Jean Philippe Girardet. (2001) Apolipoprotein B Arg3500Gln Mutation Prevalence in Children With Hypercholesterolemia: A French Multicenter Study. Journal of Pediatric Gastroenterology and Nutrition 33:2, 122-126
CrossRef44
Maren T. Scheuner. (2001) Genetic predisposition to coronary artery disease. Current Opinion in Cardiology 16:4, 251-260
CrossRef45
Ruth Frikke-Schmidt, Hans H Wittrup, Anne Tybjærg-Hansen, Hans Meinertz, Peter Schnohr, Børge G Nordestgaard. (2000) Apolipoprotein E genotypes predict attendance rates at lipid clinic. Atherosclerosis 153:2, 461-468
CrossRef46
Yen-Ni Teng, Ju-Pin Pan, Shiu-Ching Chou, Der-Yan Tai, Guey-Jen Lee-Chen. (2000) Familial defective apolipoprotein B-100: detection and haplotype analysis of the Arg3500→Gln mutation in hyperlipidemic Chinese. Atherosclerosis 152:2, 385-390
CrossRef47
Kl Khoo, P Van Acker, Jc Defesche, H Tan, L Van De Kerkhof, Sj Heijnen-van Eijk, Jjp Kastelein, Jp Deslypere. (2000) Low-density lipoprotein receptor gene mutations in a Southeast Asian population with familial hypercholesterolemia. Clinical Genetics 58:2, 98-105
CrossRef48
Markus Nauck, Heinrich Wieland, Winfried März. (2000) Evaluation of the Roche Diagnostics LightCycler-Apo B 3500 Mutation Detection Kit. Clinical Chemistry and Laboratory Medicine 38:7, 667-671
CrossRef49
Ruth Frikke-Schmidt, Anne Tybjærg-Hansen, Rolf Steffensen, Gorm Jensen, Børge G Nordestgaard. (2000) Apolipoprotein E genotype: epsilon32 women are protected while epsilon43 and epsilon44 men are susceptible to ischemic heart disease. Journal of the American College of Cardiology 35:5, 1192-1199
CrossRef50
Ruth Frikke-Schmidt, Peter Arlien-Soborg, Sixtus Thorsen, Henrik Kjaerulf Jensen, Sissel Vorstrup. (1999) LDL receptor mutations and ApoB mutations are not risk factors for ischemic cerebrovascular disease of the young, but lipids and lipoproteins are. European Journal of Neurology 6:6, 691-696
CrossRef51
Børge G. Nordestgaard, Anne Tybjærg-Hansen Glostrup. (1999) Susceptibility mutations for ischemic heart disease. Current Atherosclerosis Reports 1:2, 108-114
CrossRef52
&NA;. (1999) Lipid metabolism. Current Opinion in Lipidology 10:4, 347-362
CrossRef53
Bassam A Nassar, Jeremy Dunn, Lawrence M Title, Blair J O’Neill, Susan A Kirkland, Ekram Zayed, Iqbal R Bata, Richard C Cantrill, Jenny Johnstone, Gale I Dempsey, Meng-Hee Tan, W.Carl Breckenridge, David E Johnstone. (1999) Relation of genetic polymorphisms of apolipoprotein E, angiotensin converting enzyme, apolipoprotein B-100, and glycoprotein IIIa and early-onset coronary heart disease. Clinical Biochemistry 32:4, 275-282
CrossRef54
Pinto. (1998) Genes, hypercholesterolaemia and carotid atherosclerosis. European Journal of Clinical Investigation 28:12, 980-982
CrossRef55
(1998) Association of Mutations in the Apolipoprotein B Gene with Hypercholesterolemia and the Risk of Ischemic Heart Disease. New England Journal of Medicine 339:22, 1640-1642
Full Text
- Letters
