Original Article
Epstein–Barr Virus and a Cellular Signaling Pathway in Lymphomas from Immunosuppressed Patients
N Engl J Med 1998; 338:1413-1421May 14, 1998
- Abstract
Background
Epstein–Barr virus (EBV) is associated with various malignant and benign lymphoproliferative disorders. It also efficiently transforms human B lymphocytes in vitro. The latent membrane protein 1 (LMP1) of EBV-infected cells plays a central part in this process by mimicking members of the family of tumor necrosis factor (TNF) receptors, thereby transmitting growth signals from the cell membrane to the nucleus through cytoplasmic TNF-receptor–associated factors (TRAFs). I sought evidence of LMP1-mediated signal transduction through TRAFs in tumor tissue from patients with post-transplantation lymphoproliferative disease and non-Hodgkin's lymphomas related to the acquired immunodeficiency syndrome (AIDS).
Methods
The association of LMP1 with TRAF-1 or TRAF-3 in tumor tissue was studied with double-immunofluorescence microscopy and immunoprecipitation assays. Evidence of LMP1–TRAF signaling was sought with an electrophoretic mobility shift assay for the nuclear factor-κB (NF-κB) transcription factor.
Results
Tumors from eight patients with post-transplantation lymphoproliferative disease, two patients with AIDS-associated non-Hodgkin's lymphoma, and three patients with endemic Burkitt's lymphoma were analyzed. Tumors from six of the patients with post-transplantation lymphoproliferative disease were positive for EBV and expressed LMP1; two samples were EBV-negative. Tumors from both patients with AIDS-associated non-Hodgkin's lymphoma were EBV-positive and expressed LMP1, whereas tumors from all three patients with Burkitt's tumors were positive for EBV but negative for LMP1. Double-immunofluorescence microscopy showed that LMP1 localized with and immunoprecipitated with TRAF-1 and TRAF-3 in all eight of the EBV-positive, LMP1-positive samples. An electrophoretic mobility shift assay revealed activated NF-κB in all eight EBV-positive, LMP1-positive samples as well, but not in either of the EBV-negative, LMP1-negative samples or in the three EBV-positive, LMP1-negative samples.
Conclusions
LMP1-mediated signaling through the TRAF system has a role in the pathogenesis of the EBV-positive lymphomas that arise in immunosuppressed patients.
Media in This Article
Figure 4
Immunoprecipitation of Latent Membrane Protein 1 with TNF-Receptor–Associated Factors 1 and 3 from Tumor Tissue from a Patient with Post-Transplantation Lymphoproliferative Disease.Figure 1
The Role of Epstein–Barr Virus Latent Membrane Protein 1 in Activating Cell Growth in Post-Transplantation Lymphoproliferative Disease and AIDS-Related Non-Hodgkin's Lymphoma.Article Activity
- Article
Epstein–Barr virus (EBV) is a human herpesvirus linked to endemic (African) Burkitt's lymphoma, post-transplantation lymphoproliferative disease, and non-Hodgkin's lymphoma associated with the acquired immunodeficiency syndrome (AIDS). In vitro, EBV efficiently transforms B lymphocytes, causing them to proliferate continually.1 EBV-infected cells express only nine viral proteins, and they mediate the transforming role of EBV in B lymphocytes. One of these proteins, latent membrane protein 1 (LMP1), has potent transforming effects in cell culture and animal models2-12 and is essential for the in vitro transformation of B cells by EBV.13
LMP1 is a viral analogue of the family of tumor necrosis factor (TNF) receptors in human cells. These receptors are embedded in the cell membrane, with one end facing the external milieu and the other the interior of the cell. Like the cellular TNF receptors, LMP1 has a cytoplasmic tail that binds to intracellular proteins called TNF-receptor–associated factors (TRAFs). These LMP1-bound proteins activate the nuclear factor-κB (NF-κB) transcription factor, thereby causing the cell to proliferate (Figure 1AFigure 1
The Role of Epstein–Barr Virus Latent Membrane Protein 1 in Activating Cell Growth in Post-Transplantation Lymphoproliferative Disease and AIDS-Related Non-Hodgkin's Lymphoma., Figure 1B, Figure 1C, and Figure 1D).14-17 Cellular members of the TNF-receptor family are important mediators of lymphocyte growth and activation. Two representatives of this family, CD30 and CD40, are expressed by Hodgkin's and non-Hodgkin's lymphomas and may be important in the pathogenesis of these diseases. It is plausible that LMP1 exerts its growth-promoting effects on human B lymphocytes by aggregating in the plasma membrane in association with members of the TRAF family. In this way, it would mimic an activated TNF-receptor–TRAF complex.Despite knowledge of the in vitro transforming and biochemical properties of LMP1, there is no direct evidence that LMP1 contributes to the malignant phenotype of lymphoproliferative diseases. In fact, the role of EBV in the development and maintenance of these diseases is controversial, partly because LMP1 is not expressed in all types of EBV-associated neoplasms.1 LMP1 is typically found in post-transplantation lymphoproliferative disease, AIDS-related non-Hodgkin's lymphoma, and Hodgkin's disease, but not in endemic Burkitt's lymphoma, even though Burkitt's tumors nearly always carry the EBV genome.18-21 Burkitt's tumors also contain chromosomal translocations that constitutively activate the MYC gene on chromosome 8. The consistent association of EBV with Burkitt's lymphoma and the lack of expression of LMP1 suggest that EBV stimulates B lymphocytes early in the disease, whereas continued effects of EBV are not necessary to maintain the malignant phenotype. Activation of MYC may obviate the need for EBV proteins to sustain the transformed state.
Post-transplantation lymphoproliferative disease comprises a heterogeneous group of EBV-associated lymphoproliferative disorders that occur in patients who receive immunosuppressive therapy after solid-organ or bone marrow transplantation. Pathologically, the tumors range from a polymorphic proliferation of B lymphocytes to monoclonal high-grade malignant lymphoma. From studies of Burkitt's lymphoma, one might expect that LMP1 may no longer be expressed in monoclonal cases of post-transplantation lymphoproliferative disease. Actually, these monoclonal cases can have Burkitt-like MYC translocations and also abundantly express LMP1,22 suggesting that LMP1 is necessary for the malignant phenotype of post-transplantation lymphoproliferative disease.
In this study, I investigated the physical association of LMP1 with TRAF molecules in tumor specimens from representative cases of post-transplantation lymphoproliferative disease and EBV-positive AIDS-associated non-Hodgkin's lymphoma (Figure 1A, Figure 1B, Figure 1C, and Figure 1D). In each case, I also determined whether the NF-κB transcription factor was activated in the tumors. The finding of LMP1 in association with TRAF molecules and activated NF-κB in post-transplantation lymphoproliferative disease and AIDS-associated non-Hodgkin's lymphoma tumors is evidence that LMP1 signaling contributes to the transformed phenotype of EBV-associated tumors in vivo.
Methods
Tumor Tissue, Cells, and Cell Culture
Specimens from eight patients with post-transplantation lymphoproliferative disease, which had been analyzed previously,22 and from two patients with AIDS-associated non-Hodgkin's lymphoma were studied. Tumor tissue was obtained from fresh biopsy specimens that were flash-frozen in liquid nitrogen at the time of collection. Three frozen biopsy specimens of Burkitt's tumor were generously provided by African physicians over a span of several years. Control cell lines were grown in continuous cultures at 37°C in 5 percent carbon dioxide in RPMI-1640 medium supplemented with 10 percent fetal-calf serum (BioWhittaker, Walkersville, Md.). IB4 is an EBV-infected cord-blood B lymphoblastoid cell line that does not allow viral replication. BJAB is an EBV-negative human B lymphoma cell line.
Antibodies and Antiserum
The S12 monoclonal antibody recognizes the C-terminal portion of LMP1 and was kindly provided by Elliott Kieff (Harvard Medical School, Boston). The CS1, CS2, CS3, and CS4 anti-LMP1 monoclonal antibodies were from Dako (Carpinteria, Calif.). Antiserum to the TRAF molecules was obtained from Santa Cruz Biotech (Santa Cruz, Calif.). Rabbit anti-TRAF1 antiserum (N19) was used for immunofluorescence staining and immunoprecipitation, and rabbit anti-TRAF1 antiserum (S19) was used for Western immunoblotting. Rabbit anti-TRAF2 antiserum (C20 and N19) was used for immunofluorescence staining and Western immunoblotting. Antiserum N19 anti-TRAF1 and N19 anti-TRAF2 have distinct specificities and do not cross-react. The rabbit anti-TRAF3 antibody H20 was used for immunofluorescence staining, immunoprecipitation, and Western immunoblotting. Normal goat and rabbit serum was purchased from Sigma Chemical (St. Louis). Goat antimouse antibodies (H and L) or goat antirabbit secondary antibodies conjugated with Oregon green 488 and Texas red X were obtained from Molecular Probes (Eugene, Oreg.).
Western Immunoblotting
Proteins were solubilized from fresh or frozen tissue in sample buffer (62.5 mM TRIS–hydrochloride, pH 6.8; 2 percent sodium dodecyl sulfate, 10 percent glycerol, and 5 percent 2-mercaptoethanol) at 95°C for 10 minutes. The lysates were cleared by microcentrifugation for five minutes, and the supernatants were collected for separation by discontinuous sodium dodecyl sulfate–polyacrylamide-gel electrophoresis according to standard procedures.8 After separation, proteins were transferred to nitrocellulose and the membranes were probed with a biotin-conjugated anti-LMP1 (S12) monoclonal antibody, washed, and then probed with 125I-labeled streptavidin (Amersham, Arlington Heights, Ill.). After a final washing, the reactive protein bands were detected by autoradiography with Kodak XAR-5 film (Eastman Kodak, Rochester, N.Y.).
Immunofluorescence Microscopy
The sections were fixed in methanol–acetone (3:1 vol/vol) at -20°C for 5 to 10 minutes. After fixation, the slides were briefly washed in phosphate-buffered saline and then blocked with 10 percent (vol/vol) normal goat serum for 20 minutes and stained with monoclonal antibodies for LMP1 and rabbit antiserum for TRAF1, TRAF2, or TRAF3 as follows. All antibody dilutions were in 10 percent normal goat serum in phosphate-buffered saline. The tissue sections were incubated for one hour with S12 (anti-LMP) hybridoma supernatant (dilution, 1:100) and one of the following: 400 ng of N19 (anti-TRAF1) per milliliter, 400 ng of H20 (anti-TRAF3) per milliliter, 400 ng of C20 (anti-TRAF2) per milliliter, or 400 ng of N19 (anti-TRAF2) per milliliter. The samples were then washed three times in phosphate-buffered saline for 10 minutes. The secondary antibodies Oregon green 488 goat antimouse IgG (H and L) and Texas red X goat antirabbit IgG (H and L) were incubated at a concentration of 2 μg per milliliter with the sections for 30 minutes followed by three 10-minute washes in phosphate-buffered saline. The stained sections were air-dried, mounted in ProLong Antifade (Molecular Probes) according to the manufacturer's directions, and photographed on a microscope (model ES800, Nikon, New York) equipped with an epifluorescent system for detecting fluorescein isothiocyanate, Texas red, or a combination of the two.
Electrophoretic Mobility Shift Assay
Nuclear extracts were prepared from cultured cells or tissues as described previously.16 The protein content was determined by the Bradford assay (Bio-Rad Laboratories, Hercules, Calif.). A probe was generated from a pair of complementary oligonucleotides containing a specific binding site for the NF-κB transcription factor: 5
AGCTTGGGGACTTTCCACTAGTACG3
DNA Amplification
A pair of oligonucleotide primers 5
Results
The morphologic findings, clonality, cytogenetic characteristics, and pattern of EBV gene expression in samples of tumor from eight patients with post-transplantation lymphoproliferative disease22 and two patients with AIDS-associated non-Hodgkin's lymphoma are shown in Table 1Table 1
Characteristics of Patients with Post-Transplantation Lymphoproliferative Disease and Patients with AIDS-Associated Non-Hodgkin's Lymphoma.. Two of the 10 specimens — both from patients with post-transplantation lymphoproliferative diseases — were EBV-negative.22 The other specimens were EBV-positive and expressed the LMP1 protein on immunofluorescence microscopy and Western immunoblotting (data not shown). All three specimens of endemic Burkitt's lymphoma were EBV-positive by the polymerase chain reaction, but in none was LMP1 protein detectable by immunofluorescence microscopy or Western immunoblotting. In these three lymphomas, MYC gene rearrangements were found by Southern blotting (unpublished observations).Two methods were used to examine tumor specimens for interactions between LMP1 and TRAF molecules: double-immunofluorescence microscopy and immunoprecipitation. Tissue from all eight of the LMP1-positive specimens was examined to establish whether LMP1 was found with antibodies against either TRAF-1 or TRAF-3 on double-immunofluorescence microscopy (LMP1 associates with both TRAF-1 and TRAF-3 in vitro16). In every case, LMP1 was found with TRAF-1 (Figure 2AFigure 2
Localization of Latent Membrane Protein 1 with TNF-Receptor–Associated Factor 1 in Tumor Samples from a Patient with Post-Transplantation Lymphoproliferative Disease (×1000)., Figure 2B, and Figure 2C) and TRAF-3 (Figure 3AFigure 3
Localization of Latent Membrane Protein 1 with TNF-Receptor–Associated Factor 3 in Tumor Samples from a Patient with Post-Transplantation Lymphoproliferative Disease (×1000)., Figure 3B, and Figure 3C) in plasma-membrane aggregates. This result indicates that the two TRAF signaling molecules associate with membrane aggregates of LMP1 in post-transplantation lymphoproliferative disease and in AIDS-associated non-Hodgkin's lymphoma.To confirm these findings, an immunoprecipitation assay was performed. If LMP1 is physically associated with TRAF-1 and TRAF-3 molecules in these tumors, then immunoprecipitation with specific antiserum to TRAF-1 or TRAF-3 should also precipitate LMP1. Antibodies against TRAF-1, TRAF-3, or LMP1 were used to promote immunoprecipitation of their specific target molecules. The presence of LMP1 in the immunoprecipitates was analyzed by Western immunoblotting. Figure 4Figure 4
Immunoprecipitation of Latent Membrane Protein 1 with TNF-Receptor–Associated Factors 1 and 3 from Tumor Tissue from a Patient with Post-Transplantation Lymphoproliferative Disease. shows a representative experiment with a specimen from a patient with post-transplantation lymphoproliferative disease in which 10 percent of the total LMP1 in the tumor lysate was immunoprecipitated with either anti-TRAF-1 or anti-TRAF-3 antibodies. The findings were similar for all four of the samples from patients with post-transplantation lymphoproliferative disease that were tested in this way and for both samples from the patients with AIDS-associated non-Hodgkin's lymphoma.The immunoprecipitation of LMP1 with anti-TRAF-1 or anti-TRAF-3 antiserum confirms that the LMP1 transforming protein is physically associated with these TRAF signaling molecules in the lymphoproliferative disorders under investigation. Since in vitro studies have shown that LMP1 mimics an activated TNF-receptor complex by aggregating with TRAF molecules,14 my findings suggest that the same mechanism contributes to abnormal cell growth in post-transplantation lymphoproliferative disease and AIDS-associated non-Hodgkin's lymphoma.
In vitro, a functional consequence of the binding of LMP1 to TRAF-1 is activation of the NF-κB transcription factor. To test the hypothesis that aggregates of LMP1 and TRAF have a similar effect in vivo, an electrophoretic mobility shift assay was used to detect activated NF-κB in the nucleus of tumor cells. There was enough material to perform these assays on LMP1-positive samples from four patients with post-transplantation lymphoproliferative disease and both patients with AIDS-associated non-Hodgkin's lymphoma, and on LMP1-negative samples from three patients with endemic Burkitt's lymphoma and two patients with post-transplantation lymphoproliferative disease (Figure 5AFigure 5
Activation of NF-κB in Tumors Expressing Latent Membrane Protein 1 (Panel A), but Not in Tumors That Do Not Express the Protein (Panel B). and Figure 5B). In all the LMP1-positive samples, the electrophoretic mobility shift assay showed activated NF-κB, whereas samples of EBV-negative, LMP1-negative tissue from patients with post-transplantation lymphoproliferative disease and samples of EBV-positive, LMP1-negative tissue from patients with Burkitt's lymphoma did not have detectable activated NF-κB. In all samples showing activated NF-κB, there was complete correlation between aggregates of LMP1 and TRAF signaling molecules in the plasma membrane and signs of activation of NF-κB in the cell nucleus.Discussion
This study demonstrates an interaction between the EBV transforming protein LMP1 and the TRAF-1 and TRAF-3 signal-transduction molecules in post-transplantation lymphoproliferative disease and AIDS-associated non-Hodgkin's lymphoma. This finding provides evidence that LMP1 functions as a signaling protein in the cells of these tumors. Additional support for this conclusion is provided by the finding of activated NF-κB in tumors in which LMP1 was bound to TRAF-1 and TRAF-3 and, conversely, the absence of activated NF-κB in tumors lacking LMP1. Evidence from genetic and biochemical studies of cell cultures indicates that LMP1 is a constitutively activated viral analogue of the cellular TNF-receptor family. These investigations also show that LMP1 transduces an NF-κB activation signal that is partially mediated through TRAF molecules. Through its potent growth-promoting effects, LMP1 has been postulated to mediate cell transformation in EBV-associated cancers in humans, although direct evidence of this effect has been lacking.13-17 The frequent expression of LMP1 in tumor tissue from patients with post-transplantation lymphoproliferative disease and AIDS-associated non-Hodgkin's lymphoma supports the notion that LMP1 may contribute to the development of these diseases.
In contrast to the findings in specimens from patients with endemic Burkitt's lymphoma, all EBV-positive specimens from patients with post-transplantation lymphoproliferative disease expressed LMP1, including those with Burkitt-like lymphoma who had MYC gene translocations.22 This suggests that in post-transplantation lymphoproliferative disease, LMP1 may be necessary for the proliferation of malignant cells, even after activation of cellular oncogenes. In AIDS-associated non-Hodgkin's lymphoma, less is known about the pattern of LMP1 expression as it relates to cellular oncogene activation. Notably, Patient 9, who had AIDS-associated non-Hodgkin's lymphoma (Table 1), had both LMP1 and a MYC gene translocation, suggesting similarities in the pathogenesis of this kind of lymphoma and post-transplantation lymphoproliferative disease.
EBV was first identified in endemic Burkitt's lymphoma cells more than 30 years ago and has since been linked to several malignant diseases. Nevertheless, direct evidence of an EBV-mediated signaling process in these neoplasms has been elusive. Given the evidence that LMP1 signaling through aggregation with TRAF molecules is essential for transformation in vitro, my findings suggest that this pathway is also critical to the malignant phenotype in vivo. The presence of cellular (nonviral) members of the TNF-receptor family, including CD30 and CD40, is characteristic of other types of lymphoma. TRAF-mediated signaling processes may occur in a similar manner in these diseases and may be important in the transformation process.
Presented in part at the National AIDS Malignancy Conference, Bethesda, Md., April 22, 1997.
Supported by a grant (CA 73545) from the National Cancer Institute.
I am indebted to Elliott Kieff, M.D., Ph.D., for critical review of the data as well as for numerous helpful discussions; to Colin Duckett, Ph.D., for invaluable assistance with the NF-κB electrophoretic mobility shift assays and critical review of the data; and to Melissa Cavaghan, M.D., for critical review of the manuscript.
Source Information
From the Marjorie B. Kovler Viral Oncology Laboratories, Department of Medicine, Section of Hematology/Oncology and Virology, University of Chicago, Chicago.
Address reprint requests to Dr. Liebowitz at the University of Chicago Medical Center, Department of Medicine, Section of Hematology/Oncology, 5841 S. Maryland Ave., MC2115, Chicago, IL 60637.
- References
References
1
Kieff E. Epstein-Barr virus and its replication. In: Fields BN, Knipe DM, Howley PM, eds. Fields virology. 3rd ed. Vol. 2. Philadelphia: Lippincott-Raven, 1996:2343-96.
2
Wang D ,Liebowitz D ,Kieff E . An EBV membrane protein expressed in immortalized lymphocytes transforms established rodent cells. Cell 1985;43:831-840
CrossRef | Web of Science | Medline3
Wang D ,Liebowitz D ,Kieff E . The truncated form of the Epstein-Barr virus latent-infection membrane protein expressed in virus replication does not transform rodent fibroblasts. J Virol 1988;62:2337-2346
Web of Science | Medline4
Baichwal VR ,Sugden B . Transformation of Balb 3T3 cells by the BNLF-1 gene of Epstein-Barr virus. Oncogene 1988;2:461-467
Web of Science | Medline5
Dawson CW ,Rickinson AB ,Young LS . Epstein-Barr virus latent membrane protein inhibits human epithelial cell differentiation. Nature 1990;344:777-780
CrossRef | Web of Science | Medline6
Wilson JB ,Weinberg W ,Johnson R ,Yuspa S ,Levine AJ . Expression of the BNLF-1 oncogene of Epstein-Barr virus in the skin of transgenic mice induces hyperplasia and aberrant expression of keratin 6. Cell 1990;61:1315-1327
CrossRef | Web of Science | Medline7
Fahraeus R ,Rymo L ,Rhim JS ,Klein G . Morphological transformation of human keratinocytes expressing the LMP gene of Epstein-Barr virus. Nature 1990;345:447-449
CrossRef | Web of Science | Medline8
Wang D ,Liebowitz D ,Wang F , et al. Epstein-Barr virus latent infection membrane protein alters the human B-lymphocyte phenotype: deletion of the amino terminus abolishes activity. J Virol 1988;62:4173-4184
Web of Science | Medline9
Henderson S ,Rowe M ,Gregory C , et al. Induction of bcl-2 expression by Epstein-Barr virus latent membrane protein 1 protects infected B cells from programmed cell death. Cell 1991;65:1107-1115
CrossRef | Web of Science | Medline10
Hammarskjold ML ,Simurda MC . Epstein-Barr virus latent membrane protein transactivates the human immunodeficiency virus type 1 long terminal repeat through induction of NF-kappa B activity. J Virol 1992;66:6496-6501
Web of Science | Medline11
Laherty CD ,Hu HM ,Opipari AW ,Wang F ,Dixit VM . The Epstein-Barr virus LMP1 gene product induces A20 zinc finger protein expres-sion by activating nuclear factor kappa B. J Biol Chem 1992;267:24157-24160
Web of Science | Medline12
Rowe M ,Peng-Pilon M ,Huen DS , et al. Upregulation of bcl-2 by the Epstein-Barr virus latent membrane protein LMP1: a B-cell-specific response that is delayed relative to NF-kappa B activation and to induction of cell surface markers. J Virol 1994;68:5602-5612
Web of Science | Medline13
Kaye KM ,Izumi KM ,Kieff E . Epstein-Barr virus latent membrane protein 1 is essential for B-lymphocyte growth transformation. Proc Natl Acad Sci U S A 1993;90:9150-9154
CrossRef | Web of Science | Medline14
Mosialos G ,Birkenbach M ,Yalamanchili R ,VanArsdale T ,Ware C ,Kieff E . The Epstein-Barr virus transforming protein LMP1 engages signaling proteins for the tumor necrosis factor receptor family. Cell 1995;80:389-399
CrossRef | Web of Science | Medline15
Kaye KM ,Devergne O ,Harada JN , et al. Tumor necrosis factor receptor associated factor 2 is a mediator of NF-κB activation by latent infection membrane protein 1, the Epstein-Barr virus transforming protein. Proc Natl Acad Sci U S A 1996;93:11085-11090
CrossRef | Web of Science | Medline16
Devergne O ,Hatzivassiliou E ,Izumi KM , et al. Association of TRAF1, TRAF2, and TRAF3 with an Epstein-Barr virus LMP1 domain important for B-lymphocyte transformation: role in NF-κB activation. Mol Cell Biol 1996;16:7098-7108
Web of Science | Medline17
Liebowitz D ,Mannick J ,Takada K ,Kieff E . Phenotypes of Epstein-Barr virus LMP1 deletion mutants indicate transmembrane and amino-terminal cytoplasmic domains necessary for effects in B-lymphoma cells. J Virol 1992;66:4612-4616
Web of Science | Medline18
Liebowitz D, Kieff E. Epstein-Barr virus. In: Roizman B, Whitley RJ, Lopez C, eds. The human herpesviruses. New York: Raven Press, 1993:107-72.
19
Rowe DT ,Rowe M ,Evan GI ,Wallace LE ,Farrell PJ ,Rickinson AB . Restricted expression of EBV latent genes and T-lymphocyte-detected membrane antigen in Burkitt's lymphoma cells. EMBO J 1986;5:2599-2607
Web of Science | Medline20
Hatzubai A ,Anafi M ,Masucci MG , et al. Down-regulation of the EBV-encoded membrane protein (LMP) in Burkitt lymphomas. Int J Cancer 1987;40:358-364
CrossRef | Web of Science | Medline21
Gregory CD ,Rowe M ,Rickinson AB . Different Epstein-Barr virus-B cell interactions in phenotypically distinct clones of a Burkitt's lymphoma cell line. J Gen Virol 1990;71:1481-1495
CrossRef | Web of Science | Medline22
Liebowitz D ,LeBeau MM ,Olopade OI . Evidence for signal transduction through the TNF receptor pathway in post-transplant lymphoproliferative disorders. J Acquir Immune Defic Syndr Hum Retrovirol 1997;14:A51-A51 abstract.
CrossRef
- Citing Articles (76)
Citing Articles
1
Claudia S. Plottel, Martin J. Blaser. (2011) Microbiome and Malignancy. Cell Host & Microbe 10:4, 324-335
CrossRef2
Robin D. Kim, Takahisa Fujikawa, Shugo Mizuno, Jason J. Schwartz, John B. Sorensen, Alan W. Hemming, Shiro Fujita. (2011) Adult post-transplant lymphoproliferative disease in the liver graft in patients with recurrent hepatitis C. European Journal of Gastroenterology & Hepatology 23:7, 559-565
CrossRef3
Frederik J Verweij, Monique A J van Eijndhoven, Erik S Hopmans, Tineke Vendrig, Tom Wurdinger, Ellen Cahir-McFarland, Elliott Kieff, Dirk Geerts, Rik van der Kant, Jacques Neefjes, Jaap M Middeldorp, D Michiel Pegtel. (2011) LMP1 association with CD63 in endosomes and secretion via exosomes limits constitutive NF-κB activation. The EMBO Journal 30:11, 2115-2129
CrossRef4
Inés Rama, Josep M. Grinyó. (2010) Malignancy after renal transplantation: the role of immunosuppression. Nature Reviews Nephrology 6:9, 511-519
CrossRef5
John P. Graham, Kelly M. Arcipowski, Gail A. Bishop. (2010) Differential B-lymphocyte regulation by CD40 and its viral mimic, latent membrane protein 1. Immunological Reviews 237:1, 226-248
CrossRef6
Q.-F. Liu, Z.-P. Fan, X.-D. Luo, J. Sun, Y. Zhang, Y.-Q. Ding. (2010) Epstein-Barr virus-associated pneumonia in patients with post-transplant lymphoproliferative disease after hematopoietic stem cell transplantation. Transplant Infectious Disease 12:4, 284-291
CrossRef7
J.M. Middeldorp, D.M. Pegtel. (2008) Multiple roles of LMP1 in Epstein-Barr virus induced immune escape. Seminars in Cancer Biology 18:6, 388-396
CrossRef8
Hsin-Yun Sun, Nina Singh. (2008) Pharmacotherapy of post-transplant viral infections. Expert Opinion on Pharmacotherapy 9:14, 2409-2421
CrossRef9
Thomas Lowe, Smita Bhatia, George Somlo. (2007) Second Malignancies after Allogeneic Hematopoietic Cell Transplantation. Biology of Blood and Marrow Transplantation 13:10, 1121-1134
CrossRef10
Sherif A. Rezk, Lawrence M. Weiss. (2007) Epstein-Barr virus–associated lymphoproliferative disorders. Human Pathology 38:9, 1293-1304
CrossRef11
Ronan Swords, John Bruzzi, Francis Giles. (2007) Recent advances in the diagnosis and therapy of richter’s syndrome. Medical Oncology 24:1, 17-32
CrossRef12
Felix M Arellano, Charles E Wentworth, Alejandro Arana, Carlos Fernández, Carle F Paul. (2007) Risk of Lymphoma Following Exposure to Calcineurin Inhibitors and Topical Steroids in Patients with Atopic Dermatitis. Journal of Investigative Dermatology 127:4, 808-816
CrossRef13
Kim A Papp. (2007) The safety of etanercept for the treatment of plaque psoriasis. Therapeutics and Clinical Risk Management 3:2, 245-258
CrossRef14
Françoise Smets. (2006) Impact of primary Epstein-Barr virus infection on timing of transplantation. Pediatric Transplantation 10:8, 869-871
CrossRef15
Patrizia Burra, Andrea Buda, Ugolino Livi, Paolo Rigotti, Giacomo Zanus, Fiorella Calabrese, Alida Caforio, Chiara Menin, Daniele Canova, Fabio Farinati, Savina Maria Luciana Aversa. (2006) Occurrence of post-transplant lymphoproliferative disorders among over thousand adult recipients: any role for hepatitis C infection?. European Journal of Gastroenterology & Hepatology 18:10, 1065-1070
CrossRef16
John P. Leonard, Richard R. Furman, Morton Coleman. (2006) Proteasome inhibition with bortezomib: A new therapeutic strategy for non-Hodgkin's lymphoma. International Journal of Cancer 119:5, 971-979
CrossRef17
Hye-Jin Choi, Sung-Eun Chang, Jai-Kyoung Koh. (2006) Epstein-Barr virus (EBV)-associated aggressive peripheral T-cell lymphoma showing folliculotropism. International Journal of Dermatology 45:5, 631-633
CrossRef18
Lode J. Swinnen. 2006. Posttransplant Lymphoproliferative Disorder. , 241-260.
CrossRef19
Ghazaleh Gouya, Gabriele Hartmann, Peter Fae, Martina Tauber, Hannes Holzmuller, Werner Benzer, Alois Lang, Antonius Schuster, Heinz Drexel, Felix Albert Offner. (2006) A case of fulminant post-transplant lymphoproliferative disorder and septicemia. Clinical Transplantation 20:2, 261-264
CrossRef20
Jeffrey I. Cohen. 2006. Virology and Molecular Biology of Epstein–Barr Virus. , 21-38.
CrossRef21
N J Thornburg, W Kulwichit, R H Edwards, K H Y Shair, K M Bendt, N Raab-Traub. (2005) LMP1 signaling and activation of NF-κB in LMP1 transgenic mice. Oncogene
CrossRef22
J I Cohen. (2005) HMG CoA reductase inhibitors (statins) to treat Epstein–Barr virus-driven lymphoma. British Journal of Cancer 92:9, 1593-1598
CrossRef23
Apostolia-Maria Tsimberidou, Michael J. Keating. (2005) Richter syndrome. Cancer 103:2, 216-228
CrossRef24
Jung Hyun Kwon, Joon Chang Song, Sang Hun Lee, So Young Lee, Chul Woo Yang, Yong Soo Kim, Byung Kee Bang. (2005) Non-Hodgkin's Lymphoma Manifest as Gingival Hyperplasia in a Renal Transplant Recipient. The Korean Journal of Internal Medicine 20:4, 330
CrossRef25
Yoshihiko Hoshida, Katsuyuki Aozasa. (2004) Malignancies in organ transplant recipients. Pathology International 54:9, 649-658
CrossRef26
R. V. Mathur. (2004) Fulminant post-transplant lymphoproliferative disorder presenting with lactic acidosis and acute liver failure. Nephrology Dialysis Transplantation 19:7, 1918-1920
CrossRef27
Astrid Meerbach, Bernd Gruhn, Peter Wutzler. (2004) Recent developments in the prevention and treatment of Epstein–Barr virus-associated lymphoproliferative diseases. Expert Opinion on Therapeutic Patents 14:4, 527-547
CrossRef28
Motohiro KOBAYASHI, Makoto ITO, Kenji SANO, Takayuki HONDA, Jun NAKAYAMA. (2004) Pulmonary Lymphoepithelioma-like Carcinoma: Predominant Infiltration of Tumor-associated Cytotoxic T Lymphocytes Might Represent the Enhanced Tumor Immunity. Internal Medicine 43:4, 323-326
CrossRef29
Janice P. Dutcher. (2003) The role of Epstein-Barr virus and elevated levels of tumor necrosis factor in determining prognosis in Asian peripheral T-cell lymphomas. Leukemia Research 27:6, 467-469
CrossRef30
Atsumi Mori, Satomi Takao, Jintana Pradutkanchana, Suparp Kietthubthew, Winyou Mitarnun, Takafumi Ishida. (2003) High tumor necrosis factor-α levels in the patients with Epstein–Barr virus-associated peripheral T-cell proliferative disease/lymphoma. Leukemia Research 27:6, 493-498
CrossRef31
Jaap M. Middeldorp, Antoinette A.T.P Brink, Adriaan J.C van den Brule, Chris J.L.M Meijer. (2003) Pathogenic roles for Epstein–Barr virus (EBV) gene products in EBV-associated proliferative disorders. Critical Reviews in Oncology/Hematology 45:1, 1-36
CrossRef32
Dominique Challine, Marlyse Buisson, Michel Cadilhac, Georgios Germanidis, Irene Joab, Muriel Eliaszewicz, Eric Caumes, Antoine Flahault, Anne-Marie Fillet, Jean-Michel Pawlotsky, Jean-Marie Seigneurin, . (2002) Hepatitis C virus-Epstein-barr virus interaction in patients with AIDS. Journal of Medical Virology 67:4, 510-515
CrossRef33
Esmeralda Castaños-Vélez, Thomas Heiden, Charlotta Lindvall, Daniela Capello, Agneta Sandlund, Stefan Imreh, Elisabeth Blennow, Leif C. Andersson, Gianluca Gaidano, Magnus Nordenskjöld, Peter Biberfeld. (2002) Simian AIDS-Related Lymphoma Growth in Severe Combined Immunodeficiency Mice Is Independent of Karyotypic Abnormalities or Bcl-6 Mutations. AIDS Research and Human Retroviruses 18:5, 383-390
CrossRef34
Tatsuya Asai, Yasuhiko Tomita, Shin-ichi Nakatsuka, Yoshihiko Hoshida, Akira Myoui, Hideki Yoshikawa, Katsuyuki Aozasa. (2002) VCP (p97) Regulates NFKB Signaling Pathway, Which Is Important for Metastasis of Osteosarcoma Cell Line. Cancer Science 93:3, 296-304
CrossRef35
Ian F. Dunn, Tatyana Y. Sannikova, Raif S. Geha, Erdyni N. Tsitsikov. (2001) Identification and characterization of two CD40-inducible enhancers in the mouse TRAF1 gene locus. Molecular Immunology 37:16, 961-973
CrossRef36
Y Sasahara, H Fujie, S Kumaki, Y Ohashi, M Minegishi, S Tsuchiya. (2001) Epstein-Barr virus-associated Hodgkin's disease in a patient with Wiskott-Aldrich syndrome. Acta Paediatrica 90:11, 1348-1351
CrossRef37
Petri S Mattila, Sanna M Aalto, Lasse Heikkila, Severi Mattila, Markku Nieminen, Eeva Auvinen, Klaus Hedman, Jussi Tarkkanen. (2001) Malignancies after heart transplantation: presence of Epstein-Barr virus and cytomegalovirus. Clinical Transplantation 15:5, 337-342
CrossRef38
Robert A. Baiocchi, Jacqueline S. Ward, Lester Carrodeguas, Charles F. Eisenbeis, Ruoqi Peng, Sameek Roychowdhury, Srinivas Vourganti, Taryn Sekula, Maggie O’Brien, Melvin Moeschberger, Michael A. Caligiuri. (2001) GM-CSF and IL-2 induce specific cellular immunity and provide protection against Epstein-Barr virus lymphoproliferative disorder. Journal of Clinical Investigation 108:6, 887-894
CrossRef39
A Hiraki, N Fujii, K Masuda, K Ikeda, M Tanimoto. (2001) Genetics of Epstein-Barr virus infection. Biomedicine & Pharmacotherapy 55:7, 369-372
CrossRef40
M Okano. (2001) Epstein-Barr virus in patients with immunodeficiency disorders. Biomedicine & Pharmacotherapy 55:7, 353-361
CrossRef41
Paul G Murray, Lode J Swinnen, Joanne R Flavell, Margaret V Ragni, Karl R.N Baumforth, Siobhan M Toomey, Alexandra H Filipovich, Derek Lowe, Carrie S Schnell, Jewel Johl, Margaret Gulley, Lawrence S Young, Richard F Ambinder. (2001) Frequent expression of the tumor necrosis factor receptor–associated factor 1 in latent membrane protein 1–Positive posttransplant lymphoproliferative disease and HIV-associated lymphomas. Human Pathology 32:9, 963-969
CrossRef42
Eric D. Hsi, Subramanian Yegappan. (2001) Lymphoma Immunophenotyping: A New Era in Paraffin-Section Immunohistochemistry. Advances in Anatomic Pathology 8:4, 218-239
CrossRef43
R Ambinder. (2001) Epstein–Barr virus associated lymphoproliferations in the AIDS setting. European Journal of Cancer 37:10, 1209-1216
CrossRef44
Paul G. Murray, Joanne R. Flavell, Karl R. N. Baumforth, S. M. Toomey, Derek Lowe, John Crocker, Richard F. Ambinder, Lawrence S. Young. (2001) Expression of the tumour necrosis factor receptor-associated factors 1 and 2 in Hodgkin's disease. The Journal of Pathology 194:2, 158-164
CrossRef45
Connie L. Davis. (2001) Interferon and cytotoxic chemotherapy for the treatment of post-transplant lymphoproliferative disorder. Transplant Infectious Disease 3:2, 108-118
CrossRef46
J.E. Tanner, C. Alfieri. (2001) The Epstein-Barr virus and post-transplant lymphoproliferative disease: interplay of immunosuppression, EBV, and the immune system in disease pathogenesis. Transplant Infectious Disease 3:2, 60-69
CrossRef47
Jianguo Tao, Mariusz A Wasik. (2001) Epstein-Barr Virus Associated Polymorphic Lymphoproliferative Disorders Occurring in Nontransplant Settings. Laboratory Investigation 81:4, 429-437
CrossRef48
Yoshihiko Hoshida, Ting Li, Zhiming Dong, Yasuhiko Tomita, Amane Yamauchi, Jun Hanai, Katsuyuki Aozasa. (2001) Lymphoproliferative disorders in renal transplant patients in Japan. International Journal of Cancer 91:6, 869-875
CrossRef49
Mark Bower. (2001) Acquired immunodeficiency syndrome-related systemic non-Hodgkin's lymphoma. British Journal of Haematology 112:4, 863-873
CrossRef50
Paula G. O'Connor, David T. Scadden. (2000) AIDS ONCOLOGY. Infectious Disease Clinics of North America 14:4, 945-965
CrossRef51
Zi-Gang Xu, Keiji Iwatsuki, Mikio Ohtsuka, Noritaka Oyama, Takashi Matsui, Fumio Kaneko. (2000) Polymorphism analysis of Epstein-Barr virus isolates from patients with cutaneous natural killer/T-cell lymphoproliferative disorders: A possible relation to the endemic occurrence of these diseases in Japan. Journal of Medical Virology 62:2, 239-246
CrossRef52
Cohen, Jeffrey I., . (2000) Epstein–Barr Virus Infection. New England Journal of Medicine 343:7, 481-492
Full Text53
Motohiko Okano, Thomas G. Gross. (2000) A Review of Epstein-Barr Virus Infection in Patients with Immunodeficiency Disorders. The American Journal of the Medical Sciences 319:6, 392-396
CrossRef54
Marshall E. Kadin. (2000) Regulation of CD30 Antigen Expression and Its Potential Significance for Human Disease. The American Journal of Pathology 156:5, 1479-1484
CrossRef55
Lawrence M. Weiss. (2000) Epstein-Barr virus and hodgkin’s disease. Current Oncology Reports 2:2, 199-204
CrossRef56
Keiji Iwatsuki, Zigang Xu, Mikio Ohtsuka, Fumio Kaneko. (2000) Cutaneous lymphoproliferative disorders associated with Epstein–Barr virus infection: a clinical overview. Journal of Dermatological Science 22:3, 181-195
CrossRef57
Gianpietro Dotti, Roberto Fiocchi, Teresio Motta, Amando Gamba, Eliana Gotti, Bruno Gridelli, Gianmaria Borleri, Cristina Manzoni, Piera Viero, Giuseppe Remuzzi, Tiziano Barbui, Alessandro Rambaldi. (2000) EPSTEIN-BARR VIRUS-NEGATIVE LYMPHOPROLIFERATIVE DISORDERS IN LONG-TERM SURVIVORS AFTER HEART, KIDNEY, AND LIVER TRANSPLANT1. Transplantation827-833
CrossRef58
Stacy S. Drury, Rajeev K. Sathiapalan, R. P. Warrier. (2000) Central Nervous System Involvement of Epstein-Barr Virus Lymphoproliferative Disease in a Patient With Acute Lymphocytic Leukemia. Journal of Pediatric Hematology/Oncology 22:2, 167-170
CrossRef59
Georges Herbein, William A. O'brien. (2000) Tumor Necrosis Factor (TNF)-α and TNF Receptors in Viral Pathogenesis. Proceedings of the Society for Experimental Biology and Medicine 223:3, 241-257
CrossRef60
Georges Herbein, William A. O'brien. (2000) Tumor Necrosis Factor (TNF)-alpha and TNF Receptors in Viral Pathogenesis. Proceedings of the Society for Experimental Biology and Medicine 223:3, 241-257
CrossRef61
Yasuhiro Tabata, Shigeyoshi Hibi, Tomoko Teramura, Kikuko Kuriyama, Tomohito Yagi, Shinjiro Todo, Tadashi Sawada, Shinsaku Imashuku. (2000) Molecular Analysis of Latent Membrane Protein 1 in Patients with Epstein-Barr Virus-Associated Hemophagocytic Lymphohistiocytosis in Japan. Leukemia & Lymphoma 38:3-4, 373-380
CrossRef62
Shinsaku Imashuku, Yasuhiro Tabata, Tomoko Teramura, Shigeyoshi Hibi. (2000) Treatment Strategies for Epstein-Barr Virus-Associated Hemophagocytic Lymphohistiocytosis (EBV-HLH). Leukemia & Lymphoma 39:1-2, 37-49
CrossRef63
William A. Blattner. (1999) Human Retroviruses: Their Role in Cancer. Proceedings of the Association of American Physicians 111:6, 563-572
CrossRef64
Robert H. Arch, Craig B. Thompson. (1999) Lymphocyte Survival—The Struggle Against Death. Annual Review of Cell and Developmental Biology 15:1, 113-140
CrossRef65
Robert A. Baiocchi, Michael A. Caligiuri. (1999) Cytokines in the evolution and treatment of AIDS-lymphoma. Current Opinion in Oncology 11:6, 516
CrossRef66
I. Johannessen, D. H. Crawford. (1999) In vivo models for Epstein-Barr virus (EBV)-associated B cell lymphoproliferative disease (BLPD). Reviews in Medical Virology 9:4, 263-277
CrossRef67
Ethel Cesarman, Enrique A. Mesri. (1999) Virus-associated lymphomas. Current Opinion in Oncology 11:5, 322
CrossRef68
Christophe H
zode, Christophe Duvoux, Georgios Germanidis, Fran
CrossRef69
Jeffrey I. Cohen. (1999) The biology of Epstein-Barr virus: lessons learned from the virus and the host. Current Opinion in Immunology 11:4, 365-370
CrossRef70
Hector Ardila-Osorio, Bernard Clausse, Zohair Mishal, Jo
CrossRef71
Laura K. Aguilar, Cliona M. Rooney, Helen E. Heslop. (1999) Lymphoproliferative disorders involving Epstein-Barr virus after hemopoietic stem cell transplantation. Current Opinion in Oncology 11:2, 96
CrossRef72
Donald E. Mosier. (1999) Epstein-Barr virus and lymphoproliferative disease. Current Opinion in Hematology 6:1, 25
CrossRef73
C.M. Flaitz, M.J. Hicks. (1998) Molecular piracy: the viral link to carcinogenesis. Oral Oncology 34:6, 448-453
CrossRef74
Azra Raza. (1998) Initial transforming event in myelodysplastic syndromes may be viral: case for cytomegalovirus. Medical Oncology 15:3, 165-173
CrossRef75
Rickinson, A.B.. (1998) Epstein–Barr Virus in Action in Vivo. New England Journal of Medicine 338:20, 1461-1463
Full Text76
Richard J. O'Reilly, Trudy N. Small, Esperanza Papadopoulos, Kenneth Lucas, Joao Lacerda, Lidia Koulova. (1998) Adoptive immunotherapy for Epstein-Barr virus-associated lymphoproliferative disorders complicating marrow allografts. Springer Seminars in Immunopathology 20:3-4, 455-491
CrossRef
