Original Article
Identification of Fetal DNA and Cells in Skin Lesions from Women with Systemic Sclerosis
N Engl J Med 1998; 338:1186-1191April 23, 1998
- Abstract
Background
Systemic sclerosis is a disease of unknown origin which often occurs in women after their childbearing years. It has many clinical and histopathological similarities to chronic graft-versus-host disease. Recent studies indicate that fetal stem cells can survive in the maternal circulation for many years post partum. This finding suggests that fetal cells persisting in the maternal circulation or tissues could be involved in the pathogenesis of systemic sclerosis by initiating a graft-versus-host reaction.
Methods
We used the polymerase chain reaction (PCR) to identify Y-chromosome sequences in DNA extracted from peripheral-blood cells and skin lesions from women with systemic sclerosis of recent onset. To confirm the PCR findings, we used fluorescence in situ hybridization of peripheral-blood cells and cells within chronic inflammatory-cell infiltrates in biopsy specimens of affected skin.
Results
Y-chromosome sequences were found in DNA from peripheral-blood cells in 32 of 69 women with systemic sclerosis (46 percent), as compared with 1 of 25 normal women (4 percent, P<0.001), and in T lymphocytes from 3 women with systemic sclerosis who had male offspring. Furthermore, Y-chromosome sequences were identified in skin-biopsy specimens from 11 of 19 women with systemic sclerosis (58 percent); 9 of the 11 were known to have carried male fetuses. Nucleated cells containing Y chromosomes were detected by fluorescence in situ hybridization in paraffin-embedded sections of skin lesions from all seven women we tested whose skin-biopsy specimens contained Y-chromosome sequences.
Conclusions
Fetal antimaternal graft-versus-host reactions may be involved in the pathogenesis of systemic sclerosis in some women.
Media in This Article
Figure 2
Fluorescence in Situ Hybridization of CD3 Cells from the Peripheral Blood of a Woman with Systemic Sclerosis.Figure 1
PCR Analysis of DYZ1 in DNA Extracted from Active Skin Lesions in Women with Systemic Sclerosis.Article Activity
- Article
Systemic sclerosis is a connective-tissue disease of unknown origin that is characterized by cutaneous and visceral fibrosis; production of autoantibodies, including anticentromere and anti-topoisomerase antibodies; and prominent microvascular changes, with endothelial-cell damage and proliferation of subendothelial connective tissue. The highest incidence of systemic sclerosis occurs between 45 and 55 years of age,1,2 and it is three to eight times as frequent in women as in men.3-5 These observations suggest that pregnancy-related events are involved in its pathogenesis, although epidemiologic studies to evaluate to what extent a previous pregnancy is a risk factor for systemic sclerosis have not been performed.
Systemic sclerosis has clinical features similar to those of graft-versus-host disease,6 and it has therefore been postulated that it may be a form of that disease.7-11 Skin, lung, and esophageal involvement is prominent in both diseases,9,10,12 and both are characterized by lymphocytic infiltration of affected tissues,13-15 up-regulation of inflammatory cytokines,16-18 and fibrosis of the dermis and visceral organs.19 Furthermore, in a recent study, the systemic sclerosis–specific autoantibodies Scl-70 and Pm-Scl were found in 6 of 19 patients (32 percent) with chronic graft-versus-host disease who presented with clinical symptoms and findings similar to those of diffuse systemic sclerosis.20 Graft-versus-host disease due to the transplacental transfer of maternal T cells has been reported in infants,21 and erythema toxicum neonatorum has been postulated to be a mild, self-limited form of graft-versus-host disease caused by maternal cells in newborns.22
During pregnancy, fetal and maternal cells of various types are transferred between the mother and the fetus, predominantly from the fetus to the mother.23 Fetal erythrocytes and leukocytes can be found in the peripheral blood of up to 25 percent of pregnant women during the first trimester24 and 40 to 70 percent of women by the third trimester.25 Fetal stem cells engrafted in the maternal lymphoid organs or bone marrow may help to maintain tolerance to the semiallogeneic fetoplacental graft, and fetal hematopoietic stem cells have been detected in the circulation of women up to 27 years post partum.26 It has been suggested that a microchimerism established by fetal cells together with activation of such cells may induce a chronic graft-versus-host disease manifesting as systemic sclerosis.27-29
To test this hypothesis, it was first necessary to demonstrate the presence of fetal nucleated cells in affected tissues from women with systemic sclerosis who had previously been pregnant. For this purpose, we examined the male-specific Y-chromosome sequence DYZ1 as a marker for fetal cells in affected tissues from women with systemic sclerosis. We describe the presence of the Y-chromosome–specific sequence in DNA extracted from the peripheral blood and affected skin of women with systemic sclerosis. These observations provide support for the hypothesis that a fetal antimaternal graft-versus-host reaction may be an immunopathogenic mechanism in the development of systemic sclerosis in some women.
Methods
Subjects
We extracted DNA from peripheral-blood cells of 69 women with systemic sclerosis and 25 normal women by a procedure involving sodium chloride–ethanol precipitation.30 Two of the women with systemic sclerosis had had male children, but the pregnancy histories of the remainder of these women and of the 25 normal women were not known. DNA was also extracted from biopsy specimens of active skin lesions from 19 women who had had systemic sclerosis for 18 months or less, and from peripheral-blood cells of 2 of these women. Sixteen of the 19 women with systemic sclerosis had been pregnant before the onset of disease.
As controls, DNA was extracted from skin-biopsy specimens of 7 women with osteoarthritis and 61 female relatives of these 7 women (who were subjects of another study), 29 percent of whom were known to have had male children and 15 percent of whom were known to have had female children (31 percent were nulliparous, but the pregnancy histories of the remainder were not known). We also extracted DNA from biopsy specimens of skin and fascia from active lesions of nine women with eosinophilia myalgia syndrome and two women with eosinophilic fasciitis and from a muscle-biopsy specimen from one woman with polymyositis. One of these 12 women had had multiple pregnancies; the histories of the remainder were not known.
The diagnosis of systemic sclerosis was established according to the criteria of the American College of Rheumatology (previously known as the American Rheumatism Association).31 All the women attended the Scleroderma Center of Thomas Jefferson University Hospital between 1987 and 1997. The mean age of the women with systemic sclerosis was 53 years (range, 20 to 86), and the mean age of the normal subjects and control patients was 49 years (range, 25 to 75). The study protocol was approved by the institutional review board of Thomas Jefferson University, and informed consent was obtained from all subjects.
Polymerase-Chain-Reaction Analysis for Y-Chromosome–Positive Cells
A specific Y-chromosome sequence was detected by amplifying DNA in a nested polymerase chain reaction (PCR) with primers Y1-1 and Y1-2, as described previously.32 The first amplification was done with primers Y1-1 and Y1-2, and the second amplification was done with primers designed by our laboratory; they were Y1-3, which has the sequence 5'CAGGCCTGTCCATTACACTACA3', and Y1-4, which has the sequence 5'GAATGGGAACGAATGGAGTGAA3'. Sixty amplification cycles were performed in the presence of 10 percent dimethyl sulfoxide and 10 U of Taq polymerase (Perkin–Elmer Cetus, Foster City, Calif.) in a Rapidcycler PCR thermocycler (Idaho Technologies, Idaho Falls, Idaho). The conditions for amplification were denaturation at 94°C (five seconds), annealing at 60°C (two seconds), and extension at 72°C (five seconds) for 20 cycles, followed by 40 cycles of denaturation at 94°C (five seconds), annealing at 54°C (two seconds), and extension at 72°C (five seconds). All PCR analyses contained a blank (without DNA) for a negative control and a known positive sample for the Y sequence (male DNA). The resulting 148-bp Y-chromosome–specific fragment was identified by ethidium bromide staining after electrophoresis on a 1.5 percent agarose gel.
Sequence Analysis of the PCR-Amplified Product
The 148-bp PCR product was sequenced to confirm its identity. The fragment was cloned into the TA cloning vector (Clontech, Palo Alto, Calif.) and sequenced with M13 forward and reverse primers. The sequence results were analyzed with the program GenBank Search.
Fluorescence in Situ Hybridization of Peripheral-Blood Cells
Peripheral-blood cells from three women with systemic sclerosis who had carried male fetuses, one woman with systemic sclerosis who had never been pregnant, and two normal women were separated by a magnetic cell-separation device (Immunicon, Huntington Valley, Pa.). Peripheral-blood mononuclear cells were isolated by Ficoll–Hypaque centrifugation (Pharmacia Biotech, Piscataway, N.J.) and washed twice in phosphate-buffered saline containing 0.1 percent bovine serum albumin. The cells were resuspended in 0.85 ml of solution, and 20 μl (0.25 μg per milliliter) of mouse monoclonal antibodies directed either against CD3 (T cells) or against CD14 (monocytes) and CD45 (leukocytes) was added. The reaction mixtures were incubated at room temperature for 25 minutes, and 0.85 ml of a freshly prepared 1:20 dilution of goat antimouse antibodies conjugated to magnetic colloidal particles (Immunicon) was added. After a further 10 minutes of incubation, the cells were washed in 10 ml of phosphate-buffered saline, centrifuged, and resuspended in 1.7 ml of phosphate-buffered saline.
The resuspended cells were transferred to a collection vessel and inserted into a magnetic field for 15 minutes at room temperature. A new collection vessel containing 1.7 ml of phosphate-buffered saline was then raised onto the collecting loops, and the cells were recovered by agitating the collection device for one to two minutes. Cells recovered from the wire loops and those not adhering to the loops were suspended in 50 μl of fresh 3:1 methanol–acetic acid solution for fixation. Between 30 and 40 μl of the cell suspension was then pipetted onto clean glass slides and air-dried. The number of cells on each slide was approximately 5000 per square centimeter. The X- and Y-chromosome probes were pipetted onto the slides and incubated as described below for the tissue sections. Signals were visualized with a Leitz Orthoplan II fluorescence microscope with a triple-bandpass filter (Leitz, Rockleigh, N.J.). In each subject, 3000 nuclei were examined, and the number of signals for each probe was recorded. Image capture and recording were performed with the Oncor Image Analysis System (Oncor, Gaithersburg, Md.).
Fluorescence in Situ Hybridization of Paraffin-Embedded Skin-Biopsy Specimens
Sections were cut from paraffin-embedded skin-biopsy specimens from seven women with systemic sclerosis in whom PCR amplification of DNA extracted from skin lesions yielded the 148-bp fragment. The sections were analyzed for the presence of Y-chromosome–positive cells by fluorescence in situ hybridization. Skin-biopsy specimens from 10 women without systemic sclerosis were examined simultaneously. The sections were deparaffinized in xylene for 10 minutes and washed twice for 5 minutes each in 100 percent ethanol. The sections were treated with 0.1 percent pronase at 45°C for 10 minutes and then with 0.25 mg of proteinase K per milliliter at 45°C for 30 minutes, after which they were dehydrated in 70, 80, and 95 percent ethanol for 1 minute each. The X- and Y-chromosome probes (Oncor) were diluted 1:10 with Hybrisol VI (Oncor), and 10 μl was pipetted onto each section and covered with plastic film. The slides were heated at 70°C for five minutes, incubated overnight at 37°C, washed at 70°C in 2× saline sodium citrate (1× saline sodium citrate is 0.15 M sodium chloride and 0.015 M sodium citrate) for five minutes, counterstained with 0.1 μg of 4,6-diamidino-2-phenylindole in an antifade solution (Oncor), and viewed with an epi-fluorescence microscope (Zeiss, Thornwood, N.Y.) with a triple-bandpass filter. The nuclei in the paraffin-embedded skin-biopsy specimens were examined by fluorescence in situ hybridization for both the X chromosome (fluorescein) and the Y chromosome (Texas red). The results from the control and test groups were compared by the chi-square test with Yates' correction.
Results
PCR Analyses of Peripheral-Blood and Skin DNA
The Y-chromosome sequence was amplified from DNA extracted from peripheral-blood cells in 32 of the 69 women with systemic sclerosis (46 percent), but in only 1 of the 25 normal women (4 percent, P<0.001). Cloning and sequencing confirmed the identity of the Y-chromosome–specific product amplified from the DNA samples of the women with systemic sclerosis. The amplified product had 98 percent sequence identity with the DYZ1 sequence unique to the Y chromosome, indicating that it was a male-chromosome sequence and not an unrelated gene.
Y-chromosome–specific DNA was detected in skin lesions of 11 of the 19 women in whom it was sought (58 percent), but in none of the skin-biopsy specimens of the 68 women with osteoarthritis or their relatives (P<0.001). The results of a representative experiment are shown in Figure 1Figure 1
PCR Analysis of DYZ1 in DNA Extracted from Active Skin Lesions in Women with Systemic Sclerosis.. A prominent band represents the 148-bp product amplified from Y-chromosome DNA in samples from three women with systemic sclerosis (lanes 5, 8, and 10; arrow) and a similar product in DNA from skin-biopsy specimens from two normal men (lanes 3 and 9). The faster-migrating band seen in all lanes represents primer–dimer formation. The sample obtained from Patient 4 (lane 8) had such a high concentration of male DNA that the PCR results are those expected for a male pattern. No Y-chromosome–specific sequence material was detected in the DNA extracted from the active lesions of the women with the eosinophilia myalgia syndrome, eosinophilic fasciitis, or polymyositis.Fluorescence in Situ Hybridization of Peripheral-Blood Cells
Cell populations enriched either for CD3 T cells or for CD14 and CD45 cells from three women with systemic sclerosis who had carried male fetuses (Patients 1, 18, and 23) contained Y-chromosome sequences (Table 1Table 1
Results of Fluorescence in Situ Hybridization of Magnetically Sorted Cells from Peripheral Blood of Two Normal Subjects and Four Patients with Systemic Sclerosis. and Figure 2Figure 2Fluorescence in Situ Hybridization of CD3 Cells from the Peripheral Blood of a Woman with Systemic Sclerosis.). No Y-chromosome–positive cells were detected in cell populations from these women that were depleted of CD14 and CD45 cells or CD3 cells, nor in any of the cells from the two normal women or a woman with systemic sclerosis who had never been pregnant (Patient 17).Fluorescence in Situ Hybridization of Skin-Biopsy Specimens
Nucleated cells containing Y chromosomes were detected in the skin-biopsy specimens of all seven women with systemic sclerosis whose specimens contained Y-chromosome sequences as detected by PCR and whose skin-biopsy specimens were tested by in situ hybridization. The majority of the Y-chromosome–containing nucleated cells were present within inflammatory-cell infiltrates localized in the extracellular matrix of the deep dermis (Figure 3AFigure 3
Fluorescence in Situ Hybridization of a Paraffin-Embedded Tissue Section from an Active Skin Lesion in a Woman with Systemic Sclerosis.) or in the walls of small vessels (Figure 3B). Y-chromosome–containing nucleated cells were not seen in any of the skin biopsy specimens from the 10 normal women studied.Pregnancy History
Among the 11 women with systemic sclerosis whose skin-biopsy specimens contained Y-chromosome–specific sequences detected by PCR amplification, all but 2 were known to have carried male fetuses (Table 2Table 2
Pregnancy History and Onset of Systemic Sclerosis in Women Positive for Y Chromosomes in DNA Extracted from Biopsy Specimens of Affected Skin.). Among the eight women with systemic sclerosis who had negative PCR skin-biopsy results, three (Patients 17, 19, and 20) had never been pregnant and had systemic sclerosis before the age of 20 years, one (Patient 21) had delivered two girls, and one (Patient 22) had delivered one girl. The remaining three women had died or were lost to follow-up. Of the 68 women with osteoarthritis or their relatives whose skin-biopsy specimens were examined, 30 percent were known to have had male offspring.Discussion
The results described here demonstrate the presence of fetal nucleated cells in the skin lesions of women with systemic sclerosis and thus support the hypothesis that persistent fetal cells in the maternal circulation or tissues mediate a graft-versus-host reaction, resulting in autoimmune disease.27-29
The fate of the cells transferred from the fetal to the maternal circulation (or vice versa) is not known, although transferred stem cells would be expected to mature either to relatively short-lived B cells or to longer-lived T cells. Thus, it is likely that the fetal cells in the skin lesions of women with systemic sclerosis are T cells. Although activated T cells have profound effects on fibroblast proliferation and biosynthetic activity, there is no evidence that the foreign cells detected in the affected tissues of patients with systemic sclerosis are capable of stimulating the biosynthesis of connective tissue by resident fibroblasts.
It is likely that the hosts were immunologically unaware of the fetal cells, because the cells were not eliminated immunologically, as would have been expected. This tolerance of the fetal cells by the host may be due to maternal–fetal HLA compatibility.33 Tissues from women with the eosinophilia myalgia syndrome, eosinophilic fasciitis, or polymyositis did not contain Y-chromosome sequences; presumably, these women either had no male offspring or, if they did, fetal cells did not become localized in their tissues.
Passage of cells from the fetus to the mother is a frequent and expected occurrence, and passage of cells from the mother to the fetus also occurs.22,34 Our study offers no explanation for the occurrence of systemic sclerosis in women who have not had children or in men. Maternal cells do reach the fetus,34 and if they persisted they could cause systemic sclerosis in women who have not had children or in men. Persistence of allogeneic T cells after blood transfusion may also explain the occurrence of systemic sclerosis in men or in nulliparous women.35,36
Our results indicate that the fetal cells that cross the placenta during pregnancy either remain in the circulation or migrate to various tissue sites. We hypothesize that a subsequent event, such as an environmental exposure (viral, chemical, or other), activates them, initiating a cascade of events that results in systemic sclerosis.
Supported by grants from the National Institutes of Health (AM19616, to Dr. Jimenez) and the Scleroderma Federation of the United States (to Dr. Artlett) and in part by a contract from the National Institute of Child Health and Human Development (CRMC-92-15, to Dr. Smith).
We are indebted to Drs. M.K. Haynes and R.J. Wapner for valued criticism of the manuscript and to Ms. A. Ruta, Ms. L. Gibbas, and Mr. K. Ansari for their expert technical assistance.
Source Information
From the Department of Medicine, Division of Rheumatology, Jefferson Medical College, Thomas Jefferson University, Philadelphia.
Address reprint requests to Dr. Jimenez at the Department of Medicine, Division of Rheumatology, Thomas Jefferson University, Rm. 509, Bluemle Life Sciences Bldg., 233 S. 10th St., Philadelphia, PA 19107-5541.
- References
References
1
Silman AJ, Black CM, Welsh KI. Epidemiology, demographics, genetics. In: Clements PJ, Furst DE, eds. Systemic sclerosis. Baltimore: Williams& Wilkins, 1996:23-49.
2
Medsger TA Jr . Epidemiology of systemic sclerosis. Clin Dermatol 1994;12:207-216
CrossRef | Web of Science | Medline3
Silman AJ ,Jannini S ,Symmons D ,Bacon P . An epidemiological study of scleroderma in the West Midlands. Br J Rheumatol 1988;27:286-290
CrossRef | Medline4
Steen VD ,Medsger TA Jr . Epidemiology and natural history of systemic sclerosis. Rheum Dis Clin North Am 1990;16:1-10
Web of Science | Medline5
Medsger TA Jr ,Masi AT . Epidemiology of systemic sclerosis (scleroderma). Ann Intern Med 1971;74:714-721
Web of Science | Medline6
Chosidow O ,Bagot M ,Vernant J-P , et al. Sclerodermatous chronic graft-versus-host disease: analysis of seven cases. J Am Acad Dermatol 1992;26:49-55
CrossRef | Web of Science | Medline7
Valenta LJ ,Elias JN . Familial scleroderma in a kindred with high incidence of autoimmune disease: correlation with HLA-A1/B8 haplotype. Arch Dermatol 1987;123:1438-1440
CrossRef | Web of Science | Medline8
Clements PJ, Furst DE, Ho W, Gale R. Progressive systemic sclerosis-like disease following bone marrow transplantation. In: Black CM, Myers AR, eds. Current topics in rheumatology: systemic sclerosis (scleroderma). New York: Gower Medical Publishing, 1985:376-81.
9
Graham-Brown RAC ,Sarkany I . Scleroderma-like changes due to chronic graft-versus-host disease. Clin Exp Dermatol 1983;8:531-538
CrossRef | Web of Science | Medline10
Lawley TJ ,Peck GL ,Moutsopoulos HM ,Gratwohl AA ,Deisseroth AB . Scleroderma, Sjogren-like syndrome, and chronic graft-versus-host disease. Ann Intern Med 1977;87:707-709
Web of Science | Medline11
Bos GMJ ,Majoor GD ,Slaaf DW ,van der Gaar MJ ,Weijmer-van Velzen JS ,van Breda Vriesman PJ . Similarity of scleroderma-like skin lesions in allogeneic and syngeneic bone marrow transplantation models. Transplant Proc 1989;21:3262-3263
Web of Science | Medline12
Herzog P ,Clements PJ ,Roberts NK ,Furst DE ,Johnson CE ,Feig SA . Progressive systemic sclerosis-like syndrome after bone marrow transplantation: clinical, immunologic, and pathologic findings. J Rheumatol 1980;7:56-64
Web of Science | Medline13
Fleischmajer R ,Perlish JS ,Reeves JRT . Cellular infiltrates in scleroderma skin. Arthritis Rheum 1977;20:975-984
CrossRef | Web of Science | Medline14
Lambert IA ,Suitters AJ ,Janossy G ,Thomas JA ,Palmer S ,Smith EG . Lymphoid infiltrates in skin in graft-versus-host disease. Lancet 1981;2:1352-1352
CrossRef | Web of Science | Medline15
Jimenez SA . Cellular immune dysfunction and the pathogenesis of scleroderma. Semin Arthritis Rheum 1983;13:Suppl 1:104-113
CrossRef | Web of Science | Medline16
Fagundus DM ,Leroy EC . Cytokines and systemic sclerosis. Clin Dermatol 1994;12:407-417
CrossRef | Web of Science | Medline17
Kahaleh MB ,LeRoy EC . Interleukin-2 in scleroderma: correlation of serum level with extent of skin involvement and disease duration. Ann Intern Med 1989;110:446-450
Web of Science | Medline18
Postlethwaite AE . Connective tissue metabolism including cytokines in scleroderma. Curr Opin Rheumatol 1993;5:766-772
CrossRef | Medline19
Janin-Mercier A ,Devergie A ,van Cauwenberg D , et al. Immunohistologic and ultrastructural study of the sclerotic skin in chronic graft-versus-host disease in man. Am J Pathol 1984;115:296-306
Web of Science | Medline20
Bell SA ,Faust H ,Mittermuller J ,Kolb H-J ,Meurer M . Specificity of antinuclear antibodies in scleroderma-like chronic graft-versus-host disease: clinical correlation and histocompatibility locus antigen association. Br J Dermatol 1996;134:848-854
CrossRef | Web of Science | Medline21
O'Reilly RJ ,Patterson JH ,Bach FH , et al. Chimerism detected by HL-A typing. Transplantation 1973;15:505-507
CrossRef | Web of Science | Medline22
Bassukas ID . Is erythema toxicum neonatorum a mild self-limited acute cutaneous graft-versus-host-reaction from maternal-to-fetal lymphocyte transfer? Med Hypotheses 1992;38:334-338
CrossRef | Web of Science | Medline23
Schroder J . Transplacental passage of blood cells. J Med Genet 1975;12:230-242
CrossRef | Web of Science | Medline24
Steele CD ,Wapner RJ ,Smith JB ,Haynes MK ,Jackson LG . Prenatal diagnosis using fetal cells isolated from maternal peripheral blood: a review. Clin Obstet Gynecol 1996;39:801-813
CrossRef | Web of Science | Medline25
Gill TJ III . Chimerism in humans. Transplant Proc 1977;9:1423-1431
Web of Science | Medline26
Bianchi DW ,Zickwolf GK ,Weil GJ ,Sylvester S ,DeMaria MA . Male fetal progenitor cells persist in maternal blood for as long as 27 years postpartum. Proc Natl Acad Sci U S A 1996;93:705-708
CrossRef | Web of Science | Medline27
Silman AJ ,Black C . Increased incidence of spontaneous abortion and infertility in women with scleroderma before disease onset: a controlled study. Ann Rheum Dis 1988;47:441-444
CrossRef | Web of Science | Medline28
Black CM ,Stevens WM . Scleroderma. Rheum Dis Clin North Am 1989;15:193-212
Web of Science | Medline29
Nelson JL . Maternal-fetal immunology and autoimmune disease: is some autoimmune disease auto-alloimmune or allo-autoimmune? Arthritis Rheum 1996;39:191-194
CrossRef | Web of Science | Medline30
Miller SA ,Dykes DD ,Polesky HF . A simple salting out procedure for extracting DNA from human nucleated cells. Nucleic Acids Res 1988;16:1215-1215
CrossRef | Web of Science | Medline31
Subcommittee for Scleroderma Criteria of the American Rheumatism Association Diagnostic and Therapeutic Criteria Committee
CrossRef | Web of Science | Medline32
Patri S ,Daheron L ,Kitzis A ,Chomel J-C . Evaluation of bone marrow transplantation efficiency by competitive PCR on Y sequences. PCR Methods Appl 1994;3:361-364
Medline33
Artlett CM ,Welsh KI ,Black CM ,Jimenez SA . Fetal-maternal HLA compatibility confers susceptibility to systemic sclerosis. Immunogenetics 1997;47:17-22
CrossRef | Web of Science | Medline34
Appleton AL ,Curtis A ,Wilkes A ,Cant AJ . Differentiation of materno-fetal GVHD from Omenn's syndrome in pre-BMT patients with severe combined immunodeficiency. Bone Marrow Transplant 1994;14:157-159
Web of Science | Medline35
Brubaker DB . Immunopathogenic mechanisms of posttransfusion graft-vs-host disease. Proc Soc Exp Biol Med 1993;202:122-147
Web of Science | Medline36
Juji T ,Takahashi K ,Shibata Y , et al. Post-transfusion graft-versus-host disease in immunocompetent patients after cardiac surgery in Japan. N Engl J Med 1989;321:56-56
Web of Science | Medline
- Citing Articles (164)
Citing Articles
1
Marc Schnitzler, Paul Fisch. (2012) A role for microchimerism in obesity and evolution?. Medical Hypotheses
CrossRef2
J. J. M. Drabbels, C. van de Keur, B. M. Kemps, A. Mulder, S. A. Scherjon, F. H. J. Claas, M. Eikmans. (2011) HLA-targeted flow cytometric sorting of blood cells allows separation of pure and viable microchimeric cell populations. Blood 118:19, e149-e155
CrossRef3
Olga L. Quintero, Manuel J. Amador-Patarroyo, Gladys Montoya-Ortiz, Adriana Rojas-Villarraga, Juan-Manuel Anaya. (2011) Autoimmune disease and gender: Plausible mechanisms for the female predominance of autoimmunity. Journal of Autoimmunity
CrossRef4
Olivia J. Holland, Caitlin Linscheid, Herbert C. Hodes, Traci L. Nauser, Melissa Gilliam, Peter Stone, Larry W. Chamley, Margaret G. Petroff. (2011) Minor Histocompatibility Antigens Are Expressed in Syncytiotrophoblast and Trophoblast Debris. The American Journal of Pathology
CrossRef5
V.L. Clifton, M.J. Stark, A. Osei-Kumah, N.A. Hodyl. (2011) Review: The feto-placental unit, pregnancy pathology and impact on long term maternal health. Placenta
CrossRef6
Bobby Y. Reddy, David S. Xu, Basil M. Hantash. (2011) Mesenchymal Stem Cells as Immunomodulator Therapies for Immune-Mediated Systemic Dermatoses. Stem Cells and Development111018073428009
CrossRef7
Andrew Leventhal, Guibin Chen, Alejandra Negro, Manfred Boehm. (2011) The Benefits and Risks of Stem Cell Technology. Oral Diseasesno-no
CrossRef8
Partha Dutta, William J. Burlingham. (2011) Microchimerism. Current Opinion in Organ Transplantation 16:4, 359-365
CrossRef9
Maria-Magdalena Roth. (2011) Pregnancy Dermatoses. American Journal of Clinical Dermatology 12:1, 25-41
CrossRef10
Laura Fugazzola, Valentina Cirello, Paolo Beck-Peccoz. (2011) Fetal microchimerism as an explanation of disease. Nature Reviews Endocrinology 7:2, 89-97
CrossRef11
Francesco Zulian, James T. Cassidy. 2011. THE SYSTEMIC SCLERODERMAS AND RELATED DISORDERS. , 414-437.
CrossRef12
Xiao Xia Zeng, Kian Hwa Tan, Ailing Yeo, Piriya Sasajala, Xiaowei Tan, Zhi Cheng Xiao, Gavin Dawe, Gerald Udolph . (2010) Pregnancy-Associated Progenitor Cells Differentiate and Mature into Neurons in the Maternal Brain. Stem Cells and Development 19:12, 1819-1830
CrossRef13
E. S. M. Lee, G. Bou-Gharios, E. Seppanen, K. Khosrotehrani, N. M. Fisk. (2010) Fetal stem cell microchimerism: natural-born healers or killers?. Molecular Human Reproduction 16:11, 869-878
CrossRef14
D.M. Kavanagh, M. Kersaudy-Kerhoas, R.S. Dhariwal, M.P.Y. Desmulliez. (2010) Current and emerging techniques of fetal cell separation from maternal blood. Journal of Chromatography B 878:22, 1905-1911
CrossRef15
B. N. Akay, H. Sanli, A. O. Heper. (2010) Postirradiation linear morphoea. Clinical and Experimental Dermatology 35:4, e106-e108
CrossRef16
Jonathan G. Howlett, Robert S. McKelvie, Jeannine Costigan, Anique Ducharme, Estrellita Estrella-Holder, Justin A. Ezekowitz, Nadia Giannetti, Haissam Haddad, George A. Heckman, Anthony M. Herd, Debra Isaac, Simon Kouz, Kori Leblanc, Peter Liu, Elizabeth Mann, Gordon W. Moe, Eileen O’Meara, Miroslav Rajda, Samuel Siu, Paul Stolee, Elizabeth Swiggum, Shelley Zeiroth. (2010) The 2010 Canadian Cardiovascular Society guidelines for the diagnosis and management of heart failure update: Heart failure in ethnic minority populations, heart failure and pregnancy, disease management, and quality improvement/assurance programs. Canadian Journal of Cardiology 26:4, 185-202
CrossRef17
Rei Sunami, Mayuko Komuro, Tsutomu Yuminamochi, Kazuhiko Hoshi, Shuji Hirata. (2010) Fetal cell microchimerism develops through the migration of fetus-derived cells to the maternal organs early after implantation. Journal of Reproductive Immunology 84:2, 117-123
CrossRef18
Alison C. Fitches, Samuel Yousem, Kathleen Cieply, Simon Stebbings, John Highton, Noelyn A. Hung. (2010) PCR detectable Y chromosome-specific DNA but no intact Y chromosome-bearing cells in polymyositis biopsies of two women with male offspring. Pathology 42:2, 160-164
CrossRef19
Valentina Cirello, Michela Perrino, Carla Colombo, Marina Muzza, Marcello Filopanti, Leonardo Vicentini, Paolo Beck-Peccoz, Laura Fugazzola. (2010) Fetal cell microchimerism in papillary thyroid cancer: studies in peripheral blood and tissues. International Journal of CancerNA-NA
CrossRef20
Laura Fugazzola, Valentina Cirello, Paolo Beck-Peccoz. (2010) Fetal cell microchimerism in human cancers. Cancer Letters 287:2, 136-141
CrossRef21
Chang Hoon Yim. (2010) Microchimerism and Autoimmune Thyroid Disease. Endocrinology and Metabolism 25:2, 89
CrossRef22
Osamu SAMURA. (2010) Fetal microchimerism and autoimmune disease. Japanese Journal of Clinical Immunology 33:6, 293-303
CrossRef23
Muddassir Aliniazee, Marilyn K. Glassberg. 2010. Sex and Gender Differences in Pulmonary Manifestations of Autoimmune Disease. , 277-285.
CrossRef24
Y.M. Dennis Lo, Ivy H.N. Wong, Nancy B.Y. Tsui, Ching-Wan Lam. 2009. Molecular Biological Analyses and Molecular Pathology in Clinical Chemistry. .
CrossRef25
David M. Lissauer, Karen P. Piper, Paul A.H. Moss, Mark D. Kilby. (2009) Fetal microchimerism: the cellular and immunological legacy of pregnancy. Expert Reviews in Molecular Medicine 11,
CrossRef26
Kiarash Khosrotehrani, Selim Aractingi. (2009) Fetal cell microchimerism in cancer: a meaningful event?. Future Oncology 5:9, 1441-1448
CrossRef27
Thomas Klonisch, Régen Drouin. (2009) Fetal–maternal exchange of multipotent stem/progenitor cells: microchimerism in diagnosis and disease. Trends in Molecular Medicine 15:11, 510-518
CrossRef28
Michele Leduc, Selim Aractingi, Kiarash Khosrotehrani. (2009) Fetal-cell microchimerism, lymphopoiesis, and autoimmunity. Archivum Immunologiae et Therapiae Experimentalis 57:5, 325-329
CrossRef29
Pietro Invernizzi, Simone Pasini, Carlo Selmi, M. Eric Gershwin, Mauro Podda. (2009) Female predominance and X chromosome defects in autoimmune diseases. Journal of Autoimmunity 33:1, 12-16
CrossRef30
Gabrielli, Armando, Avvedimento, Enrico V., Krieg, Thomas, . (2009) Scleroderma. New England Journal of Medicine 360:19, 1989-2003
Full Text31
Vijayalakshmi Kunadian, Cafer Zorkun, William J. Gibson, Navin Nethala, Caitlin Harrigan, Alexandra M. Palmer, Katherine J. Ogando, Leah H. Biller, Erin E. Lord, Scott P. Williams, Michelle E. Lew, Lauren N. Ciaglo, Jacqueline L. Buros, Susan J. Marble, C. Michael Gibson. (2009) Transfusion associated microchimerism: a heretofore little recognized complication following transfusion. Journal of Thrombosis and Thrombolysis 27:1, 57-67
CrossRef32
Ntobeko B.A. Ntusi, Bongani M. Mayosi. (2009) Aetiology and risk factors of peripartum cardiomyopathy: A systematic review. International Journal of Cardiology 131:2, 168-179
CrossRef33
Miho Tanigawa, Hiroshi Miyoshi, Osamu Samura, Keizo Sugino, Naoya Fujito, Maki Hyodo, Norio Miharu, Yoshiki Kudo. (2008) Cell-free fetal DNA in the non-pregnant woman with thyroid disease disappeared after surgery. Clinica Chimica Acta 397:1-2, 101-102
CrossRef34
Ilona Hromadnikova, Denisa Zlacka, Thi Thu Hien Nguyen, Lucie Sedlackova, Lenka Zejskova, Antonin Sosna. (2008) Fetal cells of mesenchymal origin in cultures derived from synovial tissue and skin of patients with rheumatoid arthritis. Joint Bone Spine 75:5, 563-566
CrossRef35
Tomoko Sato, Keiya Fujimori, Akira Sato, Hitoshi Ohto. (2008) Microchimerism After Induced or Spontaneous Abortion. Obstetrics & Gynecology 112:3, 593-597
CrossRef36
Marije Koopmans, Idske C.L. Kremer Hovinga, Hans J. Baelde, Mark S. Harvey, Emile de Heer, Jan A. Bruijn, Ingeborg M. Bajema. (2008) Chimerism occurs in thyroid, lung, skin and lymph nodes of women with sons. Journal of Reproductive Immunology 78:1, 68-75
CrossRef37
W.S. Bartynski. (2008) Posterior Reversible Encephalopathy Syndrome, Part 2: Controversies Surrounding Pathophysiology of Vasogenic Edema. American Journal of Neuroradiology 29:6, 1043-1049
CrossRef38
Elif Uz, Laurence S. Loubiere, Vijayakrishna K. Gadi, Zeynep Ozbalkan, Jeffrey Stewart, J. Lee Nelson, Tayfun Ozcelik. (2008) Skewed X-Chromosome Inactivation in Scleroderma. Clinical Reviews in Allergy & Immunology 34:3, 352-355
CrossRef39
H.J. Girschick. (2008) Sklerodermie im Kindes- und Jugendalter. Zeitschrift für Rheumatologie 67:2, 128-136
CrossRef40
Armando Gabrielli, Silvia Svegliati, Gianluca Moroncini, Michele Luchetti, Cecilia Tonnini, Enrico V. Avvedimento. (2007) Stimulatory autoantibodies to the PDGF receptor: A link to fibrosis in scleroderma and a pathway for novel therapeutic targets. Autoimmunity Reviews 7:2, 121-126
CrossRef41
M. Fabri, T. Krieg. (2007) Pathogenese der systemischen Sklerodermie. Der Hautarzt 58:10, 838-843
CrossRef42
G. H. Utter, W. F. Reed, T.-H. Lee, M. P. Busch. (2007) Transfusion-associated microchimerism. Vox Sanguinis 93:3, 188-195
CrossRef43
Edmond J. Yunis, Joaquin Zuniga, Viviana Romero, Emilio J. Yunis. (2007) Chimerism and tetragametic chimerism in humans: implications in autoimmunity, allorecognition and tolerance. Immunologic Research 38:1-3, 213-236
CrossRef44
C. Vernochet, S.M. Caucheteux, C. Kanellopoulos-Langevin. (2007) Bi-directional Cell Trafficking Between Mother and Fetus in Mouse Placenta. Placenta 28:7, 639-649
CrossRef45
S. Svegliati, A. Olivieri, N. Campelli, M. Luchetti, A. Poloni, S. Trappolini, G. Moroncini, A. Bacigalupo, P. Leoni, E. V. Avvedimento, A. Gabrielli. (2007) Stimulatory autoantibodies to PDGF receptor in patients with extensive chronic graft-versus-host disease. Blood 110:1, 237-241
CrossRef46
Norbert Gleicher, Andrea Weghofer, David Barad. (2007) Female infertility due to abnormal autoimmunity: frequently overlooked and greatly underappreciated. Part I. Expert Review of Obstetrics & Gynecology 2:4, 453-464
CrossRef47
Norbert Gleicher. (2007) Pregnancy-related cell traffic, microchimerism and autoimmunity: the possibility of reducing autoimmune disease prevalence. Expert Review of Obstetrics & Gynecology 2:3, 341-345
CrossRef48
Wolfgang Holzgreve, Sinuhe Hahn, Xiao Yan Zhong, Olav Lapaire, Irene Hösli, Sevgi Tercanli, Peter Miny, Claude Diesch. (2007) Genetic communication between fetus and mother: short- and long-term consequences. American Journal of Obstetrics and Gynecology 196:4, 372-381
CrossRef49
S. N. Huu, M. Oster, S. Uzan, F. Chareyre, S. Aractingi, K. Khosrotehrani. (2007) Maternal neoangiogenesis during pregnancy partly derives from fetal endothelial progenitor cells. Proceedings of the National Academy of Sciences 104:6, 1871-1876
CrossRef50
Diana W. Bianchi. (2007) Fetomaternal cell trafficking: a story that begins with prenatal diagnosis and may end with stem cell therapy. Journal of Pediatric Surgery 42:1, 12-18
CrossRef51
Norio Nakamura, Hideaki Yamabe, Ken Okumura. (2007) Change in blood group in systemic lupus erythematosus – Authors' reply. The Lancet 369:9557, 187
CrossRef52
Lazaros I Sakkas, Ian C Chikanza, Chris D Platsoucas. (2006) Mechanisms of Disease: the role of immune cells in the pathogenesis of systemic sclerosis. Nature Clinical Practice Rheumatology 2:12, 679-685
CrossRef53
Camilla Drexler, Thomas Wagner. (2006) Blood group chimerism. Current Opinion in Hematology 13:6, 484-489
CrossRef54
Carlo Selmi, Pietro Invernizzi, M Eric Gershwin. (2006) The X chromosome and systemic sclerosis. Current Opinion in Rheumatology 18:6, 601-605
CrossRef55
Connie M Westhoff. (2006) Molecular testing for transfusion medicine. Current Opinion in Hematology 13:6, 471-475
CrossRef56
Cristen J. Willer, Blanca M. Herrera, Katie M.E. Morrison, A.D. Sadovnick, George C. Ebers. (2006) Association between microchimerism and multiple sclerosis in Canadian twins. Journal of Neuroimmunology 179:1-2, 145-151
CrossRef57
Y.M. Dennis Lo, Ching-Wan Lam, Ivy H.N. Wong. 2006. Molecular Biological Analyses and Molecular Pathology in Clinical Chemistry. .
CrossRef58
Idske C. L. Kremer Hovinga, Marije Koopmans, Hans J. Baelde, Annemieke M. van der Wal, Yvo W. J. Sijpkens, Emile de Heer, Jan A. Bruijn, Ingeborg M. Bajema. (2006) Chimerism occurs twice as often in lupus nephritis as in normal kidneys. Arthritis & Rheumatism 54:9, 2944-2950
CrossRef59
B. Fleta Asín, M.C. Gonzalvo Liarte, P. Cía Gómez. (2006) Quimerismo: origen e implicaciones médicas. Revista Clínica Española 206:7, 340-342
CrossRef60
Gabriela Huerta Sil, Gabriel Medrano Ramírez. (2006) Microquimerismo fetal en enfermedades reumáticas. Reumatología Clínica 2:4, 202-209
CrossRef61
Marzia Caproni, Barbara Giomi, Samantha Berti, Beatrice Bianchi, Paolo Fabbri. (2006) Relevance of cellular infiltrate and cytokines in polymorphic eruption of pregnancy (PEP). Journal of Dermatological Science 43:1, 67-69
CrossRef62
Alison W. Loren, Greta R. Bunin, Christian Boudreau, Richard E. Champlin, Avital Cnaan, Mary M. Horowitz, Fausto R. Loberiza, David L. Porter. (2006) Impact of Donor and Recipient Sex and Parity on Outcomes of HLA-Identical Sibling Allogeneic Hematopoietic Stem Cell Transplantation. Biology of Blood and Marrow Transplantation 12:7, 758-769
CrossRef63
T. Krieg, N. Hunzelmann. (2006) Aktuelle pathophysiologische Aspekte der systemischen Sklerose. Zeitschrift für Rheumatologie 65:4, 275-278
CrossRef64
Margit Bauer, Wolfgang Weger, Irmgard Orescovic, Eva Maria Hiebaum, Christoph Benedicic, Uwe Lang, Christof Pertl, Barbara Pertl. (2006) Fetal microchimerism is not involved in the pathogenesis of lichen sclerosus of the vulva. Prenatal Diagnosis 26:2, 175-178
CrossRef65
W. Weger, M. Bauer, E. Odell, B. Pertl, L. Cerroni, H. Kerl, N. Jakse, C. Pertl. (2006) Role of microchimerism in the pathogenesis of oral lichen planus. Experimental Dermatology 15:2, 125-129
CrossRef66
Levente Lázár, Aacute;gnes Harmath, Zoltán Bán, Bálint Nagy, Csaba Papp, János Rigó, Zoltán Papp. (2006) Detection of maternal deoxyribonucleic acid in peripheral blood of premature and mature newborn infants. Prenatal Diagnosis 26:2, 168-170
CrossRef67
Viggo Jønsson, Johannes E. Bock, Jørgen Hilden, Richard S. Houlston, Allan Wiik. (2006) The influence of pregnancy on the development of autoimmunity in chronic lymphocytic leukemia. Leukemia & Lymphoma 47:8, 1481-1487
CrossRef68
Margalit E Rosenkranz, Lucila M A Agle, Petros Efthimiou, Thomas J A Lehman. (2006) Systemic and Localized Scleroderma in Children. Pediatric Drugs 8:2, 85-97
CrossRef69
Carol M. Artlett. (2005) Pathophysiology of fetal microchimeric cells. Clinica Chimica Acta 360:1-2, 1-8
CrossRef70
Anne M. Stevens. (2005) Maternal microchimerism—Allogenic target of autoimmune disease or Normal Biology?. Clinical and Applied Immunology Reviews 5:5, 325-338
CrossRef71
C.J. Willer, D.A. Dyment, A.D. Sadovnick, G.C. Ebers. (2005) Maternal - offspring HLA-DRB1 compatibility in multiple sclerosis. Tissue Antigens 66:1, 44-47
CrossRef72
Zeynep Özbalkan, Sevgi Ba??ışlar, Sedat Kiraz, Cemaliye Boylu Akyerli, Hüseyin T. E. Özer, Şule Yavuz, A. Merih Birlik, Meral Çalgüneri, Tayfun Özçelik. (2005) Skewed X chromosome inactivation in blood cells of women with scleroderma. Arthritis & Rheumatism 52:5, 1564-1570
CrossRef73
Sigrid Regauer. (2005) Immune dysregulation in lichen sclerosus. European Journal of Cell Biology 84:2-3, 273-277
CrossRef74
Lutz Kowalzick, Carol M. Artlett, Karin Thoss, Hans-Peter Baum, Heidrun Ziegler, Daniel Mischke, Roland Blum, Jörg-Martin Pönnighaus, Jürgen Quietzsch. (2005) Chronic Graft-versus-Host-Disease-Like Dermopathy in a Child with CD4+ Cell Microchimerism. Dermatology 210:1, 68-71
CrossRef75
Sélim Aractingi, Kiarash Khosrotehrani. (2005) Microchimerism: Fears and Hopes. Dermatology 210:1, 1-2
CrossRef76
Sergio A Jimenez, Carol M Artlett. (2005) Microchimerism and systemic sclerosis. Current Opinion in Rheumatology 17:1, 86-90
CrossRef77
Yu Wang, Hirotsugu Iwatani, Takahito Ito, Naoko Horimoto, Masaya Yamato, Isao Matsui, Enyu Imai, Masatsugu Hori. (2004) Fetal cells in mother rats contribute to the remodeling of liver and kidney after injury. Biochemical and Biophysical Research Communications 325:3, 961-967
CrossRef78
Sunanda Kane, John Kisiel, Lorena Shih, Stephen Hanauer. (2004) HLA Disparity Determines Disease Activity through Pregnancy in Women with Inflammatory Bowel Disease. The American Journal of Gastroenterology 99:8, 1523-1526
CrossRef79
Paloma Garcı́a de la Peña-Lefebvre, Youri Chanseaud, Mathieu C Tamby, Joseph Reinbolt, Frédéric Batteux, Yannick Allanore, André Kahan, Olivier Meyer, Olivier Benveniste, Olivier Boyer, Loı̈c Guillevin, Marie-Christophe Boissier, Luc Mouthon. (2004) IgG reactivity with a 100-kDa tissue and endothelial cell antigen identified as topoisomerase 1 distinguishes between limited and diffuse systemic sclerosis patients. Clinical Immunology 111:3, 241-251
CrossRef80
Lazaros I. Sakkas, Chris D. Platsoucas. (2004) Is systemic sclerosis an antigen-driven T cell disease?. Arthritis & Rheumatism 50:6, 1721-1733
CrossRef81
Alexandros Spyridonidis, Annette Schmitt-Gräff, Tina Tomann, Anne Dwenger, Marie Follo, Dirk Behringer, Jürgen Finke. (2004) Epithelial Tissue Chimerism after Human Hematopoietic Cell Transplantation Is a Real Phenomenon. The American Journal of Pathology 164:4, 1147-1155
CrossRef82
Sigrid Regauer, Patrizia Schwaiger, Bernadette Liegl, Michael Klintschar. (2004) Fetal Microchimerism Is Common in Normal and Diseased Vulvar Skin. Journal of Investigative Dermatology 122:4, 1059-1060
CrossRef83
M.E. Reid. (2003) Applications of DNA-based assays in blood group antigen and antibody identification. Transfusion 43:12, 1748-1757
CrossRef84
Masatoshi Deguchi, Diana Whitaker-Menezes, Stephen C. Jones, Setsuya Aiba, Satoshi Nakagawa, Hachiro Tagami, Robert Korngold, George F. Murphy. (2003) 12E2. The American Journal of Pathology 163:5, 1817-1825
CrossRef85
Kiarash Khosrotehrani, Kirby L. Johnson, Joseph Lau, Alain Dupuy, Dong Hyun Cha, Diana W. Bianchi. (2003) The influence of fetal loss on the presence of fetal cell microchimerism: A systematic review. Arthritis & Rheumatism 48:11, 3237-3241
CrossRef86
Carol M. Artlett, Terrence P. O'Hanlon, Ana M. Lopez, Yeong Wook Song, Frederick W. Miller, Lisa G. Rider, . (2003) HLA-DQA1 is not an apparent risk factor for microchimerism in patients with various autoimmune diseases and in healthy individuals. Arthritis & Rheumatism 48:9, 2567-2572
CrossRef87
Chris T Derk, Sergio A Jimenez. (2003) Systemic sclerosis: current views of its pathogenesis. Autoimmunity Reviews 2:4, 181-191
CrossRef88
Nathalie Lambert, J Lee Nelson. (2003) Microchimerism in autoimmune disease: more questions than answers?. Autoimmunity Reviews 2:3, 133-139
CrossRef89
Mathieu C Tamby, Youri Chanseaud, Loı̈c Guillevin, Luc Mouthon. (2003) New insights into the pathogenesis of systemic sclerosis. Autoimmunity Reviews 2:3, 152-157
CrossRef90
Christophe Ferrand, Sylvain Perruche, Eric Robinet, Anton Martens, Pierre Tiberghien, Philippe Saas. (2003) How should chimerism be decoded?1. Transplantation 75:Supplement, 50S-54S
CrossRef91
Kiarash Khosrotehrani, Diana W. Bianchi. (2003) Fetal cell microchimerism: helpful or harmful to the parous woman?. Current Opinion in Obstetrics and Gynecology 15:2, 195-199
CrossRef92
Carol M. Artlett. (2003) Microchimerism and scleroderma: An update. Current Rheumatology Reports 5:2, 154-159
CrossRef93
Carol M. Artlett, C. Gennaro Dito, Paul J. Christner. (2003) Methodology for detecting trace amounts of microchimeric DNA from peripheral murine white blood cells by real-time PCR. Biological Procedures Online 5:1, 103-107
CrossRef94
Keng Chen, Adrian See, Stephen Shumack. (2003) Epidemiology and pathogenesis of scleroderma. Australasian Journal of Dermatology 44:1, 1-7
CrossRef95
Gabriele Valentini, Carol Black. (2002) Systemic sclerosis. Best Practice & Research Clinical Rheumatology 16:5, 807-816
CrossRef96
Monique Gannag
, Zahir Amoura, Olivier Lantz, Jean-Charles Piette, Sophie Caillat-Zucman. (2002) Feto-maternal microchimerism in connective tissue diseases. European Journal of Immunology 32:12, 3405-3413
CrossRef97
Damir Hamamdzic, Laura M. Kasman, E. Carwile LeRoy. (2002) The role of infectious agents in the pathogenesis of systemic sclerosis. Current Opinion in Rheumatology 14:6, 694-698
CrossRef98
Wenhan Wan, Shoji Shimizu, Hiromichi Ikawa, Kiyosh Sugiyama, Nobuo Yamaguchi. (2002) Maternal cell traffic bounds for immune modulation: tracking maternal H-2 alleles in spleens of baby mice by DNA fingerprinting. Immunology 107:2, 261-267
CrossRef99
Tatsuo Ichinohe, Etsuko Maruya, Hiroh Saji. (2002) Long-term Feto-Maternal Microchimerism: Nature’s Hidden Clue for Alternative Donor Hematopoietic Cell Transplantation?. International Journal of Hematology 76:3, 229-237
CrossRef100
Balu H. Athreya. (2002) Juvenile scleroderma. Current Opinion in Rheumatology 14:5, 553-561
CrossRef101
Barbara C Biedermann, Silvia Sahner, Michael Gregor, Dimitrios A Tsakiris, Christina Jeanneret, Jordan S Pober, Alois Gratwohl. (2002) Endothelial injury mediated by cytotoxic T lymphocytes and loss of microvessels in chronic graft versus host disease. The Lancet 359:9323, 2078-2083
CrossRef102
Carol M. Artlett, Lori A. Cox, Ronald C. Ramos, Tara N. Dennis, Richard A. Fortunato, Laura K. Hummers, Sergio A. Jimenez, J.Bruce Smith. (2002) Increased Microchimeric CD4+ T Lymphocytes in Peripheral Blood from Women with Systemic Sclerosis. Clinical Immunology 103:3, 303-308
CrossRef103
Cristen J. Willer, A.Dessa Sadovnick, George C. Ebers. (2002) Microchimerism in autoimmunity and transplantation: potential relevance to multiple sclerosis. Journal of Neuroimmunology 126:1-2, 126-133
CrossRef104
S
CrossRef105
B. de Wazières, T.C. Fraisse, A. di Castri, A. Damigny, J. Fourcade. (2002) Association myasthénie et sclérodermie systémique. La Revue de Médecine Interne 23:4, 403-404
CrossRef106
J.Lee Nelson. (2002) Microchimerism: incidental byproduct of pregnancy or active participant in human health?. Trends in Molecular Medicine 8:3, 109-113
CrossRef107
Randall W. Johnson, Monty B. Tew, Frank C. Arnett. (2002) The genetics of systemic sclerosis. Current Rheumatology Reports 4:2, 99-107
CrossRef108
Marion E. Reid, Christine Lomas-Francis. (2002) Molecular approaches to blood group identification. Current Opinion in Hematology 9:2, 152-159
CrossRef109
Cristina Scaletti, Alessandra Vultaggio, Stefania Bonifacio, Lorenzo Emmi, Francesca Torricelli, Enrico Maggi, Sergio Romagnani, Marie-Pierre Piccinni. (2002) Th2-oriented profile of male offspring T cells present in women with systemic sclerosis and reactive with maternal major histocompatibility complex antigens. Arthritis & Rheumatism 46:2, 445-450
CrossRef110
Federica Edith Pisa, Massimo Bovenzi, Luciano Romeo, Alberta Tonello, Domenico Biasi, Lisa Maria Bambara, Alberto Betta, Fabio Barbone. (2002) Reproductive factors and the risk of scleroderma: An Italian case-control study. Arthritis & Rheumatism 46:2, 451-456
CrossRef111
J. Lee Nelson. (2002) Pregnancy and microchimerism in autoimmune disease: Protector or insurgent?. Arthritis & Rheumatism 46:2, 291-297
CrossRef112
Hiromichi Ariga, Hitoshi Ohto, Michael P. Busch, Shinya Imamura, Robert Watson, William Reed, Tzong-Hae Lee. (2001) Kinetics of fetal cellular and cell-free DNA in the maternal circulation during and after pregnancy: implications for noninvasive prenatal diagnosis. Transfusion 41:12, 1524-1530
CrossRef113
Kenneth Tokita, Paul Terasaki, Etsuko Maruya, Hiroh Saji. (2001) Tumour regression following stem cell infusion from daughter to microchimeric mother. The Lancet 358:9298, 2047-2048
CrossRef114
Bharath Srivatsa, Sumathi Srivatsa, Kirby L Johnson, Osamu Samura, Stephanie L Lee, Diana W Bianchi. (2001) Microchimerism of presumed fetal origin in thyroid specimens from women: a case-control study. The Lancet 358:9298, 2034-2038
CrossRef115
J.Lee Nelson. (2001) HLA relationships of pregnancy, microchimerism and autoimmune disease. Journal of Reproductive Immunology 52:1-2, 77-84
CrossRef116
Alberto Martini. (2001) Juvenile systemic scleroderma. Current Rheumatology Reports 3:5, 387-390
CrossRef117
N. C. LAMBERT, A. M. STEVENS, T. S. TYLEE, T. D. ERICKSON, D. E. FURST, J. L. NELSON. (2001) From the Simple Detection of Microchimerism in Patients with Autoimmune Diseases to Its Implication in Pathogenesis. Annals of the New York Academy of Sciences 945:1, 164-171
CrossRef118
R. Giacomelli, P. Cipriani, A. Fulminis, G. Barattelli, M. Matucci-Cerinic, S. D'Alo, G. Cifone, G. Tonietti. (2001) Circulating gamma/delta T lymphocytes from systemic sclerosis (SSc) patients display a T helper (Th) 1 polarization. Clinical and Experimental Immunology 125:2, 310-315
CrossRef119
Kirby L. Johnson, J. Lee Nelson, Daniel E. Furst, Peter A. McSweeney, Drucilla J. Roberts, Dong-Kai Zhen, Diana W. Bianchi. (2001) Fetal cell microchimerism in tissue from multiple sites in women with systemic sclerosis. Arthritis & Rheumatism 44:8, 1848-1854
CrossRef120
J. Lee Nelson. (2001) Microchimerism and hla relationships of pregnancy: Implications for autoimmune diseases. Current Rheumatology Reports 3:3, 222-229
CrossRef121
J Lee Nelson, Nathalie C Lambert. (2001) Microchimerism in rheumatic diseases. Joint Bone Spine 68:4, 290-296
CrossRef122
Naomi Ichikawa, Shigeru Kotake, Masayuki Hakoda, Naoyuki Kamatani. (2001) Microchimerism in Japanese patients with systemic sclerosis. Arthritis & Rheumatism 44:5, 1226-1228
CrossRef123
Hisao Osada, Shigeharu Doi, Takashi Fukushima, Hiromitsu Nakauchi, Katsuyoshi Seki, Souei Sekiya. (2001) Detection of fetal HPCs in maternal circulation after delivery. Transfusion 41:4, 499-503
CrossRef124
M. Nelson, C. Eagle, M. Langshaw, H. Popp, H. Kronenberg. (2001) Genotyping fetal DNA by non-invasive means: extraction from maternal plasma. Vox Sanguinis 80:2, 112-116
CrossRef125
Ivan Foeldvari, Nico Wulffraat. (2001) Recognition and Management of Scleroderma in Children. Paediatric Drugs 3:8, 575-583
CrossRef126
P. Invernizzi, C. De Andreis, S. M. Sirchia, P. M. Battezzati, M. Zuin, F. Rossella, F. Perego, M. Bignotto, G. Simoni, M. Podda. (2000) Blood fetal microchimerism in primary biliary cirrhosis. Clinical and Experimental Immunology 122:3, 418-422
CrossRef127
Carol M Artlett, Ron Ramos, SergAio A Jiminez, Kathleen Patterson, Frederick W Miller, Lisa G Rider. (2000) Chimeric cells of maternal origin in juvenile idiopathic inflammatory myopathies. The Lancet 356:9248, 2155-2156
CrossRef128
Paul J. Christner, Carol M. Artlett, Raymond F. Conway, Sergio A. Jiménez. (2000) Increased numbers of microchimeric cells of fetal origin are associated with dermal fibrosis in mice following injection of vinyl chloride. Arthritis & Rheumatism 43:11, 2598-2605
CrossRef129
Ivan Foeldvari. (2000) Diffuse and limited cutaneous systemic scleroderma. Current Opinion in Rheumatology 12:5, 435-438
CrossRef130
Mieke W. J. C. Jansen, Karin Korver-Hakkennes, Dik van Leenen, Helen Brandenburg, Hajo I. J. Wildschut, Juriy W. Wladimiroff, Rob E. Ploemacher. (2000) How useful is thein vitro expansion of fetal CD34+ progenitor cells from maternal blood samples for diagnostic purposes?. Prenatal Diagnosis 20:9, 725-731
CrossRef131
A. Brand. (2000) Immunological aspects of blood transfusions. Blood Reviews 14:3, 130-144
CrossRef132
Henry J. C de Vries, Dory N. H Enomoto, Jan van Marle, Paul P. M van Zuijlen, Jan R Mekkes, Jan D Bos. (2000) Dermal Organization in Scleroderma: The Fast Fourier Transform and the Laser Scatter Method Objectify Fibrosis in Nonlesional as well as Lesional Skin. Laboratory Investigation 80:8, 1281-1289
CrossRef133
Carlo Chizzolini. (2000) T lymphocyte and fibroblast interactions: the case of skin involvement in systemic sclerosis and other examples. Springer Seminars in Immunopathology 21:4, 431-450
CrossRef134
Y. M. DENNIS LO. (2000) Fetal DNA in Maternal Plasma. Annals of the New York Academy of Sciences 906:1, 141-147
CrossRef135
Diana W. Bianchi. (2000) Fetomaternal cell trafficking: A new cause of disease?. American Journal of Medical Genetics 91:1, 22-28
CrossRef136
Atsushi Tanaka, Keith Lindor, Aftab Ansari, M. Eric Gershwin. (2000) Fetal microchimerisms in the mother: Immunologic implications. Liver Transplantation 6:2, 138-143
CrossRef137
Timothy McAlindon. (2000) Update on the epidemiology of systemic lupus erythematosus: new spins on old ideas. Current Opinion in Rheumatology 12:2, 104-112
CrossRef138
Henk E Viëtor, Ben C.J Hamel, Simone P.M.J van Bree, Ellen M.W van der Meer, Dominique F.C.M Smeets, Barto J Otten, Robert A Holl, Frans H.J Claas. (2000) Immunological tolerance in an HLA non-identical chimeric twin. Human Immunology 61:3, 190-192
CrossRef139
Krovvidi S. R. SivaSai, Martin Jendrisak, Brian F. Duffy, Donna Phelan, Mark Ravenscraft, Todd Howard, T. Mohanakumar. (2000) CHIMERISM IN PERIPHERAL BLOOD OF SENSITIZED PATIENTS WAITING FOR RENAL TRANSPLANTATION1,2. Transplantation 69:4, 538-544
CrossRef140
K.J. Kao. (2000) Mechanisms and new approaches for the allogeneic blood transfusion-induced immunomodulatory effects. Transfusion Medicine Reviews 14:1, 12-22
CrossRef141
Yuko MIYASHITA, Masashi ONO, Mariko ONO, Hiroaki UEKI. (2000) Fetal Microchimerism in Rheumatic Autoimmune Disease.. Nishi Nihon Hifuka 62:3, 353-356
CrossRef142
Carlo Chizzolini. (1999) T lymphocyte and fibroblast interactions: the case of skin involvement in systemic sclerosis and other examples. Springer Seminars in Immunopathology 21:4, 431-450
CrossRef143
Barbara Pertl, Diana W. Bianchi. (1999) First trimester prenatal diagnosis: Fetal cells in the maternal circulation. Seminars in Perinatology 23:5, 393-402
CrossRef144
Atsushi Tanaka, Keith Lindor, Robert Gish, Kenneth Batts, Yasushi Shiratori, Masao Omata, J. Lee Nelson, Aftab Ansari, Ross Coppel, Margaret Newsome, M. Eric Gershwin. (1999) Fetal microchimerism alone does not contribute to the induction of primary biliary cirrhosis. Hepatology 30:4, 833-838
CrossRef145
Bodó, Imre, Peters, Marion, Radich, Jerald P., Hess, Jay, Blinder, Morey, Watson, Michael S., Van Rheeden, RichardNatarajan, Shanti, Lowell, Jeffrey A., Brown, Randy, DiPersio, John, Adkins, Douglas, . (1999) Donor-Derived Acute Promyelocytic Leukemia in a Liver-Transplant Recipient. New England Journal of Medicine 341:11, 807-813
Full Text146
Laura Rubbia-Brandt, Marie-Marthe Philippeaux, Sylvia Chavez, Gilles Mentha, Bettina Borisch, Antoine Hadengue. (1999) FISH for Y chromosome in women with primary biliary cirrhosis: Lack of evidence for leukocyte microchimerism. Hepatology 30:3, 821-822
CrossRef147
Harvey G. Klein. (1999) Immunomodulatory Aspects of Transfusion. Anesthesiology 91:3, 861
CrossRef148
ANTHONY P. WEETMAN. (1999) The Immunology of Pregnancy. Thyroid 9:7, 643-646
CrossRef149
Hideyuki Murata, Hiromitsu Nakauchi, Takauchi Sumida. (1999) Microchimerism in Japanese women patients with systemic sclerosis. The Lancet 354:9174, 220
CrossRef150
TERRY F. DAVIES. (1999) The Thyroid Immunology of the Postpartum Period. Thyroid 9:7, 675-684
CrossRef151
Sean Maloney, Anajane Smith, Daniel E. Furst, David Myerson, Kate Rupert, Paul C. Evans, J. Lee Nelson. (1999) Microchimerism of maternal origin persists into adult life. Journal of Clinical Investigation 104:1, 41-47
CrossRef152
J. Lee Nelson. (1999) Microchimerism and scleroderma. Current Rheumatology Reports 1:1, 15-21
CrossRef153
Diana W. Bianchi. (1999) Fetal cells in the maternal circulation: feasibility for prenatal diagnosis. British Journal of Haematology 105:3, 574-583
CrossRef154
Robert A. Brodsky, B. Douglas Smith. (1999) Bone marrow transplantation for autoimmune diseases. Current Opinion in Oncology 11:2, 83
CrossRef155
Michael Girardi, Jennifer M. McNiff, Peter W. Heald. (1999) Extracorporeal photochemotherapy in human and murine graft-versus-host disease. Journal of Dermatological Science 19:2, 106-113
CrossRef156
Y. M. Dennis Lo, Jun Zhang, Tse N. Leung, Tze K. Lau, Allan M.Z. Chang, N. Magnus Hjelm. (1999) Rapid Clearance of Fetal DNA from Maternal Plasma. The American Journal of Human Genetics 64:1, 218-224
CrossRef157
Epstein, Franklin H., , Starzl, Thomas E., Zinkernagel, Rolf M., . (1998) Antigen Localization and Migration in Immunity and Tolerance. New England Journal of Medicine 339:26, 1905-1913
Full Text158
Barbara J Doss, Suzanne M Jacques, Maureen D Mayes, Faisal Qureshi. (1998) Maternal scleroderma: Placental findings and perinatal outcome. Human Pathology 29:12, 1524-1530
CrossRef159
Sélim Aractingi, Nadia Berkane, Philippe Bertheau, Caroline Le Goué, Jean Dausset, Serge Uzan, Edgardo D Carosella. (1998) Fetal DNA in skin of polymorphic eruptions of pregnancy. The Lancet 352:9144, 1898-1901
CrossRef160
Jones-Caballero, FernAndez-Herrera, COrdoba-Guijarro, DaudEN-Tello, GarcIA-DIez. (1998) Sclerodermatous graft-versus-host disease after donor leucocyte infusion. British Journal of Dermatology 139:5, 889-892
CrossRef161
John B. Harley, Barbara R. Neas. (1998) Oklahoma Choctaw and systemic sclerosis: The founder effect and genetic susceptibility. Arthritis & Rheumatism 41:10, 1725-1728
CrossRef162
(1998) Fetal DNA and Cells in Women with Systemic Sclerosis. New England Journal of Medicine 339:11, 771-772
Full Text163
W. Michael McDonnell. (1998) Is primary biliary cirrhosis a complication of pregnancy?. Hepatology 28:2, 593-593
CrossRef164
Nelson, J. Lee, . (1998) Microchimerism and Autoimmune Disease. New England Journal of Medicine 338:17, 1224-1225
Full Text
- Letters
