Original Article
Brief Report
Molecular Analysis of the Progression from Helicobacter pylori–Associated Chronic Gastritis to Mucosa-Associated Lymphoid-Tissue Lymphoma of the Stomach
N Engl J Med 1998; 338:804-810March 19, 1998
- Article
Several lines of evidence suggest a link between chronic gastritis due to Helicobacter pylori and mucosa-associated lymphoid-tissue (MALT) lymphoma of the stomach.1,2 A close epidemiologic association has been reported.3-5 The microorganism can be found in the gastric mucosa in nearly all cases, and regression of low-grade gastric MALT lymphoma has been demonstrated after the eradication of H. pylori. 6,7
The suggested progression from H. pylori–associated chronic gastritis to overt MALT lymphoma8 has not been formally demonstrated, although if it exists, such a mechanism may have important implications for the treatment of H. pylori–associated gastritis. Each B cell contains immunoglobulin heavy-chain genes in a novel configuration that provides a marker for small populations of monoclonal B cells, which can be identified in pathological specimens by the polymerase chain reaction (PCR).9,10 We describe two patients with histories of chronic H. pylori–associated gastritis and subsequent gastric MALT lymphoma in whom gastric-biopsy samples obtained several years before the onset of lymphoma were molecularly analyzed with a patient-specific PCR approach. We were able to show that the lymphomas arose from a B-cell clone at the site of chronic gastritis.
Case Reports
Patient 1
Patient 1 was a 36-year-old man with a six-month history of epigastric pain for which he underwent upper gastrointestinal endoscopy, with random biopsy specimens obtained, in 1981 (Table 1Table 1
Clinical Characteristics of Patient 1 and Results of Molecular Analyses.). Benign gastric peptic ulcer with chronic gastritis of the antrum and the body was diagnosed. The patient was treated with antacids and remained well until 1985, when the gastric symptoms recurred. Further endoscopic gastric biopsy confirmed the diagnosis of chronic gastritis associated with H. pylori infection. Treatment with ranitidine was given, with good relief of symptoms. Follow-up endoscopy in March 1990 revealed lymphoepithelial lesions and plasma-cell infiltrates in both the gastric body and the duodenum. A histologic diagnosis of low-grade MALT lymphoma was made. Routine staging procedures12 revealed stage I disease (lymphoma confined to the gastric mucosa). The symptoms resolved with the resumption of ranitidine treatment, and the patient declined to undergo gastrectomy. His condition was monitored with regular endoscopy and gastric biopsy, which showed no changes in histologic findings. In September 1993, he received a 10-day course of amoxicillin (750 mg three times daily), metronidazole (500 mg three times daily), and omeprazole (40 mg daily) to eradicate H. pylori. Repeated gastric biopsies from 1994 to 1996 documented the eradication of H. pylori but the persistence of multifocal lesions of low-grade MALT lymphoma.In October 1996 endoscopy revealed a clear progression of the low-grade lymphoma in the stomach, with diffuse and deep infiltration of the gastric wall and duodenal invasion with stenosis of the duodenal bulb. A computed tomographic scan showed abdominal adenopathy; the results of a bone marrow biopsy were normal. He was treated with six cycles of a regimen consisting of doxorubicin, cyclophosphamide, vincristine, prednisone, and methotrexate. Complete remission was documented in June 1997. The patient was still in remission at the most recent follow-up visit in December 1997.
Patient 2
Patient 2 underwent selective proximal vagotomy in 1976, at the age of 40, followed eight years later by partial gastrectomy with a Billroth II anastomosis (Table 2Table 2
Clinical Characteristics of Patient 2 and Results of Molecular Analyses.). She had had severe peptic ulcer disease since the early 1970s. Pathological examination of the stomach specimens obtained at resection showed diffuse gastritis and peptic ulcer, without neoplastic tissue. In June 1988 a diffuse, mixed, predominantly large cell lymphoma (group F, according to the working formulation for the classification of lymphoma) in the gastric stump was diagnosed by endoscopic biopsy, and the patient was referred for staging and treatment. She reported increasing dysphagia, back pain, regurgitation, fever, night sweats, and a substantial weight loss in the preceding six months. Her H. pylori status was not known. Abdominal ultrasonography and computed tomographic scanning showed a large mass in the remnant gastric wall; multiple paragastric, mesenteric, and retroperitoneal lymphadenopathies; a focal liver lesion; and splenomegaly. Radiographs and computed tomographic scans of the chest showed no abnormalities. Analysis of a bone marrow aspirate and trephine biopsy showed infiltration from a large-cell lymphoma.The patient was treated with six courses of a regimen consisting of doxorubicin, cyclophosphamide, vincristine, prednisone, and high-dose methotrexate with leucovorin rescue, alternating every 22 days with etoposide, bleomycin, procarbazine, and cytarabine.13 She had a complete remission, but she had a relapse identified in bone marrow in January 1990 (the results of a gastric-stump biopsy were suggestive of relapse but not conclusive). She had a second complete remission after two cycles of salvage treatment14 with a regimen consisting of etoposide, methylprednisolone, high-dose cytarabine, and cisplatin and subsequently underwent autologous bone marrow transplantation in September 1990. At the most recent follow-up visit in December 1997, she had no evidence of lymphoma.
Methods
Histologic Analysis
All slides were reviewed according to the criteria of Isaacson and Norton15 and graded according to the histologic scoring system proposed by Wotherspoon et al.11 In this system a score of 0 indicates normal gastric mucosa; a score of 1, chronic active gastritis with small clusters of lymphocytes in the lamina propria, without lymphoid follicles or lymphoepithelial lesions; a score of 2, chronic active gastritis with prominent lymphoid follicles and surrounding mantle-zone and plasma cells without lymphoepithelial lesions; a score of 3, a probable reactive lymphoid infiltrate, with lymphoid follicles surrounded by small lymphocytes that diffusely infiltrate the lamina propria and occasionally the epithelium; a score of 4, a probable neoplastic lymphoid infiltrate composed of lymphoid follicles surrounded by centrocyte-like cells that diffusely penetrate the lamina propria and epithelium in small groups; and a score of 5, low-grade MALT lymphoma with dense infiltration of centrocyte-like cells in the lamina propria and prominent lymphoepithelial lesions. A modified Giemsa stain was used to identify H. pylori. 16 The slides were reviewed by one pathologist before and after the completion of the molecular analysis. For the second review the pathologist was unaware of the results of the molecular analysis. The histologic diagnoses were confirmed by a second pathologist.
Consensus-Sequence PCR
DNA was extracted from paraffin-embedded tissue sections that were 10 μm thick, as previously described.17 A 268-bp segment of the β-globin gene was amplified by PCR with the PCO4 (5'CAACTTCATCCACGTTCACC3') and GH20 (5'GAAGAGCCAAGGACAGGTAC3') primers (Perkin-Elmer, Norwalk, Conn.). We amplified the complementarity-determining region 3 (CDR3), which is the most variable region of the immunoglobulin heavy-chain gene,9 using semi-nested PCR with the FR3A primer (5'ACACGGCC[TC]GTGTATTACTGT3') for the conserved-framework-3 segment of the variable region and the LJH (5'TGAGGAGACGGTGACC3') and VLJH (5'GTGACCAGGGTNCCTTGGCCCCAG3') primers for the joining region. PCR reactions were performed in accordance with the methods described by Diss et al.10 Samples from the patients were analyzed in duplicate, and DNA from the Raji cell line of human B-cell lymphoma was used as a positive control. A negative control containing all PCR reagents without any template DNA was also used. The amplification products were analyzed on 10 percent nondenaturing polyacrylamide gels and visualized with ultraviolet light after staining with ethidium bromide. The presence of a distinct single band (with or without other less intense bands, reflecting the formation of heteroduplexes) was considered to indicate monoclonality, the presence of a few intensely stained distinct bands oligoclonality, and the presence of a smear of amplified products polyclonality.18,19
Cloning and Sequencing of PCR Products
Monoclonal bands from at least two different lymphoma-containing samples from each patient were excised from the polyacrylamide gel. DNA was extracted19,20 and purified with Sephacryl MicroSpin S-400 HR columns (Pharmacia, Uppsala, Sweden). Cloning and sequencing of CDR3 were performed with the pMOSBlue T-vector kit (Amersham, Little Chalfont, Buckinghamshire, United Kingdom) and a Sequenase DNA Sequencing kit (version 2.0, Amersham), according to the manufacturer's instructions.
Allele-Specific PCR
Allele-specific oligonucleotides were designed for each patient from the CDR3 sequences of the predominant clones (i.e., identical clones representing at least three of six recombinants examined from each patient) and used as 5' primers to perform nested PCR in DNA from biopsy samples showing gastritis in the two patients. The CDR3 sequences have been assigned GenBank accession numbers AF016207 and AF016208 in the case of the two clones in Patient 1 and AF016215 in the case of the predominant clone in Patient 2. The first round of amplification was carried out in the same manner as the PCR for the consensus sequence of CDR3; in the second round the allele-specific oligonucleotide was used as a primer in conjunction with the consensus VLJH primer. DNA from the sequenced lymphoma sample from each patient was used as a positive control. In order to assess the specificity of the lymphoma allele-specific oligonucleotide, DNA from a disease-free specimen from the patients and DNA from the Raji cell line were analyzed. Reaction products were analyzed on 10 percent nondenaturing polyacrylamide gels as described above.
Results
Patient 1
In Patient 1, chronic gastritis (histologic score, 3) was confirmed by histologic review only in the initial sample (Figure 1AFigure 1
Histologic Patterns in the Evolution from Chronic Gastritis to Gastric Lymphoma.), obtained in 1981. This sample had an oligoclonal pattern of B cells on PCR assay of the CDR3 segment of the immunoglobulin gene. Low-grade MALT lymphoma (histologic score, 4 or 5) was diagnosed in biopsy specimens obtained from 1985 onward (Figure 1C and Figure 1D); a monoclonal rearrangement of the immunoglobulin heavy-chain gene with a similar band size was detected in all samples (Table 1).Sequencing analysis of the monoclonal band in the specimens of low-grade MALT lymphoma that were obtained in 1990 and 1992 showed two major lymphoma clones of 97 bp and 100 bp. Because the two differed by only 3 bp, they could not be clearly distinguished on gel electrophoresis. Both CDR3 sequences of these clones were used for allele-specific PCR, and both clones were present in the initial (1981) sample as well as in the biopsy specimens obtained in 1985 (Table 1, Figure 2AFigure 2
Results of Polyacrylamide-Gel Electrophoresis of the Immunoglobulin Heavy-Chain CDR3 PCR Products from the Two Patients., and Figure 2B). After 1993, one of the two B-cell clones was no longer detectable (Table 1). Both CDR3 sequences were in the correct reading frame for the production of a potentially functional protein. As a result of allelic exclusion, a B-cell clone usually produces only a single immunoglobulin. The fact that both sequences were in the correct reading frame suggests the presence of a biclonal lymphoma.Patient 2
Histologic review of the gastric-biopsy specimens obtained three months before gastric resection in 1984 and at gastrectomy confirmed the absence of lymphoma (Figure 1B). The pathological features were those of active gastritis, with lymphoid follicles, focal intestinal metaplasia, and chronic peptic ulceration (histologic score, 2). The presence of H. pylori was documented in specimens obtained in 1984 and 1988. The patient never received antibiotics with the specific aim of eradicating H. pylori. However, during and after chemotherapy, she received a variety of antibiotics to treat infections. These treatments may have eradicated H. pylori.
Review of samples from the gastric-stump biopsy performed in 1988 confirmed the presence of diffuse, aggressive non-Hodgkin's lymphoma, which was reclassified as a large-cell lymphoma with focal areas of low-grade MALT lymphoma (Figure 1E and Figure 1F). The presence of large lymphoma cells was also substantiated in the bone marrow after histologic review of the specimen obtained by trephine biopsy. The histologic examination of the endoscopic-biopsy specimens obtained immediately before the relapse of lymphoma in the bone marrow showed focal suspicious-appearing dense, small lymphocytic infiltrates (histologic score, 4) that may have been related to the presence of residual low-grade MALT lymphoma. The gastric-biopsy specimen obtained after transplantation showed no such B-cell infiltration.
PCR amplification of the immunoglobulin gene with consensus primers demonstrated an oligoclonal pattern in the samples obtained at the time gastritis was diagnosed and a monoclonal band of the same size in all the samples of both low-grade and high-grade lymphoma obtained in 1988 and 1990 before autologous bone marrow transplantation. An oligoclonal or polyclonal pattern continued to be present after transplantation (Table 1). One predominant B-cell clone was sequenced from a paraffin-embedded lymphoma specimen, and its CDR3 sequence was used to make an allele-specific primer. Allele-specific PCR demonstrated the presence of this clone in the gastritis specimen and in all subsequent biopsy samples until bone marrow transplantation in 1990, after which this clone became undetectable (Figure 2A and Figure 2B).
Discussion
Epidemiologic,4,5 experimental,21 and clinical6,7,15,22 data support a strong association between primary MALT lymphoma of the stomach (a clonal B-cell cancer) and gastric H. pylori infection. In our study, we used a sensitive, patient-specific molecular technique — allele-specific PCR — to show that histologically confirmed H. pylori gastritis harbors the clonal B cell that eventually gives rise to MALT lymphoma.
A spectrum of lymphoproliferations, from polyclonal to monoclonal, may be involved in the transformation from benign to overtly neoplastic forms in the stomach.23,24 The scoring system proposed by Wotherspoon et al.11 reflects this continuum from a histologic point of view. Tumor progression is a multistep process, and defining the point at which a non-neoplastic lesion becomes neoplastic is difficult.25 Some genetic lesions have a clonal abnormality that remains responsive to normal regulators of growth and differentiation.25,26 Recent studies27-29 have shown antigenic selection and clonal expansion in B-cell clones of MALT lymphoma. The proliferation of these clones might be subclinical or of minimal clinical significance until additional genetic changes occur and the process becomes irreversible.
Sequencing analysis of DNA from Patient 1 showed two major lymphoma clones apparently arising from a biclonal proliferation of B cells. Allele-specific PCR based on these sequences was positive in the gastritis samples and in the subsequent lymphoma samples. One clone disappeared after several years, after antibiotic treatment, whereas the other did not. The persistent clone may have progressed to a stage of independence from H. pylori. The development of biclonal or oligoclonal lymphomas has also been documented in other circumstances, such as after organ transplantation.30-32 In lymphomas induced by Epstein–Barr virus and associated with organ transplantation, a similar process of clonal B-cell proliferation is seen, and withdrawal of immunosuppression may suppress the proliferation and halt the progression of lymphoma.31,32 Withdrawal of the H. pylori antigenic stimulus at an early stage of clonal B-cell proliferation — such as by eradicating the microorganism — may reverse the malignant process before it becomes irreversible.
H. pylori is a very common bacterial infection in humans, present in almost half of all people.33 Gastric MALT lymphoma, however, will develop in only a very small percentage. The estimated incidence of this lymphoma in the United States is between 1 in 30,000 and 1 in 80,000.34 A higher incidence (13 in 100,000) has been reported in northeastern Italy.4 Additional environmental or host-related factors may be needed to sustain gastric lymphomagenesis.
The point at which H. pylori infection should be treated is controversial. There is general agreement only that it should be eradicated in patients with gastric or duodenal peptic ulcer.35,36 Our findings could be seen as supporting the use of antibiotic therapy in all symptomatic patients with H. pylori gastritis. However, considerations of cost as well as the high cure rate of MALT lymphoma37,38 and the increasing resistance to antibiotics36,39 weigh against the indiscriminate use of antibiotics to treat all people with H. pylori gastritis. Moreover, there are insufficient data to demonstrate that eradicating H. pylori prevents the progression of gastritis to cancer or lymphoma.
Nevertheless, our findings suggest that analysis of B-cell clonality by PCR may help physicians to care for patients with H. pylori gastritis, particularly those with suspicious-appearing lymphoid infiltrates at histologic examination. In patients with a monoclonal B-cell population, which might represent an early, reversible step in the process of lymphomagenesis, we believe that antibiotic treatment of gastritis should be considered in order to reduce the risk of lymphoma.
Supported by grants from the Swiss National Science Foundation (32-45993.95) and the Schweizerische Krebsliga–Krebsforschung Schweiz (AKT 623), and grants and fellowships from the Fondazione Tettamanti per lo Studio delle Leucemie ed Emopatie Infantili, the Associazione Italiana per la Ricerca sul Cancro, and the Consiglio Nazionale delle Ricerche.
We are indebted to Dr. Antonio Bonetti and Dr. Bernard Miazza for performing diagnostic and follow-up endoscopies and to Dr. Finbarr Cotter, Dr. Michele De Boni, and Dr. Giorgio Mombelli for helpful discussions.
Source Information
From the Servizio Oncologico Cantonale, Ospedale San Giovanni, Bellinzona, Switzerland (E.Z., F.B., E.R., G.B., F.C.); Clinica Pediatrica dell'Università di Milano, Ospedale San Gerardo, Monza, Italy (G.C., A.B.); and Istituto Cantonale di Patologia, Locarno, Switzerland (E.P.).
Address reprint requests to Dr. Cavalli at the Servizio Oncologico Cantonale, Ospedale San Giovanni, 6500 Bellinzona, Switzerland.
- References
References
1
Isaacson PG . The MALT lymphoma concept updated. Ann Oncol 1995;6:319-320
Web of Science | Medline2
Zucca E ,Roggero E . Biology and treatment of MALT lymphoma: the state-of-the-art in 1996: a workshop at the 6th International Conference on Malignant Lymphoma. Ann Oncol 1996;7:787-792
Web of Science | Medline3
Wotherspoon AC ,Ortiz-Hidalgo C ,Falzon MR ,Isaacson PG . Helicobacter pylori-associated gastritis and primary B-cell gastric lymphoma. Lancet 1991;338:1175-1176
CrossRef | Web of Science | Medline4
Doglioni C ,Wotherspoon AC ,Moschini A ,de Boni M ,Isaacson PG . High incidence of primary gastric lymphoma in northeastern Italy. Lancet 1992;339:834-835
CrossRef | Web of Science | Medline5
Parsonnet J ,Hansen S ,Rodriguez L , et al. Helicobacter pylori infection and gastric lymphoma. N Engl J Med 1994;330:1267-1271
Full Text | Web of Science | Medline6
Roggero E ,Zucca E ,Pinotti G , et al. Eradication of Helicobacter pylori infection in primary low-grade gastric lymphoma of mucosa-associated lymphoid tissue. Ann Intern Med 1995;122:767-769
Web of Science | Medline7
Bayerdorffer E ,Neubauer A ,Rudolph B , et al. Regression of primary gastric lymphoma of mucosa-associated lymphoid tissue type after cure of Helicobacter pylori infection. Lancet 1995;345:1591-1594
CrossRef | Web of Science | Medline8
Carlson SJ ,Yokoo H ,Vanagunas A . Progression of gastritis to monoclonal B-cell lymphoma with resolution and recurrence following eradication of Helicobacter pylori. JAMA 1996;275:937-939
CrossRef | Web of Science | Medline9
Schwartz RS . Jumping genes and the immunoglobulin V gene system. N Engl J Med 1995;333:42-44
Full Text | Web of Science | Medline10
Diss TC ,Peng H ,Wotherspoon AC ,Isaacson PG ,Pan L . Detection of monoclonality in low-grade B-cell lymphomas using the polymerase chain reaction is dependent on primer selection and lymphoma type. J Pathol 1993;169:291-295
CrossRef | Web of Science | Medline11
Wotherspoon AC ,Doglioni C ,Diss TC , et al. Regression of primary low-grade B-cell gastric lymphoma of mucosa-associated lymphoid tissue type after eradication of Helicobacter pylori. Lancet 1993;342:575-577
CrossRef | Web of Science | Medline12
Rohatiner A ,d'Amore F ,Coiffier B , et al. Report on a workshop convened to discuss the pathological and staging classifications of gastrointestinal tract lymphoma. Ann Oncol 1994;5:397-400
Web of Science | Medline13
Zucca E ,Martinelli G ,Csontos S ,Cavalli F . MACOP/CytaBEP: a novel effective treatment for aggressive non-Hodgkin's lymphomas. Proc Am Soc Clin Oncol 1993;12:369-369 abstract.14
Cabanillas F . Experience with salvage regimens at M.D. Anderson Hospital. Ann Oncol 1991;2:Suppl 1:31-32
Web of Science | Medline15
Isaacson PG, Norton AJ. Malignant lymphoma of the gastrointestinal tract. In: Isaacson PG, Norton AJ, eds. Extranodal lymphomas. Edinburgh, Scotland: Churchill Livingstone, 1994:15-65.
16
Potter HVPJ ,Loffeld RJLF ,Stobberingh E ,van Spreeuwel JP ,Arends JW . Rapid staining of Campylobacter pyloridis. Histopathology 1987;11:1223-1223
CrossRef | Web of Science17
Wright DK, Manos M. Sample preparation from paraffin-embedded tissues. In: Innis MA, Gelfand DH, Sninsky JJ, White TJ, eds. PCR protocols: a guide to methods and applications. London: Academic Press, 1990:153-8.
18
Bottaro M ,Berti E ,Biondi A ,Migone N ,Crosti L . Heteroduplex analysis of T-cell receptor γ gene rearrangements for diagnosis and monitoring of cutaneous T-cell lymphomas. Blood 1994;83:3271-3278
Web of Science | Medline19
Goulden N, Langlands K, Steward C, Knechtli C, Potter M, Oakhill T. PCR of gene rearrangements for the detection of minimal residual disease in childhood ALL. In: Cotter FE, ed. Molecular diagnosis of cancer. Totowa, N.J.: Humana Press, 1996:3-23.
20
Ausubel FM, Brent R, Kingston RE, et al., eds. Short protocols in molecular biology. 2nd ed. New York: Greene Publishing, 1992:2.21-2.22.
21
Hussell T ,Isaacson PG ,Crabtree JE ,Spencer J . The response of cells from low-grade B-cell gastric lymphomas of mucosa-associated lymphoid tissue to Helicobacter pylori. Lancet 1993;342:571-574
CrossRef | Web of Science | Medline22
Weber DM ,Dimopoulos MA ,Anandu DP ,Pugh WC ,Steinbach G . Regression of gastric lymphoma of mucosa-associated lymphoid tissue with antibiotic therapy for Helicobacter pylori. Gastroenterology 1994;107:1835-1838
Web of Science | Medline23
Rudolph B ,Bayerdorffer E ,Ritter M , et al. Is the polymerase chain reaction or cure of Helicobacter pylori infection of help in the differential diagnosis of early gastric mucosa-associated lymphatic tissue lymphoma? J Clin Oncol 1997;15:1104-1109
Web of Science | Medline24
Savio A ,Franzin G ,Wotherspoon AC , et al. Diagnosis and posttreatment follow-up of Helicobacter pylori-positive gastric lymphoma of mucosa-associated lymphoid tissue: histology, polymerase chain reaction, or both? Blood 1996;87:1255-1260
Web of Science | Medline25
Magrath IT. Concepts and controversies in lymphoid neoplasia. In: Magrath IT, ed. The non-Hodgkin's lymphomas. 2nd ed. London: Arnold, 1997:3-46.
26
Ludwig CU ,Gencik M ,Shipman R . Multistep transformation in low-grade lymphoproliferative diseases. Ann Oncol 1993;4:825-830
Web of Science | Medline27
Qin Y ,Greiner A ,Trunk MJF ,Schmausser B ,Ott MM ,Muller-Hermelink HK . Somatic hypermutation in low-grade mucosa-associated lymphoid tissue-type B-cell lymphoma. Blood 1995;86:3528-3534
Web of Science | Medline28
Du M ,Diss TC ,Xu C ,Peng H ,Isaacson PG ,Pan L . Ongoing mutation in MALT lymphoma immunoglobulin gene suggests that antigen stimulation plays a role in the clonal expansion. Leukemia 1996;10:1190-1197
Web of Science | Medline29
Bertoni F ,Cazzaniga G ,Bosshard G , et al. Immunoglobulin heavy chain diversity genes rearrangement pattern indicates that MALT-type gastric lymphoma B cells have undergone an antigen selection process. Br J Haematol 1997;97:830-836
CrossRef | Web of Science | Medline30
Sklar J ,Cleary ML ,Thielemans K ,Gralow J ,Warnke R ,Levy R . Biclonal B-cell lymphoma. N Engl J Med 1984;311:20-27
Full Text | Web of Science | Medline31
Levine AM . Lymphoma complicating immunodeficiency disorders. Ann Oncol 1994;5:Suppl 2:29-35
Medline32
Knowles DM ,Cesarman E ,Chadburn A , et al. Correlative morphologic and molecular genetic analysis demonstrates three distinct categories of posttransplantation lymphoproliferative disorders. Blood 1995;85:552-565
Web of Science | Medline33
Cover TL ,Blaser MJ . Helicobacter pylori infection, a paradigm for chronic mucosal inflammation: pathogenesis and implications for eradication and prevention. Adv Intern Med 1996;41:85-117
Medline34
Zaki M ,Schubert ML . Helicobacter pylori and gastric lymphoma. Gastroenterology 1995;108:610-612
CrossRef | Medline35
NIH Consensus Development Panel on Helicobacter pylori in Peptic Ulcer Disease
CrossRef | Web of Science36
Rabeneck L ,Graham DY . Helicobacter pylori: when to test, when to treat. Ann Intern Med 1997;126:315-316
Web of Science | Medline37
Zucca E ,Cavalli F . Gut lymphomas. Baillieres Clin Haematol 1996;9:727-741
CrossRef | Web of Science | Medline38
Roggero E ,Zucca E ,Cavalli F . Gastric mucosa-associated lymphoid tissue lymphomas: more than a fascinating model. J Natl Cancer Inst 1997;89:1328-1330
CrossRef | Web of Science | Medline39
Bower H . Sequencing of Helicobacter pylori will radically alter research. BMJ 1997;315:383-383
CrossRef | Web of Science
- Citing Articles (67)
Citing Articles
1
Marion J. J. Kuper-Hommel, J. Han J. M. van Krieken. (2012) Molecular pathogenesis and histologic and clinical features of extranodal marginal zone lymphomas of mucosa-associated lymphoid tissue type. Leukemia & Lymphoma1-14
CrossRef2
Sung-Hsin Kuo, Wen-Hui Weng, Zi-Hua Chen, Ping-Ning Hsu, Ming-Shiang Wu, Chung-Wu Lin, Huei-Jiuan Jeng, Kun-Huei Yeh, Hui-Jen Tsai, Li-Tzong Chen, Ann-Lii Cheng. (2011) Establishment of a novel MALT lymphoma cell line, ma-1, from a patient with t(14;18)(q32;q21)-positive Helicobacter Pylori-Independent Gastric MALT Lymphoma. Genes, Chromosomes and Cancer 50:11, 908-921
CrossRef3
A Dagklis, M Ponzoni, S Govi, M G Cangi, E Pasini, F Charlotte, A Vino, C Doglioni, F Davì, I S Lossos, I Ntountas, T Papadaki, R Dolcetti, A J M Ferreri, K Stamatopoulos, P Ghia. (2011) Immunoglobulin gene repertoire in ocular adnexal lymphomas: hints on the nature of the antigenic stimulation. Leukemia
CrossRef4
Jerome S. Burke. (2011) Lymphoproliferative Disorders of the Gastrointestinal Tract: A Review and Pragmatic Guide to Diagnosis. Archives of Pathology & Laboratory Medicine 135:10, 1283-1297
CrossRef5
Lucia Flossbach, Elias Antoneag, Michaela Buck, Reiner Siebert, Torsten Mattfeldt, Peter Möller, Thomas F.E. Barth. (2011) BCL6 gene rearrangement and protein expression are associated with large cell presentation of extranodal marginal zone B-cell lymphoma of mucosa-associated lymphoid tissue. International Journal of Cancer 129:1, 70-77
CrossRef6
Didier Decaudin, Agnès Ferroni, Anne Vincent-Salomon, Kheira Beldjord, Pierre Validire, Patricia de Cremoux, Patricia Validire, Corine Plancher, Claire Mathiot, Elizabeth Macintyre, Bernard Asselain, Jacques Girodet, Frédéric Mal, Nicole Brousse, Jean-Luc Beretti, Rémi Dendale, Livia Lumbroso-Le Rouic, Olivier Hermine, Marc Lecuit. (2010) Ocular adnexal lymphoma and Helicobacter pylori gastric infection. American Journal of Hematology 85:9, 645-649
CrossRef7
Dominique Velin, Pierre Michetti. (2010) Advances in vaccination against Helicobacter pylori. Expert Review of Gastroenterology & Hepatology 4:2, 157-166
CrossRef8
V. J. Craig, I. Arnold, C. Gerke, M. Q. Huynh, T. Wundisch, A. Neubauer, C. Renner, S. Falkow, A. Muller. (2010) Gastric MALT lymphoma B cells express polyreactive, somatically mutated immunoglobulins. Blood 115:3, 581-591
CrossRef9
Dai Chihara, Yoshitoyo Kagami, Yasuhiro Oki, Harumi Kato, Hiroshi Onoda, Shouji Ine, Hirofumi Taji, Kazuhito Yamamoto, Yasuo Morishima. (2010) R-CHOP therapy for MALT lymphoma of the rectum. European Journal of Haematology 84:1, 84-86
CrossRef10
Andrés J. M. Ferreri, Riccardo Dolcetti, Simone Magnino, Claudio Doglioni, Maurilio Ponzoni. (2009) Chlamydial infection: the link with ocular adnexal lymphomas. Nature Reviews Clinical Oncology 6:11, 658-669
CrossRef11
J. A. Burger, P. Ghia, A. Rosenwald, F. Caligaris-Cappio. (2009) The microenvironment in mature B-cell malignancies: a target for new treatment strategies. Blood 114:16, 3367-3375
CrossRef12
A. Stathis, C. Chini, F. Bertoni, I. Proserpio, C. Capella, L. Mazzucchelli, E. Pedrinis, F. Cavalli, G. Pinotti, E. Zucca. (2009) Long-term outcome following Helicobacter pylori eradication in a retrospective study of 105 patients with localized gastric marginal zone B-cell lymphoma of MALT type. Annals of Oncology 20:6, 1086-1093
CrossRef13
A. J. M. Ferreri, I. Ernberg, C. Copie-Bergman. (2009) Infectious agents and lymphoma development: molecular and clinical aspects. Journal of Internal Medicine 265:4, 421-438
CrossRef14
Marta Muzio, Maria T. S. Bertilaccio, Giorgia Simonetti, Michela Frenquelli, Federico Caligaris-Cappio. (2009) The role of Toll-like receptors in chronic B cell malignancies. Leukemia & Lymphoma 50:10, 1573-1580
CrossRef15
Sung-Hsin Kuo, Li-Tzong Chen, Ming-Shiang Wu, Chung-Wu Lin, Kun-Huei Yeh, Kuan-Ting Kuo, Pei-Yen Yeh, Yi-Shin Tzeng, Hsiu-Po Wang, Ping-Ning Hsu, Jaw-Town Lin, Ann-Lii Cheng. (2008) Long-term Follow-up of Gastrectomized Patients With Mucosa-associated Lymphoid Tissue Lymphoma. Annals of Surgery 247:2, 265-269
CrossRef16
Hyung Min Kang, Nayoung Kim, Young Soo Park, Jin-Hyeok Hwang, Jin-Wook Kim, Sook-Hyang Jeong, Dong Ho Lee, Hye Seung Lee, Hyun Chae Jung, In Sung Song. (2008) Effects of Helicobacter pylori Infection on Gastric Mucin Expression. Journal of Clinical Gastroenterology 42:1, 29-35
CrossRef17
Sandrine Roulland, Felipe Suarez, Olivier Hermine, Bertrand Nadel. (2008) Pathophysiological aspects of memory B-cell development. Trends in Immunology 29:1, 25-33
CrossRef18
Eduardo Retamales, Luis Rodriguez, Leda Guzman, Francisco Aguayo, Mariana Palma, Claudia Backhouse, Jorge Argandona, Erick Riquelme, Alejandro Corvalan. (2007) Analytical Detection of Immunoglobulin Heavy Chain Gene Rearrangements in Gastric Lymphoid Infiltrates by Peak Area Analysis of the Melting Curve in the LightCycler System. The Journal of Molecular Diagnostics 9:3, 351-357
CrossRef19
Dong Soo Lee, Steven F Moss. (2007) Targeting Helicobacter pylori in gastric carcinogenesis. Expert Opinion on Therapeutic Targets 11:6, 757-769
CrossRef20
Yongliang Zhu, Caihua Wang, Jian Huang, Zhen Ge, Qi Dong, Xian Zhong, Yanyan Su, Shu Zheng. (2007) The Helicobacter pylori virulence factor CagA promotes Erk1/2-mediated Bad phosphorylation in lymphocytes: a mechanism of CagA-inhibited lymphocyte apoptosis. Cellular Microbiology 9:4, 952-961
CrossRef21
S-H Kuo, L-T Chen, M-S Wu, K-T Kuo, K-H Yeh, S-L Doong, P-Y Yeh, H-C Hsu, Y-S Tzeng, C-W Lin, J-T Lin, A-L Cheng. (2007) Differential response toH. pylori eradication therapy of co-existing diffuse large B-cell lymphoma and MALT lymphoma of stomach—significance of tumour cell clonality and BCL10 expression. The Journal of Pathology 211:3, 296-304
CrossRef22
Pier Francesco Ferrucci, Emanuele Zucca. (2007) Primary gastric lymphoma pathogenesis and treatment: what has changed over the past 10
years?. British Journal of Haematology 136:4, 521-538
CrossRef23
TFE Barth, CA Barth, HA Kestler, P Michl, MA Weniger, M Buchholz, P Möller, T Gress. (2007) Transcriptional profiling suggests that secondary and primary large B-cell lymphomas of the gastrointestinal (GI) tract are blastic variants of GI marginal zone lymphoma. The Journal of Pathology 211:3, 305-313
CrossRef24
Hidekazu Suzuki, Toshifumi Hibi, Barry James Marshall. (2007) Helicobacter pylori: present status and future prospects in Japan. Journal of Gastroenterology 42:1, 1-15
CrossRef25
Elías Gracia, Patrizia Froesch, Luca Mazzucchelli, Vittoria Martin, Delvys Rodríguez-Abreu, Julio Jiménez, María Melgares, Dania Santos, Virginia Capó, Franco Cavalli, Emanuele Zucca, Francesco Bertoni. (2007) Low prevalence of Chlamydia psittaci in ocular adnexal lymphomas from Cuban patients. Leukemia & Lymphoma 48:1, 104-108
CrossRef26
P M Banks. (2007) Gastrointestinal lymphoproliferative disorders. Histopathology 50:1, 42-54
CrossRef27
Alex Gutierrez-Dalmau, Josep M Campistol. (2007) Immunosuppressive Therapy and Malignancy in Organ Transplant Recipients. Drugs 67:8, 1167-1198
CrossRef28
Dustin Roberts, Michael Hopkins, Steven Miller, T W. Schafer. (2006) Gastric MALT Lymphoma in the Absence of Helicobacter pylori Infection Presenting as an Upper Gastrointestinal Hemorrhage. Southern Medical Journal 99:10, 1134-1136
CrossRef29
Krstic V., Marinkovic D., Vakanjac Slobodanka, Lalosevic D., Aleksic-Kovacevic Sanja. (2006) Helicobacter spp. In gastroscopic biopsies in dogs. Acta veterinaria 56:4, 305-314
CrossRef30
William Y. F Lo, Jackson Y. W Li, Y K Chan, Lawrence S. W Lai, Y W Yeung, Stephen T. H Lo, Wilson M. S Tsui, C S Ng. (2005) Instability of Clonality in Gastric Lymphoid Infiltrates. The American Journal of Surgical Pathology 29:12, 1582-1592
CrossRef31
Sotirios D. Georgopoulos, Konstantinos Triantafyllou, Maria Fameli, Panagiota Kitsanta, Charis Spiliadi, Dimitra Anagnostou, Spiros D. Ladas. (2005) Molecular Analysis of B-Cell Clonality in Helicobacter Pylori Gastritis. Digestive Diseases and Sciences 50:9, 1616-1620
CrossRef32
Paul R. Avery, Anne C. Avery. (2004) Molecular methods to distinguish reactive and neoplastic lymphocyte expansions and their importance in transitional neoplastic states. Veterinary Clinical Pathology 33:4, 196-207
CrossRef33
Francesco Bertoni, Annarita Conconi, Sergio B. Cogliatti, Shu-Fang Hsu Schmitz, Michele Ghielmini, Thomas Cerny, Martin Fey, Gabriella Pichert, Francesco Bertolini, Maurilio Ponzoni, Luca Baldini, Chris Jones, Rebecca Auer, Emanuele Zucca, Franco Cavalli, Finbarr E. Cotter, . (2004) Immunoglobulin heavy chain genes somatic hypermutations and chromosome 11q22-23 deletion in classic mantle cell lymphoma: a study of the Swiss Group for Clinical Cancer Research. British Journal of Haematology 124:3, 289-298
CrossRef34
Randy D Gascoyne. (2003) Molecular Pathogenesis of Mucosal-Associated Lymphoid Tissue (MALT) Lymphoma. Leukemia & Lymphoma 44:S3, S13-S20
CrossRef35
S. A. Birkeland, S. Hamilton-Dutoit. (2003) Is posttransplant lymphoproliferative disorder (PTLD) caused by any specific immunosuppressive drug or by the transplantation per se?. Transplantation 76:6, 984-988
CrossRef36
Thomas Wündisch, Andreas Neubauer, Manfred Stolte, Markus Ritter, Christian Thiede. (2003) B-cell Monoclonality Is Associated With Lymphoid Follicles in Gastritis. The American Journal of Surgical Pathology 27:7, 882-887
CrossRef37
Johannes Seydel, Andreas Ullrich, Ralf Bender, Wolfgang Fischbach, Maria Blettner. (2003) Helicobacter pylori and carcinogenesis of gastric B-cell lymphomas. International Journal of Cancer 104:5, 646-649
CrossRef38
Kim Ahrens, Raul Braylan, Nidal Almasri, Robin Foss, Lisa Rimsza. (2002) IgH PCR of Zinc Formalin-Fixed, Paraffin-Embedded Non-Lymphomatous Gastric Samples Produces Artifactual “Clonal” Bands Not Observed in Paired Tissues Unexposed to Zinc Formalin. The Journal of Molecular Diagnostics 4:3, 159-163
CrossRef39
Elena Nardini, Simona Rizzi, Sylvie Ménard, Andrea Balsari. (2002) Molecular Phenotype Distinguishes Two Subsets of Gastric Low-Grade Mucosa-Associated Lymphoid Tissue Lymphomas. Laboratory Investigation 82:5, 535-542
CrossRef40
Antonio Tursi, Maria Ester Modeo. (2002) Monoclonal Gammopathy of Undetermined Significance Predisposing to Helicobacter pylori-Related Gastric Mucosa-Associated Lymphoid Tissue Lymphoma. Journal of Clinical Gastroenterology 34:2, 147-149
CrossRef41
Michael Derwahl, Hugo Studer. (2002) Hyperplasia versus adenoma in endocrine tissues: are they different?. Trends in Endocrinology & Metabolism 13:1, 23-28
CrossRef42
Yoshikatsu Okada, Hiroshi Mori, Tamaki Maeda, Yasuhiro Ito, Minoru Hasegawa, Takashi Kageyama. (2001) Autopsy case of lymphoplasmacytic lymphoma with a large submucosal tumor in the stomach. Pathology International 51:10, 802-806
CrossRef43
Thomas F.E. Barth, Martin Bentz, Frank Leith
CrossRef44
N. Amft, S. J. Bowman. (2001) Chemokines and Cell Trafficking in Sjogren's Syndrome. Scandinavian Journal of Immunology 54:1-2, 62-69
CrossRef45
Antonello D Cabras, Sonja Candidus, Falko Fend, Marcus Kremer, Stephan Schulz, Cesare Bordi, Gregor Weirich, Heinz Höfler, Martin Werner. (2001) Biclonality of Gastric Lymphomas. Laboratory Investigation 81:7, 961-967
CrossRef46
Thomas W
CrossRef47
Markus Raderer, Peter G Isaacson. (2001) Extranodal lymphoma of MALT-type: perspective at the beginning of the 21st century. Expert Review of Anticancer Therapy 1:1, 53-64
CrossRef48
Tzee-Chung Wu, Liang-Kung Chen, Chiung-Ru Lai. (2001) Primary Gastric Lymphoma Associated With Helicobacter pylori in a Child. Journal of Pediatric Gastroenterology and Nutrition 32:5, 608-610
CrossRef49
D.A. de Luis, J.M. Cordero, C. Caballero, D. Boixeda, R. Aller, R. Cantón, H. de la Calle. (2001) Effect of the treatment of Helicobacter pylori infection on gastric emptying and its influence on the glycaemic control in type 1 diabetes mellitus. Diabetes Research and Clinical Practice 52:1, 1-9
CrossRef50
William D. Chey. (2000) Accurate Diagnosis of Helicobacter Pylori. Gastroenterology Clinics of North America 29:4, 895-902
CrossRef51
Alfredo Papa, Giovanni Cammarota, Antonio Tursi, Antonio Gasbarrini, Giovanni Gasbarrini. (2000) Helicobacter pylori Eradication and Remission of Low-grade Gastric Mucosa-associated Lymphoid Tissue Lymphoma. Journal of Clinical Gastroenterology 31:2, 169-171
CrossRef52
Viggo Jønsson, Curtis G Gemmell, Allan Wiik. (2000) Emerging concepts in the management of the malignant haematological disorders. Expert Opinion on Pharmacotherapy 1:4, 713-735
CrossRef53
Francesco Bertoni, Piero Sanna, Marianne Tinguely, Enrico Roggero, Annarita Conconi, Michela Gisi, Giovanni Cazzaniga, Andrea Biondi, Ennio Pedrinis, Franco Cavalli, Emanuele Zucca. (2000) Association of gastric and Waldeyer's ring lymphoma: a molecular study. Hematological Oncology 18:1, 15-19
CrossRef54
Paula G. Burkard, Peter Lance. (2000) Mucosa-associated lymphoid tissue and other gastrointestinal lymphomas. Current Opinion in Gastroenterology 16:2, 107-112
CrossRef55
Enrico Roggero, Emanuele Zucca, Carlo Mainetti, Francesco Bertoni, Claudio Valsangiacomo, Ennio Pedrinis, Bettina Borisch, Jean-Claude Piffaretti, Franco Cavalli, Peter G. Isaacson. (2000) Eradication of Borrelia burgdorferi infection in primary marginal zone B-cell lymphoma of the skin. Human Pathology 31:2, 263-268
CrossRef56
Francesco Bertoni, Roman Müllenbach, Massimo Broggini, Enrico Roggero, Franco Cavalli, Finbarr E. Cotter, Emanuele Zucca. (2000) Extranodal Marginal Zone B-Cell Lymphoma Genotyping by Alu — Polymerase Chain Reaction. Leukemia & Lymphoma 38:5-6, 605-610
CrossRef57
E. D. Hsi, T. P. Singleton, L. Swinnen, C. H. Dunphy, S. Alkan. (2000) Mucosa-Associated Lymphoid Tissue-Type Lymphomas Occurring in Post-Transplantation Patients. The American Journal of Surgical Pathology 24:1, 100
CrossRef58
Luca Mazzucchelli, Andrea Blaser, Andreas Kappeler, Patrik Schärli, Jean A. Laissue, Marco Baggiolini, Mariagrazia Uguccioni. (1999) BCA-1 is highly expressed in Helicobacter pylori–induced mucosa-associated lymphoid tissue and gastric lymphoma. Journal of Clinical Investigation 104:10, R49-R54
CrossRef59
Michal Y. Chowers, Nathan Keller, Ruth Tal, Iris Barshack, Ruth Lang, Simon Bar-Meir, Yehuda Chowers. (1999) Human gastrin: A Helicobacter pylori–specific growth factor. Gastroenterology 117:5, 1113-1118
CrossRef60
Peter McLaughlin. (1999) Treatment of follicular and other indolent lymphomas. Current Opinion in Oncology 11:5, 333
CrossRef61
Thanh N. Nguyen, Alan N. Barkun, Carlo A. Fallone. (1999) Host Determinants of Helicobacter pylori Infection and Its Clinical Outcome. Helicobacter 4:3, 185-197
CrossRef62
Andreas Sarris, Richard Ford. (1999) Recent advances in the molecular pathogenesis of lymphomas. Current Opinion in Oncology 11:5, 351
CrossRef63
Harry L Ioachim, Cristina Hajdu, Francesca R Giancotti, Brent Dorsett. (1999) Lymphoid proliferations and lymphomas associated with gastric metaplasia, dysplasia, and carcinoma. Human Pathology 30:7, 833-842
CrossRef64
C. Birek, R. Grandhi, K. McNeill, D. Singer, G. Ficarra, G. Bowden. (1999) Detection of Helicobacter pylori in oral aphthous ulcers. Journal of Oral Pathology & Medicine 28:5, 197-203
CrossRef65
A. Di Leo, C. Messa, F. Russo, M. Linsalata, L. Amati, L. Caradonna, S. Pece, N. M. Pellegrino, D. Caccavo, S. Antonaci, E. Jirillo. (1999) Helicobacter Pylori Infecn and Host Cell Responses. Immunopharmacology and Immunotoxicology 21:4, 803-846
CrossRef66
Anne Jouret, J. Haot. (1998) Relation entre le lymphome gastrique du MALT et l’Helicobacter pylori: le point de vue du pathologiste. Acta Endoscopica 28:5, 509-519
CrossRef67
Pierluigi Porcu, Craig R. Nichols. (1998) Evaluation and management of the “New” lymphoma entities: Mantle cell lymphoma, lymphoma of mucosa-associated lymphoid tissue, anaplastic large-cell lymphoma, and primary mediastinal B-cell lymphoma. Current Problems in Cancer 22:5, 283-368
CrossRef
