Original Article
Brief Report
Plasmodium malariae Infection in an Asymptomatic 74-Year-Old Greek Woman with Splenomegaly
N Engl J Med 1998; 338:367-371February 5, 1998
- Article
Malaria most commonly presents as an acute systemic, febrile illness but may manifest more indolently as chronic anemia, glomerulonephritis, or tropical splenomegaly syndrome (or hyperreactive malarial splenomegaly) due to Plasmodium falciparum, P. vivax, or P. malariae. 1 Although all the major malaria parasites of humans cause acute illness that may be accompanied by splenomegaly, P. malariae is the only one recognized to cause asymptomatic infections that can last decades.1 Asymptomatic P. malariae infections are typically associated with very low levels of parasitemia and normal physical examinations,2,3 and they generally come to medical attention when malaria is transmitted by transfusion2,3 or a recrudescence is induced by splenectomy performed for reasons unrelated to malaria.4
We report a case of malaria due to P. malariae in a 74-year-old woman from Greece whose illness was reactivated after decades of latency. All manifestations were reversed with a three-day course of chloroquine. Although thick and thin peripheral-blood smears were repeatedly negative, a nucleic acid–based assay detected the infecting species of malaria parasite. Since malaria was eradicated from Greece by about 1950, the patient's infection most likely lasted more than 40 years, possibly as long as 70. Symptoms of malaria began after asymptomatic splenomegaly was mistaken for lymphoma and she was treated with methotrexate. The fevers were in a quartan pattern (recurring every 72 hours). As Hippocrates wrote, “The least dangerous of all [fevers], and the mildest and most protracted, is the quartan.”5
Case Report
In 1994, splenomegaly was documented in a 72-year-old woman from the Greek island of Karpathos during a routine examination (her first in many years). The woman felt healthy, had no constitutional symptoms, denied ever having malaria, and had never traveled outside of Greece. At a hospital in Athens in September 1995, ultrasonography and computed tomography of the abdomen showed an enlarged spleen but no other abnormalities; the spleen measured 21 cm. The patient was given a diagnosis of lymphoma and advised to undergo splenectomy, which she declined. In October 1995, she was treated with oral methotrexate (10 mg per day for 10 days). After seven days, rigors, headache, and fever (temperature of up to 39°C) developed that recurred in a quartan pattern for five cycles and that resolved after the methotrexate was stopped. Evaluation, including several blood films, provided no explanation for these symptoms.
When the woman was evaluated for splenomegaly in our clinic in February 1996, she denied all symptoms of illness. The physical examination was normal, except for a nontender, firm spleen extending 14 cm below the costal margin. Relevant laboratory data are shown in Table 1Table 1
Laboratory Data before and after Chloroquine Treatment.. The results of hemoglobin electrophoresis were normal, and glucose-6-phosphate 1-dehydrogenase levels were normal. Renal function and liver function, assessed by serum chemical analyses, were normal, as were the results of urinalysis. Serum IgG levels were elevated (Table 1). Serum levels of IgM were low (35 mg per deciliter). Five thick and five thin blood films obtained over a two-week period were negative for plasmodium species (more than 500 fields per slide were examined, corresponding to a finding of fewer than 2 parasites per microliter of blood).The patient was given a conventional three-day course of chloroquine. One month later the spleen was no longer palpable; at six months, the size of the spleen was normal (13 cm) on ultrasonography. The patient's older sister reported that the patient had had malaria at approximately three years of age (around 1925) that was never treated and that spontaneously resolved.
In May 1997, one year after chloroquine treatment, we reevaluated the patient. She continued to feel clinically well and had gained 10 kg (22 lb). No abnormalities were found on physical examination. The spleen was no longer palpable, and ultrasonography confirmed that the spleen was of normal size (13 cm in the longest axis). Indirect immunofluorescence showed that antibodies against P. malariae had declined by a factor of 4 (Table 2Table 2
Results of an Indirect Immunofluorescence Assay for the Presence of Antiplasmodium Antibodies in the Patient's Blood.). Serum IgG and hemoglobin levels had returned to normal (Table 1).Methods
The study was approved by the Johns Hopkins Medical Institutions Joint Committee on Clinical Investigation and the National Institutes of Health Human Subjects Committee. The patient gave written informed consent.
Antibodies against all four malaria parasites of humans were measured by an immunofluorescence assay at the Centers for Disease Control and Prevention, Atlanta.6,7 The presence of P. malariae was evaluated by determining the species-specific sequence of an 18S ribosomal RNA (rRNA) in blood samples from the patient. This test can detect one plasmodium cell in 500 μl of whole blood.8 Parasite rRNA was reverse transcribed into single-stranded complementary DNA that was then amplified with the polymerase chain reaction (PCR), as previously described.8 The design of the PCR primers was based on highly conserved sequences in the 18S rRNA gene from the genus plasmodium: 5' primer 841 (5'GAACGAGATCTTAACCTGC3'); 3' primer 844 (5'TAITGATAAAGATTACCTA3'). The resulting products were separated by electrophoresis and Southern blot hybridization with a 32P-labeled oligonucleotide probe specific for P. malariae rRNA (5'TTTCACTTAAGAATATAGTGTATT3'). Amplified DNA fragments of rRNA were cloned as described previously.8 DNA sequencing was done manually by a modification of the dideoxynucleotide termination method of Sanger (Sequenase 2.0, U.S. Biochemical, Cleveland). The sequence of the P. malariae rRNA fragment reported here has GenBank accession number AF014942.
Results
Five specimens of whole blood, collected in citrate and simultaneously used for blood smears, were obtained over a two-week period and stored at 4°C. Thin and thick smears of all specimens were negative. Reverse-transcription (RT) PCR with genus-specific primers for plasmodium 18S asexual-stage rRNA was performed on total RNA extracted from 50 μl of whole blood. A Southern blot of the amplified DNA was hybridized with an internal probe specific for the P. malariae 18S rRNA gene (Figure 1Figure 1
Identification of 18S Plasmodium Ribosomal RNA from Whole-Blood Specimens from the Patient by Staining with Ethidium Bromide (Panel A) and Southern Blot Hybridization (Panel B).). Two of five specimens showed the presence of P. malariae rRNA, suggesting that the degree of parasitemia was most likely near the limit of detection. Sequence analysis of PCR-amplified DNA fragments from the patient's specimens further confirmed the presence of an infection with P. malariae (Figure 2AFigure 2
The Plasmodium Asexual-Stage 18S Ribosomal RNA Gene (Panel A) and Sequence Analysis of the Plasmodium 18S Ribosomal RNA Gene DNA Fragment Amplified from the Patient's Blood Specimen (Panel B). and Figure 2B); the sequence amplified from the patient differed slightly from another P. malariae sequence determined in our laboratory (GenBank accession number U78741).Two specimens obtained one month after chloroquine treatment were negative on the basis of both ethidium-stained agarose-gel fractionation and Southern blot hybridization of RT-PCR products. An indirect immunofluorescence assay showed high titers of antiplasmodium antibodies, highest against P. malariae, which had declined to one fourth of that level one year after chloroquine treatment (Table 2).
Discussion
This case demonstrates that P. malariae can cause prolonged asymptomatic infection that can reactivate decades after the initial infection and manifest as an indolent illness associated with insidious weight loss, splenomegaly, anemia, and hypergammaglobulinemia. On the basis of documentation provided by the World Health Organization (Dzenowagis J: personal communication) and others,9,10 the transmission of malaria was essentially eradicated in Greece, including Peloponnesus and Karpathos, by the early 1950s. Thus, the patient had most likely had this infection for more than 40 years. The clinical history suggests that her infection could have lasted about 70 years.
Although long-term asymptomatic infection with P. malariae is a well-recognized clinical entity, this case has a number of unusual features. First, the infection was suspected on the basis of the finding of splenomegaly; patients with chronic P. malariae typically have normal physical examinations.2 In contrast, acute malaria due to any of the four malaria parasites of humans is often associated with splenomegaly, which is also common in regions in which malaria is endemic among residents, with chronic or recurrent malaria due to P. falciparum or P. vivax. Second, despite the fact that more than 10 blood smears were negative over a period of more than 15 months, we were able to detect the infecting species of malaria parasite using an RT-PCR assay that provides a species-specific diagnosis. Third, serologic analysis was useful in confirming the clinical diagnosis of malaria. Typically, the indirect immunofluorescence assay is helpful for excluding the diagnosis of malaria; a positive titer does not confirm current infection, but rather that infection has occurred at some time in the past.11
Finally, that the patient's methotrexate treatment induced a malarial quartan fever seems certain: she had never had acute symptoms of fever or malaria previously, the symptoms disappeared soon after the methotrexate was stopped, and the pattern of fever was characteristic. Curiously, methotrexate is lethal to malaria parasites12; the blood levels of methotrexate must have been sublethal to the parasite in our patient but presumably sufficient to interfere with cell-mediated immunity, as occurs, for example, in rheumatoid arthritis and systemic lupus erythematosus.13 Because neither antibody titers nor antibody specificities would be expected to change within one week after immunosuppression induced by treatment with methotrexate, the rapid appearance of malaria symptoms after the administration of methotrexate suggests that cellular immunity contributed to the control of P. malariae infection in this patient. P. inui, a quartan-malaria parasite of monkeys thought to be analogous to P. malariae, has been reported to recur as a consequence of T-cell immunosuppression due to infection with the simian immunodeficiency virus.14 In contrast, neither the severity nor the frequency of illness due to P. falciparum, the lethal malaria parasite of humans, seems to be exacerbated by T-cell immunosuppression from concomitant infection with the human immunodeficiency virus,15-17 despite data from murine models of malaria suggesting that T cells are central to both induction and effector mechanisms of naturally acquired protection.18,19
The differential diagnosis was difficult in this case, especially given the paucity of systemic manifestations. In the tropics, a finding of splenomegaly has a broad range of diagnostic possibilities.20,21 Consideration in the present case was given to whether tropical splenomegaly syndrome (also known as hyperreactive malarial splenomegaly)22 was present. This syndrome is characterized by fever, anemia, weight loss, abdominal discomfort, and lassitude. Laboratory hallmarks include abnormal results of liver-function tests, elevated IgM levels, and hepatic sinusoidal lymphocytosis.22 Our patient had normal liver function and low rather than elevated serum IgM levels; a liver biopsy was not performed. Given the absence of clinical signs and symptoms, normal liver function, and low IgM levels, we conclude that this patient did not have tropical splenomegaly syndrome.
The epidemiologic importance of subclinical parasitemia is unclear and has not been well studied. A person may be asymptomatic while parasitemic and can be a source of transmission to mosquitoes and, hence, to other humans in a local population. Recent data indicate that more residents of regions in which malaria is holoendemic are continuously parasitemic (with P. falciparum) than the results of conventional microscopy would suggest; many such people carry subclinical infections demonstrable only by PCR.23 Subclinical carriers of malaria parasites may not be important in terms of transmission at any one time, since some critical level of gametocytemia, perhaps even at a subclinical level, is necessary. If the level of gametocytemia rises to levels in which transmission to mosquitoes is possible, however, malaria could be reintroduced into an area where it was once eradicated if anopheles mosquitoes are still present. Such a reintroduction of malaria occurred years after documented eradication in the West Indies.24 A highly sensitive assay such as the one we used may be a useful adjunct to serologic analysis in screening people for persistent malaria infections in a region where transmission of the disease has been eliminated.
Presented in part at the 45th Annual Meeting of the American Society for Tropical Medicine and Hygiene, Baltimore, December 1–5, 1996, and at the Infectious Disease Society of America Annual Meeting, San Francisco, September 7–11, 1997.
Supported by a Physician Postdoctoral Fellow Award from the Howard Hughes Medical Institute (to Dr. Vinetz).
We are indebted to Maria Nikolaides for her help in gathering evidence for this report; to William Collins, Ph.D., and Marianna Wilson, M.S., of the Parasitology Branch, Centers for Disease Control and Prevention, Atlanta, for performing monkey and serologic studies and for helpful discussions; to J. Dzenowagis, Ph.D., World Health Organization, Geneva, for obtaining archival information about malaria transmission in Greece; to Drs. Franklin Neva, Louis Miller, Theodore Nash, Thomas Nutman, David Fidock, Mary Marovich, and Philip Cooper for helpful discussions and critique of the manuscript; to Thomas Spahr of the Johns Hopkins Hospital Clinical Microbiology Laboratory, for preparing blood smears and handling the specimens; to the Malaria Internet Group for obtaining information about the history of malaria transmission in Greece; and to Nancy Shulman for helping to prepare the manuscript.
Source Information
From the Laboratory of Parasitic Diseases, National Institute of Allergy and Infectious Diseases, National Institutes of Health, Bethesda, Md. (J.M.V., J.L., T.F.M., D.C.K.), and the Division of Infectious Diseases, Department of Medicine, Johns Hopkins School of Medicine, Baltimore (J.M.V.).
Address reprint requests to Dr. Vinetz at the Laboratory of Parasitic Diseases, National Institute of Allergy and Infectious Diseases, 9000 Rockville Pike, Bldg. 4, Rm. 126, Bethesda, MD 20892.
- References
References
1
Krogstad DJ. Plasmodium species (malaria). In Mandell GL, Bennett JE, Dolin R, eds. Mandell, Douglas and Bennett's principles and practice of infectious disease. 4th ed. Vol. 2. New York: Churchill Livingstone, 1995:2415-27.
2
Guerrero IC ,Weniger BG ,Schultz MG . Transfusion malaria in the United States, 1972-1981. Ann Intern Med 1983;99:221-226
Web of Science | Medline3
Bruce-Chwatt LJ . Blood transfusion and tropical disease. Trop Dis Bull 1972;69:825-862
Medline4
Tsuchida H ,Yamaguchi K ,Yamamoto S ,Ebisawa I . Quartan malaria following splenectomy 36 years after infection. Am J Trop Med Hyg 1982;31:163-165
Web of Science | Medline5
Hippocrates. The epidemics. Book 1. In: The genuine works of Hippocrates. Adams F, trans. New York: William Wood, 1886:307.
6
Sulzer AJ ,Wilson M . The fluorescent antibody test for malaria. CRC Crit Rev Clin Lab Sci 1971;2:601-619
CrossRef | Medline7
Sulzer AJ ,Wilson M ,Hall EC . Indirect fluorescent-antibody tests for parasitic diseases. V. An evaluation of a thick-smear antigen in the IFA test for malaria antibodies. Am J Trop Med Hyg 1969;18:199-205
Web of Science | Medline8
Li J ,Wirtz RA ,McConkey GA , et al. Plasmodium: genus-conserved primers for species identification and quantitation. Exp Parasitol 1995;81:182-190
CrossRef | Web of Science | Medline9
Livadas GA . Malaria eradication in Greece. Rivista di Malariologia 1958;37:173-191
Medline10
Belios GD . Recent course and current pattern of malaria in relation with its control in Greece. Rivista di Malariologia 1955;34:1-24
Medline11
Wilson M ,Sulzer AJ ,Runcik K . Malaria-antibody patterns as determined by the IFA test in U.S. servicemen after chemotherapy. Am J Trop Med Hyg 1970;19:401-404
Web of Science | Medline12
Walter RD ,Bergmann B ,Kansy M ,Wiese M ,Seydel JK . Pyrimethamin-resistant Plasmodium falciparum lack cross-resistance to methotrexate and 2,4-diamino-5-(substituted benzyl) pyrimidines. Parasitol Res 1991;77:346-350
CrossRef | Web of Science | Medline13
Fox DA ,McCune WJ . Immunologic and clinical effects of cytotoxic drugs used in the treatment of rheumatoid arthritis and systemic lupus erythematosus. Concepts Immunopathol 1989;7:20-78
Medline14
Hirsch VM ,Goldstein S ,Hynes NA , et al. Prolonged clinical latency and survival of macaques given a whole inactivated simian immunodeficiency virus vaccine. J Infect Dis 1994;170:51-59
CrossRef | Web of Science | Medline15
Simooya OO ,Mwendapole RM ,Sikateyo BM . Severe falciparum malaria and the acquired immunodeficiency syndrome (AIDS) in Zambia. Ann Trop Med Parasitol 1991;85:269-270
Web of Science | Medline16
Greenberg AE ,Nsa W ,Ryder RW , et al. Plasmodium falciparum malaria and perinatally acquired human immunodeficiency virus type 1 infection in Kinshasa, Zaire. N Engl J Med 1991;325:105-109
Full Text | Web of Science | Medline17
Muller O ,Moser R . The clinical and parasitological presentation of Plasmodium falciparum malaria in Uganda is unaffected by HIV-1 infection. Trans R Soc Trop Med Hyg 1990;84:336-338
CrossRef | Web of Science | Medline18
Cavacini LL ,Parke LA ,Weidanz WP . Resolution of acute malarial infections by T-cell-dependent non-antibody-mediated mechanisms of immunity. Infect Immun 1990;58:2946-2950
Web of Science | Medline19
Kumar S ,Good MF ,Dontfraid F ,Vinetz JM ,Miller LH . Interdependence of CD4+ T cells and malarial spleen in immunity to Plasmodium vinckei vinckei: relevance to vaccine development. J Immunol 1989;143:2017-2023
Web of Science | Medline20
Schaefer K-U ,Khan B ,Gachihi GS , et al. Splenomegaly in Baringo District, Kenya, an area endemic for visceral leishmaniasis and malaria. Trop Geogr Med 1995;47:111-114
Medline21
Cook GC, ed. Manson's tropical diseases. 20th ed. London: W.B. Saunders, 1996:23.
22
Fakunle YM . Tropical splenomegaly. 1. Tropical Africa. Clin Haematol 1981;10:963-975
Medline23
Bottius E ,Guanzirolli A ,Trape J-F ,Rogier C ,Konate L ,Druilhe P . Malaria: even more chronic in nature than previously thought; evidence for subpatent parasitaemia detectable by the polymerase chain reaction. Trans R Soc Trop Med Hyg 1996;90:15-19
CrossRef | Web of Science | Medline24
Tikasingh E ,Edwards C ,Hamilton PJS ,Commissiong LM ,Draper CC . A malaria outbreak due to Plasmodium malariae on the island of Grenada. Am J Trop Med Hyg 1980;29:715-719
Web of Science | Medline
- Citing Articles (19)
Citing Articles
1
A. Smith, J. Denholm, J. Shortt, D. Spelman. (2011) Plasmodium species co-infection as a cause of treatment failure. Travel Medicine and Infectious Disease
CrossRef2
Bryan Spencer, Steven Kleinman, Brian Custer, Ritchard Cable, Susan L. Wilkinson, Whitney Steele, Patrick M. High, David Wright, . (2011) Deconstructing the risk for malaria in United States donors deferred for travel to Mexico. Transfusion 51:11, 2398-2410
CrossRef3
Richard Hedelius, James J. Fletcher, William F. Glass, Augustina I. Susanti, Jason D. Maguire. (2011) Nephrotic Syndrome and Unrecognized Plasmodium malariae Infection in a US Navy Sailor 14 Years After Departing Nigeria. Journal of Travel Medicine 18:4, 288-291
CrossRef4
Begoña Monge-Maillo, Rogelio López-Vélez. (2011) Is screening for malaria necessary among asymptomatic refugees and immigrants coming from endemic countries?. Expert Review of Anti-infective Therapy 9:5, 521-524
CrossRef5
Marian C Bruce, Allan Macheso, Alex McConnachie, Malcolm E Molyneux. (2011) Comparative population structure of Plasmodium malariae and Plasmodium falciparum under different transmission settings in Malawi. Malaria Journal 10:1, 38
CrossRef6
J. D. Maguire, J. K. Baird. (2010) The 'non-falciparum' malarias: the roles of epidemiology, parasite biology, clinical syndromes, complications and diagnostic rigour in guiding therapeutic strategies. Annals of Tropical Medicine and Parasitology 104:4, 283-301
CrossRef7
Bryan Spencer, Whitney Steele, Brian Custer, Steven Kleinman, Ritchard Cable, Susan Wilkinson, David Wright. (2009) Risk for malaria in United States donors deferred for travel to malaria-endemic areas. Transfusion 49:11, 2335-2345
CrossRef8
Christopher Duplessis, Jason D. Maguire. (2009) Melioidosis Masquerading as Community-Acquired Pneumonia: A Case Report Demonstrating Efficacy of Intrapleural Fibrinolytic Therapy. Journal of Travel Medicine 16:1, 74-77
CrossRef9
Georgios Pappas, Ismene J. Kiriaze, Matthew E. Falagas. (2008) Insights into infectious disease in the era of Hippocrates. International Journal of Infectious Diseases 12:4, 347-350
CrossRef10
Atis Muehlenbachs, Theonest K. Mutabingwa, Michal Fried, Patrick E. Duffy. (2007) An unusual presentation of placental malaria: a single persisting nidus of sequestered parasites. Human Pathology 38:3, 520-523
CrossRef11
William P. Weidanz, Joan M. Batchelder, P. Flaherty, G. LaFleur, C. Wong, H.C. van der Heyde. (2005) Plasmodium chabaudi adami: Use of the B-cell-deficient mouse to define possible mechanisms modulating parasitemia of chronic malaria. Experimental Parasitology 111:2, 97-104
CrossRef12
F. Bidegain, A. Berry, M. Alvarez, O. Verhille, F. Huguet, P. Brousset, J. Pris, B. Marchou, J. F. Magnaval. (2005) Acute Plasmodium falciparum Malaria Following Splenectomy for Suspected Lymphoma in 2 Patients. Clinical Infectious Diseases 40:11, e97-e100
CrossRef13
Miro Morovic, Ivica Poljak, Bojan Miletic, Biserka Troselj-Vukic, Irene Seili-Bekafigo, Irena Milotic. (2003) Late Symptomatic Plasmodium malariae Relapse in the Territory of the Former Yugoslavia. Journal of Travel Medicine 10:5, 301-302
CrossRef14
Bevinje Srinivas Kakkilaya. (2003) Rapid Diagnosis of Malaria. Laboratory Medicine 34:8, 602-608
CrossRef15
Bernd U.J. Wejda, Hans Huchzermeyer, Arno J. Dormann. (2002) Hotel Malaria in Greece: Mozambique Origin, American Vector, German Victims. Journal of Travel Medicine 9:5, 277-277
CrossRef16
Fumihiko Kawamoto, Thin Thida Win, Sahoko Mizuno, Khin Lin, Ohn Kyaw, Indah S. Tantular, Daniel P. Mason, Masatsugu Kimura, Chansuda Wongsrichanalai. (2002) UNUSUAL PLASMODIUM MALARIAE-LIKE PARASITES IN SOUTHEAST ASIA. Journal of Parasitology 88:2, 350-357
CrossRef17
(2000) Malaria in a Trinidadian Man. New England Journal of Medicine 343:14, 1046-1047
Full Text18
Chadee, Dave D., Tilluckdharry, Clive C., , Maharaj, Paramanand, , Sinanan, C., . (2000) Reactivation of Plasmodium malariae Infection in a Trinidadian Man after Neurosurgery. New England Journal of Medicine 342:25, 1924-1924
Full Text19
Daniel P Mason, F.Ellis McKenzie, William H Bossert. (1999) The Blood-stage Dynamics of Mixed Plasmodium malariae–Plasmodium falciparum Infections. Journal of Theoretical Biology 198:4, 549-566
CrossRef
