Original Article
SYT–SSX Gene Fusion as a Determinant of Morphology and Prognosis in Synovial Sarcoma
N Engl J Med 1998; 338:153-160January 15, 1998
- Abstract
Background
Synovial sarcomas account for up to 10 percent of soft-tissue sarcomas and include two major histologic subtypes, biphasic and monophasic, defined respectively by the presence and absence of glandular epithelial differentiation in a background of spindle tumor cells. A characteristic SYT–SSX fusion gene resulting from the chromosomal translocation t(X;18)(p11;q11) is detectable in almost all synovial sarcomas. The translocation fuses the SYT gene from chromosome 18 to either of two highly homologous genes at Xp11, SSX1 or SSX2. SYT–SSX1 and SYT–SSX2 are thought to function as aberrant transcriptional regulators. We attempted to determine the influence of the two alternative forms of the SYT–SSX fusion gene on tumor morphology and clinical outcome in patients with this sarcoma.
Methods
We analyzed SYT–SSX fusion transcripts in 45 synovial sarcomas (33 monophasic and 12 biphasic) by the reverse-transcriptase polymerase chain reaction and compared the results with relevant clinical and pathological data.
Results
The SYT–SSX1 and SYT–SSX2 fusion transcripts were detected in 29 (64 percent) and 16 (36 percent) of the tumors, respectively. There was a significant relation (P = 0.003) between histologic subtype (monophasic vs. biphasic) and SSX1 or SSX2 involvement in the fusion transcript: all 12 biphasic synovial sarcomas had an SYT–SSX1 fusion transcript, and all 16 tumors that were positive for SYT–SSX2 were monophasic. Kaplan–Meier analysis of 39 patients with localized tumors showed that the 15 patients with SYT–SSX2 had significantly better metastasis-free survival than the 24 patients with SYT–SSX1 (P = 0.03 by multivariate analysis; relative risk, 3.0). There were no significant correlations between the type of SYT–SSX transcript and age, sex, tumor location and size, whether there were metastases at diagnosis, or whether patients underwent chemotherapy. Histologic subtype alone was not prognostically important.
Conclusions
The type of SYT–SSX fusion transcript correlates with both the histologic subtype and the clinical behavior of synovial sarcoma. SYT–SSX fusion transcripts are a defining diagnostic marker of synovial sarcomas and may also yield important independent prognostic information.
Media in This Article
Figure 3
Metastasis-free Survival in Patients with Localized Tumors.Figure 1
Analysis of SY T–SSX Fusion Transcripts in Synovial Sarcoma.Article Activity
- Article
Synovial sarcomas, which account for 5 to 10 percent of soft-tissue sarcomas, typically arise in the para-articular regions in adolescents and young adults. These tumors occur in two major forms, biphasic and monophasic.1 Biphasic synovial sarcomas contain both epithelial cells arranged in glandular structures and spindle cells, whereas monophasic types are entirely composed of spindle cells.
Cytogenetic studies of synovial sarcomas have revealed a characteristic chromosomal translocation, t(X;18)(p11;q11), in more than 90 percent of both biphasic and monophasic tumors.2 The presence of this translocation as the sole cytogenetic abnormality in at least some tumors suggests that it is the primary causal event in synovial sarcoma. Cloning of the translocation breakpoints showed that t(X;18) results in the fusion of two novel genes, designated SYT (at 18q11) and SSX (at Xp11).3 It soon became apparent that the Xp11 breakpoint actually involves either of two closely related genes, SSX1 and SSX2, 4,5 located in the vicinity of ornithine aminotransferase–like (OATL) pseudogenes 1 and 2, respectively. The SSX1 and SSX2 genes are presumably derived from a relatively recent duplication event and encode proteins with considerable homology (81 percent). Recently, additional related SSX genes, apparently not involved by t(X;18), have been identified in Xp11.6,7
Like other chromosomal translocations in sarcomas, t(X;18) results in the formation of a chimeric protein that probably deregulates the transcription and, hence, the expression of specific target genes.8,9 Consistent with the intracellular site of transcriptional regulators, SYT, SSX, and SYT–SSX are nuclear proteins.10,11 Moreover, the amino-terminal regions of both SSX1 and SSX2 contain a repressor domain that inhibits transcription.10 In the chimeric transcript of synovial sarcoma this repressor domain, encoded by the 5' portion of SSX1 and SSX2, is replaced by all but the 3' end of SYT, a ubiquitously expressed gene encoding a region that can function as a transcriptional activation domain.10 SYT and the SSX proteins probably regulate transcription primarily through interactions between proteins because they seem to lack DNA-binding domains. In the current working model of the molecular pathogenesis of synovial sarcoma, t(X;18) subverts normal transcriptional regulation by directing SYT-mediated transcriptional activation to targets presumably recognized by the carboxy end of SSX and normally inhibited by the latter's amino-terminal transcriptional repressor domain. The genes normally repressed by SSX1 and SSX2, and presumably aberrantly activated by the SYT–SSX gene product, are unknown.
Whether the precise location of the X chromosome breakpoint correlates with the morphology of synovial sarcoma has been debated for some time. Results of fluorescence in situ hybridization (FISH) from three independent groups suggested a relation between the two histologic subtypes of synovial sarcoma and breakpoints in the OATL1 or OATL2 region, now known respectively to contain the SSX1 and SSX2 genes.12-14 However, another group failed to confirm these findings.5,15,16 Moreover, no studies have compared the effects of SSX1 and SSX2 in t(X;18) on clinical outcome. To address these issues, we compared the type of SYT–SSX fusion, as determined by the reverse-transcriptase polymerase chain reaction (RT-PCR), with relevant clinicopathological data in 45 patients with synovial sarcoma.
Methods
Patients and Tumors
The study included 45 patients with histologically verified synovial sarcoma, treated at Memorial Sloan-Kettering Cancer Center between 1982 and 1997, who were enrolled exclusively on the basis of the availability of frozen tumor for molecular analysis. Partial clinical and molecular data on 34 patients were included in a previous report.17 There were 25 male and 20 female patients. The age at diagnosis ranged from 13 to 70 years (mean, 33). Thirty-four primary tumors were located in the extremities (33 in the lower extremity including the buttocks and groin, and 1 in the upper extremity) and 11 in the central axis (Table 1Table 1
Clinical, Histologic, and Molecular Characteristics of the Study Patients.). The size of the tumor, represented by the largest tumor dimension in the resected specimen, ranged from 2 to 21 cm (mean, 9.5). At the time of diagnosis, 39 patients had localized disease and 6 patients had distant metastases.The tumor samples studied were obtained from primary tumor in 29 cases, metastatic deposits in 12, and locally recurrent tumor in 4. The histopathological findings were reviewed by two physicians who were unaware of the results of molecular genetic analyses. All tumors had morphologic and immunohistochemical features consistent with synovial sarcoma. Tumors were classified as biphasic on the basis of architectural evidence of epithelial differentiation, such as glandular structures. All tumors were considered high grade, and all were deep-seated. All primary tumors were surgically treated with curative intent. Negative surgical margins were achieved in 44 patients, and 1 patient had a microscopically positive margin. Radiation therapy was given to 19 patients (external radiation in 10 patients and brachytherapy in 9 patients).
Chemotherapy including doxorubicin, ifosfamide, or both18 was administered to 21 patients. The postoperative follow-up period ranged from 2 to 180 months (mean, 40; median, 26). Extended follow-up data (>60 months) were available on seven patients. These included four patients with SYT–SSX1, two of whom were alive with disease at 144 and 180 months (Patients 31 and 9, respectively) and two of whom had no apparent disease at 61 and 78 months (Patients 10 and 25), and three patients with SYT–SSX2, of whom two were alive with disease at 172 and 180 months (Patients 7 and 2) and one had died of the disease at 62 months (Patient 8).
RT-PCR Analysis
Total RNA was isolated from snap-frozen tumor samples according to the acid–guanidinium–phenol–chloroform method, then 1 μg was reverse-transcribed with Superscript II reverse transcriptase (GIBCO BRL, Gaithersburg, Md.) and random hexamers. The resulting complementary DNA was subjected to PCR amplification with the forward primer 5'CAACAGCAAGATGCATACCA3' for SYT3 and one of the following reverse primers: 5'CACTTGCTATGCACCTGATG3' (consensus) for SSX,3 5'GGTGCAGTTGTTTCCCATCG3' for SSX1,4 5'GGCACAGCTCTTTCCCATCA3' for SSX2,4 or 5'CCCCTTTTGGGTCCAGATATCA3' for SSX3. The amplification conditions consisted of denaturation at 95°C for 1 minute, annealing at 60°C for 1 minute, and extension at 72°C for 1 minute for 35 cycles, with a final period of extension at 72°C for 10 minutes. The products were separated by electrophoresis in agarose gels and visualized with ethidium bromide.
We identified the amplified fragments on the basis of their size on agarose gels and confirmed the results if necessary by blotting the PCR products onto nylon membranes and hybridizing them with internal and junction-specific probes, or by sequencing with the dideoxy chain-termination method modified for fluorescent-based DNA sequencing with a DNA sequencer (model 373, Applied Biosystems, Foster City, Calif.). As an internal control for PCR and for quality assessment of the tumor RNAs, a 247-bp portion of the ubiquitously expressed phosphoglycerate kinase transcript was amplified with primers 5'CAGTTTGGAGCTCCTGGAAG3' and 5'TGCAAATCCAGGGTGCAGTG3' under identical PCR conditions. Negative controls included reactions lacking RNA and reactions lacking reverse transcriptase.
Statistical Analysis
Survival curves were estimated according to the method of Kaplan and Meier from the date of primary-tumor surgery to the time of metastatic recurrence or death.19 The differences in survival curves were examined with the log-rank test. Multivariate analysis was performed by Cox proportional-hazards analysis. To arrive at a parsimonious multivariate model, covariates were selected with a stepwise regression model using backward elimination. Associations between variables were studied with Fisher's exact test. All P values are two-sided.
Results
Of the 45 synovial sarcomas, 29 (64 percent) had a SYT–SSX1 fusion transcript and 16 (36 percent) contained a SYT–SSX2 fusion transcript (Figure 1Figure 1
Analysis of SY T–SSX Fusion Transcripts in Synovial Sarcoma.). Representative histologic sections from two patients are shown in Figure 2AFigure 2
Monophasic and Biphasic Synovial Sarcoma. and Figure 2B. Because the SSX1 primer we used might misprime from SSX3, all tumors positive for SYT–SSX1 were also analyzed with SYT and an SSX3-specific reverse primer. None of these samples contained an SYT–SSX3 fusion transcript.The results of all analyses of fusion transcripts and the clinicopathological features of the 45 patients are summarized in Table 1. There were 12 biphasic and 33 monophasic tumors. All 12 biphasic synovial sarcomas had a SYT–SSX1 fusion transcript, whereas 17 monophasic synovial sarcomas contained an SYT–SSX1 fusion transcript and 16 had an SYT–SSX2 fusion transcript. There was a statistically significant (P = 0.003) relation between the histologic subtype and the presence of SSX1 or SSX2 in the fusion transcript. There were no significant correlations between the type of transcript and age, sex, tumor location or size, or whether there were metastases at diagnosis (Table 2Table 2
Comparison of Fusion Types and Clinicopathological Features.).The overall survival rate at five years for all 45 patients was 55 percent. In the study group as a whole, the presence of metastases at diagnosis was the only significant factor related to overall survival (P = 0.001 by multivariate analysis). Further analysis was performed on the 39 patients who had localized tumor at diagnosis. In this subgroup, the 15 patients with tumors containing the SYT–SSX2 fusion transcript had a significantly longer metastasis-free survival than the 24 patients with tumors containing an SYT–SSX1 fusion transcript (P = 0.03 by multivariate analysis; relative risk, 3.0; 95 percent confidence interval, 1.1 to 8.0) (Figure 3Figure 3
Metastasis-free Survival in Patients with Localized Tumors.). In the multivariate analysis, the type of fusion transcript emerged as the only variable associated with metastasis-free survival (Table 3Table 3
Analysis of Factors Predicting Metastasis-free Survival in Patients with Localized Synovial Sarcoma.). There was also a trend toward better overall survival in patients with localized tumors containing the SYT–SSX2 fusion transcript (P = 0.11 by multivariate analysis) (data not shown). The histologic subtype did not affect survival in any subgroup of patients.Because some patients were treated before the widespread use of ifosfamide, one of the few effective agents against synovial sarcoma,20,21 we examined the distribution of ifosfamide-treated patients in the SYT–SSX1 and SYT–SSX2 groups. Among the 29 patients in the SYT–SSX1 group, 10 had received ifosfamide, as compared with 2 of 14 patients in the SYT–SSX2 group (Table 2). This difference was not statistically significant (P =0.16 by Fisher's exact test), suggesting that the survival advantage for the SYT–SSX2 group was not related to treatment with this agent. Not surprisingly, adjuvant chemotherapy, with or without ifosfamide, had no significant effect on outcomes in this historical cohort of patients who did not undergo randomization for adjuvant chemotherapy.
Discussion
Specific chromosomal translocations have come to define many types of sarcomas.8,9 The translocation t(X;18)(p11;q11) occurs in over 90 percent of synovial sarcomas.2,22 Cloning of the translocation breakpoints has shown that two novel genes are thereby rearranged, SYT (at 18q11) and a duplicated gene, SSX (at Xp11).3 Identification of the SYT–SSX chimeric transcript provides a sensitive diagnostic test for synovial sarcoma.5,16,17 Previously, we and Crew et al.5,17 found a specific SYT–SSX RT-PCR product in 58 of 64 (91 percent) synovial sarcomas tested. Analysis of additional material subsequently obtained from several of our patients with initially negative results yielded positive results, indicating that the prevalence of this fusion transcript in synovial sarcoma approaches 100 percent when there is material adequate for molecular analysis. This finding is clinically important, because the differential diagnosis of synovial sarcoma is broad and often problematic.1
The aim of our study was to determine whether the two alternative forms of the SYT–SSX fusion transcript (SYT–SSX1 and SYT–SSX2) are related to the histologic and clinical characteristics of synovial sarcoma. Among 45 tumors analyzed, 29 (64 percent) contained an SYT–SSX1 fusion transcript and 16 (36 percent) had an SYT–SSX2 fusion transcript, a ratio concordant with that obtained elsewhere.5 SSX3, a third member of the SSX gene cluster at Xp11, was not involved in any case or in a previous series of 15 synovial sarcomas.6
We found a significant correlation between the SSX gene involved in the fusion transcript and the histologic subtype of tumors. All 16 synovial sarcomas with SSX2 involvement were monophasic, whereas all 12 biphasic synovial sarcomas showed SSX1 involvement. This observation confirms earlier FISH results from three independent studies including a total of 23 tumors, which found a correlation between the location of the X chromosome breakpoint and the histologic subtype: in aggregate, all eight biphasic tumors had a breakpoint in the OATL1 region (SSX1 gene).12-14 Another group has reported the SYT–SSX2 fusion in two biphasic synovial sarcomas,5,16 of which only one could be histologically confirmed to contain focal glandular structures (Fisher C: personal communication). Thus, the present analysis and previous studies suggest a significant relation between the type of fusion and the histologic findings, but it is not a simple one, since over half of tumors containing SYT–SSX1 are monophasic. Hypothetically, the SYT–SSX1 fusion protein, although not sufficient by itself to induce architectural epithelial differentiation (gland formation), may be more permissive than SYT–SSX2 with respect to this process.
Prognosis in synovial sarcoma has been correlated with age, site, tumor size, mitotic rate, necrosis, and histologic subtype.23-28 Our study confirms that the presence of metastases at diagnosis is the most important prognostic factor for synovial sarcomas. The prognostic value of the histologic subtype has been controversial. Some early studies reported a more favorable outcome in patients with biphasic tumors,23,29 whereas other groups found no differences in survival between patients with monophasic tumors and those with biphasic tumors.25-28 Our results confirm the lack of prognostic importance of the histologic subtype. In most sarcomas arising in the extremities, grade and depth are usually also of prognostic importance,30 but they are of little value in defining prognostic subgroups in synovial sarcomas, because these tumors are uniformly high grade and almost all are deep-seated.1 It is therefore important to look for other prognostic variables.
Our data suggest that the type of SYT–SSX fusion transcript may be a major prognostic factor in synovial sarcoma. This result does not appear to be biased by unequal distribution of the patients, because possible prognostic factors for patients with localized tumors containing an SYT–SSX2 transcript (mean age, 29 years; tumor size, 8.9 cm; adjuvant chemotherapy, 4 of 15 patients; median follow-up period, 36 months) were similar to those for patients with tumors containing an SYT–SSX1 transcript (mean age, 37 years; tumor size, 8.4 cm; adjuvant chemotherapy, 11 of 24 patients; median follow-up period, 26 months). Moreover, in multivariate analysis, the type of SYT–SSX fusion transcript was the sole independent prognostic factor for metastasis-free survival in localized tumors (P = 0.03). We examined metastasis-free survival because local recurrence of sarcomas is primarily related to the quality of local surgical control.30 Since the type of SYT–SSX fusion transcript was significantly correlated with both the clinical course and the histologic subtype, but the latter alone had no prognostic importance, the biologic mechanisms underlying these two different effects of fusion type may be independent.
Remarkably, there were no deaths due to cancer in patients with tumors containing the SYT–SSX2 fusion transcript in the first five years after surgery (data not shown). Analysis of metastasis-free survival showed that after the first two years, the survival curve of patients with tumors containing SYT–SSX2 began to drop and became almost parallel to that of patients with tumors containing SYT–SSX1 (Figure 3). These findings indicate that patients with tumors positive for SYT–SSX2 had a low risk of early relapse, but the cumulative risk of distant metastasis may be similar in both groups. A relatively high incidence of late metastases is characteristic of synovial sarcoma.1 It is possible that tumors with SYT–SSX2 could account for this clinical observation in synovial sarcoma. Studies with a larger number of patients and longer follow-up are needed to confirm these observations. We have developed a method for detecting SYT–SSX transcripts in archival formalin-fixed, paraffin-embedded material31 that should facilitate retrospective studies of historical cohorts of patients with extended follow-up.
The biologic basis of our results is unclear. Comparative functional studies of the two types of SYT–SSX fusion proteins have not yet been performed. Hypothetically, the differences in 13 amino acids among the 78 amino acids of the carboxy terminal of the SSX proteins included in SYT–SSX4,5 may influence specific protein–protein interactions and, hence, alter the target gene specificity of SYT–SSX chimeric proteins or the degree of transactivation of target-gene subgroups, thereby influencing the biologic behavior of synovial sarcoma.
Different fusion products generated by cytogenetically identical chromosomal translocation can have major clinical correlates. This was first demonstrated for the BCR–ABL rearrangement (the Philadelphia chromosome), in which the position of the breakpoint within the BCR gene determines which BCR exons are included in the encoded chimeric tyrosine kinase, thereby leading to either chronic myelogenous leukemia or acute lymphoblastic leukemia.32 More recently, the type of PAX-FKHR chimeric transcription factor (i.e., PAX3–FKHR or PAX7–FKHR) has been shown to influence the clinical presentation and course of alveolar rhabdomyosarcoma.33 We and others have also found that the precise exon composition of the EWS–FLI1 fusion transcript is a prognostic factor in the Ewing's sarcoma tumor group.34,35 The structure of the fusion transcript appears to be a novel marker of clinical behavior in sarcomas and leukemias with specific chromosomal translocations that show molecular heterogeneity.
In conclusion, the SYT–SSX gene fusion resulting from the translocation t(X;18), already presumed to be a primary pathogenetic event in synovial sarcoma, also appears to influence its morphology and subsequent clinical behavior. Analysis of SYT–SSX fusion transcripts provides both a useful diagnostic marker for synovial sarcoma and important independent prognostic information, because SYT–SSX1 and SYTSSX2 may define subtly different types of synovial sarcoma.
We are indebted to Aimée Hamelin for technical assistance.
Source Information
From the Departments of Surgery (A.K., J.H.H., M.F.B.), Pathology (J.W., C.R.A., M.L.), and Human Genetics (M.L.), Memorial Sloan-Kettering Cancer Center, New York.
Address reprint requests to Dr. Ladanyi at the Department of Pathology, Memorial Sloan-Kettering Cancer Center, 1275 York Ave., New York, NY 10021.
- References
References
1
Enzinger FM, Weiss SW. Synovial sarcoma. In: Enzinger FM, Weiss SW, eds. Soft tissue tumors. 3rd ed. St. Louis: Mosby, 1995:757-86.
2
Sreekantaiah C ,Ladanyi M ,Rodriguez E ,Chaganti RSK . Chromosomal aberrations in soft tissue tumors: relevance to diagnosis, classification, and molecular mechanisms. Am J Pathol 1994;144:1121-1134
Web of Science | Medline3
Clark J ,Rocques PJ ,Crew AJ , et al. Identification of novel genes, SYT and SSX, involved in the t(X;18)(p11.2;q11.2) translocation found in human synovial sarcoma. Nat Genet 1994;7:502-508
CrossRef | Web of Science | Medline4
de Leeuw B ,Balemans M ,Olde Weghuis D ,Geurts van Kessel A . Identification of two alternative fusion genes, SYT-SSX1 and SYT-SSX2, int(X;18)(p11.2;q11.2)-positive synovial sarcomas. Hum Mol Genet 1995;4:1097-1099
CrossRef | Web of Science | Medline5
Crew AJ ,Clark J ,Fisher C , et al. Fusion of SYT to two genes, SSX1 and SSX2, encoding proteins with homology to the Kruppel-associated box in human synovial sarcoma. EMBO J 1995;14:2333-2340
Web of Science | Medline6
de Leeuw B ,Balemans M ,Geurts van Kessel A . A novel Kruppel-associated box containing the SSX gene (SSX3) on the human X chromosome is not implicated in t(X;18)-positive synovial sarcomas. Cytogenet Cell Genet 1996;73:179-183
CrossRef | Medline7
Chand A ,Clark J ,Cooper CS ,Craig IW . Long-range organization of reiterated sequences, including the SSX1 cDNA at the OATL1 cluster in Xp11.23. Genomics 1995;30:545-552
CrossRef | Web of Science | Medline8
Ladanyi M . The emerging molecular genetics of sarcoma translocations. Diagn Mol Pathol 1995;4:162-173
CrossRef | Web of Science | Medline9
Sorensen PH ,Triche TJ . Gene fusions encoding chimaeric transcription factors in solid tumours. Semin Cancer Biol 1996;7:3-14
CrossRef | Web of Science | Medline10
Brett D ,Whitehouse S ,Antonson P ,Shipley J ,Cooper C ,Goodwin G . The SYT protein involved in the t(X;18) synovial sarcoma translocation is a transcriptional activator localised in nuclear bodies. Hum Mol Genet 1997;6:1559-1564
CrossRef | Web of Science | Medline11
dos Santos NR ,de Bruijn DRH ,Balemans M , et al. Nuclear localization of SYT, SSX and the synovial sarcoma-associated SYT-SSX fusion proteins. Hum Mol Genet 1997;6:1549-1558
CrossRef | Web of Science | Medline12
de Leeuw B ,Suijkerbuijk RF ,Olde Weghuis D , et al. Distinct Xp11.2 breakpoint regions in synovial sarcoma revealed by metaphase and interphase FISH: relationship to histologic subtypes. Cancer Genet Cytogenet 1994;73:89-94
CrossRef | Web of Science | Medline13
Janz M ,De Leeuw B ,Weghuis DO , et al. Interphase cytogenetic analysis of distinct X-chromosomal translocation breakpoints in synovial sarcoma. J Pathol 1995;175:391-396
CrossRef | Web of Science | Medline14
Renwick PJ ,Reeves BR ,Dal Cin P , et al. Two categories of synovial sarcoma defined by divergent chromosome translocation breakpoints in Xp11.2, with implications for the histologic sub-classification of synovial sarcoma. Cytogenet Cell Genet 1995;70:58-63
CrossRef | Medline15
Shipley JM ,Clark J ,Crew AJ , et al. The t(X;18)(p11.2;q11.2) translocation found in human synovial sarcomas involves two distinct loci on the X chromosome. Oncogene 1994;9:1447-1453
Web of Science | Medline16
Shipley J ,Crew J ,Birdsall S , et al. Interphase fluorescence in situ hybridization and reverse transcription polymerase chain reaction as a diagnostic aid for synovial sarcoma. Am J Pathol 1996;148:559-567
Web of Science | Medline17
Fligman I ,Lonardo F ,Jhanwar SC ,Gerald WL ,Woodruff J ,Ladanyi M . Molecular diagnosis of synovial sarcoma and characterization of a variant SYT-SSX2 fusion transcript. Am J Pathol 1995;147:1592-1599
Web of Science | Medline18
Kampe CE ,Rosen G ,Eilber F , et al. Synovial sarcoma: a study of intensive chemotherapy in 14 patients with localized disease. Cancer 1993;72:2161-2169
CrossRef | Web of Science | Medline19
Kaplan EL ,Meier P . Nonparametric estimation from incomplete observations. J Am Stat Assoc 1958;53:457-481
CrossRef | Web of Science20
Rosen G ,Forscher C ,Lowenbraun S , et al. Synovial sarcoma: uniform response of metastases to high dose ifosfamide. Cancer 1994;73:2506-2511
CrossRef | Web of Science | Medline21
Connelly EF ,Budd GT . Ifosfamide in the treatment of soft tissue sarcomas. Semin Oncol 1996;23:Suppl 6:16-21
Web of Science | Medline22
Limon J ,Mrozek K ,Mandahl N , et al. Cytogenetics of synovial sarcoma: presentation of ten new cases and review of the literature. Genes Chromosomes Cancer 1991;3:338-345
CrossRef | Web of Science | Medline23
Cagle LA ,Mirra JM ,Storm FK ,Roe DJ ,Eilber FR . Histologic features relating to prognosis in synovial sarcoma. Cancer 1987;59:1810-1814
CrossRef | Web of Science | Medline24
Rooser B ,Willen H ,Hugoson A ,Rydholm A . Prognostic factors in synovial sarcoma. Cancer 1989;63:2182-2185
CrossRef | Web of Science | Medline25
Brodsky JT ,Burt ME ,Hajdu SI ,Casper ES ,Brennan MF . Tendosynovial sarcoma: clinicopathologic features, treatment, and prognosis. Cancer 1992;70:484-489
CrossRef | Web of Science | Medline26
Oda Y ,Hashimoto H ,Tsuneyoshi M ,Takeshita S . Survival in synovial sarcoma: a multivariate study of prognostic factors with special emphasis on the comparison between early death and long-term survival. Am J Surg Pathol 1993;17:35-44
CrossRef | Web of Science | Medline27
Pappo AS ,Fontanesi J ,Luo X , et al. Synovial sarcoma in children and adolescents: the St Jude Children's Research Hospital experience. J Clin Oncol 1994;12:2360-2366
Web of Science | Medline28
Singer S ,Baldini EH ,Demetri GD ,Fletcher JA ,Corson JM . Synovial sarcoma: prognostic significance of tumor size, margin of resection, and mitotic activity for survival. J Clin Oncol 1996;14:1201-1208
Web of Science | Medline29
Krall RA ,Kostianovsky M ,Patchefsky AS . Synovial sarcoma: a clinical, pathological, and ultrastructural study of 26 cases supporting the recognition of a monophasic variant. Am J Surg Pathol 1981;5:137-151
CrossRef | Web of Science | Medline30
Pisters PW ,Leung DH ,Woodruff J ,Shi W ,Brennan MF . Analysis of prognostic factors in 1,041 patients with localized soft tissue sarcomas of the extremities. J Clin Oncol 1996;14:1679-1689
Web of Science | Medline31
Argani P, Zakowski MF, Klimstra DS, Rosai J, Ladanyi M. Detection of the SYT–SSX chimeric RNA of synovial sarcoma in paraffin-embedded tissue and its application in problematic cases. Mod Pathol (in press).
32
Melo JV . The diversity of BCR-ABL fusion proteins and their relationship to leukemia phenotype. Blood 1996;88:2375-2384
Web of Science | Medline33
Kelly KM ,Womer RB ,Sorensen PHB ,Xiong QB ,Barr FG . Common and variant gene fusions predict distinct clinical phenotypes in rhabdomyosarcoma. J Clin Oncol 1997;15:1831-1836
Web of Science | Medline34
Zoubek A ,Dockhorn-Dworniczak B ,Delattre O , et al. Does expression of different EWS chimeric transcripts define clinically distinct risk groups of Ewing tumor patients? J Clin Oncol 1996;14:1245-1251
Web of Science | Medline35
de Alava E, Kawai A, Healey JH, et al. EWS-FLI1 fusion transcript structure is an independent determinant of prognosis in Ewing's sarcoma. J Clin Oncol (in press).
- Citing Articles (190)
Citing Articles
1
Daniel Orbach, Heather Mc Dowell, Annie Rey, Nathalie Bouvet, Anna Kelsey, Mike C Stevens. (2011) Sparing strategy does not compromise prognosis in pediatric localized synovial sarcoma: Experience of the International Society of pediatric oncology, malignant mesenchymal tumors (SIOP-MMT) Working Group. Pediatric Blood & Cancer 57:7, 1130-1136
CrossRef2
Zenaida Piñeiro Aguín, Xavier León Vintró, Jacinto García Lorenzo, Francisco J. Sancho, Antonio López Pousa, Miquel Quer Agustí. (2011) Sarcomas de cabeza y cuello. Nuestra experiencia. Acta Otorrinolaringológica Española 62:6, 436-442
CrossRef3
Zenaida Piñeiro Aguín, Xavier León Vintró, Jacinto García Lorenzo, Francisco J. Sancho, Antonio López Pousa, Miquel Quer Agustí. (2011) Head and Neck Sarcomas. Our Experience. Acta Otorrinolaringologica (English Edition) 62:6, 436-442
CrossRef4
Salvatore Romeo, Angelo P Dei Tos. (2011) Clinical application of molecular pathology in sarcomas. Current Opinion in Oncology 23:4, 379-384
CrossRef5
Hao-Wei Teng, Hsei-Wei Wang, Wei-Ming Chen, Ta-Chung Chao, Yao-Yu Hsieh, Chi-Hsiu Hsih, Cheng-Hwai Tzeng, Paul Chih-Hsueh Chen, Chueh-Chuan Yen. (2011) Prevalence and prognostic influence of genomic changes of EGFR pathway markers in synovial sarcoma. Journal of Surgical Oncology 103:8, 773-781
CrossRef6
C E Corrales, G Berry, E J Damrose. (2011) Primary cervical tracheal monophasic synovial sarcoma confirmed by SYT–SSX gene rearrangement. The Journal of Laryngology & Otology 125:06, 651-654
CrossRef7
Ioannis A. Voutsadakis, Khalil Zaman, Serge Leyvraz. (2011) Breast sarcomas: Current and future perspectives. The Breast 20:3, 199-204
CrossRef8
Yoshiyuki Suehara, Naobumi Tochigi, Daisuke Kubota, Kazutaka Kikuta, Robert Nakayama, Kunihiko Seki, Akihiko Yoshida, Hitoshi Ichikawa, Tadashi Hasegawa, Kazuo Kaneko, Hirokazu Chuman, Yasuo Beppu, Akira Kawai, Tadashi Kondo. (2011) Secernin-1 as a novel prognostic biomarker candidate of synovial sarcoma revealed by proteomics. Journal of Proteomics 74:6, 829-842
CrossRef9
Anand Vasant Ghiya, Mrunal Nitin Ketkar, Shilpa Patankar, Sudhir Kothari. (2011) A Rare Case of Synovial Sarcoma Involving the Brachial Plexus. Indian Journal of Surgical Oncology 2:1, 24-26
CrossRef10
A. H. Krieg, F. Hefti, B. M. Speth, G. Jundt, L. Guillou, U. G. Exner, A. R. von Hochstetter, M. D. Cserhati, B. Fuchs, E. Mouhsine, A. Kaelin, F. M. Klenke, K. A. Siebenrock. (2011) Synovial sarcomas usually metastasize after >5 years: a multicenter retrospective analysis with minimum follow-up of 10 years for survivors. Annals of Oncology 22:2, 458-467
CrossRef11
I. Petersen, B. Günther, K. Mildner, F. Subhi, T. Knösel, A. Altendorf-Hofmann, D. Katenkamp. (2011) Neues aus dem Jenaer Weichteiltumor-Register. Der Pathologe 32:1, 40-46
CrossRef12
Ming-Tseh Lin, Li-Hui Tseng, Roy G. Rich, Michael J. Hafez, Shuko Harada, Kathleen M. Murphy, James R. Eshleman, Christopher D. Gocke. (2011) Δ-PCR, A Simple Method to Detect Translocations and Insertion/Deletion Mutations. The Journal of Molecular Diagnostics 13:1, 85-92
CrossRef13
Veena S. Devarakonda, Larissa Lembert, John W. Entwistle, III, Jeffrey B. Hoag. (2011) Primary Synovial Sarcoma of the Lung with Intra-Cardiac Extension. Respiration 81:3, 249-252
CrossRef14
Vaiyapuri P. Sumathi, Cyril Fisher, Ann Williams, Jean M. Meis, Raji Ganesan, Lars-Gunnar Kindblom, McCluggage. (2011) Synovial Sarcoma of the Vulva and Vagina. International Journal of Gynecological Pathology 30:1, 84-91
CrossRef15
Fuminori Nomura, Taku Ito, Seiji Kishimoto. (2011) Orohypopharyngeal Synovial Sarcoma in a 10-Year-Old Child. Practica Oto-Rhino-Laryngologica 104:2, 123-127
CrossRef16
Zsofia Balogh, Zsuzsanna Szemlaky, Miklos Szendroi, Imre Antal, Papai Zsuzsanna, Laszlo Fonyad, Gergo Papp, Yi-Che Changchien, Zoltan Sapi. (2011) Correlation between DNA ploidy, metaphase High-Resolution Comparative Genomic Hybridization results and clinical outcome of synovial sarcoma. Diagnostic Pathology 6:1, 107
CrossRef17
Noriko Ogasawara, Naoki Hyakushima, Keisuke Kikuchi, Tomonori Nagaya, Masao Murakami, Yoshio Hishikawa, Iwao Yoshioka. (2011) Carbon Ion Radiotherapy as an Initial Treatment in an Unresectable Head and Neck Soft Tissue Tumor. Practica Oto-Rhino-Laryngologica 104:12, 899-903
CrossRef18
Ramiro G.M. Silva, Jefferson L. Gross, Rodrigo A. Silva, Fabio J. Haddad, Riad N. Younes, Vasco M. Cruz, Antonio B.M. Avertano-Rocha. (2010) Primary monophasic synovial sarcoma of the pleura: Neoadjuvant chemotherapy followed by complete resection. Thoracic Cancer 1:3, 95-101
CrossRef19
U. Vogel, M. Wehrmann, W. Eichhorn, B. Bültmann, M. Stiegler, W. Wagner. (2010) Molecular and Clinicopathological Findings in a Tonsillar Synovial Sarcoma. A Case Study and Review of the Literature. Head and Neck Pathology 4:3, 257-260
CrossRef20
José Luis Ordóñez, Daniel Osuna, Daniel J. García-Domínguez, Ana Teresa Amaral, Ana Pastora Otero-Motta, Carlos Mackintosh, María Victoria Sevillano, María Victoria Barbado, Teresa Hernández, Enrique de Alava. (2010) The Clinical Relevance of Molecular Genetics in Soft Tissue Sarcomas. Advances in Anatomic Pathology 17:3, 162-181
CrossRef21
Andrew H. Beck, Robert B. West, Matt Rijn. (2010) Gene expression profiling for the investigation of soft tissue sarcoma pathogenesis and the identification of diagnostic, prognostic, and predictive biomarkers. Virchows Archiv 456:2, 141-151
CrossRef22
Cyril Fisher. (2010) Soft tissue sarcomas with non-EWS translocations: molecular genetic features and pathologic and clinical correlations. Virchows Archiv 456:2, 153-166
CrossRef23
Judith V. M. G. Bovée, Pancras C. W. Hogendoorn. (2010) Molecular pathology of sarcomas: concepts and clinical implications. Virchows Archiv 456:2, 193-199
CrossRef24
Jae-Won Jang, Jung-Kil Lee, Bo-Ra Seo, Soo-Han Kim. (2010) Synovial Sarcoma of the Posterior Neck : A Case Report and Review of Literature. Journal of Korean Neurosurgical Society 47:4, 306
CrossRef25
Johsuke Hara, Kouichi Nishi, Shingo Nishikawa, Yoshio Tsunezuka, Kazuo Kasahara, Masaki Fujimura. (2010) A Case of Primary Pleural Synovial Sarcoma. Haigan 50:7, 906-911
CrossRef26
Jae Seok Park, Bo Ram Min, Soon Hyo Park, Kun Young Kwon, Dong-Yoon Keum, Won-Il Choi. (2010) Primary Pulmonary Biphasic Synovial Sarcoma Confirmed by Molecular Detection of a SYT-SSX2 Fusion Gene: Report of 1 Case. The Korean Journal of Internal Medicine 25:3, 331
CrossRef27
Subbaya Subramanian, Venugopal Thayanithy, Robert B West, Cheng-Han Lee, Andrew H Beck, Shirley Zhu, Erinn Downs-Kelly, Kelli Montgomery, John R Goldblum, Pancras CW Hogendoorn, Christopher L Corless, Andre M Oliveira, Sarah M Dry, Torsten O Nielsen, Brian P Rubin, Jonathan A Fletcher, Christopher DM Fletcher, Matt van de Rijn. (2010) Genome-wide transcriptome analyses reveal p53 inactivation mediated loss of miR-34a expression in malignant peripheral nerve sheath tumours. The Journal of Pathology 220:1, 58-70
CrossRef28
Andrew L. Folpe, Enrique de Alava. 2010. Adjuvant Techniques –Immunohistochemistry, Cytogenetics, and Molecular Genetics. , 18-39.
CrossRef29
Y.M. Dennis Lo, Ivy H.N. Wong, Nancy B.Y. Tsui, Ching-Wan Lam. 2009. Molecular Biological Analyses and Molecular Pathology in Clinical Chemistry. .
CrossRef30
Takahisa Nakayama, Satoru Miyabe, Mitsukuni Okabe, Hidenori Sakuma, Kei Ijichi, Yasuhisa Hasegawa, Hitoshi Nagatsuka, Kazuo Shimozato, Hiroshi Inagaki. (2009) Clinicopathological significance of the CRTC3–MAML2 fusion transcript in mucoepidermoid carcinoma. Modern Pathology 22:12, 1575-1581
CrossRef31
Paola Collini, Poul H.B. Sorensen, Shreyaskumar Patel, Jean-Yves Blay, Rolf D. Issels, Robert G. Maki, Mikael Eriksson, Xavier Garcia del Muro. (2009) Sarcomas With Spindle Cell Morphology. Seminars in Oncology 36:4, 324-337
CrossRef32
Emanuela Palmerini, Eric L. Staals, Marco Alberghini, Licciana Zanella, Cristina Ferrari, Maria Serena Benassi, Piero Picci, Mario Mercuri, Gaetano Bacci, Sefano Ferrari. (2009) Synovial sarcoma. Cancer 115:13, 2988-2998
CrossRef33
Yan Sun, Baocun Sun, Jian Wang, Wenjuan Cai, Xiulan Zhao, Shiwu Zhang, Xishan Hao. (2009) Prognostic implication of SYT-SSX fusion type and clinicopathological parameters for tumor-related death, recurrence, and metastasis in synovial sarcoma. Cancer Science 100:6, 1018-1025
CrossRef34
Yoshiyuki Suehara, Kazutaka Kikuta, Robert Nakayama, Naobumi Tochigi, Kunihiko Seki, Hitoshi Ichikawa, Kiyonaga Fujii, Tadashi Hasegawa, Tadakazu Shimoda, Hisashi Kurosawa, Hirokazu Chuman, Yasuo Beppu, Akira Kawai, Setsuo Hirohashi, Tadashi Kondo. (2009) GST-P1 as a histological biomarker of synovial sarcoma revealed by proteomics. PROTEOMICS - Clinical Applications 3:5, 623-634
CrossRef35
Suzan E. ten Heuvel, Harald J. Hoekstra, Esther Bastiaannet, Albert J. H. Suurmeijer. (2009) The Classic Prognostic Factors Tumor Stage, Tumor Size, and Tumor Grade are the Strongest Predictors of Outcome in Synovial Sarcoma. Applied Immunohistochemistry & Molecular Morphology 17:3, 189-195
CrossRef36
Radhika Srinivasan, Upasana Gautam, Ruchi Gupta, Arvind Rajwanshi, Rakesh Kumar Vasistha. (2009) Synovial sarcoma: Diagnosis on fine-needle aspiration by morphology and molecular analysis. Cancer Cytopathology 117:2, 128-136
CrossRef37
Kazuhiro Yoshitani, Akira Kido, Kanya Honoki, Hiromasa Fujii, Yoshinori Takakura. (2009) Pelvic metastasis of breast synovial sarcoma. Journal of Orthopaedic Science 14:2, 219-223
CrossRef38
Brian P. Rubin, Alexander J.F. Lazar, Andre M. Oliveira. 2009. Molecular Pathology of Bone and Soft Tissue Tumors. , 325-359.
CrossRef39
SHARON P. WILCZYNSKI. 2009. Molecular Biology. , 85-120.
CrossRef40
Hiroaki FUJI, Rei MIZUNO, Tomohiko MORI, Daisuke ITO, Katsuyoshi FURUMOTO, Masafumi KOGIRE. (2009) INTRAABDOMINAL RECURRENCE OF GRANULOSA CELL TUMOR OF THE OVARY TWENTY YEARS AFTER INITIAL SURGERY-A CASE REPORT-. Nihon Rinsho Geka Gakkai Zasshi (Journal of Japan Surgical Association) 70:12, 3689-3693
CrossRef41
N Friedrichs, J Küchler, E Endl, A Koch, J Czerwitzki, P Wurst, D Metzger, JH Schulte, MI Holst, LC Heukamp, O Larsson, S Tanaka, A Kawai, E Wardelmann, R Buettner, T Pietsch, W Hartmann. (2008) Insulin-like growth factor-1 receptor acts as a growth regulator in synovial sarcoma. The Journal of Pathology 216:4, 428-439
CrossRef42
Changliang Peng, Wei Guo, Yi Yang, Hui Zhao. (2008) Downregulation of SS18-SSX1 expression by small interfering RNA inhibits growth and induces apoptosis in human synovial sarcoma cell line HS-SY-II in vitro. European Journal of Cancer Prevention 17:5, 392-398
CrossRef43
Mukul Divetia, Arti Karpate, Ranjan Basak, Sangeeta B. Desai. (2008) Synovial sarcoma of the kidney. Annals of Diagnostic Pathology 12:5, 333-339
CrossRef44
Balaji Krishnan, Gaurav Khanna, Denis Clohisy. (2008) Gene Translocations in Musculoskeletal Neoplasms. Clinical Orthopaedics and Related Research 466:9, 2131-2146
CrossRef45
Malay Haldar, R. Lor Randall, Mario R. Capecchi. (2008) Synovial Sarcoma: From Genetics to Genetic-based Animal Modeling. Clinical Orthopaedics and Related Research 466:9, 2156-2167
CrossRef46
Ziv Gil, Avi Orr-Urtreger, Nadia Voskoboinik, Leonor Trejo-Leider, Ruth Shomrat, Dan M. Fliss. (2008) Cytogenetic analysis of 101 skull base tumors. Head & Neck 30:5, 567-581
CrossRef47
Fernando Gabilondo, Francisco Rodríguez, Alejandro Mohar, Gerald J. Nuovo, Hugo Domínguez-Malagón. (2008) Primary synovial sarcoma of the kidney: corroboration with in situ polymerase chain reaction. Annals of Diagnostic Pathology 12:2, 134-137
CrossRef48
Robert G. Maki. (2008) Pediatric sarcomas occurring in adults. Journal of Surgical Oncology 97:4, 360-368
CrossRef49
Fritz C. Eilber, Sarah M. Dry. (2008) Diagnosis and management of synovial sarcoma. Journal of Surgical Oncology 97:4, 314-320
CrossRef50
Ayesha Qayum, Taylor S. Riall, Ramesh Srinivasan, Fernando A. Salazar. (2008) A Patient with Synovial Cell Sarcoma Primary to the Gallbladder and Common Bile Duct. Journal of Gastrointestinal Surgery 12:3, 609-611
CrossRef51
Louis Guillou. (2008) Contribution of Molecular Biology and Markers to the Prognosis and Management of Patients With Soft Tissue Sarcoma. Pathology Case Reviews 13:2, 69-77
CrossRef52
Kevin B. Jones, Peter C. Ferguson, Rita Kandel, Jay S. Wunder. (2008) Determination of Chromosomal Translocations in Soft Tissue Sarcomas: A Worthwhile Undertaking. Pathology Case Reviews 13:2, 57-64
CrossRef53
Kei Kushitani, Yukio Takeshima, Vishwa Jeet Amatya, Osamu Furonaka, Akio Sakatani, Kouki Inai. (2008) Differential diagnosis of sarcomatoid mesothelioma from true sarcoma and sarcomatoid carcinoma using immunohistochemistry. Pathology International 58:2, 75-83
CrossRef54
Olivia Aranha, Mark Agulnik. (2008) Molecularly targeted therapies in adult soft tissue sarcomas: present approach and future directions. Expert Opinion on Therapeutic Targets 12:2, 197-207
CrossRef55
D R H de Bruijn, A H A van Dijk, M P Willemse, A Geurts van Kessel. (2008) The C terminus of the synovial sarcoma-associated SSX proteins interacts with the LIM homeobox protein LHX4. Oncogene 27:5, 653-662
CrossRef56
Hisao UEHARA, Koji YAMASAKI, Tsuyoshi FUKUSHIMA, Atsushi YAMASHITA, Kosuke MARUTSUKA, Shinichi NAKANO, Yujiro ASADA, Hideo TAKESHIMA. (2008) Intraneural Synovial Sarcoma Originating From the Median Nerve. Neurologia medico-chirurgica 48:2, 77-82
CrossRef57
Julie D.R. Reimann, Christopher D.M. Fletcher. 2008. Soft-Tissue Sarcomas. , 471-477.
CrossRef58
Constantine Komis, George A. Lagogiannis, Gregory Faratzis, Alexander D. Rapidis. (2008) Synovial Sarcoma of the Tongue: Report of a Case and Review of the Literature. Journal of Oral and Maxillofacial Surgery 66:1, 154-160
CrossRef59
B. Ashleigh Guadagnolo, Gunar K. Zagars, Matthew T. Ballo, Shreyaskumar R. Patel, Valerae O. Lewis, Peter W.T. Pisters, Robert S. Benjamin, Raphael E. Pollock. (2007) Long-Term Outcomes for Synovial Sarcoma Treated With Conservation Surgery and Radiotherapy. International Journal of Radiation Oncology*Biology*Physics 69:4, 1173-1180
CrossRef60
Chan Hon Chui. (2007) Nonrhabdomyosarcoma soft tissue sarcoma (NRSTS). Surgical Oncology 16:3, 187-193
CrossRef61
Lenka Krskov??, David Sumerauer, Eva Stejskalov??, Roman Kodet. (2007) A Novel Variant of SYT-SSX1 Fusion Gene in a Case of Spindle Cell Synovial Sarcoma. Diagnostic Molecular Pathology 16:3, 179-183
CrossRef62
M. Åkerman, H. A. Domanski. (2007) The complex cytological features of synovial sarcoma in fine needle aspirates, an analysis of four illustrative cases. Cytopathology 18:4, 234-240
CrossRef63
William J. Harb, Mario A. Luna, Shreyaskumar R. Patel, Matthew T. Ballo, Dianna B. Roberts, Erich M. Sturgis. (2007) Survival in patients with synovial sarcoma of the head and neck: Association with tumor location, size, and extension. Head & Neck 29:8, 731-740
CrossRef64
Katharina Tschoep, Alexander Kohlmann, Marcus Schlemmer, Torsten Haferlach, Rolf-Dieter Issels. (2007) Gene expression profiling in sarcomas. Critical Reviews in Oncology/Hematology 63:2, 111-124
CrossRef65
Paul H Hartel, Julie C Fanburg-Smith, Aletta A Frazier, Jeffrey R Galvin, Jack H Lichy, Konstantin Shilo, Teri J Franks. (2007) Primary pulmonary and mediastinal synovial sarcoma: a clinicopathologic study of 60 cases and comparison with five prior series. Modern Pathology 20:7, 760-769
CrossRef66
Gino R Somers, Maria Zielenska, Shaker Abdullah, Christopher Sherman, Suzanne Chan, Paul S Thorner. (2007) Expression of MYCN in pediatric synovial sarcoma. Modern Pathology 20:7, 734-741
CrossRef67
Maria Fernanda C Amary, Fitim Berisha, Fabiola Del Carlo Bernardi, Amanda Herbert, Michelle James, Jorge Sérgio Reis-Filho, Cyril Fisher, Andrew G Nicholson, Roberto Tirabosco, Timothy C Diss, Adrienne M Flanagan. (2007) Detection of SS18-SSX fusion transcripts in formalin-fixed paraffin-embedded neoplasms: analysis of conventional RT-PCR, qRT-PCR and dual color FISH as diagnostic tools for synovial sarcoma. Modern Pathology 20:4, 482-496
CrossRef68
Malay Haldar, Jeffrey D. Hancock, Cheryl M. Coffin, Stephen L. Lessnick, Mario R. Capecchi. (2007) A Conditional Mouse Model of Synovial Sarcoma: Insights into a Myogenic Origin. Cancer Cell 11:4, 375-388
CrossRef69
Shuichi Kanemitsu, Masanori Hisaoka, Shohei Shimajiri, Atsuji Matsuyama, Hiroshi Hashimoto. (2007) Molecular Detection of SS18-SSX Fusion Gene Transcripts by cRNA In Situ Hybridization in Synovial Sarcoma Using Formalin-fixed, Paraffin-embedded Tumor Tissue Specimens. Diagnostic Molecular Pathology 16:1, 9-17
CrossRef70
Brian Boulmay, Gary Cooper, John D. Reith, Robert Marsh. (2007) Primary Cardiac Synovial Sarcoma: A Case Report and Brief Review of the Literature. Sarcoma 2007, 1-4
CrossRef71
Akira Mitsuhashi, Yuichiro Nagai, Kiyomi Suzuka, Koji Yamazawa, Takayuki Nojima, Takashi Nikaido, Hiroshi Ishikura, Hideo Matsui, Makio Shozu. (2007) Primary Synovial Sarcoma in Fallopian Tube. International Journal of Gynecological Pathology 26:1, 34-37
CrossRef72
Sandrine de Ribaupierre, Olivier Vernet, Maya Beck-Popovic, Kathleen Meagher-Villemure, Bénédict Rilliet. (2007) Cervical Nerve Root Synovial Sarcoma in a Child with Chromosomal (X;18) Translocation. Pediatric Neurosurgery 43:5, 382-385
CrossRef73
Teiyu Izumi, Yoshinao Oda, Tadashi Hasegawa, Yukihiro Nakanishi, Akira Kawai, Hiroshi Sonobe, Tomonari Takahira, Chikashi Kobayashi, Hidetaka Yamamoto, Sadafumi Tamiya, Setsuo Hirohashi, Yukihide Iwamoto, Masazumi Tsuneyoshi. (2007) Dysadherin Expression as a Significant Prognostic Factor and as a Determinant of Histologic Features in Synovial Sarcoma: Special REFERENCE to its Inverse Relationship With E-cadherin Expression. The American Journal of Surgical Pathology 31:1, 85-94
CrossRef74
Stephanie Greene, Douglas S. Hawkins, Joe C. Rutledge, Karen D. Tsuchiya, James Douglas, Richard G. Ellenbogen, Anthony M. Avellino. (2006) PEDIATRIC INTRADURAL EXTRAMEDULLARY SYNOVIAL SARCOMA. Neurosurgery 59:6, E1339
CrossRef75
Sebastian Bauer, Joerg T. Hartmann. (2006) Locally advanced and metastatic sarcoma (adult type) including gastrointestinal stromal tumors. Critical Reviews in Oncology/Hematology 60:2, 112-130
CrossRef76
Manish Mani Subramaniam, Samuel Navarro, Antonio Pellin, Jose Antonio López-Guerrero, Carmen Carda, Jose Antonio Heredia Alvaro, Pau Lluís Gozalbo Sabater, Antonio Llombart-Bosch. (2006) Tissue microarray profiling of primary and xenotransplanted synovial sarcomas demonstrates the immunophenotypic similarities existing between SYT-SSX fusion gene confirmed, biphasic, and monophasic fibrous variants. Virchows Archiv 449:4, 435-447
CrossRef77
Y.M. Dennis Lo, Ching-Wan Lam, Ivy H.N. Wong. 2006. Molecular Biological Analyses and Molecular Pathology in Clinical Chemistry. .
CrossRef78
Joerg Thomas Hartmann, Sebastian Bauer. (2006) Soft tissue sarcoma. Update on Cancer Therapeutics 1:3, 385-402
CrossRef79
Yasuko Nakagawa, Kunihiko Numoto, Aki Yoshida, Toshiyuki Kunisada, Hidenori Ohata, Ken Takeda, Daniel Wai, Christopher Poremba, Toshifumi Ozaki. (2006) Chromosomal and genetic imbalances in synovial sarcoma detected by conventional and microarray comparative genomic hybridization. Journal of Cancer Research and Clinical Oncology 132:7, 444-450
CrossRef80
Tsuyoshi Saito, Yoshinao Oda, Hidetaka Yamamoto, Ken-ichi Kawaguchi, Kazuhiro Tanaka, Shuichi Matsuda, Yukihide Iwamoto, Masazumi Tsuneyoshi. (2006) Nuclear β-catenin correlates with cyclin D1 expression in spindle and pleomorphic sarcomas but not in synovial sarcoma. Human Pathology 37:6, 689-697
CrossRef81
N. Ferigo, J. Cottalorda, D. Allard, A. Gentil-Perret, M. Fessy, C. Berger, J. L. St??phan. (2006) Successful Treatment Via Chemotherapy and Surgical Resection of a Femoral Hemangiopericytoma With Pulmonary Metastasis. Journal of Pediatric Hematology/Oncology 28:4, 237-240
CrossRef82
Elena Antoaneta Nedea, Thomas F. DeLaney. (2006) Sarcoma and Skin Radiation Oncology. Hematology/Oncology Clinics of North America 20:2, 401-429
CrossRef83
P. O’Donnell, T. C. Diss, J. Whelan, A. M. Flanagan. (2006) Synovial sarcoma with radiological appearances of primitive neuroectodermal tumour/Ewing sarcoma: differentiation by molecular genetic studies. Skeletal Radiology 35:4, 233-239
CrossRef84
Josefin Fernebro, Princy Francis, Patrik Edén, Åke Borg, Ioannis Panagopoulos, Fredrik Mertens, Johan Vallon-Christersson, Måns Åkerman, Anders Rydholm, Henrik CF Bauer, Nils Mandahl, Mef Nilbert. (2006) Gene expression profiles relate to SS18/SSX fusion type in synovial sarcoma. International Journal of Cancer 118:5, 1165-1172
CrossRef85
Eun A Lee, Do Young Lee, Hyon Joo Kwag, Min Kyung Kim, Tae Yun Oh, Si Young Lim, Seong Yong Lim. (2006) A Case of Monophasic Fibrous Synovial Sarcoma Confirmed Primary Pulmonary Origin by 18F-FDG PET/CT. Tuberculosis and Respiratory Diseases 60:6, 673
CrossRef86
A T Deyrup, S W Weiss. (2006) Grading of soft tissue sarcomas: the challenge of providing precise information in an imprecise world. Histopathology 48:1, 42-50
CrossRef87
Carlos Zamarrón, Ihab Abdulkader, Uxio Calvo Alvarez, Franciisco Javiver Barón, Jose Maria Garcia Prim, Ramiro Ledo Andio Ledo, Jeronimo Forteza. (2006) Primary Synovial Sarcoma of the Lung. Internal Medicine 45:10, 679-683
CrossRef88
Kazuya Fukuoka. (2006) Molecular Detection of SYT-SSX Fusion Gene Transcripts Currently Represents the Most Specific and Sensitive Tool for Diagnosing Intrathoracic Synovial Sarcoma. Internal Medicine 45:15, 881-882
CrossRef89
Chikako Fukukawa, Yusuke Nakamura, Toyomasa Katagiri. (2005) Molecular target therapy for synovial sarcoma. Future Oncology 1:6, 805-812
CrossRef90
Masumi Tsuda, Takuya Watanabe, Tatsuya Seki, Taichi Kimura, Hirofumi Sawa, Akio Minami, Tsuyoshi Akagi, Ken-ichi Isobe, Kazuo Nagashima, Shinya Tanaka. (2005) Induction of p21WAF1/CIP1 by human synovial sarcoma-associated chimeric oncoprotein SYT-SSX1. Oncogene 24:54, 7984-7990
CrossRef91
R. Lor Randall, Kathryn L. S. Schabel, Ying Hitchcock, David E. Joyner, Karen H. Albritton. (2005) Diagnosis and Management of Synovial Sarcoma. Current Treatment Options in Oncology 6:6, 449-459
CrossRef92
Pei Hui, Ning Li, Chaline Johnson, Ivo De Wever, Raf Sciot, Guidalberto Manfioletti, Giovanni Tallini. (2005) HMGA proteins in malignant peripheral nerve sheath tumor and synovial sarcoma: preferential expression of HMGA2 in malignant peripheral nerve sheath tumor. Modern Pathology 18:11, 1519-1526
CrossRef93
E. Koscielniak, T. Klingebiel, A. Schuck, I. Leuschner. (2005) Weichteilsarkome im Kindesalter. Der Onkologe 11:10, 1047-1053
CrossRef94
Randall J. Olsen, William M. Lydiatt, Scott A. Koepsell, Daniel Lydiatt, Sonny L. Johansson, Sabine Naumann, Julia A. Bridge, James R. Neff, Steven H. Hinrichs, Stefano R. Tarantolo. (2005) C-erb-B2 (HER2/neu) expression in synovial sarcoma of the head and neck. Head & Neck 27:10, 883-892
CrossRef95
Jose Antonio L??pez-Guerrero, Samuel Navarro, Rosa Noguera, Carmen Carda, Silvia Calabuig Fari??as, Antonio Pell??n, Antonio Llombart-Bosch. (2005) Mutational Analysis of the c-KIT AND PDGFR?? in a Series of Molecularly Well-Characterized Synovial Sarcomas. Diagnostic Molecular Pathology 14:3, 134-139
CrossRef96
Masanori Hisaoka, Hiroshi Hashimoto. (2005) Extraskeletal myxoid chondrosarcoma: Updated clinicopathological and molecular genetic characteristics. Pathology International 55:8, 453-463
CrossRef97
S. Merkelbach-Bruse, R. Büttner. (2005) Molekulare Diagnostik bei nicht-hämatologischen malignen Erkrankungen. Der Onkologe 11:8, 873-888
CrossRef98
Boo Messahel, Sandra Hing, Ruth Nash, Iona Jeffrey, Kathy Pritchard-Jones. (2005) Clinical features of molecular pathology of solid tumours in childhood. The Lancet Oncology 6:6, 421-430
CrossRef99
Tatsuo Ito, Mamoru Ouchida, Yuki Morimoto, Aki Yoshida, Yoshimi Jitsumori, Toshifumi Ozaki, Hiroshi Sonobe, Hajime Inoue, Kenji Shimizu. (2005) Significant growth suppression of synovial sarcomas by the histone deacetylase inhibitor FK228 in vitro and in vivo. Cancer Letters 224:2, 311-319
CrossRef100
I. Migeon-Duballet, V. Albert-Dunais, S. Milinkevitch, M. Paccalin. (2005) Synovialosarcome médiastinal du sujet âgé : à propos d'un cas. La Revue de Médecine Interne 26:5, 435-436
CrossRef101
Osamu Sato, Takuro Wada, Akira Kawai, Umio Yamaguchi, Atsushi Makimoto, Yasuo Kokai, Toshihiko Yamashita, Hirokazu Chuman, Yasuo Beppu, Yoichi Tani, Tadashi Hasegawa. (2005) Expression of epidermal growth factor receptor,ERBB2 andKIT in adult soft tissue sarcomas. Cancer 103:9, 1881-1890
CrossRef102
Richard Beverly Raney. (2005) Synovial Sarcoma in Young People. Journal of Pediatric Hematology/Oncology 27:4, 207-211
CrossRef103
Marina N. Nikiforova, Pamela Groen, George Mutema, Yuri E. Nikiforov, David Witte. (2005) Detection of SYT-SSX Rearrangements in Synovial Sarcomas by Real-Time One-Step RT-PCR. Pediatric and Developmental Pathology 8:2, 162-167
CrossRef104
Karen H Albritton, R Lor Randall. (2005) Prospects for Targeted Therapy of Synovial Sarcoma. Journal of Pediatric Hematology/Oncology 27:4, 219-222
CrossRef105
Cynthia E Herzog. (2005) Overview of Sarcomas in the Adolescent and Young Adult Population. Journal of Pediatric Hematology/Oncology 27:4, 215-218
CrossRef106
B. Bode-Lesniewska, J. Hodler, A. Hochstetter, L. Guillou, U. Exner, R. Caduff. (2005) Late solitary bone metastasis of a primary pulmonary synovial sarcoma with SYT-SSX1 translocation type: case report with a long follow-up. Virchows Archiv 446:3, 310-315
CrossRef107
Hugues B??gueret, Fran??oise Galateau-Salle, Louis Guillou, Bruno Chetaille, Elisabeth Brambilla, Jean-Michel Vignaud, Philippe Terrier, Odile Groussard, Jean-Michel Coindre. (2005) Primary Intrathoracic Synovial Sarcoma. The American Journal of Surgical Pathology 29:3, 339-346
CrossRef108
Dafydd G. Thomas, Thomas J. Giordano, Donita Sanders, Sybil Biermann, Vernon K. Sondak, Jonathan C. Trent, Dihua Yu, Raphael E. Pollock, Laurence Baker. (2005) Expression of receptor tyrosine kinases epidermal growth factor receptor and HER-2/neu in synovial sarcoma. Cancer 103:4, 830-838
CrossRef109
R Lor Randall, Stephen L Lessnick, Brian Johnson, David E Joyner. (2004) Molecular biology of sarcomas: update-the cell cycle paradigm. Current Opinion in Orthopaedics 15:6, 456-467
CrossRef110
C Fisher, A L Folpe, H Hashimoto, S W Weiss. (2004) Intra-abdominal synovial sarcoma: a clinicopathological study. Histopathology 45:3, 245-253
CrossRef111
Catherine Campbell, John Gallagher, Ian Dickinson. (2004) Synovial sarcoma − towards a simplified approach to prognosis. ANZ Journal of Surgery 74:9, 727-731
CrossRef112
Carl van Walraven, Darryl Davis, Alan J. Forster, George A. Wells. (2004) Time-dependent bias was common in survival analyses published in leading clinical journals. Journal of Clinical Epidemiology 57:7, 672-682
CrossRef113
Masaaki Yano, Shinichi Toyooka, Kazunori Tsukuda, Hideaki Dote, Yuki Morimoto, Norihide Ohata, Kouichi Ichimura, Motoi Aoe, Hiroshi Date, Nobuyoshi Shimizu. (2004) SYT–SSX fusion genes in synovial sarcoma of the thorax. Lung Cancer 44:3, 391-397
CrossRef114
Sun-Young Jun, Jene Choi, Gyeong Hoon Kang, Sun Hoo Park, Alberto G Ayala, Jae Y Ro. (2004) Synovial Sarcoma of the Kidney With Rhabdoid Features. The American Journal of Surgical Pathology 28:5, 634-637
CrossRef115
M. V. Chandu de Silva, Alex D. McMahon, Robin Reid. (2004) Prognostic Factors Associated With Local Recurrence, Metastases, and Tumor-Related Death in Patients With Synovial Sarcoma. American Journal of Clinical Oncology 27:2, 113-121
CrossRef116
Akira Kawai, Noriko Naito, Aki Yoshida, Yuki Morimoto, Mamoru Ouchida, Kenji Shimizu, Yasuo Beppu. (2004) Establishment and characterization of a biphasic synovial sarcoma cell line, SYO-1. Cancer Letters 204:1, 105-113
CrossRef117
Peiguo G Chu, Jean Benhattar, Lawrence M Weiss, Kathleen Meagher-Villemure. (2004) Intraneural synovial sarcoma: two cases. Modern Pathology 17:2, 258-263
CrossRef118
Jacob Engellau. (2004) Prognostic factors in soft tissue sarcoma Tissue microarray for immunostaining, the importance of whole-tumor sections and time-dependence. Acta Orthopaedica 75:s314, 1-52
CrossRef119
M V C de Silva, A D McMahon, L Paterson, R Reid. (2003) Identification of poorly differentiated synovial sarcoma: a comparison of clinicopathological and cytogenetic features with those of typical synovial sarcoma. Histopathology 43:3, 220-230
CrossRef120
Neil H. Segal, Paul Pavlidis, Cristina R. Antonescu, Robert G. Maki, William S. Noble, Diann DeSantis, James M. Woodruff, Jonathan J. Lewis, Murray F. Brennan, Alan N. Houghton, Carlos Cordon-Cardo. (2003) Classification and Subtype Prediction of Adult Soft Tissue Sarcoma by Functional Genomics. The American Journal of Pathology 163:2, 691-700
CrossRef121
Chung-Che Chang, Vinod B. Shidham. (2003) Molecular Genetics of Pediatric Soft Tissue Tumors. The Journal of Molecular Diagnostics 5:3, 143-154
CrossRef122
Alexei Shir, Inbar Friedrich, Alexander Levitzki. (2003) Tumor specific activation of PKR as a non-toxic modality of cancer treatment. Seminars in Cancer Biology 13:4, 309-314
CrossRef123
Robyn Gaffney, Artemis Chakerian, John X. O'Connell, Joan Mathers, Kelly Garner, Nancy Joste, David S. Viswanatha. (2003) Novel Fluorescent Ligase Detection Reaction and Flow Cytometric Analysis of SYT-SSX Fusions in Synovial Sarcoma. The Journal of Molecular Diagnostics 5:2, 127-135
CrossRef124
Erich M. Sturgis, Bryan O. Potter. (2003) Sarcomas of the head and neck region. Current Opinion in Oncology 15:3, 239-252
CrossRef125
M
ns
CrossRef126
Seigo Hara, Masahito Hatori, Masami Hosaka, Tetsuro Komatsu, Takashi Tsuchiya, Noriko Kimura. (2003) Synovial Sarcoma with Massive Ossification – A Case Report. Upsala Journal of Medical Sciences 108:2, 151-158
CrossRef127
Murray F. Brennan. (2003) Presumption, Privilege, and Preemption. Transactions of the ... Meeting of the American Surgical Association 121, 1-8
CrossRef128
D. Ashley Hill, Maureen J. O'Sullivan, Xiaopei Zhu, Robin T. Vollmer, Peter A. Humphrey, Louis P. Dehner, John D. Pfeifer. (2002) Practical Application of Molecular Genetic Testing as an Aid to the Surgical Pathologic Diagnosis of Sarcomas. The American Journal of Surgical Pathology 26:8, 965-977
CrossRef129
Taisuke Hosaka, Yasuaki Nakashima, Katsuyuki Kusuzaki, Hiroaki Murata, Tomitaka Nakayama, Takeharu Nakamata, Tomoki Aoyama, Takeshi Okamoto, Kohichi Nishijo, Nobuhito Araki, Tadao Tsuboyama, Takashi Nakamura, Junya Toguchida. (2002) A Novel Type of EWS-CHOP Fusion Gene in Two Cases of Myxoid Liposarcoma. The Journal of Molecular Diagnostics 4:3, 164-171
CrossRef130
Timothy B. Rapp, Liu Yang, Ernest U. Conrad, Nils Mandahl, Howard A. Chansky. (2002) RNA splicing mediated by YB-1 is inhibited by TLS/CHOP in human myxoid liposarcoma cells. Journal of Orthopaedic Research 20:4, 723-729
CrossRef131
Stephen J. Qualman, Raffaella A. Morotti. (2002) Risk assignment in pediatric soft-tissue sarcomas: An evolving molecular classification. Current Oncology Reports 4:2, 123-130
CrossRef132
T Saito, Y Oda, A Sakamoto, S Tamiya, Y Iwamoto, M Tsuneyoshi. (2002) Matrix metalloproteinase-2 expression correlates with morphological and immunohistochemical epithelial characteristics in synovial sarcoma. Histopathology 40:3, 279-285
CrossRef133
Isabelle Hostein, Armelle Menard, Bin Nguyen Bui, Cathy Lussan, Jean Wafflart, Olivier Delattre, Martine Peter, Jean Benhattar, Louis Guillou, Jean-Michel Coindre. (2002) Molecular Detection of the Synovial Sarcoma Translocation t(X;18) by Real-Time Polymerase Chain Reaction in Paraffin-Embedded Material. Diagnostic Molecular Pathology 11:1, 16-21
CrossRef134
Akinobu Matsuzaki, Aiko Suminoe, Hiroyoshi Hattori, Takayuki Hoshina, Toshiro Hara. (2002) Immunotherapy With Autologous Dendritic Cells and Tumor-Specific Synthetic Peptides for Synovial Sarcoma. Journal of Pediatric Hematology/Oncology 24:3, 220-223
CrossRef135
Yoshifumi Namba, Akira Kawai, Noriko Naito, Yuki Morimoto, Shiro Hanakawa, Hajime Inoue. (2002) Intraarticular Synovial Sarcoma Confirmed by SYT-SSX Fusion Transcript. Clinical Orthopaedics and Related Research 395, 221-226
CrossRef136
Karen E. Bijwaard, John F. Fetsch, Ronald Przygodzki, Jeffery K. Taubenberger, Jack H. Lichy. (2002) Detection of SYT-SSX Fusion Transcripts in Archival Synovial Sarcomas by Real-Time Reverse Transcriptase-Polymerase Chain Reaction. The Journal of Molecular Diagnostics 4:1, 59-64
CrossRef137
Jacqueline K. Trupiano, Thomas W. Rice, Kevin Herzog, Frederic G. Barr, Janet Shipley, Cyril Fisher, John R. Goldblum. (2002) Mediastinal synovial sarcoma: report of two cases with molecular genetic analysis. The Annals of Thoracic Surgery 73:2, 628-630
CrossRef138
D.R.H. de Bruijn, N.R. dos Santos, A. Geurts van Kessel. 2002. SYT-SSX Fusion Genes. .
CrossRef139
Lydia R. Essary, Sara O. Vargas, Christopher D. M. Fletcher. (2002) Primary pleuropulmonary synovial sarcoma. Cancer 94:2, 459-469
CrossRef140
Oana Tomescu, Frederic G Barr. (2001) Chromosomal translocations in sarcomas: prospects for therapy. Trends in Molecular Medicine 7:12, 554-559
CrossRef141
Tsuyoshi Saito, Yoshinao Oda, Keishi Sugimachi, Ken-ichi Kawaguchi, Sadafumi Tamiya, Kazuhiro Tanaka, Shuichi Matsuda, Akio Sakamoto, Yukihide Iwamoto, Masazumi Tsuneyoshi. (2001) E-Cadherin Gene Mutations Frequently Occur in Synovial Sarcoma as a Determinant of Histological Features. The American Journal of Pathology 159:6, 2117-2124
CrossRef142
Brian P. Rubin, Jonathan A. Fletcher. (2001) Molecular alterations in sarcomas. Current Opinion in Orthopaedics 12:6, 519-525
CrossRef143
Achim A. Jungbluth, Cristina R. Antonescu, Klaus J. Busam, Kristin Iversen, Denise Kolb, Keren Coplan, Yao T. Chen, Elisabeth Stockert, Marc Ladanyi, Lloyd J. Old. (2001) Monophasic and biphasic synovial sarcomas abundantly express cancer/testis antigen ny-eso-1 but not mage-a1 or ct7. International Journal of Cancer 94:2, 252-256
CrossRef144
Ioannis Panagopoulos, Fredrik Mertens, Margareth Isaksson, Janusz Limon, Pelle Gustafson, Bj
CrossRef145
M. Fatih Okcu, Simona Despa, Mary Choroszy, Su G. Berrak, Ayten Cangir, Norman Jaffe, R. Beverly Raney. (2001) Synovial sarcoma in children and adolescents: Thirty three years of experience with multimodal therapy. Medical and Pediatric Oncology 37:2, 90-96
CrossRef146
Marie-Christine Aubry, Julia A. Bridge, Robert Wickert, Henry D. Tazelaar. (2001) Primary Monophasic Synovial Sarcoma of the Pleura. The American Journal of Surgical Pathology 25:6, 776-781
CrossRef147
Nobuyuki Hashimoto, Akira Myoui, Nobuhito Araki, Tatsuya Asai, Hiroshi Sonobe, Seiichi Hirota, Hideki Yoshikawa. (2001) Detection of SYT-SSX Fusion Gene in Peripheral Blood From a Patient With Synovial Sarcoma. The American Journal of Surgical Pathology 25:3, 406-410
CrossRef148
Michihisa Zenmyo, Setsuro Komiya, Tetsuya Hamada, Koji Hiraoka, Kensei Nagata, Seiji Tsuji, Hiroshi Hashimoto, Akio Inoue. (2001) Intraneural Monophasic Synovial Sarcoma. Spine 26:3, 310-313
CrossRef149
Rastko Golouh, Giorgio Stanta, Matej Bra?ko, Serena Bonin. (2001) Correlation of MTS1/p16 and nm23 mRNA expression with survival in patients with peripheral synovial sarcoma. Journal of Surgical Oncology 76:2, 83-88
CrossRef150
Hiroshi Inagaki, Mitsukuni Okabe, Masaru Seto, Shigeo Nakamura, Ryuzo Ueda, Tadaaki Eimoto. (2001) API2-MALT1 Fusion Transcripts Involved in Mucosa-Associated Lymphoid Tissue Lymphoma. The American Journal of Pathology 158:2, 699-706
CrossRef151
V Winnepenninckx, R De Vos, M Debiec-Rychter, I Samson, P Brys, A Hagemeijer, R Sciot. (2001) Calcifying/ossifying synovial sarcoma shows t(X;18) with SSX2 involvement and mitochondrial calcifications. Histopathology 38:2, 141-145
CrossRef152
Cabot, Richard C.Scully, Robert E., Mark, Eugene J., McNeely, William F., Shepard, Jo-Anne O., Ebeling, Sally H.Ellender, Stacey M.Peters, Christine C., Einhorn, Thomas A.Nielsen, G. Petur. (2001) Case 1-2001. New England Journal of Medicine 344:2, 124-131
Full Text153
Louis Guillou, Jean-Michel Coindre, Gabrielle Gallagher, Philippe Terrier, Sandra Gebhard, Nicolas De Saint Aubain Somerhausen, Jean-Jacques Michels, Gernot Jundt, Dominique Ranchère Vince, Françoise Collin, Martine Trassard, Viviane Le Doussal, Jean Benhattar. (2001) Detection of the synovial sarcoma translocation t(X;18) (SYT;SSX) in paraffin-embedded tissues using reverse transcriptase-polymerase chain reaction: A reliable and powerful diagnostic tool for pathologists. Human Pathology 32:1, 105-112
CrossRef154
Nuno R. dos Santos, Diederik R.H. de Bruijn, Ad Geurts van Kessel. (2001) Molecular mechanisms underlying human synovial sarcoma development. Genes, Chromosomes and Cancer 30:1, 1-14
CrossRef155
Alessandra Mezzelani, Gian Paolo Dagrada, Gabriella Sozzi, Marco A. Pierotti, Silvana Pilotti. (2000) SYT-SSX Fusion Transcripts and Epithelial Differentiation in Synovial Sarcoma. Diagnostic Molecular Pathology 9:4, 234
CrossRef156
R J Sneath, D C Mangham. (2000) CD44 isoform expression in synovial sarcoma correlates with epitheliogenesis but not prognosis. Histopathology 37:2, 166-174
CrossRef157
Duck-Hwan Kim, Jin H. Sohn, Min C. Lee, Gilho Lee, Ghil-Suk Yoon, Hiroshi Hashimoto, Hiroshi Sonobe, Jae Y. Ro. (2000) Primary Synovial Sarcoma of the Kidney. The American Journal of Surgical Pathology 24:8, 1097-1104
CrossRef158
Stephen X. Skapek, Chan Hon Chui. (2000) Cytogenetics and the biologic basis of sarcomas. Current Opinion in Oncology 12:4, 315-322
CrossRef159
Jeffrey F. Moley, Timothy J. Eberlein. (2000) SOFT-TISSUE SARCOMAS. Surgical Clinics of North America 80:2, 687-708
CrossRef160
Roby C. Thompson, Ashima Garg, Joseph Goswitz, Edward Y. Cheng, Denis R. Clohisy, Kathryn Dusenbery. (2000) Synovial Sarcoma. Clinical Orthopaedics and Related Research 373, 18-24
CrossRef161
Cristina R. Antonescu, Akira Kawai, Denis H. Leung, Fulvio Lonardo, James M. Woodruff, John H. Healey, Marc Ladanyi. (2000) Strong Association of SYT-SSX Fusion Type and Morphologic Epithelial Differentiation in Synovial Sarcoma. Diagnostic Molecular Pathology 9:1, 1-8
CrossRef162
Cristina R. Antonescu, Denis H. Leung, Maria Dudas, Marc Ladanyi, Murray Brennan, James M. Woodruff, Carlos Cordon-Cardo. (2000) Alterations of Cell Cycle Regulators in Localized Synovial Sarcoma. The American Journal of Pathology 156:3, 977-983
CrossRef163
Nobuyuki Hashimoto, Nobuhito Araki, Hideki Yoshikawa, Akira Myoui, Akihiko Matsumine, Motoharu Kaneko, Hiroshi Sonobe, Takahiro Ochi. (2000) SYT-SSX fusion proteins in synovial sarcomas: detection and characterization with new antibodies. Cancer Letters 149:1-2, 31-36
CrossRef164
Yoshinao O.D.A., Akio Sakamoto, Tsuyoshi Saito, Naoko Kinukawa, Yukihide Iwamoto, Masazumi Tsuneyoshi. (2000) Expression of hepatocyte growth factor (HGF)/scatter factor and its receptor c-MET correlates with poor prognosis in synovial sarcoma. Human Pathology 31:2, 185-192
CrossRef165
J.F. Graadt van Roggen, MB ChB, J.V.M.G. Bovée, H.J. van der Woude, P.C.W. Hogendoorn. (2000) An update of diagnostic strategies using molecular genetic and magnetic resonance imaging techniques for musculoskeletal tumors. Current Opinion in Rheumatology 12:1, 77-83
CrossRef166
Björn Skytting. (2000) Synovial sarcoma. Acta Orthopaedica 71:2, 1-28
CrossRef167
Susana C. Raimondi. (2000) Fluorescence in Situ Hybridization: Molecular Probes for Diagnosis of Pediatric Neoplastic Diseases. Cancer Investigation 18:2, 135-147
CrossRef168
Marc Ladanyi. (1999) Diagnosis and Classification of Small Round-Cell Tumors of Childhood. The American Journal of Pathology 155:6, 2181-2182
CrossRef169
Brian H. Kushner, Michael P. LaQuaglia, Nai-Kong V. Cheung, Kim Kramer, Aimee C. Hamelin, William L. Gerald, Marc Ladanyi. (1999) Clinically critical impact of molecular genetic studies in pediatric solid tumors. Medical and Pediatric Oncology 33:6, 530-535
CrossRef170
Sandra Birdsall, Pinchas Osin, Yong-Jie Lu, Cyril Fisher, Janet Shipley. (1999) Synovial sarcoma specific translocation associated with both epithelial and spindle cell components. International Journal of Cancer 82:4, 605-608
CrossRef171
Samuel Singer. (1999) New diagnostic modalities in soft tissue sarcoma. Seminars in Surgical Oncology 17:1, 11-22
CrossRef172
Jeannette L. Bennicelli, Frederic G. Barr. (1999) Genetics and the biologic basis of sarcomas. Current Opinion in Oncology 11:4, 267
CrossRef173
Peter Bergh, Jeanne M. Meis-Kindblom, Franco Gherlinzoni,
CrossRef174
J. Sybil Biermann, Laurence H. Baker. (1999) Soft tissue sarcoma. Cancer 85:12, 2497-2498
CrossRef175
B. Skytting, G. Nilsson, B. Brodin, Y. Xie, J. Lundeberg, M. Uhlen, O. Larsson. (1999) A Novel Fusion Gene, SYT-SSX4, in Synovial Sarcoma. JNCI Journal of the National Cancer Institute 91:11, 974-975
CrossRef176
Christopher D.M. Fletcher, Paola Dal Cin, Ivo de Wever, Nils Mandahl, Fredrik Mertens, Felix Mitelman, Juan Rosai, Anders Rydholm, Raf Sciot, Giovanni Tallini, Herman van den Berghe, Roberta Vanni, Helena Willén. (1999) Correlation between Clinicopathological Features and Karyotype in Spindle Cell Sarcomas. The American Journal of Pathology 154:6, 1841-1847
CrossRef177
G. Bruce Mann, Jonathan J. Lewis, Murray F. Brennan. (1999) ADULT SOFT TISSUE SARCOMA. ANZ Journal of Surgery 69:5, 336-343
CrossRef178
Yong-Jie Lu, Sandra Birdsall, Brenda Summersgill, Damian Smedley, Pinchas Osin, Cyril Fisher, Janet Shipley. (1999) Dual colour fluorescencein situ hybridization to paraffin-embedded samples to deduce the presence of the der(X)t(X;18)(p11.2;q11.2) and involvement of either theSSX1 orSSX2 gene: a diagnostic and prognostic aid for synovial sarcoma. The Journal of Pathology 187:4, 490-496
CrossRef179
Hisaoka, Hashimoto, Iwamasa, Ishikawa, Aoki. (1999) Primary synovial sarcoma of the lung: report of two cases confirmed by molecular detection of SYT-SSX fusion gene transcripts. Histopathology 34:3, 205-210
CrossRef180
S. Karen Machen, Kirk A. Easley, John R. Goldblum. (1999) Synovial Sarcoma of the Extremities. The American Journal of Surgical Pathology 23:3, 268-275
CrossRef181
Hiroshi Iwasaki, Masako Ishiguro, Yuko Ohjimi, Hiroki Ikegami, Toshio Takeuchi, Masahiro Kikuchi, Yasuhiko Kaneko, Asami Ariyoshi. (1999) Synovial Sarcoma of the Prostate With t(X;18)(p11.2;q11.2). The American Journal of Surgical Pathology 23:2, 220-226
CrossRef182
Peter Cole, Marc Ladanyi, William L. Gerald, Nai-Kong V. Cheung, Kim Kramer, Michael P. LaQuaglia, Brian H. Kushner. (1999) Synovial sarcoma mimicking desmoplastic small round-cell tumor: Critical role for molecular diagnosis. Medical and Pediatric Oncology 32:2, 97-101
CrossRef183
Björm Skytting, Jeanne M Meis-Kindblom, Olle Larsson, Martti Virolainen, Roland Perfekt, Måns Åkerman, Lars-Gunnar Kindblom. (1999) Synovial sarcoma–identification of favorable and unfavorable histologic types: A Scandinavian sarcoma group study of 104 cases. Acta Orthopaedica 70:6, 543-554
CrossRef184
Dan Jones, Christopher D. M. Fletcher. (1999) How shall we apply the new biology to diagnostics in surgical pathology?. The Journal of Pathology 187:1, 147-154
CrossRef185
Seiji Tsuji, Masanori Hisaoka, Yosuke Morimitsu, Hiroshi Hashimoto, Shohei Shimajiri, Setsuro Komiya, Masahiro Ushijima, Toshitaka Nakamura. (1998) Detection of SYT-SSX Fusion Transcripts in Synovial Sarcoma by Reverse Transcription-Polymerase Chain Reaction Using Archival Paraffin-Embedded Tissues. The American Journal of Pathology 153:6, 1807-1812
CrossRef186
Aida Safar, Robert Wickert, Marilu Nelson, James R. Neff, Julia A. Bridge. (1998) Characterization of a Variant SYT-SSX1 Synovial Sarcoma Fusion Transcript. Diagnostic Molecular Pathology 7:5, 283
CrossRef187
A. Geurts van Kessel, D. de Bruijn, L. Hermsen, I. Janssen, N. R. dos Santos, R. Willems, L. Makkus, H. Schreuder, R. Veth. (1998) Masked t(X;18)(p11;q11) in a biphasic synovial sarcoma revealed by FISH and RT-PCR. Genes, Chromosomes and Cancer 23:2, 198-201
CrossRef188
Toru Motoi, Tsuyoshi Ishida, Masahiko Kuroda, Hajime Horiuchi, Teruaki Oka, Kunio Matsumoto, Toshikazu Nakamura, Rikuo Machinami. (1998) Coexpression of hepatocyte growth factor and c-Met proto-oncogene product in synovial sarcoma. Pathology International 48:10, 769-775
CrossRef189
(1998) Genetic Abnormalities in Synovial Sarcoma. New England Journal of Medicine 338:23, 1699-1699
Full Text190
Rabbitts, T.H., . (1998) The Clinical Significance of Fusion Oncogenes in Cancer. New England Journal of Medicine 338:3, 192-194
Full Text
- Letters
