Original Article
The Association of Atopy with a Gain-of-Function Mutation in the α Subunit of the Interleukin-4 Receptor
N Engl J Med 1997; 337:1720-1725December 11, 1997
- Abstract
Background
Atopic diseases are very common, and atopy has a strong genetic predisposition.
Methods
Using single-strand conformation polymorphism analysis and DNA sequencing, we searched for mutations in the α subunit of the interleukin-4 receptor that would predispose persons to atopy. We examined the prevalence of the alleles among patients with allergic inflammatory disorders and among 50 prospectively recruited adults. Subjects with atopy were identified on the basis of an elevated serum lgE level (>95 IU per milliliter) or a positive radioimmunosorbent test in response to standard inhalant allergens. The signaling function of mutant interleukin-4 receptor α was examined by flow cytometry, binding assays, and immunoblotting.
Results
A novel interleukin-4 receptor α allele was identified in which guanine was substituted for adenine at nucleotide 1902, causing a change from glutamine to arginine at position 576 (R576) in the cytoplasmic domain of the interleukin-4 receptor α protein. The R576 allele was common among patients with allergic inflammatory disorders (found in 3 of 3 patients with the hyper-IgE syndrome and 4 of 7 patients with severe atopic dermatitis) and among the 50 prospectively recruited adults (found in 13 of 20 subjects with atopy and 5 of 30 without atopy; P = 0.001; relative risk of atopy among those with a mutant allele, 9.3). The R576 allele was associated with higher levels of expression of CD23 by interleukin-4 than the wild-type allele. This enhanced signaling was associated with a change in the binding specificity of the adjacent tyrosine residue at position 575 to signal-transducing molecules.
Conclusions
The R576 allele of interleukin-4 receptor α is strongly associated with atopy. This mutation may predispose persons to allergic diseases by altering the signaling function of the receptor.
Media in This Article
Figure 4
Binding of a Recombinant SHP-1 Fragment to Allelic Y575 Phosphopeptides.Figure 2
Effect of the R576 Allele on the Expression of CD23.Article Activity
- Article
Atopy is characterized by the formation of IgE antibody in persons with a genetic predisposition, who respond with immediate hypersensitivity on exposure to specific allergens. Atopy is common, affecting up to 40 percent of populations of Western societies,1-3 and it underlies the development of allergic diseases in susceptible persons. Although environmental factors such as exposure to antigens have an important role in the development of allergic diseases,4-6 there is a strong genetic predisposition.7,8 Recently, a number of atopy susceptibility genes have been identified. Some of these, such as those for interleukin-49-11 and several HLA class II molecules,8,12,13 regulate the production of IgE, whereas others, such as FcεRIβ, 14 mediate IgE effector functions.
The production of IgE is initiated by the interaction of antigen-presenting B cells with antigen-specific type 2 T helper cells.15 Cytokines secreted by type 2 T helper cells, including interleukin-4 and interleukin-13, act at their respective receptors to activate germ-line transcription from the epsilon heavy-chain gene locus and, together with signals delivered by the B-cell–surface molecule CD40, induce isotype switching from mu to epsilon.16 The interleukin-4 receptor is composed of two subunits: a 140-kd α subunit, which binds interleukin-4 and transduces its growth-promoting and transcription-activating functions,17,18 and a γc subunit, common to several cytokine receptors, which amplifies signaling of interleukin-4 receptor α.19-21 There is evidence to suggest that interleukin-4 receptor α is also a component of the interleukin-13 receptor.22
The central part played by interleukin-4 receptor α in regulating the production of IgE prompted us to investigate whether it is targeted by gain-of-function mutations or deletions that would enhance receptor signaling and hence precipitate atopy.
Methods
Study Subjects
The hyper-IgE syndrome and severe atopic dermatitis were diagnosed in three and seven patients, respectively, according to standard criteria.23-25 Patients with severe atopic dermatitis had chronic inflammation affecting 20 percent or more of their skin area and recurrent superficial infections. Fifty healthy, unrelated adults were prospectively recruited among employees of medical centers affiliated with Washington University School of Medicine. The single exclusion criterion was a history of immunotherapy, which may influence the results of tests used to identify subjects with atopy. Subjects were designated as having atopy on the basis of in vitro correlates of immediate hypersensitivity: an elevated serum IgE level (>95 IU per milliliter) or a positive radioimmunosorbent test (score, >3+) in response to one or more of the following inhalant allergens: the common mold Alternaria alternata, the house-dust mite Dermatophagoides pteronyssinus, and cat dander.26 The IgE assays and radioimmunosorbent test were performed with kits purchased from Pharmacia Diagnostics (Columbus, Ohio). Informed consent was obtained from all adult participants in these studies and, in the case of children, from parents or legal guardians.
Cell Lines
Isolation of peripheral-blood mononuclear cells and derivation of B-cell lines transformed by Epstein–Barr virus (EBV) were carried out according to standard methods. The EBV-negative Burkitt's lymphoma cell line BJAB was a kind gift of Dr. Elliott Kieff (Harvard Medical School, Boston). Cells were cultured in RPMI medium supplemented with 10 percent fetal bovine serum and maintained at 37°C in an atmosphere of 5 percent carbon dioxide.
Single-Strand Conformation Polymorphism Analysis and Sequencing
Complementary DNA (cDNA) was derived from EBV-transformed cell lines or peripheral-blood mononuclear cells and analyzed by single-strand conformation polymorphism (SSCP) as previously described27 with synthetic primers (Integrated DNA Technologies, Coralville, Iowa). A nested polymerase chain reaction (PCR) was used to amplify nucleotides 1840 to 2125 of interleukin-4 receptor α cDNA, with 5'GCCCACACTGGAAGAATTGTCTTAC'3 (sense) and 5'TTTTGGGGGTCTGGCTTGAG3' (antisense) as the outer primer pair and 5'CCGAAATGTCCTCCAGCATG3' (sense) and 5'CCAGTCCAAAGGTGAACAAGGGG (antisense) as the inner primer pair. Direct PCR sequencing was done with the fmol sequencing system from Promega (Madison, Wis.).
Peptide Conjugation, Binding Assays, and Immunoblotting
The following synthetic peptides corresponding to the sequences flanking amino acids Y575 and Y603 of interleukin-4 receptor α were used: wild-type unphosphorylated Y575 (NH2-SAPTSGYQEFVHAVE-COOH), wild-type phosphorylated Y575 (NH2-SAPTSG(pY)QEFVHAVE-COOH), mutant phosphorylated Y575 (NH2-SAPTSG(pY)REFVHAVE-COOH), and phosphorylated Y603 (high-affinity Stat-6 site; NH2-SSGEEG(pY)-KPFQDLIP-COOH) (all from Quality Controlled Biochemicals, Hopkinton, Mass.). The peptides were coupled to Affigel 10 beads (BioRad Laboratories, Hercules, Calif.) at a ratio of 3 mg of peptide per milliliter of beads.
To assess the binding of cellular proteins to synthetic interleukin-4 receptor α peptides, 20 μl of peptide-conjugated beads was incubated with BJAB-cell lysates (2×107 cells) and then analyzed for the presence of peptide-associated Stat-6 or SHP-1 by immunoblotting with specific antiserum.28 Rabbit antihuman Stat-6 antiserum was purchased from Santa Cruz Biotechnology (Santa Cruz, Calif.); the rabbit anti–SHP-1 antiserum has been described previously.29 To assess the binding of recombinant SHP-1 protein fragment (positions 1 to 219)29 to interleukin-4 receptor α peptides, 100 ng of this fragment was incubated with the indicated peptide-conjugated beads, and bound protein was detected by immunoblotting.
Flow-Cytometric Analysis of the Expression of CD23
Peripheral-blood mononuclear cells were cultured for 48 hours in the presence of 33 ng of recombinant human interleukin-4 per milliliter (R & D Systems, Minneapolis) and in its absence, and the cells were then stained with fluorescein isothiocyanate–conjugated murine antihuman CD23 monoclonal antibody (Coulter Immunology, Hialeah, Fla.). Monocytic cells present in the respective samples of peripheral-blood mononuclear cells were identified by flow cytometry on the basis of forward-scatter and side-scatter characteristics and analyzed for the expression of CD23.
Statistical Analysis
The data were analyzed by the two-tailed version of Fisher's exact test with Primer of Biostatistics software for Apple Macintosh.30
Results
Identification of an Interleukin-4 Receptor α Allele That Segregates with Atopy
There are phenotypic similarities between patients with the hyper-IgE syndrome and interleukin-4 transgenic mice, including very high IgE levels, allergic inflammation, and osteoporosis.31-33 However, the patients have normal or decreased production of interleukin-4 in vitro,34,35 suggesting the presence of mutations that affect the function of interleukin-4 receptor α.
We screened the full-length interleukin-4 receptor α cDNA of three patients with the hyper-IgE syndrome for mutations by SSCP analysis of sequential cDNA segments spanning about 300 bp each. All three patients had an identical alteration (as compared with controls) in the SSCP profile of one cDNA segment, spanning nucleotides 1840 to 2125 (Figure 1AFigure 1
Identification of a Mutant Interleukin-4 Receptor α Allele.). This SSCP profile is consistent with a heterozygous configuration and predicts the presence of a point mutation or a small deletion in the affected allele. The affected cDNA segment was amplified by PCR and subjected to direct PCR sequencing, a method that allows the sequences of both alleles to be visualized simultaneously. The results of sequence analysis of cDNA of one patient with the hyper-IgE syndrome and one control subject are shown in Figure 1B: the patient has a missense mutation in which guanine is substituted for adenine at nucleotide 1902 (according to the interleukin-4 receptor α nucleotide sequence of Idzerda et al.17), causing a change from glutamine to arginine residue at position 576 (R576) of the protein (including the signal peptide).17,18 The sequence from the patient had both wild-type and mutant nucleotides, confirming the presence of heterozygosity. The same substitution was also found in the two other patients with hyper-IgE syndrome (data not shown). Analysis of the parents of these patients revealed that the R576 allele was inherited in a classic mendelian fashion (data not shown).The phenotype of the hyper-IgE syndrome overlaps that of severe atopic dermatitis, in that both are characterized by allergic inflammatory skin disease and high IgE levels. We therefore examined seven patients with severe atopic dermatitis for the presence of the mutant interleukin-4 receptor α allele. Three were found to be heterozygous and one was homozygous for the R576 allele, indicating that this allele is not restricted to patients with the hyper-IgE syndrome but may also involve patients with different allergic inflammatory conditions (Table 1Table 1
Frequency of Interleukin-4 Receptor a Alleles in Subjects with Atopy and Those without Atopy.).To establish the relation of the R576 allele with atopy, we studied their cosegregation in a prospectively chosen sample of 50 unrelated adults (100 chromosomes). Subjects with atopy were identified on the basis of the presence of an elevated serum IgE level or evidence of a specific IgE antibody response to one or more of the following allergens: A. alternata, D. pteronyssinus, and cat dander. Twenty subjects were identified as atopic, representing a percentage of the study group — 40 percent — that is in agreement with published reports of the prevalence of atopy in large populations.1-3 Among the 20 subjects with atopy, 13 had the R576 allele, as compared with only 5 of the 30 subjects without atopy (P = 0.001) (Table 1). The presence of the R576 allele carried a calculated relative risk of atopy of 9.3. The overall allelic frequency of R576 in the population of 100 chromosomes was 20 percent (35 percent in the group with atopy and 10 percent in the group without atopy, P = 0.004). Overall, these results suggested a strong association of the R576 allele with atopy.
Association of the R576 Allele with Enhanced Responsiveness to Interleukin-4
We investigated the molecular basis of the association of the Q576R substitution with atopy by examining the signaling functions of the wild-type and mutant interleukin-4 receptor α alleles. Binding of interleukin-4 to its receptor induces the expression of the low-affinity IgE receptor (CD23) on B cells, monocytes, and macrophages.36 We therefore used flow cytometry to assess the capacities of wild-type and mutant alleles to mediate the induction by interleukin-4 of the expression of CD23 in peripheral-blood mononuclear cells. Interleukin-4 induced higher levels of CD23 expression (by a mean [±SE] factor of 2.17±0.14) in peripheral-blood mononuclear cells from R576 heterozygotes than from wild-type homozygotes (six subjects) (Figure 2Figure 2
Effect of the R576 Allele on the Expression of CD23.). The level of expression of CD23 was also higher in peripheral-blood mononuclear cells from R576 homozygotes (by a mean factor of 3.07±0.62) than from wild-type homozygotes (two subjects). Enhanced expression of CD23 was noted in R576-positive cells from both subjects with atopy and those without atopy, and it was not due to the presence of higher levels of the mutant allele, as determined by flow cytometry (data not shown). These results suggest that the signaling function of the R576 allele is greater than that of the wild-type allele.Association of SHP-1 with Interleukin-4 Receptor α Alleles
Position 575 is occupied by a tyrosine residue (Y575) that on phosphorylation recruits phosphotyrosine-binding effector molecules.37 This suggested that the substitution of R for Q at position 576 may influence the interaction of phosphorylated Y575 with signaling intermediates.
We focused on the effect of the Q576R mutation on the binding to phosphorylated Y575 of two molecules implicated in interleukin-4 receptor signaling: Stat-6,38 a transcription factor that mediates gene induction by interleukin-4, and SHP-1,39 a phosphotyrosine phosphatase involved in signal termination by means of cytokine receptors, including interleukin-4 receptor.40-45 Binding assays were performed in which synthetic peptides spanning phosphorylated Y575 and harboring either the wild-type or mutant 576 residue were incubated with lysates of BJAB, a Burkitt's lymphoma B-cell line, which contain both Stat-6 and SHP-1. A wild-type peptide with an unphosphorylated Y575 residue was used as a negative control, and a phosphotyrosyl peptide spanning the interleukin-4 receptor α high-affinity Stat-6–binding site at position Y603 was used as a positive control.38 Binding of Stat-6 was similar with the wild-type and mutant phosphorylated Y575 peptides (Figure 3AFigure 3
Association of SHP-1 with Allelic Y575 Phosphopeptides., lanes 2 and 3, respectively). The phosphorylated Y603 peptide (lane 4 in Figure 3A) precipitated levels of Stat-6 that were twice as high as those precipitated by the wild-type and mutant phosphorylated Y575 peptides, in agreement with the fact that Stat-6 has a higher affinity for phosphorylated Y603 than phosphorylated Y575.38 In contrast, virtually no Stat-6 was precipitated by the unphosphorylated wild-type Y575 peptide (lane 1 in Figure 3A), which is consistent with the requirement for phosphotyrosine residues for Stat-6 binding.In contrast to Stat-6, SHP-1 bound much better to the wild-type phosphorylated Y575 peptide than to the mutant peptide (Figure 3A, lanes 2 and 3, respectively). Densitometric analysis revealed that wild-type phosphorylated Y575 peptide bound approximately twice as much SHP-1 as the mutant phosphorylated peptide (Figure 3A and Figure 3B). Wild-type unphosphorylated Y575 and phosphorylated Y603 peptides were ineffective binders (Figure 3A, lanes 1 and 4, respectively), which is consistent with the specificity of SHP-1 for phosphorylated Y575.
To determine whether SHP-1 associates with phosphorylated Y575 directly, we used a purified recombinant protein fragment of SHP-1, which corresponds to amino acids 1 to 219 of the native protein and contains the two SH2 domains of SHP-1. As shown in Figure 4Figure 4
Binding of a Recombinant SHP-1 Fragment to Allelic Y575 Phosphopeptides., the recombinant protein fragment selectively bound to the wild-type phosphorylated Y575 peptide (lane 3), a finding consistent with the occurrence of direct binding, but it bound only minimally to the mutant phosphorylated Y575 (lane 4), wild-type unphosphorylated Y575 (lane 2), and phosphorylated Y603 peptides (lane 5).Discussion
We found that an allele for the α subunit of the interleukin-4 receptor segregates with atopy. The interleukin-4 receptor α allele that we identified contains an arginine in lieu of a glutamine at position 576. This allele was common in patients with the hyper-IgE syndrome and severe atopic dermatitis as well as in prospectively recruited adults with atopy. It is inherited in a classic mendelian fashion and appears to be widespread, suggesting that it may contribute to the pathogenesis of a variety of allergic diseases.
A majority of subjects identified as carrying a single copy of the mutant allele were found to have atopy, suggesting a dominant effect. However, the finding that some carriers of the R576 allele, including one who was homozygous, were not atopic indicates that the penetrance of this allele may be modified by other factors. These may include distinct genetic loci that impart susceptibility to or protection from atopy and environmental factors such as the level and duration of exposure to allergens.4-6
The Q576R mutation is associated with enhanced signaling of interleukin-4 receptor, an effect that may underlie the predisposition of this allele to atopy. The substitution of arginine for glutamine at position 576 alters the binding profile of the adjacent phosphorylated tyrosine residue, as is evidenced by the decreased binding of the phosphotyrosine phosphatase SHP-1 in the presence of the mutation. SHP-1 dephosphorylates regulatory phosphotyrosine residues and has been implicated in termination of signaling by means of cytokine receptors.40-43,46 In the case of the interleukin-4 receptor signaling pathway, candidate intermediate molecules that may be regulated by SHP-1 include Stat-6, Janus protein kinases (Jak), and phosphatidylinositol 3-kinase.44
Decreased binding of SHP-1 to phosphorylated Y575 may be causally related to the altered signaling function of the mutant allele. A precedent for a disease resulting from the failure of receptor regulation by SHP-1 is familial erythrocytosis. Patients with this disorder have deletions in the carboxy-terminal segment of the cytoplasmic domain of the erythropoietin receptor.47,48 The deleted sequence contains binding sites for SHP-1, and the resultant lack of SHP-1 regulation results in exaggerated receptor signaling.41
It should be emphasized that although decreased binding of SHP-1 to phosphorylated Y575 may provide an explanation for the association of the R576 allele with atopy, other mechanisms may be involved. These include alteration in the binding to phosphorylated Y575 of other, as yet unidentified, signaling intermediates, leading to exaggerated signaling. We also cannot rule out the presence in the interleukin-4 receptor gene of additional mutations, not detected by our screening, that predispose persons to atopy either independently of or in synergy with the Q576R mutation. Lastly, the R576 allele may segregate with a mutation in another molecule, such as a signaling intermediate, which fosters atopy. Discrimination between these alternative mechanisms will require further investigation.
Supported in part by a grant from the Monsanto–Searle/Washington University Biomedical Program (to Dr. Chatila) and a grant from the Howard Hughes Medical Institute through the Undergraduate Biological Sciences Education Program (to Ms. Friedrich). Dr. Hershey is the recipient of an Allergy Training Award from Glaxo Wellcome. Dr. Esswein is the recipient of a Fellowship Award from the Immune Deficiency Foundation.
We are indebted to Harvey Colten, Jonathan Gitlin, Helen Donis-Keller, and Emil Unanue for discussions; to Susan Mallory for referral of patients; and to Nga Ho, Sharon Bader, and Praveen Chand for assistance.
Source Information
From the Departments of Pediatrics (G.K.K.H., M.F.F., L.A.E., T.A.C.) and Pathology (M.L.T., T.A.C.), Howard Hughes Medical Institute (M.L.T.), and the Center for Immunology (M.L.T., T.A.C.), Washington University School of Medicine, St. Louis.
Address reprint requests to Dr. Chatila at the Division of Immunology–Rheumatology, Department of Pediatrics, Washington University School of Medicine, 1 Children's Pl., St. Louis, MO 63110.
- References
References
1
Holford-Strevens V ,Warren P ,Wong C ,Manfreda J . Serum total immunoglobulin E levels in Canadian adults. J Allergy Clin Immunol 1984;73:516-522
CrossRef | Web of Science | Medline2
Peat JK ,Britton WJ ,Salome CM ,Woolcock AJ . Bronchial hyperresponsiveness in two populations of Australian schoolchildren. III. Effect of exposure to environmental allergens. Clin Allergy 1987;17:291-300
CrossRef | Medline3
Cline MG ,Burrows B . Distribution of allergy in a population sample residing in Tucson, Arizona. Thorax 1989;44:425-431
CrossRef | Web of Science | Medline4
Sporik R ,Holgate ST ,Platts-Mills TAE ,Cogswell JJ . Exposure to house-dust mite allergen (Der p I) and the development of asthma in childhood: a prospective study. N Engl J Med 1990;323:502-507
Full Text | Web of Science | Medline5
Young RP ,Hart BJ ,Merrett TG ,Read AF ,Hopkin JM . House dust mite sensitivity: interaction of genetics and allergen dosage. Clin Exp Allergy 1992;22:205-211
CrossRef | Web of Science | Medline6
Peat JK ,Tovey E ,Toelle BG , et al. House dust mite allergens: a major risk factor for childhood asthma in Australia. Am J Respir Crit Care Med 1996;153:141-146
Web of Science | Medline7
Zeiger RS. Development and prevention of allergic disease in childhood. In: Middleton E Jr, Reed CE, Ellis EF, Adkinson NF Jr, Yunginger JW, Busse WW, eds. Allergy: principles and practice. 4th ed. Vol. 2. St. Louis: Mosby–Year Book, 1993:1137-71.
8
Huang SK ,Marsh DG . Genetics of allergy. Ann Allergy 1993;70:347-358
Medline9
Meyers DA ,Postma DS ,Panhuysen CIM , et al. Evidence for a locus regulating total serum IgE levels mapping to chromosome 5. Genomics 1994;23:464-470
CrossRef | Web of Science | Medline10
Marsh DG ,Neely JD ,Breazeale DR , et al. Linkage analysis of IL4 and chromosome 5q31.1 markers and total serum immunoglobulin E concentrations. Science 1994;264:1152-1156
CrossRef | Web of Science | Medline11
Postma DS ,Bleecker ER ,Amelung PJ , et al. Genetic susceptibility to asthma -- bronchial hyperresponsiveness coinherited with a major gene for atopy. N Engl J Med 1995;333:894-900
Full Text | Web of Science | Medline12
Marsh DG ,Hsu SH ,Roebber M , et al. HLA-Dw2: a genetic marker for human immune response to short ragweed pollen allergen Ra5. I. Response resulting primarily from natural antigenic exposure. J Exp Med 1982;155:1439-1451
CrossRef | Web of Science | Medline13
Young RP ,Dekker JW ,Wordsworth BP , et al. HLA-DR and HLA-DP genotypes and immunoglobulin E responses to common major allergens. Clin Exp Allergy 1994;24:431-439
CrossRef | Web of Science | Medline14
Shirakawa T ,Li A ,Dubowitz M , et al. Association between atopy and variants of the beta subunit of the high-affinity immunoglobulin E receptor. Nat Genet 1994;7:125-129
CrossRef | Web of Science | Medline15
Bonnefoy JY ,Gauchat JF ,Lecoanet-Henchoz S ,Graber P ,Aubry JP . Regulation of human IgE synthesis. Ann N Y Acad Sci 1996;796:59-71
CrossRef | Web of Science | Medline16
Stavnezer J . Antibody class switching. Adv Immunol 1996;61:79-146
CrossRef | Web of Science | Medline17
Idzerda RL ,March CJ ,Mosley B , et al. Human interleukin 4 receptor confers biological responsiveness and defines a novel receptor superfamily. J Exp Med 1990;171:861-873
CrossRef | Web of Science | Medline18
Galizzi JP ,Zuber CE ,Harada N , et al. Molecular cloning of a cDNA encoding the human interleukin 4 receptor. Int Immunol 1990;2:669-675
CrossRef | Web of Science | Medline19
Kondo M ,Takeshita T ,Ishii N , et al. Sharing of the interleukin-2 (IL-2) receptor gamma chain between receptors for IL-2 and IL-4. Science 1993;262:1874-1877
CrossRef | Web of Science | Medline20
Russell SM ,Keegan AD ,Harada N , et al. Interleukin-2 receptor gamma chain: a functional component of the interleukin-4 receptor. Science 1993;262:1880-1883
CrossRef | Web of Science | Medline21
Oakes SA ,Candotti F ,Johnston JA , et al. Signaling via IL-2 and IL-4 in JAK3-deficient severe combined immunodeficiency lymphocytes: JAK3-dependent and independent pathways. Immunity 1996;5:605-615
CrossRef | Web of Science | Medline22
Aman MJ ,Tayebi N ,Obiri NI ,Puri RK ,Modi WS ,Leonard WJ . cDNA cloning and characterization of the human interleukin 13 receptor alpha chain. J Biol Chem 1996;271:29265-29270
CrossRef | Web of Science | Medline23
Buckley RH. Disorders of the IgE system. In: Stiehm ER, ed. Immunologic disorders in infants & children. 4th ed. Philadelphia: W.B. Saunders, 1996:409-22.
24
Geha RS ,Leung DY . Hyper immunoglobulin E syndrome. Immunodefic Rev 1989;1:155-172
Medline25
Hanifin JM ,Rajka G . Diagnostic features of atopic dermatitis. Acta Derm Venereol Suppl 1980;92:44-4726
Cookson WOCM ,Hopkin JM . Dominant inheritance of atopic immunoglobulin-E responsiveness. Lancet 1988;1:86-88
CrossRef | Web of Science | Medline27
Donis-Keller H ,Dou S ,Chi D , et al. Mutations in the RET proto-oncogene are associated with MEN 2A and FMTC. Hum Mol Genet 1993;2:851-856
CrossRef | Web of Science | Medline28
Migone TS ,Lin JX ,Cereseto A , et al. Constitutively activated Jak-STAT pathway in T cells transformed with HTLV-I. Science 1995;269:79-81
CrossRef | Web of Science | Medline29
Plas DR ,Johnson R ,Pingel JT , et al. Direct regulation of ZAP-70 by SHP-1 in T cell antigen receptor signaling. Science 1996;272:1173-1176
CrossRef | Web of Science | Medline30
Glantz SA. Primer of biostatistics. 4th ed. New York: McGraw-Hill, 1997.
31
Kirchner SG ,Sivit CJ ,Wright PF . Hyperimmunoglobulinemia E syndrome: association with osteoporosis and recurrent fractures. Radiology 1985;156:362-362
Web of Science | Medline32
Tepper RI ,Levinson DA ,Stanger BZ ,Campos-Torres J ,Abbas AK ,Leder P . IL-4 induces allergic-like inflammatory disease and alters T cell development in transgenic mice. Cell 1990;62:457-467
CrossRef | Web of Science | Medline33
Lewis DB ,Liggitt HD ,Effmann EL , et al. Osteoporosis induced in mice by overproduction of interleukin 4. Proc Natl Acad Sci U S A 1993;90:11618-11622
CrossRef | Web of Science | Medline34
Vercelli D ,Jabara HH ,Cunningham-Rundles C , et al. Regulation of immunoglobulin (Ig)E synthesis in the hyper-IgE syndrome. J Clin Invest 1990;85:1666-1671
CrossRef | Web of Science | Medline35
Ishizaka A ,Joh K ,Shibata R , et al. Regulation of IgE and IgG4 synthesis in patients with hyper IgE syndrome. Immunology 1990;70:414-416
Web of Science | Medline36
Defrance T ,Aubry JP ,Rousset F , et al. Human recombinant interleukin 4 induces Fc epsilon receptors (CD23) on normal human B lymphocytes. J Exp Med 1987;165:1459-1467
CrossRef | Web of Science | Medline37
Ryan JJ ,McReynolds LJ ,Keegan A , et al. Growth and gene expression are predominantly controlled by distinct regions of the human IL-4 receptor. Immunity 1996;4:123-132
CrossRef | Web of Science | Medline38
Hou J ,Schindler U ,Henzel WJ ,Ho TC ,Brasseur M ,McKnight SL . An interleukin-4-induced transcription factor: IL-4 Stat. Science 1994;265:1701-1706
CrossRef | Web of Science | Medline39
Matthews RJ ,Bowne DB ,Flores E ,Thomas ML . Characterization of hematopoietic intracellular protein tyrosine phosphatases: description of a phosphatase containing an SH2 domain and another enriched in proline-, glutamic acid-, serine-, and threonine-rich sequences. Mol Cell Biol 1992;12:2396-2405
Web of Science | Medline40
Yi T ,Mui AL ,Krystal G ,Ihle JN . Hematopoietic cell phosphatase associates with the interleukin-3 (IL-3) receptor beta chain and down-regulates IL-3-induced tyrosine phosphorylation and mitogenesis. Mol Cell Biol 1993;13:7577-7586
Web of Science | Medline41
Klingmuller U ,Lorenz U ,Cantley LC ,Neel BG ,Lodish HF . Specific recruitment of SH-PTP1 to the erythropoietin receptor causes inactivation of JAK2 and termination of proliferative signals. Cell 1995;80:729-738
CrossRef | Web of Science | Medline42
Chen HE ,Chang S ,Trub T ,Neel BG . Regulation of colony-stimulating factor 1 receptor signaling by the SH2 domain-containing tyrosine phosphatase SHPTP1. Mol Cell Biol 1996;16:3685-3697
Web of Science | Medline43
Paulson RF ,Vesely S ,Siminovitch KA ,Bernstein A . Signalling by the W/Kit receptor tyrosine kinase is negatively regulated in vivo by the protein tyrosine phosphatase Shp1. Nat Genet 1996;13:309-315
CrossRef | Web of Science | Medline44
Imani F ,Rager KJ ,Catipovic B ,Marsh DG . Interleukin-4 (IL-4) induces phosphatidylinositol 3-kinase (p85) dephosphorylation: implications for the role of SHP-1 in the IL-4-induced signals in human B cells. J Biol Chem 1997;272:7927-7931
CrossRef | Web of Science | Medline45
Yetter A ,Uddin S ,Krolewski JJ ,Jiao H ,Yi T ,Platanias LC . Association of the interferon-dependent tyrosine kinase Tyk-2 with the hematopoietic cell phosphatase. J Biol Chem 1995;270:18179-18182
CrossRef | Web of Science | Medline46
Gelderloos JA ,Anderson SM . Over-expression of protein tyrosine phosphatase 1 (PTP1) alters IL-3-dependent growth and tyrosine phosphorylation. Oncogene 1996;13:2367-2378
Web of Science | Medline47
de la Chapelle A ,Traskelin AL ,Juvonen E . Truncated erythropoietin receptor causes dominantly inherited benign human erythrocytosis. Proc Natl Acad Sci U S A 1993;90:4495-4499
CrossRef | Web of Science | Medline48
Sokol L ,Luhovy M ,Guan Y ,Prchal JF ,Semenza GL ,Prchal JT . Primary familial polycythemia: a frameshift mutation in the erythropoietin receptor gene and increased sensitivity of erythroid progenitors to erythropoietin. Blood 1995;86:15-22
Web of Science | Medline
- Citing Articles (254)
Citing Articles
1
H. Chu, M. Wang, F. Yan, D. Zhong, D. Shi, L. Ma, X. Pan, C. Qin, C. Yin, Z. Zhang. (2012) Polymorphisms in the IL-13 and IL-4R genes are associated with the development of renal cell carcinoma. Annals of Oncology
CrossRef2
S. Wenzel. (2012) Severe asthma: from characteristics to phenotypes to endotypes. Clinical & Experimental Allergyn/a-n/a
CrossRef3
Haiyan Chu, Lan Ma, Meilin Wang, Danni Shi, Chao Qin, Lin Yuan, Changjun Yin, Zhengdong Zhang. (2011) The polymorphisms of IL-4, IL-4R and IL-13 genes and bladder cancer risk in a Chinese population: a case–control study. Molecular Biology Reports
CrossRef4
Tarundeep Kakkar, Cynthia Sung, Leonid Gibiansky, Thuy Vu, Adimoolam Narayanan, Shao-Lee Lin, Michael Vincent, Christopher Banfield, Alex Colbert, Sarah Hoofring, Marta Starcevic, Peiming Ma. (2011) Population PK and IgE Pharmacodynamic Analysis of a Fully Human Monoclonal Antibody Against IL4 Receptor. Pharmaceutical Research 28:10, 2530-2542
CrossRef5
MATHILDE LECLERE, ANOUK LAVOIE-LAMOUREUX, JEAN-PIERRE LAVOIE. (2011) Heaves, an asthma-like disease of horses. Respirology 16:7, 1027-1046
CrossRef6
Kenji Izuhara, Shoichiro Ohta, Hiroshi Shiraishi, Shoichi Suzuki. 2011. Interleukin 4, Interleukin 13, and Interleukin 9. , 173-185.
CrossRef7
Marsha Wills-karp. 2011. Role of Th2 Cells in the Allergic Diathesis. , 15-25.
CrossRef8
Jiangwei Han, Xingming Jiang, Lida Zhang. (2011) Optimisation of extraction conditions for polysaccharides from the roots of Isatis tinctoria L. by response surface methodology and their in vitro free radicals scavenging activities and effects on IL-4 and IFN-γ mRNA expression in chicken lymphocytes. Carbohydrate Polymers 86:3, 1320-1326
CrossRef9
Oliver T. Burton, Hans C. Oettgen. (2011) Beyond immediate hypersensitivity: evolving roles for IgE antibodies in immune homeostasis and allergic diseases. Immunological Reviews 242:1, 128-143
CrossRef10
Stefan Reichert, Jamal M. Stein, Jana Klapproth, Uta Zimmermann, Yvonne Reichert, Christiane Gläser, Hans-Günter Schaller, Susanne Schulz. (2011) The genetic impact of the Q551R interleukin-4 receptor alpha polymorphism for aggressive or chronic periodontitis and the occurrence of periodontopathic bacteria. Archives of Oral Biology
CrossRef11
Stephan Weidinger, Alan D. Irvine. 2011. Genetics of Atopic Dermatitis. , 23.1-23.17.
CrossRef12
Supinda Bunyavanich, Josef Shargorodsky, Juan C. Celedón. (2011) A meta-analysis of Th2 pathway genetic variants and risk for allergic rhinitis. Pediatric Allergy and Immunology 22:4, 378-387
CrossRef13
Clinton B. Mathias, Suejy A. Hobson, Maria Garcia-Lloret, Greg Lawson, Dimitri Poddighe, Eva-Jasmin Freyschmidt, Wei Xing, Michael F. Gurish, Talal A. Chatila, Hans C. Oettgen. (2011) IgE-mediated systemic anaphylaxis and impaired tolerance to food antigens in mice with enhanced IL-4 receptor signaling. Journal of Allergy and Clinical Immunology 127:3, 795-805.e6
CrossRef14
N. Gahr, R. Fölster-Holst, M. Weichenthal, E. Christophers, J.-M. Schröder, J. Bartels. (2011) Dermal fibroblasts from acute inflamed atopic dermatitis lesions display increased eotaxin/CCL11 responsiveness to interleukin-4 stimulation. British Journal of Dermatologyno-no
CrossRef15
P. Bründler, C.F. Frey, B. Gottstein, P. Nussbaumer, S. Neuhaus, V. Gerber. (2011) Lower shedding of strongylid eggs by Warmblood horses with recurrent airway obstruction compared to unrelated healthy horses. The Veterinary Journal
CrossRef16
Robert A. Colbert, Susan D. Thompson, David N. Glass. 2011. INTEGRATIVE GENOMICS. , 60-70.
CrossRef17
Alan P. Knutsen. (2011) Immunopathology and Immunogenetics of Allergic Bronchopulmonary Aspergillosis. Journal of Allergy 2011, 1-9
CrossRef18
Alan P. Knutsen, Raymond G. Slavin. (2011) Allergic Bronchopulmonary Aspergillosis in Asthma and Cystic Fibrosis. Clinical and Developmental Immunology 2011, 1-13
CrossRef19
Erin A.S. Clark, Lisa Mele, Ronald J. Wapner, Catherine Y. Spong, Yoram Sorokin, Alan Peaceman, Jay D. Iams, Kenneth J. Leveno, Margaret Harper, Steve N. Caritis, Menachem Miodovnik, Brian M. Mercer, John M. Thorp, Susan M. Ramin, Marshall Carpenter, Dwight J. Rouse. (2010) Association of fetal inflammation and coagulation pathway gene polymorphisms with neurodevelopmental delay at age 2 years. American Journal of Obstetrics and Gynecology 203:1, 83.e1-83.e10
CrossRef20
Omid Khalilzadeh, Mehdi Anvari, Fatemeh Momen-Heravi, Alireza Esteghamati, Armin Rashidi, Mahdi Mahmoudi, Behrouz Nikbin, Aliakbar Amirzargar. (2010) Gene polymorphisms of interleukin-4, interleukin-10 and transforming growth factor-beta in Graves’ disease. Clinical and Experimental Medicine 10:2, 123-128
CrossRef21
Vojko Berce, Uroš Potoˇnik. (2010) Association of Q551R polymorphism in the interleukin 4 receptor gene with nonatopic asthma in Slovenian children. Wiener klinische Wochenschrift 122:S2, 11-18
CrossRef22
Xiaohui Wu, Yirong Li, Qingguo Chen, Fenghua Chen, Pengcheng Cai, Lin Wang, Lihua Hu. (2010) Association and Gene-Gene Interactions of Eight Common Single-Nucleotide Polymorphisms with Pediatric Asthma in Middle China. Journal of Asthma 47:3, 238-244
CrossRef23
B. Beghé, I. P. Hall, S. G. Parker, M. F. Moffatt, A. Wardlaw, M. J. Connolly, L. M. Fabbri, C. Ruse, I. Sayers. (2010) Polymorphisms in IL13 pathway genes in asthma and chronic obstructive pulmonary disease. Allergy 65:4, 474-481
CrossRef24
P. S. Friedmann, M. R. Ardern-Jones, C. A. Holden. 2010. Atopic Dermatitis. , 1-34.
CrossRef25
Marie-Anne Shaw. 2010. Immunogenetics. .
CrossRef26
Elizabeth R. Jarman, Jonathan R. Lamb. 2010. Airway Hypersensitivity. .
CrossRef27
M. B. Freidin, V. P. Puzyrev. (2010) Syntropic genes of allergic diseases. Russian Journal of Genetics 46:2, 224-229
CrossRef28
Thomas Bieber. (2010) Atopic Dermatitis. Annals of Dermatology 22:2, 125
CrossRef29
R. Tachdjian, C. Mathias, S. Al Khatib, P. J. Bryce, H. S. Kim, F. Blaeser, B. D. O'Connor, D. Rzymkiewicz, A. Chen, M. J. Holtzman, G. K. Hershey, H. Garn, H. Harb, H. Renz, H. C. Oettgen, T. A. Chatila. (2009) Pathogenicity of a disease-associated human IL-4 receptor allele in experimental asthma. Journal of Experimental Medicine 206:10, 2191-2204
CrossRef30
A.L. Lobashevsky, J.E. Manwaring, M.M. Travis, B.L. Nord, N.G. Higgins, Y.A. Serov, T.S. Arnoff, G.A. Hommel-Berrey, W.C. Goggins, T.E. Taber, C.B. Carter, D.S. Smith, T.C. Wozniak, J.A. O'Donnell, M.W. Turrentine. (2009) Effect of desensitization in solid organ transplant recipients depends on some cytokines genes polymorphism. Transplant Immunology 21:3, 169-178
CrossRef31
Animesh Chatterjee, Anurag Rathore, Tapan N. Dhole. (2009) Association of IL-4 589 C/T promoter and IL-4RαI50V receptor polymorphism with susceptibility to HIV-1 infection in North Indians. Journal of Medical Virology 81:6, 959-965
CrossRef32
Carlo Pincelli, Marco Pignatti, Riccardo G. Borroni. (2009) Pharmacogenomics in dermatology: from susceptibility genes to personalized therapy. Experimental Dermatology 18:4, 337-349
CrossRef33
Kian Fan Chung. 2009. Cytokines. , 327-341.
CrossRef34
Alan P. Knutsen, Barbara Kariuki, Luis A. Santiago, Raymond G. Slavin, Jonathan D. Wofford, Clifford Bellone, Maulik R. Shah. (2008) HLA-DR, IL-4RA, and IL-10: Genetic Risk Factors in Allergic Bronchopulmonary Aspergillosis. Pediatric Asthma, Allergy & Immunology 21:4, 185-190
CrossRef35
J. Zhu, W. E. Paul. (2008) CD4 T cells: fates, functions, and faults. Blood 112:5, 1557-1569
CrossRef36
I. H. S. Chan, N. L. S. Tang, T. F. Leung, W. Huang, Y. Y. O. Lam, C. Y. Li, C. K. Wong, G. W. K. Wong, C. W. K. Lam. (2008) Study of genegene interactions for endophenotypic quantitative traits in Chinese asthmatic children. Allergy 63:8, 1031-1039
CrossRef37
Larry Borish, Jeffrey A. Culp. (2008) Asthma: a syndrome composed of heterogeneous diseases. Annals of Allergy, Asthma & Immunology 101:1, 1-9
CrossRef38
Gareth Baynam, Guicheng Zhang, Siew-Kim Khoo, Peter Sly, Patrick Holt, Jack Goldblatt, Peter N. Le Souëf. (2008) Gender-specific effects of cytokine gene polymorphisms on childhood vaccine responses. Vaccine 26:29-30, 3574-3579
CrossRef39
Joseph Meletiadis, Stephen Chanock, Thomas J Walsh. (2008) Defining targets for investigating the pharmacogenomics of adverse drug reactions to antifungal agents. Pharmacogenomics 9:5, 561-584
CrossRef40
Eunyoung Ha, Seon-Hee Yang, Kyung-Im Yoo, In-Sung Chung, Mi-Young Lee, Jae-Hoon Bae, Jung-Chul Seo, Joo-Ho Chung, Dong-Hoon Shin. (2008) Interleukin 4 receptor is associated with an increase in body mass index in Koreans. Life Sciences 82:19-20, 1040-1043
CrossRef41
Young-Ae Lee, Ulrich Wahn. 2008. Genetic dissection of eczema. , 13-24.
CrossRef42
Natalija Novak, Thomas Bieber. 2008. The pathogenesis of atopic dermatitis. , 25-34.
CrossRef43
H He, A Isnard, B Kouriba, S Cabantous, A Dessein, O Doumbo, C Chevillard. (2008) A STAT6 gene polymorphism is associated with high infection levels in urinary schistosomiasis. Genes and Immunity 9:3, 195-206
CrossRef44
Emma L. Ivansson, Inger M. Gustavsson, Jessica J. Magnusson, Lori L. Steiner, Patrik K.E. Magnusson, Henry A. Erlich, Ulf B. Gyllensten. (2007) Variants of chemokine receptor 2 and interleukin 4 receptor, but not interleukin 10 or Fas ligand, increase risk of cervical cancer. International Journal of Cancer 121:11, 2451-2457
CrossRef45
Yin-Hsiu Chien, Wuh-Liang Hwu, Bor-Luen Chiang. (2007) The Genetics of Atopic Dermatitis. Clinical Reviews in Allergy & Immunology 33:3, 178-190
CrossRef46
Yang-Kyum Kim, Chul-Woo Pyo, Hee-Baeg Choi, Su-Yeon Kim, Tae-Yoon Kim, Tai-Gyu Kim. (2007) Associations of IL-2 and IL-4 gene polymorphisms with psoriasis in the Korean population. Journal of Dermatological Science 48:2, 133-139
CrossRef47
Michihiro Hide, Yuhki Yanase, Malcolm W. Greaves. (2007) Cutaneous Mast Cell Receptors. Dermatologic Clinics 25:4, 563-575
CrossRef48
I. Marenholz, Y.-A. Lee. (2007) Die Genetik atopischer Erkrankungen. medizinische genetik 19:3, 346-349
CrossRef49
Matthew J. Loza, Bao-Li Chang. (2007) Association between Q551R IL4R genetic variants and atopic asthma risk demonstrated by meta-analysis. Journal of Allergy and Clinical Immunology 120:3, 578-585
CrossRef50
Elizabeth E. Brown, Qing Lan, Tongzhang Zheng, Yawei Zhang, Sophia S. Wang, Shelia Hoar-Zahm, Stephen J. Chanock, Nathaniel Rothman, Dalsu Baris. (2007) Common variants in genes that mediate immunity and risk of multiple myeloma. International Journal of Cancer 120:12, 2715-2722
CrossRef51
K. Yabiku, M. Hayashi, I. Komiya, T. Yamada, Y. Kinjo, Y. Ohshiro, T. Kouki, N. Takasu. (2007) Polymorphisms of interleukin (IL)-4 receptor alpha and signal transducer and activator of transcription-6 (Stat6) are associated with increased IL-4Rα-Stat6 signalling in lymphocytes and elevated serum IgE in patients with Graves' disease. Clinical & Experimental Immunology 148:3, 425-431
CrossRef52
Hiroshi Seno, Kiichi Satoh, Shingo Tsuji, Takayuki Shiratsuchi, Yosuke Harada, Nobuyuki Hamajima, Kentaro Sugano, Sunao Kawano, Tsutomu Chiba. (2007) Novel interleukin-4 and interleukin-1 receptor antagonist gene variations associated with non-cardia gastric cancer in Japan: Comprehensive analysis of 207 polymorphisms of 11 cytokine genes. Journal of Gastroenterology and Hepatology 22:5, 729-737
CrossRef53
Hanna Danielewicz, Andrzej Boznański. (2007) Genetyczne modyfikacje receptora IL-4 i ich znaczenie dla rozwoju chorób uwarunkowanych atopią. Pediatria Polska 82:3, 227-232
CrossRef54
Jeong Joong Kim, Jung Youl Min, Jae Hoon Lee. (2007) Polymorphisms in the IL-13 and IL-4 receptor alpha genes and allergic rhinitis. European Archives of Oto-Rhino-Laryngology 264:4, 395-399
CrossRef55
K. I. M. López, S. E. F. Martínez, M. C. M. Moguel, L. T. Romero, C. S. Figueroa, G. V. Pacheco, B. Ibarra, J. S. Corona. (2007) Genetic diversity of the IL-4, IL-4 receptor and IL-13 loci in mestizos in the general population and in patients with asthma from three subpopulations in Mexico. International Journal of Immunogenetics 34:1, 27-33
CrossRef56
Akihiko SEKI, Tomoko TAKIGAWA, Reiko KISHI, Kou SAKABE, Shinpei TORII, Masatoshi TANAKA, Takesumi YOSHIMURA, Kanehisa MORIMOTO, Takahiko KATOH, Shohei KIRA, Yoshiharu AIZAWA. (2007) Review of 'Sick House Syndrome'. Nippon Eiseigaku Zasshi (Japanese Journal of Hygiene) 62:4, 939-948
CrossRef57
Michihiro HIDE, Yuki YANASE, Hidenori SUZUKI, Takaaki HIRAGUN, Shiyouji MIHARA. (2007) Nishi Nihon Hifuka 69:4, 414-423
CrossRef58
Selma P. Wiertsema, Gareth Baynam, Siew-Kim Khoo, Reinier H. Veenhoven, Niels van Heerbeek, Guicheng Zhang, Ingrid A. Laing, Ger T. Rijkers, Jack Goldblatt, Elisabeth A.M. Sanders, Peter N. Le Souëf. (2007) Impact of genetic variants in IL-4, IL-4 RA and IL-13 on the anti-pneumococcal antibody response. Vaccine 25:2, 306-313
CrossRef59
Weidong Zhang, Xiaozhu Zhang, Diwen Qiu, Andrew Sandford, Wan C. Tan. (2007) IL-4 receptor genetic polymorphisms and asthma in Asian populations. Respiratory Medicine 101:1, 186-190
CrossRef60
K. Tanaka, M. H. Roberts, N. Yamamoto, H. Sugiura, M. Uehara, J. M. Hopkin. (2006) Upregulating promoter polymorphisms of RANTES relate to atopic dermatitis. International Journal of Immunogenetics 33:6, 423-428
CrossRef61
V. Suppiah, M. Rooney, K. Vandenbroeck. (2006) Polymorphisms in the interleukin-4 and IL-4 receptor genes modify risk for chronic inflammatory arthropathies in women. Experimental and Molecular Pathology 81:3, 239-244
CrossRef62
David I. Bernstein, Ning Wang, Paloma Campo, Ranajit Chakraborty, Andrew Smith, André Cartier, Louis-Philippe Boulet, Jean-Luc Malo, Berran Yucesoy, Michael Luster, Susan M. Tarlo, Gurjit K. Khurana Hershey. (2006) Diisocyanate asthma and gene-environment interactions with IL4RA, CD-14, and IL-13 genes. Annals of Allergy, Asthma & Immunology 97:6, 800-806
CrossRef63
Takaharu Negoro, Kanami Orihara, Tomoko Irahara, Hiroshi Nishiyama, Kanae Hagiwara, Risa Nishida, Hiroki Takagi, Kazue Satoh, Yoshiki Yamamoto, Shunichi Shimizu, Tamio Hagiwara, Masakazu Ishii, Toshihiro Tanioka, Yasuko Nakano, Ken Takeda, Isao Yoshimura, Yoji Iikura, Takashi Tobe. (2006) Influence of SNPs in cytokine-related genes on the severity of food allergy and atopic eczema in children. Pediatric Allergy and Immunology 17:8, 583-590
CrossRef64
E. Melén, S. Umerkajeff, F. Nyberg, M. Zucchelli, A. Lindstedt, H. Gullstén, M. Wickman, G. Pershagen, J. Kere. (2006) Interaction between variants in the interleukin-4 receptor ? and interleukin-9 receptor genes in childhood wheezing: evidence from a birth cohort study. Clinical & Experimental Allergy 36:11, 1391-1398
CrossRef65
Rosa-Maria Guéant-Rodriguez, Antonino Romano, Mylène Béri-Dexheimer, Marinella Viola, Francesco Gaeta, Jean-Louis Guéant. (2006) Gene–gene interactions of IL13 and IL4RA variants in immediate allergic reactions to betalactam antibiotics. Pharmacogenetics and Genomics 16:10, 713-719
CrossRef66
Ann-Marie Bergin, Barbro Balder, Shivendra Kishore, Kajsa Swärd, Mirjana Hahn-Zoric, Olle Löwhagen, Lars Å. Hanson, Leonid Padyukov. (2006) Common variations in the IL4R gene affect splicing and influence natural expression of the soluble isoform. Human Mutation 27:10, 990-998
CrossRef67
Wendell W. Weber, Maureen T. Cronin. 2006. Pharmacogenetic Testing. .
CrossRef68
L. Guglielmi, C. Fontaine, C. Gougat, O. Avinens, J.-F. Eliaou, P. Guglielmi, P. Demoly. (2006) IL-10 promoter and IL4-Ralpha gene SNPs are associated with immediate beta-lactam allergy in atopic women. Allergy 61:8, 921-927
CrossRef69
D Brassat, A A Motsinger, S J Caillier, H A Erlich, K Walker, L L Steiner, B A C Cree, L F Barcellos, M A Pericak-Vance, S Schmidt, S Gregory, S L Hauser, J L Haines, J R Oksenberg, M D Ritchie. (2006) Multifactor dimensionality reduction reveals gene–gene interactions associated with multiple sclerosis susceptibility in African Americans. Genes and Immunity 7:4, 310-315
CrossRef70
Iryna Prots, Alla Skapenko, Jörg Wendler, Stefan Mattyasovszky, Clarisse L. Yoné, Bernd Spriewald, Harald Burkhardt, Rolf Rau, Joachim R. Kalden, Peter E. Lipsky, Hendrik Schulze-Koops. (2006) Association of theIL4R single-nucleotide polymorphism I50V with rapidly erosive rheumatoid arthritis. Arthritis & Rheumatism 54:5, 1491-1500
CrossRef71
Hervé Do, Alexandre Vasilescu, Gora Diop, Thomas Hirtzig, Cédric Coulonges, Taoufik Labib, Simon C. Heath, Jean-Louis Spadoni, Amu Therwath, Mark Lathrop, Fumihiko Matsuda, Jean-François Zagury. (2006) Associations of the IL2Rα, IL4Rα, IL10Rα, and IFN γ R1 cytokine receptor genes with AIDS progression in a French AIDS cohort. Immunogenetics 58:2-3, 89-98
CrossRef72
Moon-Won Kang, Chul-Woo Pyo, Seong-Heo Wie, Hee-Baeg Choi, Su-Yeon Kim, Yang-Kyum Kim, Joo-Sil Lee, Tai-Gyu Kim. (2006) Associations of IFN- γ Polymorphism with HIV-1 Infection in the Korean Population. AIDS Research and Human Retroviruses 22:3, 297-299
CrossRef73
Choon-Sik Park. (2006) Genetics of Branchal Asthma. Tuberculosis and Respiratory Diseases 60:4, 391
CrossRef74
Sung Il Nam, Eunyoung Ha, Kyung Hee Jung, Hyung Hwan Baik, Seo Hyun Yoon, Hae Jeong Park, Bong-Keun Choe, Joo-Ho Chung, Jung-Chul Seo, Mi Young Lee, Jae-Hoon Bae, Min Nam, In-Jang Choi, Joong-Gahng Kim, Dong-Hoon Shin. (2006) IL4 receptor polymorphism is associated with increased risk of sudden deafness in Korean population. Life Sciences 78:6, 664-667
CrossRef75
Tae Won Song, Hea Sun Yang, Kyung Eun Lee, Kyung Won Kim, Eun Soo Kim, Myung Hyun Sohn, Kyu-Earn Kim. (2006) Polymorphisms of the CTLA-4 promoter(-318) and exon 1(+49) genes with atopic dermatitis in Korean children. Korean Journal of Pediatrics 49:5, 545
CrossRef76
Alan P. Knutsen. (2006) Genetic and respiratory tract risk factors for aspergillosis: ABPA and asthma with fungal sensitization. Medical Mycology 44:s1, 61-70
CrossRef77
Kirk E. Lohmueller, Matthew M. Mauney, David Reich, John M. Braverman. (2006) Variants Associated with Common Disease Are Not Unusually Differentiated in Frequency across Populations. The American Journal of Human Genetics 78:1, 130-136
CrossRef78
V. Suppiah, A. Goris, I. Alloza, S. Heggarty, B. Dubois, H. Carton, A. Antiguedad, M. Mendibe, G. McDonnell, A. Droogan, S. Hawkins, C. Graham, K. Vandenbroeck. (2005) Polymorphisms in the interleukin-4 and IL-4 receptor genes and multiple sclerosis: a study in Spanish-Basque, Northern Irish and Belgian populations. International Journal of Immunogenetics 32:6, 383-388
CrossRef79
Alan P. Knutsen, Blakeslee Noyes, Manoj R. Warrier, Judy Consolino. (2005) Allergic bronchopulmonary aspergillosis in a patient with cystic fibrosis: diagnostic criteria when the IgE level is less than 500 IU/mL. Annals of Allergy, Asthma & Immunology 95:5, 488-493
CrossRef80
Sarah A. Rosner, Paul M. Ridker, Robert Y. L. Zee, Nancy R. Cook. (2005) Interaction between inflammation-related gene polymorphisms and cigarette smoking on the risk of myocardial infarction in the Physician’s Health Study. Human Genetics 118:2, 287-294
CrossRef81
Alexandra F Freeman, Steven M Holland. (2005) Hyper IgE syndrome: review and future directions. Expert Review of Clinical Immunology 1:4, 645-651
CrossRef82
Joseph Gut, Dario Bagatto. (2005) Theragenomic knowledge management for individualised safety of drugs, chemicals, pollutants and dietary ingredients. Expert Opinion on Drug Metabolism & Toxicology 1:3, 537-554
CrossRef83
Alex Soriano, Francisco Lozano, Harold Oliva, Felipe García, Meritxell Nomdedéu, Elisa Lazzari, Carmen Rodríguez, Alicia Barrasa, José I. Lorenzo, Jorge Romero, Montserrat Plana, José M. Miró, José M. Gatell, Jordi Vives, Teresa Gallart. (2005) Polymorphisms in the interleukin-4 receptor α chain gene influence susceptibility to HIV-1 infection and its progression to AIDS. Immunogenetics 57:9, 644-654
CrossRef84
Sabine Hoffjan, Jörg T. Epplen. (2005) The genetics of atopic dermatitis: recent findings and future options. Journal of Molecular Medicine 83:9, 682-692
CrossRef85
H.-L. Qiao, J. Yang, Y.-W. Zhang. (2005) Relationships between specific serum IgE, cytokines and polymorphisms in the IL-4, IL-4Ralpha in patients with penicillins allergy. Allergy 60:8, 1053-1059
CrossRef86
Mauro Donati, Tord Berglundh, Ann-Marie Hytonen, Mirjana Hahn-Zoric, Lars-A. Hanson, Leonid Padyukov. (2005) Association of the -159 CD14 gene polymorphism and lack of association of the -308 TNFA and Q551R IL-4RA polymorphisms with severe chronic periodontitis in Swedish Caucasians. Journal of Clinical Periodontology 32:5, 474-479
CrossRef87
Ly P Ngoc, Diane R Gold, Arthur O Tzianabos, Scott T Weiss, Juan C Celedón. (2005) Cytokines, allergy, and asthma. Current Opinion in Allergy and Clinical Immunology 5:2, 161-166
CrossRef88
Stephan Bischoff, Sheila E. Crowe. (2005) Gastrointestinal food allergy: New insights into pathophysiology and clinical perspectives. Gastroenterology 128:4, 1089-1113
CrossRef89
Noora Noponen-Hietala, Iita Virtanen, Riitta Karttunen, Susanne Schwenke, Eveliina Jakkula, Hong Li, Riitta Merikivi, Sandra Barral, Jürg Ott, Jaro Karppinen, Leena Ala-Kokko. (2005) Genetic variations in IL6 associate with intervertebral disc disease characterized by sciatica. Pain 114:1-2, 186-194
CrossRef90
Bodo Grimbacher, Steven M. Holland, Jennifer M. Puck. (2005) Hyper-IgE syndromes. Immunological Reviews 203:1, 244-250
CrossRef91
Izolda Franjkovic, Andre Gessner, Inke K
nig, Karin Kissel, Anette Bohnert, Anne Hartung, Astrid Ohly, Andreas Ziegler, Holger Hackstein, Gregor Bein. (2005) Effects of common atopy-associated amino acid substitutions in the IL-4 receptor alpha chain on IL-4 induced phenotypes. Immunogenetics 56:11, 808-817
CrossRef92
María Isidoro-García, Ignacio Davila, Esther Moreno, Elena Laffond, Félix Lorente, Rogelio González-Sarmiento. (2005) El polimorfismo Q576R del gen IL4RA se asocia con valores elevados de IgE total en pacientes con antecedentes familiares de atopia. Medicina Clínica 124:6, 211-212
CrossRef93
Philippe H. Jais. (2005) How frequent is altered gene expression among susceptibility genes to human complex disorders?. Genetics in Medicine 7:2, 83-96
CrossRef94
M. J. Loza, S. P. Peters, R. B. Penn. (2005) Atopy, asthma, and experimental approaches based on the linear model of T cell maturation. Clinical <html_ent glyph="@amp;" ascii="&"/> Experimental Allergy 35:1, 8-17
CrossRef95
Bishnu Acharya, Toshiro Shirakawa, Ardanykusuma Pungky, Parlin Damanik, Muh. Nasrum Massi, Masahiro Miyata, Masafumi Matsuo, Akinobu Gotoh. (2005) Polymorphism of the Interleukin-4, Interleukin-13, and Signal Transducer and Activator of Transcription 6 Genes in Indonesian Children with Minimal Change Nephrotic Syndrome. American Journal of Nephrology 25:1, 30-35
CrossRef96
A.-M. Hytonen, O. Lowhagen, M. Arvidsson, B. Balder, A. L. Bjork, S. Lindgren, M. Hahn-Zoric, L. A. Hanson, L. Padyukov. (2004) Haplotypes of the interleukin-4 receptor alpha chain gene associate with susceptibility to and severity of atopic asthma. Clinical <html_ent glyph="@amp;" ascii="&"/> Experimental Allergy 34:10, 1570-1575
CrossRef97
Talal A. Chatila. (2004) Interleukin-4 receptor signaling pathways in asthma pathogenesis. Trends in Molecular Medicine 10:10, 493-499
CrossRef98
(2004) Investigation and Analysis of Allergy-related SNPs for Allergy Affected Students in a high school.. Journal of Life Science 14:5, 847-854
CrossRef99
Joannis Mytilineos, Gunter Laux, Gerhard Opelz. (2004) Relevance of IL10, TGFbeta1, TNFalpha, and IL4Ralpha Gene Polymorphisms in Kidney Transplantation: A Collaborative Transplant Study Report. American Journal of Transplantation 4:10, 1684-1690
CrossRef100
Michiko Suzuki, Hirokazu Arakawa, Kazushi Tamura, Takumi Takizawa, Hiroyuki Mochizuki, Kenichi Tokuyama, Mayumi Tamari, X-Q Mao, Taro Shirakawa, Akihiro Morikawa. (2004) Dinucleotide repeat polymorphisms in the signal transducers and activators of transcription 6 (Stat6) gene in children with allergic diseases. Allergology International 53:3, 235-240
CrossRef101
Michiko Suzuki, Hirokazu Arakawa, Yasuko Kobayashi, Kazushi Tamura, Hiroyuki Mochizuki, Kenichi Tokuyama, Mayumi Tamari, X-Q Mao, Taro Shirakawa, Kenji Izuhara, Akihiro Morikawa. (2004) Signal transducers and activators of transcription 6 (Stat6) variants in childhood and adult asthma. Allergology International 53:3, 241-244
CrossRef102
S.-G. Lee, B.-S. Kim, J.-H. Kim, S.-Y. Lee, S.-O. Choi, J.-Y. Shim, T.-J. Hong, S.-J. Hong. (2004) Gene-gene interaction between interleukin-4 and interleukin-4 receptor alpha in Korean children with asthma. Clinical <html_ent glyph="@amp;" ascii="&"/> Experimental Allergy 34:8, 1202-1208
CrossRef103
H. Arakawa, A. Morikawa. (2004) The genetics of pollinosis. Clinical <html_ent glyph="@amp;" ascii="&"/> Experimental Allergy Reviews 4:1, 3-7
CrossRef104
David H Dreyfus, Agniesczka Matczuk, Ramsay Fuleihan. (2004) An RNA external guide sequence ribozyme targeting human interleukin-4 receptor α mRNA. International Immunopharmacology 4:8, 1015-1027
CrossRef105
Monica J. Basehore, Timothy D. Howard, Leslie A. Lange, Wendy C. Moore, Gregory A. Hawkins, Patricia L. Marshik, Michelle S. Harkins, Deborah A. Meyers, Eugene R. Bleecker. (2004) A comprehensive evaluation of IL4 variants in ethnically diverse populations: association of total serum IgE levels and asthma in white subjects. Journal of Allergy and Clinical Immunology 114:1, 80-87
CrossRef106
K Fukai, N Hosomi, N Oiso, A Kato, M Ishii, H Kunimoto, K Nakajima. (2004) Proximal promoter polymorphisms of the interleukin-4 receptor alpha are associated with psoriasis in Japan: inverse association pattern compared with atopic dermatitis. Journal of Dermatological Science 35:1, 78-80
CrossRef107
Megan S. Lim, Kojo S.J. Elenitoba-Johnson. (2004) The Molecular Pathology of Primary Immunodeficiencies. The Journal of Molecular Diagnostics 6:2, 59-83
CrossRef108
Guruprasad P. Aithal, Lesley Ramsay, Ann K. Daly, Nhareet Sonchit, Julian B. S. Leathart, Graeme Alexander, J. Gerald Kenna, John Caldwell, Christopher P. Day. (2004) Hepatic adducts, circulating antibodies, and cytokine polymorphisms in patients with diclofenac hepatotoxicity. Hepatology 39:5, 1430-1440
CrossRef109
Marsha Wills-Karp, Susan L. Ewart. (2004) Time to draw breath: asthma-susceptibility genes are identified. Nature Reviews Genetics 5:5, 376-387
CrossRef110
Shahla Azadi, Kimberly J Klink, B.Jean Meade. (2004) Divergent immunological responses following glutaraldehyde exposure. Toxicology and Applied Pharmacology 197:1, 1-8
CrossRef111
Xin Liu, Terri H Beaty, Philipp Deindl, Shau-Ku Huang, Susanne Lau, Christine Sommerfeld, M.Daniele Fallin, W.H.Linda Kao, Ulrich Wahn, Renate Nickel. (2004) Associations between specific serum IgE response and 6 variants within the genes IL4, IL13, and IL4RA in German children. Journal of Allergy and Clinical Immunology 113:3, 489-495
CrossRef112
Manuel A. R. Ferreira. (2004) Inflammation in allergic asthma: Initiating events, immunological response and risk factors. Respirology 9:1, 16-24
CrossRef113
Kati Ådjers, Tanja Pessi, Jussi Karjalainen, Heini Huhtala, Mikko Hurme. (2004) Epistatic effect of IL1A and IL4RA genes on the risk of atopy. Journal of Allergy and Clinical Immunology 113:3, 445-447
CrossRef114
O Solberg. (2004) Genomic characterization of equine Interleukin-4 receptor α-chain (IL4R). Veterinary Immunology and Immunopathology 97:3-4, 187-194
CrossRef115
K Fan Chung. (2004) Anti-IgE monoclonal antibody, omalizumab: a new treatment for allergic asthma. Expert Opinion on Pharmacotherapy 5:2, 439-446
CrossRef116
A. P. Knutsen, P. S. Hutchinson, G. M. Albers, J. Consolino, J. Smick, V. P. Kurup. (2004) Increased sensitivity to IL-4 in cystic fibrosis patients with allergic bronchopulmonary aspergillosis. Allergy 59:1, 81-87
CrossRef117
Bernd Woitsch, David Carr, Daniel Stachel, Irene Schmid, Stephan K. Weiland, Christian Fritzsch, Erika von Mutius, Michael Kabesch. (2004) A Comprehensive Analysis of Interleukin-4 Receptor Polymorphisms and Their Association with Atopy and IgE Regulation in Childhood. International Archives of Allergy and Immunology 135:4, 319-324
CrossRef118
T. Jung, R. Moessner, C. Neumann. (2003) Naive CD4+ T cells from patients with atopic dermatitis show an aberrant maturation towards IL-4-producing skin-homing CLA+ cells. Experimental Dermatology 12:5, 555-562
CrossRef119
C. Migliaccio, C. Patuzzo, G. Malerba, E. Trabetti, R. Galavotti, L. Pescollderung, A. L. Boner, P. F. Pignatti. (2003) No linkage or association of five polymorphisms in the interleukin-4 receptor alpha gene with atopic asthma in Italian families. European Journal of Immunogenetics 30:5, 349-353
CrossRef120
Chul-Woo Pyo, Seong-Suk Hur, Yang-Kyum Kim, Hee-Baeg Choi, Young-Sun Hong, Dong-Wook Kim, Chun-Choo Kim, Hack-Ki Kim, Tai-Gyu Kim. (2003) Polymorphisms of IL-1B, IL-1RN, IL-2, IL-4, IL-6, IL-10, and IFN-γ genes in the Korean population. Human Immunology 64:10, 979-989
CrossRef121
Stephanie A Shore, Paul E Moore. (2003) Regulation of β-adrenergic responses in airway smooth muscle. Respiratory Physiology & Neurobiology 137:2-3, 179-195
CrossRef122
Tsippora Shainhouse, Lawrence F Eichenfield. (2003) Long-term safety of tacrolimus ointment in children treated for atopic dermatitis. Expert Opinion on Drug Safety 2:5, 457-465
CrossRef123
Yasuko Kobayashi, Hirokazu Arakawa, Michiko Suzuki, Takumi Takizawa, Kenichi Tokuyama, Akihiro Morikawa. (2003) Polymorphisms of interleukin-4—related genes in Japanese children with minimal change nephrotic syndrome. American Journal of Kidney Diseases 42:2, 271-276
CrossRef124
B. Beghe, S. Barton, S. Rorke, Q. Peng, I. Sayers, T. Gaunt, T. P. Keith, J. B. Clough, S. T. Holgate, J. W. Holloway. (2003) Polymorphisms in the interleukin-4 and interleukin-4 receptor alpha chain genes confer susceptibility to asthma and atopy in a Caucasian population. Clinical <html_ent glyph="@amp;" ascii="&"/> Experimental Allergy 33:8, 1111-1117
CrossRef125
Martin Raithel, Harald Dormann, Igor A. Harsch, Sandra Winterkamp, Michael Weidenhiller, Bernhard Fischer, Eckhart Georg Hahn, Thomas Schneider. (2003) Immunoglobulin E production in chronic pancreatitis. European Journal of Gastroenterology & Hepatology 15:7, 801-807
CrossRef126
Tianpen Cui, Jianmin Wu, Shixiu Pan, Jungang Xie. (2003) Polymorphisms in the IL-4 and IL-4R [α] Genes and Allergic Asthma. Clinical Chemistry and Laboratory Medicine 41:7, 888-892
CrossRef127
Tae-Youn Jun, Kyoung-Uk Lee, Chi-Un Pae, Jeong-Ho Chae, Won-Myong Bahk, Kwang-Soo Kim, Hoon Han. (2003) Polymorphisms of interleukin-4 promoter and receptor gene for schizophrenia in the Korean population. Psychiatry and Clinical Neurosciences 57:3, 283-288
CrossRef128
Teck-Hiong Loh, Gil Yosipovitch, Yong-Kwang Tay. (2003) Palmar-Plantar Keratoderma of Unna Thost Associated with Atopic Dermatitis: An Underrecognized Entity?. Pediatric Dermatology 20:3, 195-198
CrossRef129
A. Kato, K. Fukai, N. Oiso, N. Hosomi, T. Murakami, M. Ishii. (2003) Association of SPINK5 gene polymorphisms with atopic dermatitis in the Japanese population. British Journal of Dermatology 148:4, 665-669
CrossRef130
G. J. Laundy, J. L. Bidwell. (2003) Human cytokine gene nucleotide sequence alignments: interleukin 4 receptor alpha chain (IL4RA), IL5RA, IL8, IL8RB and IL13. European Journal of Immunogenetics 30:1, 13-87
CrossRef131
H. Kluken, T. Wienker, T. Bieber. (2003) Atopic eczema/dermatitis syndrome - a genetically complex disease. New advances in discovering the genetic contribution. Allergy 58:1, 5-12
CrossRef132
Kazuki Santa, Kenji Watanabe, Tsutomu Nakada, Hiroyuki Kato, Sonoko Habu, Shunichiro Kubota. (2003) Enhanced expression of B7.2 (CD86) by percutaneous sensitization with house dust mite antigen. Immunology Letters 85:1, 5-12
CrossRef133
Sylvia M Miescher, Monique Vogel. (2002) Molecular aspects of allergy. Molecular Aspects of Medicine 23:6, 413-462
CrossRef134
Sabine Hoffjan, Carole Ober. (2002) Present status on the genetic studies of asthma. Current Opinion in Immunology 14:6, 709-717
CrossRef135
Urs-A Meyer, Josef Gut. (2002) Genomics and the prediction of xenobiotic toxicity. Toxicology 181-182, 463-466
CrossRef136
James J-C Chin. (2002) Revisiting the “hygiene hypothesis” in gastrointestinal allergy. Current Opinion in Gastroenterology 18:6, 705-710
CrossRef137
Yuichiro Tsunemi, Hidehisa Saeki, Koichiro Nakamura, Takashi Sekiya, Koichi Hirai, Hideki Fujita, Noriko Asano, Megumi Kishimoto, Yuka Tanida, Takashi Kakinuma, Hiroshi Mitsui, Yayoi Tada, Motoshi Wakugawa, Hideshi Torii, Mayumi Komine, Akihiko Asahina, Kunihiko Tamaki. (2002) Interleukin-12 p40 gene (IL12B) 3′-untranslated region polymorphism is associated with susceptibility to atopic dermatitis and psoriasis vulgaris. Journal of Dermatological Science 30:2, 161-166
CrossRef138
Stephanie A Shore, Paul E Moore. (2002) Effects of cytokines on contractile and dilator responses of airway smooth muscle. Clinical and Experimental Pharmacology and Physiology 29:10, 859-866
CrossRef139
K. I. Mujica-Lopez, S. E. Flores-Martinez, R. Ramos-Zepeda, S. A. Castaneda-Ramos, A. Gazca-Aguilar, J. Garcia-Perez, J. Sanchez-Corona. (2002) Association analysis of polymorphisms in the interleukin-4 receptor (alpha) gene with atopic asthma in patients from western Mexico. European Journal of Immunogenetics 29:5, 375-378
CrossRef140
Jacob Bryan Blumenthal, Malcolm N Blumenthal. (2002) Genetics of asthma. Medical Clinics of North America 86:5, 937-950
CrossRef141
Yuichiro Tsunemi, Hidehisa Saeki, Koichiro Nakamura, Takashi Sekiya, Koichi Hirai, Hideki Fujita, Noriko Asano, Yuka Tanida, Takashi Kakinuma, Motoshi Wakugawa, Hideshi Torii, Kunihiko Tamaki. (2002) Eotaxin gene single nucleotide polymorphisms in the promoter and exon regions are not associated with susceptibility to atopic dermatitis, but two of them in the promoter region are associated with serum IgE levels in patients with atopic dermatitis. Journal of Dermatological Science 29:3, 222-228
CrossRef142
A. Haagerup, T. Bjerke, P. O. Schiotz, H. G. Binderup, R. Dahl, T. A. Kruse. (2002) Asthma and atopy - a total genome scan for susceptibility genes. Allergy 57:8, 680-686
CrossRef143
N. Bottini, X.-Q. Mao, P. Borgiani, P. Saccucci, L. Stefanini, E. Greco, L. Fontana, T. Shirakawa, J. M. Hopkin. (2002) Low molecular weight PTP-IL-4RA interaction in atopy predisposition. Allergy 57:s72, 10-12
CrossRef144
C. Soderhall, M. Bradley, I. Kockum, H. Luthman, C.-F. Wahlgren, M. Nordenskjold. (2002) Analysis of association and linkage for the interleukin-4 and interleukin-4 receptor balpha; regions in Swedish atopic dermatitis families. Clinical <html_ent glyph="@amp;" ascii="&"/> Experimental Allergy 32:8, 1199-1202
CrossRef145
R. E. Callard, R. Hamvas, C. Chatterton, C. Blanco, M. Pembrey, R. Jones, A. Sherriff, J. Henderson, . (2002) An interaction between the IL-4Ralpha gene and infection is associated with atopic eczema in young children. Clinical <html_ent glyph="@amp;" ascii="&"/> Experimental Allergy 32:7, 990-993
CrossRef146
St
CrossRef147
M. Wjst, S. Kruse, T. Illig, K. Deichmann. (2002) Asthma and IL-4 receptor alpha gene variants. European Journal of Immunogenetics 29:3, 263-268
CrossRef148
Alan P Knutsen, Clifford Bellone, Henk Kauffman. (2002) Immunopathogenesis of allergic bronchopulmonary aspergillosis in cystic fibrosis. Journal of Cystic Fibrosis 1:2, 76-89
CrossRef149
Masako Toda, Santa Jeremy Ono. (2002) Genomics and proteomics of allergic disease. Immunology 106:1, 1-10
CrossRef150
Laurie A. Whittaker, Lauren Cohn. (2002) Recent Concepts in the Pathogenesis and Treatment of Asthma. Clinical Pulmonary Medicine 9:3, 135-144
CrossRef151
Keiko Tanaka, Mark H. Roberts, Naoko Yamamoto, Hisashi Sugiura, Masami Uehara, Xiao-Quan Mao, Taro Shirakawa, Julian M. Hopkin. (2002) Genetic Variants of the Receptors for Thromboxane A2 and IL-4 in Atopic Dermatitis. Biochemical and Biophysical Research Communications 292:3, 776-780
CrossRef152
N Bottini, P Borgiani, A Otsu, P Saccucci, L Stefanini, E Greco, L Fontana, JM Hopkin, X-Q Mao, T Shirakawa. (2002) IL-4 receptor alpha chain genetic polymorphism and total IgE levels in the English population: two-locus haplotypes are more informative than individual SNPs. Clinical Genetics 61:4, 288-292
CrossRef153
Malcolm M. Blumenthal. (2002) What we know about the genetics of asthma at the beginning of the 21st century. Clinical Reviews in Allergy & Immunology 22:1, 11-31
CrossRef154
Lee Maddox, David A. Schwartz. (2002) T
HE PATHOPHYSIOLOGY OF ASTHMA . Annual Review of Medicine 53:1, 477-498
CrossRef155
Timothy D. Howard, Gerard H. Koppelman, Jianfeng Xu, Siqun L. Zheng, Dirkje S. Postma, Deborah A. Meyers, Eugene R. Bleecker. (2002) Gene-Gene Interaction in Asthma: IL4RA and IL13 in a Dutch Population with Asthma. The American Journal of Human Genetics 70:1, 230-236
CrossRef156
Ann K. Daly, Christopher P. Day, Peter T. Donaldson. (2002) Polymorphisms in Immunoregulatory Genes. American Journal of PharmacoGenomics 2:1, 13-23
CrossRef157
Hakon Hakonarson, Eva Halapi. (2002) Genetic Analyses in Asthma. American Journal of PharmacoGenomics 2:3, 155-166
CrossRef158
M BOGUNIEWICZ, D LEUNG. (2001) Pathophysiologic mechanisms in atopic dermatitis&. Seminars in Cutaneous Medicine and Surgery 20:4, 217-225
CrossRef159
Ann K. Daly, Christopher P. Day. (2001) Candidate gene case-control association studies: advantages and potential pitfalls. British Journal of Clinical Pharmacology 52:5, 489-499
CrossRef160
Andrea Heinzmann, Klaus A. Deichmann. (2001) Genes for atopy and asthma. Current Opinion in Allergy and Clinical Immunology 1:5, 387-392
CrossRef161
K. Tanaka, H. Sugiura, M. Uehara, Y. Hashimoto, C. Donnelly, D. S. Montgomery. (2001) Lack of association between atopic eczema and the genetic variants of interleukin-4 and the interleukin-4 receptor alpha chain gene: heterogeneity of genetic backgrounds on immunoglobulin E production in atopic eczema patients. Clinical <html_ent glyph="@amp;" ascii="&"/> Experimental Allergy 31:10, 1522-1527
CrossRef162
K. Tamura, H. Arakawa, M. Suzuki, Y. Kobayashi, H. Mochizuki, M. Kato, K. Tokuyama, A. Morikawa. (2001) Novel dinucleotide repeat polymorphism in the first exon of the STAT-6 gene is associated with allergic diseases. Clinical <html_ent glyph="@amp;" ascii="&"/> Experimental Allergy 31:10, 1509-1514
CrossRef163
Paula Kauppi, Kerstin Lindblad-Toh, Petteri Sevon, Hannu T.T. Toivonen, John D. Rioux, Anu Villapakkam, Lauri A. Laitinen, Thomas J. Hudson, Juha Kere, Tarja Laitinen. (2001) A Second-Generation Association Study of the 5q31 Cytokine Gene Cluster and the Interleukin-4 Receptor in Asthma. Genomics 77:1-2, 35-42
CrossRef164
Amy B. Hahn, Jane C. Kasten-Jolly, Don M. Constantino, Eileen Graffunder, T. Paul Singh, Gary K. Shen, David J. Conti. (2001) TNF-??, IL-6, IFN-??, AND IL-10 GENE EXPRESSION POLYMORPHISMS AND THE IL-4 RECEPTOR ??-CHAIN VARIANT Q576R: EFFECTS ON RENAL ALLOGRAFT OUTCOME. Transplantation 72:4, 660-665
CrossRef165
N. Kondo, E. Matsui, H. Kaneko, T. Fukao, T. Teramoto, R. Inoue, M. Watanabe, M. Aoki, K. Kasahara, N. Morimoto. (2001) Atopy and mutations of IL-12 receptor beta2 chain gene. Clinical <html_ent glyph="@amp;" ascii="&"/> Experimental Allergy 31:8, 1189-1193
CrossRef166
A. Haagerup, T. Bjerke, P. O. Schiotz, R. Dahl, H. G. Binderup, T. A. Kruse. (2001) No linkage and association of atopy to chromosome 16 including the interleukin-4 receptor gene. Allergy 56:8, 775-779
CrossRef167
V. Magnusson, B. Nakken, A. I. Bolstad, M. E. Alarcon-Riquelme. (2001) Cytokine Polymorphisms in Systemic Lupus Erythematosus and Sjogren's Syndrome. Scandinavian Journal of Immunology 54:1-2, 55-61
CrossRef168
Hakon Hakonarson, Matthias Wjst. (2001) Current concepts on the genetics of asthma. Current Opinion in Pediatrics 13:3, 267-277
CrossRef169
C.C. Banfield, R.E. Callard, J.I. Harper. (2001) The role of cutaneous dendritic cells in the immunopathogenesis of atopic dermatitis. British Journal of Dermatology 144:5, 940-946
CrossRef170
M. Benson, M. Adner, L. O. Cardell. (2001) Cytokines and cytokine receptors in allergic rhinitis: how do they relate to the Th2 hypothesis in allergy?. Clinical <html_ent glyph="@amp;" ascii="&"/> Experimental Allergy 31:3, 361-367
CrossRef171
Chandri N. Yandava, George T. De Sanctis. (2001) The Genetics of Asthma. Clinical Pulmonary Medicine 8:2, 59-65
CrossRef172
Weiping Zhang, Jianli Wang, Quanxing Wang, Guoyou Chen, Jia Zhang, Taoyong Chen, Tao Wan, Yi Zhang, Xuetao Cao. (2001) Identification of a Novel Type I Cytokine Receptor CRL2 Preferentially Expressed by Human Dendritic Cells and Activated Monocytes. Biochemical and Biophysical Research Communications 281:4, 878-883
CrossRef173
Holger Hackstein, Andreas Bitsch, Anette Bohnert, Henrike Hofmann, Frank Weber, Astrid Ohly, Chris Linington, Matthias Mäurer, Sigrid Poser, Peter Rieckmann, Gregor Bein. (2001) Analysis of interleukin-4 receptor α chain variants in multiple sclerosis. Journal of Neuroimmunology 113:2, 240-248
CrossRef174
Debra L. Winterton, Joel Kaufman, Cassie V. Keener, Sean Quigley, Fred M. Farin, Paul V. Williams, Jane Q. Koenig. (2001) Genetic polymorphisms as biomarkers of sensitivity to inhaled sulfur dioxide in subjects with asthma. Annals of Allergy, Asthma & Immunology 86:2, 232-238
CrossRef175
B.K. Park, D.J. Naisbitt, S.F. Gordon, N.R. Kitteringham, M. Pirmohamed. (2001) Metabolic activation in drug allergies. Toxicology 158:1-2, 11-23
CrossRef176
Sue Yun Hwang, Seung Hoon Kim, Sung Hee Hwang, Chul Soo Cho, Ho Youn Kim. (2001) Detection of single nucleotide polymorphism in human IL‐4 receptor by PCR amplification of specific alleles. Korean Journal of Biological Sciences 5:2, 153-156
CrossRef177
Uday Nanavaty, Adam D. Goldstein, Stewart J. Levine. (2001) Polymorphisms in Candidate Asthma Genes. The American Journal of the Medical Sciences 321:1, 11-16
CrossRef178
Emiko Noguchi, Tadao Arinami. (2001) Candidate Genes for Atopic Asthma. American Journal of PharmacoGenomics 1:4, 251-261
CrossRef179
Saveria Pastore, Maria Laura Giustizieri, Francesca Mascia, Alberto Giannetti, Kenneth Kaushansky, Giampiero Girolomoni. (2000) Dysregulated Activation of Activator Protein 1 in Keratinocytes of Atopic Dermatitis Patients with Enhanced Expression of Granulocyte/Macrophage-Colony Stimulating Factor. Journal of Investigative Dermatology 115:6, 1134-1143
CrossRef180
Hans C Oettgen. (2000) Regulation of the IgE isotype switch: new insights on cytokine signals and the functions of ε germline transcripts. Current Opinion in Immunology 12:6, 618-623
CrossRef181
P.-S. Gao, X.-Q. Mao, J. M. Hopkin, C. N. Adra, X. Yang, T. Shirakawa. (2000) Functional significance of polymorphisms of the interleukin-4 and interleukin-13 receptors in allergic disease. Clinical <html_ent glyph="@amp;" ascii="&"/> Experimental Allergy 30:12, 1672-1675
CrossRef182
Sumit Bhattacharyya, Nicholas I. Leaves, Steven Wiltshire, Roger Cox, William O.C.M. Cookson. (2000) A High-Density Genetic Map of the Chromosome 13q14 Atopy Locus. Genomics 70:3, 286-291
CrossRef183
Jack Green, Rodney D Sinclair. (2000) Genetics of alopecia areata. Australasian Journal of Dermatology 41:4, 213-218
CrossRef184
Sara E. Marshall, Andrew J. McLaren, Neil A. Haldar, Mike Bunce, Peter J. Morris, Ken I. Welsh. (2000) THE IMPACT OF RECIPIENT CYTOKINE GENOTYPE ON ACUTE REJECTION AFTER RENAL TRANSPLANTATION. Transplantation 70:10, 1485-1491
CrossRef185
B.Kevin Park, Neil R. Kitteringham, Helen Powell, Munir Pirmohamed. (2000) Advances in molecular toxicology–towards understanding idiosyncratic drug toxicity. Toxicology 153:1-3, 39-60
CrossRef186
Simon H. Murch. (2000) The immunologic basis for intestinal food allergy. Current Opinion in Gastroenterology 16:6, 552-557
CrossRef187
E. Noguchi, M. Shibasaki, T. Arinami, K. Yamakawa-Kobayashi, Y. Yokouchi, K. Takeda, A. Matsui, H. Hamaguchi. (2000) Mutation screening of interferon regulatory factor 1 gene (IRF-1) as a candidate gene for atopy/asthma. Clinical <html_ent glyph="@amp;" ascii="&"/> Experimental Allergy 30:11, 1563-1567
CrossRef188
A. Wollenberg, S. Kraft, T. Oppel, T. Bieber. (2000) Atopic dermatitis: pathogenetic mechanisms. Clinical and Experimental Dermatology 25:7, 530-534
CrossRef189
K. C. Barnes. (2000) Atopy and asthma genes - where do we stand?. Allergy 55:9, 803-817
CrossRef190
Michel D. S. Erlewyn-Lajeunesse. (2000) Hyperimmunoglobulin-E syndrome with recurrent infection: A review of current opinion and treatment. Pediatric Allergy and Immunology 11:3, 133-141
CrossRef191
(2000) Atopy and a Mutation in the Interleukin-4 Receptor Gene. New England Journal of Medicine 343:1, 69-70
Full Text192
Andrew J. Sandford, Tabassum Chagani, Shoukang Zhu, Tracey D. Weir, Tony R. Bai, John J. Spinelli, J.Mark FitzGerald, Nasser A. Behbehani, Wan C. Tan, Peter D. Paré. (2000) Polymorphisms in the IL4, IL4RA, and FCERIB genes and asthma severity. Journal of Allergy and Clinical Immunology 106:1, 135-140
CrossRef193
Carole Ober, Miriam F. Moffatt. (2000) CONTRIBUTING FACTORS TO THE PATHOBIOLOGY. Clinics in Chest Medicine 21:2, 245-261
CrossRef194
Annette M. Colavita, Alan J. Reinach, Stephen P. Peters. (2000) CONTRIBUTING FACTORS TO THE PATHOBIOLOGY OF ASTHMA. Clinics in Chest Medicine 21:2, 263-277
CrossRef195
N. Oiso, K. Fukai, M. Ishii. (2000) Interleukin 4 receptor α chain polymorphism Gln551Arg is associated with adult atopic dermatitis in Japan. British Journal of Dermatology 142:5, 1003-1006
CrossRef196
A. Wolkerstorfer, A. P. Oranje. (2000) Preventie van atopisch eczeem. Tijdschrift voor kindergeneeskunde 68:2, 179-182
CrossRef197
Kenneth M. Murphy, Wenjun Ouyang, J. David Farrar, Jianfei Yang, Sheila Ranganath, Helene Asnagli, Maryam Afkarian, Theresa L. Murphy. (2000) Signaling and Transcription in T Helper Development. Annual Review of Immunology 18:1, 451-494
CrossRef198
Santa Jeremy Ono. (2000) Molecular Genetics of Allergic Diseases. Annual Review of Immunology 18:1, 347-366
CrossRef199
Stéphane Chavanas, Chad Garner, Christine Bodemer, Mohsin Ali, Dominique Hamel- Teillac, John Wilkinson, Jean-Louis Bonafé, Mauro Paradisi, David P. Kelsell, Shin-ichi Ansai, Yoshihiko Mitsuhashi, Marc Larrègue, Irene M. Leigh, John I. Harper, Alain Taïeb, Yves de Prost, Lon R. Cardon, Alain Hovnanian. (2000) Localization of the Netherton Syndrome Gene to Chromosome 5q32, by Linkage Analysis and Homozygosity Mapping. The American Journal of Human Genetics 66:3, 914-921
CrossRef200
A. Wollenberg, T. Bieber. (2000) Atopic dermatitis: from the genes to skin lesions. Allergy 55:3, 205-213
CrossRef201
Leonard B. Bacharier, Raif S. Geha. (2000) Molecular mechanisms of IgE regulation. Journal of Allergy and Clinical Immunology 105:2, S547-S558
CrossRef202
Timothy D. Howard, Deborah A. Meyers, Eugene R. Bleecker. (2000) Mapping susceptibility genes for asthma and allergy. Journal of Allergy and Clinical Immunology 105:2, S477-S481
CrossRef203
Carole Ober, Stephanie A. Leavitt, Anya Tsalenko, Timothy D. Howard, Danessa M. Hoki, Rajeev Daniel, Dina L. Newman, Xiaodong Wu, Rodney Parry, Lucille A. Lester, Julian Solway, Malcolm Blumenthal, Richard A. King, Jianfeng Xu, Deborah A. Meyers, Eugene R. Bleecker, Nancy J. Cox. (2000) Variation in the Interleukin 4–Receptor α Gene Confers Susceptibility to Asthma and Atopy in Ethnically Diverse Populations. The American Journal of Human Genetics 66:2, 517-526
CrossRef204
Ivo P Touw, John P De Koning, Alister C Ward, Mirjam H.A Hermans. (2000) Signaling mechanisms of cytokine receptors and their perturbances in disease. Molecular and Cellular Endocrinology 160:1-2, 1-9
CrossRef205
SHARON K. REIMSNIDER, SARAH E. ECKENRODE, MICHELE P. MARRON, ANDREW MUIR, JIN-XIONG SHE. (2000) IL4 and IL4R ?? Genes Are Not Linked or Associated with Type 1 Diabetes. Pediatric Research 47:2, 246
CrossRef206
P. Vabres, M. Larrègue. (2000) Génétique de la dermatite atopique. Revue Française d'Allergologie et d'Immunologie Clinique 40:1, 60-64
CrossRef207
André Gessner, Martin Röllinghoff. (2000) Biologic Functions and Signaling of the Interleukin-4 Receptor Complexes. Immunobiology 201:3-4, 285-307
CrossRef208
Ghaffar, Christodoulopoulos, Lamkhioued, Wright, Ihaku, Nakamura, Frenkiel, Hamid. (2000) In vivo expression of signal transducer and activator of transcription factor 6 (STAT6) in nasal mucosa from atopic allergic rhinitis: effect of topical corticosteroids. Clinical <html_ent glyph="@amp;" ascii="&"/> Experimental Allergy 30:1, 86-93
CrossRef209
Elisabeth Geiger, Roland Magerstaedt, Jörg H.M. Weßendorf, Stefan Kraft, Daniel Hanau, Thomas Bieber. (2000) IL-4 induces the intracellular expression of the α chain of the high-affinity receptor for IgE in in vitro-generated dendritic cells. Journal of Allergy and Clinical Immunology 105:1, 150-156
CrossRef210
S. Louis Bridges. (1999) The genetics of rheumatoid arthritis: Influences on susceptibility, severity, and treatment response. Current Rheumatology Reports 1:2, 164-171
CrossRef211
Ping-Ying Pan, Paul Rothman. (1999) IL-4 receptor mutations. Current Opinion in Immunology 11:6, 615-620
CrossRef212
H Hackstein, H Hofmann, A Bohnert, G Bein. (1999) Definition of human interleukin-4 receptor alpha chain haplotypes and allelic association with atopy markers. Human Immunology 60:11, 1119-1127
CrossRef213
H. Hackstein, H. Klüter, L. Fricke, J. Hoyer, G. Bein. (1999) The IL-4 receptor α-chain variant Q576R is strongly associated with decreased kidney allograft survival. Tissue Antigens 54:5, 471-477
CrossRef214
Hans C. Oettgen, Raif S. Geha. (1999) IgE in asthma and atopy: cellular and molecular connections. Journal of Clinical Investigation 104:7, 829-835
CrossRef215
Ec Tan, Bw Lee, Awn Tay, L Shek, Ft Chew, Ahn Tay. (1999) Interleukin-4 receptor variant Q576R: ethnic differences and association with atopy. Clinical Genetics 56:4, 333-334
CrossRef216
J.‐F. Magnaval, D. Duffy. (1999) Genetic studies on atopy and helminthiasis. Allergy 54:10, 1120-1121
CrossRef217
Sandeep K. Agarwal, Gailen D. Marshall†. (1999) Perimenstrual alterations in type-1/type-2 cytokine balance of normal women. Annals of Allergy, Asthma & Immunology 83:3, 222-228
CrossRef218
B GRIMBACHER, A SCHAFFER, S HOLLAND, J DAVIS, J GALLIN, H MALECH, T ATKINSON, B BELOHRADSKY, R BUCKLEY, F COSSU. (1999) Genetic Linkage of Hyper-IgE Syndrome to Chromosome 4. The American Journal of Human Genetics 65:3, 735-744
CrossRef219
E.C. Tan*, B.W. Lee, F.T. Chew, L. Shek, A.W.N. Tay, A.H.N. Tay. (1999) IL-4Ralpha gene Ile50Val polymorphism. Allergy 54:9, 1005-1007
CrossRef220
Nicholas A. Cacalano, James A. Johnston. (1999) Interleukin-2 Signaling and Inherited Immunodeficiency. The American Journal of Human Genetics 65:2, 287-293
CrossRef221
Holloway, Beghe, Holgate. (1999) The genetic basis of atopic asthma. Clinical <html_ent glyph="@amp;" ascii="&"/> Experimental Allergy 29:8, 1023-1032
CrossRef222
JUNG, MOESSNER, DIECKHOFF, HEIDRICH, NEUMANN. (1999) Mechanisms of deficient interferon-gamma production in atopic diseases. Clinical <html_ent glyph="@amp;" ascii="&"/> Experimental Allergy 29:7, 912-919
CrossRef223
Andrew R. Mkenzie-Wood, Susanne Freeman. (1999) Unclassified endogenous eczema. Contact Dermatitis 41:1, 18-21
CrossRef224
Yukiyoshi Yanagihara. (1999) Molecular regulation of human IgE synthesis. Allergology International 48:2, 111-119
CrossRef225
Deepak Sampath, Mario Castro, Dwight C. Look, Michael J. Holtzman. (1999) Constitutive activation of an epithelial signal transducer and activator of transcription (STAT) pathway in asthma. Journal of Clinical Investigation 103:9, 1353-1361
CrossRef226
Larry Borish. (1999) Genetics of allergy and asthma. Annals of Allergy, Asthma & Immunology 82:5, 413-426
CrossRef227
Keats Nelms, Achsah D. Keegan, José Zamorano, John J. Ryan, William E. Paul. (1999) THE IL-4 RECEPTOR: Signaling Mechanisms and Biologic Functions. Annual Review of Immunology 17:1, 701-738
CrossRef228
Michael F McDermott, Ivona Aksentijevich, Jérôme Galon, Elizabeth M McDermott, B.William Ogunkolade, Michael Centola, Elizabeth Mansfield, Massimo Gadina, Leena Karenko, Tom Pettersson, John McCarthy, David M Frucht, Martin Aringer, Yelizaveta Torosyan, Anna-Maija Teppo, Meredith Wilson, H.Mehmet Karaarslan, Ying Wan, Ian Todd, Geryl Wood, Ryan Schlimgen, Thisum R Kumarajeewa, Sheldon M Cooper, John P Vella, Christopher I Amos, John Mulley, Kathleen A Quane, Michael G Molloy, Annamari Ranki, Richard J Powell, Graham A Hitman, John J O’Shea, Daniel L Kastner. (1999) Germline Mutations in the Extracellular Domains of the 55 kDa TNF Receptor, TNFR1, Define a Family of Dominantly Inherited Autoinflammatory Syndromes. Cell 97:1, 133-144
CrossRef229
Marsha Wills-Karp. (1999) IMMUNOLOGIC BASIS OF ANTIGEN-INDUCED AIRWAY HYPERRESPONSIVENESS. Annual Review of Immunology 17:1, 255-281
CrossRef230
Grimbacher, Bodo, Holland, Steven M., Gallin, John I., Greenberg, Frank, Hill, Suvimol C., Malech, Harry L., Miller, Judith A., O'Connell, Anne C., Puck, Jennifer M., . (1999) Hyper-IgE Syndrome with Recurrent Infections — An Autosomal Dominant Multisystem Disorder. New England Journal of Medicine 340:9, 692-702
Full Text231
KRUSE, JAPHA, TEDNER, SPARHOLT, FORSTER, KUEHR, DEICHMANN. (1999) The polymorphisms S503P and Q576R in the interleukin-4 receptor alpha gene are associated with atopy and influence the signal transduction. Immunology 96:3, 365-371
CrossRef232
Yojiro Arinobu, Sergei P. Atamas, Takeshi Otsuka, Hiroaki Niiro, Kunihiro Yamaoka, Hiromichi Mitsuyasu, Yoshiyuki Niho, Naotaka Hamasaki, Barbara White, Kenji Izuhara. (1999) Antagonistic Effects of an Alternative Splice Variant of Human IL-4, IL-4δ2, on IL-4 Activities in Human Monocytes and B Cells. Cellular Immunology 191:2, 161-167
CrossRef233
Olivier Garraud, Stacey N. Mollis, Steven M. Holland, Michael C. Sneller, Harry L. Malech, John I. Gallin, Thomas B. Nutman. (1999) Regulation of immunoglobulin production in hyper-IgE (Job’s) syndrome. Journal of Allergy and Clinical Immunology 103:2, 333-340
CrossRef234
Noguchi, Shibasaki, Arinami, Takeda, Yokouchi, Kobayashi, Imoto, Nakahara, Matsui, Hamaguchi. (1999) Lack of association of atopy/asthma and the interleukin-4 receptor alpha gene in Japanese. Clinical <html_ent glyph="@amp;" ascii="&"/> Experimental Allergy 29:2, 228-233
CrossRef235
Hajime Nakahama, Kyoko Obata, Taisuke Nakajima, Hitoshi Nakamura, Osamu Kitada, Minoru Sugita, Yoshimasa Fujita, Noritaka Kawada, Toshiki Moriyama. (1999) Renin-Angiotensin System Component Gene Polymorphism in Japanese Bronchial Asthma Patients. Journal of Asthma 36:2, 187-193
CrossRef236
Mary F. Lipscomb, Julie A. Wilder. (1999) Immune dysregulation as a cause for allergic asthma. Current Opinion in Pulmonary Medicine 5:1, 10
CrossRef237
Sang-Cheol Bae, Patricia Fraser, Matthew H. Liang. (1998) The epidemiology of systemic lupus erythematosus in populations of African ancestry: A critical review of the ?prevalence gradient hypothesis?. Arthritis & Rheumatism 41:12, 2091-2099
CrossRef238
John Bell. (1998) Medical implications of understanding complex disease traits. Current Opinion in Biotechnology 9:6, 573-577
CrossRef239
Anthony D Whetton, Elaine Spooncer. (1998) Role of cytokines and extracellular matrix in the regulation of haemopoietic stem cells. Current Opinion in Cell Biology 10:6, 721-726
CrossRef240
Rosenwasser, Borish. (1998) Promoter polymorphisms predisposing to the development of asthma and atopy. Clinical <html_ent glyph="@amp;" ascii="&"/> Experimental Allergy 28:Suppl. 5, 13-15
CrossRef241
Hall. (1998) Genetic factors in asthma severity. Clinical <html_ent glyph="@amp;" ascii="&"/> Experimental Allergy 28:Suppl. 5, 16-20
CrossRef242
Martinez. (1998) Gene by environment interactions in the development of asthma. Clinical <html_ent glyph="@amp;" ascii="&"/> Experimental Allergy 28:Suppl. 5, 21-25
CrossRef243
L. J. Rosenwasser. (1998) The genetics of atopy. Allergy 53, 8-11
CrossRef244
S. Rotmagnani. (1998) The Th1/Th2 paradigm and allergic disorders. Allergy 53, 12-15
CrossRef245
Bullens, Kasran, Peng, LorrE, Ceuppens. (1998) Effects of anti-IL-4 receptor monoclonal antibody on in vitro T cell cytokine levels: IL-4 production by T cells from non-atopic donors. Clinical and Experimental Immunology 113:3, 320-326
CrossRef246
W. O. C. M. Cookson. (1998) Genetic aspects of atopic allergy. Allergy 53, 9-14
CrossRef247
R M Ten. (1998) Primary immunodeficiencies.. Mayo Clinic Proceedings 73:9, 865-872
CrossRef248
J. D. Bos, E. J. M. Leent, J. H. Sillevis Smitt. (1998) The millennium criteria for the diagnosis of atopic dermatitis. Experimental Dermatology 7:4, 132-138
CrossRef249
Alan P. Knutsen, Bela Chauhan, Raymond G. Slavin. (1998) CELL-MEDIATED IMMUNITY IN ALLERGIC BRONCHOPULMONARY ASPERGILLOSIS. Immunology and Allergy Clinics of North America 18:3, 575-599
CrossRef250
Altshuler, David, Kruglyak, Leonid, Lander, Eric, . (1998) Genetic Polymorphisms and Disease. New England Journal of Medicine 338:22, 1626-1626
Full Text251
Juan J Lafaille. (1998) The Role of Helper T Cell Subsets in Autoimmune Diseases. Cytokine & Growth Factor Reviews 9:2, 139-151
CrossRef252
(1998) The Interleukin-4 Receptor Variant Q576R in Hyper-IgE Syndrome. New England Journal of Medicine 338:15, 1073-1074
Full Text253
KLAUS A. DEICHMANN, NICOLE JUSTIES, SUSANNE KRUSE, JOHANNES FORSTER, JOACHIM KUEHR. (1998) A Common Polymorphism in the Coding Part of the CD19 Gene Is Not Associated with Atopy. Pediatric Asthma, Allergy & Immunology 12:2, 123-127
CrossRef254
Rosenwasser, Lanny J., . (1997) Interleukin-4 and the Genetics of Atopy. New England Journal of Medicine 337:24, 1766-1767
Full Text
- Letters
