Original Article
Clonality in Nodular Lymphocyte-Predominant Hodgkin's Disease
N Engl J Med 1997; 337:459-466August 14, 1997
- Abstract
Background
There is general agreement that lymphocytic and histiocytic (L&H) cells, the variants of Reed–Sternberg cells in nodular lymphocyte-predominant Hodgkin's disease, belong to the B-cell lineage. However, the clonality of L&H cells remains controversial.
Methods
We used complementarity-determining region 3 (CDR3) of the immunoglobulin heavy-chain gene as a clonal marker to study individual L&H cells isolated by micromanipulation from tissue sections of five patients with nodular lymphocyte-predominant Hodgkin's disease. The heavy-chain CDR3 of each cell was amplified by the polymerase chain reaction. The products were analyzed by gel electrophoresis, and representative amplification products from each patient were sequenced.
Results
L&H cells whose heavy-chain CDR3 was related, indicating the presence of a clonal population, were detected in all five patients and were the dominant population in three. In four of the five patients, members of the clone were found in different nodules in the tissue section, different tissue blocks from the same tumor, or different lymph nodes from the same patient. The CDR3 sequences in each clone frequently contained nucleotide substitutions indicative of intraclonal mutation.
Conclusions
Clonal populations of L&H cells occur in nodular lymphocyte-predominant Hodgkin's disease. Intraclonal variation in nucleotide sequences suggests that hypermutation of the heavy-chain CDR3 continues to occur among the clonal progeny.
Media in This Article
Figure 1
Results of Polyacrylamide-Gel Electrophoresis of the Heavy-Chain CDR3 PCR Products from Each of the Single L&H Cells from Patient 2.Figure 2
Results of Polyacrylamide-Gel Electrophoresis of the Heavy-Chain CDR3 PCR Products from the Single L&H Cells from Patient 4 That Had Related Sequences.Article Activity
- Article
Nodular lymphocyte-predominant Hodgkin's disease, a subtype of Hodgkin's disease, is an indolent disorder in which tumors contain a variant of Reed–Sternberg cells known as lymphocytic and histiocytic (L&H) cells, which are admixed with small lymphocytes and histiocytes in nodular aggregates.1-4 Immunohistochemical studies have provided strong evidence that these L&H cells originate from B cells,5-9 but whether they represent monoclonal or polyclonal populations remains unclear.
Studies of immunoglobulin-gene rearrangement as a clonal marker in nodular lymphocyte-predominant Hodgkin's disease have yielded conflicting results.10-18 To resolve the controversy, investigators have isolated single L&H cells and studied them by the polymerase chain reaction (PCR) for rearrangements of the genes for the immunoglobulin heavy chain, the light chain, or both.19,20 Küppers et al.19 reported a clonal population of L&H cells in a patient with nodular lymphocyte-predominant Hodgkin's disease, whereas Delabie et al.20 did not detect such populations in two patients they studied. It is unclear whether case selection or technical factors, such as sampling bias, account for these discordant findings. We performed single-cell analysis of five patients with nodular lymphocyte-predominant Hodgkin's disease; different nodules in the tumor and, when available, different tissue blocks and lymph nodes were sampled. We found a clonal population in each of the five patients, and in four the population appeared to be present throughout the tumor.
Methods
Case Selection
We studied seven formalin-fixed, paraffin-embedded specimens of tissue from five patients with nodular lymphocyte-predominant Hodgkin's disease who were selected from the data base of the lymphoma registry at the University of Nebraska Medical Center. All the specimens had the characteristic histopathological features and immunophenotype of the disease. The specimens from Patients 1, 2, 3, and 4 had moderately abundant L&H cells and relatively few small B lymphocytes in the nodules; in the specimen from Patient 5 the nodules contained few L&H cells and numerous small B lymphocytes.
Immunohistochemical Analysis
Tissue sections 4 to 6 μm thick were stained with anti-CD20 or anti-CD3 (Dako, Carpinteria, Calif.) by a three-step immunoperoxidase method.21 Before the staining with anti-CD20, the sections were heated in citrate buffer (pH 6.0) for five minutes in a microwave oven; before the staining with anti-CD3, the sections were digested with pepsin.
Isolation of Single Cells from Tissue Sections
With the use of an inverted microscope (Nikon, New York), the L&H cells stained with anti-CD20 were isolated with a microknife and a micropipette that were fixed to hydraulic micromanipulators (Narishige, New York) and expelled into a tube containing PCR buffer as described by d'Amore et al.22 In addition to the L&H cells, CD20+ small B cells and CD3+ small T cells were isolated by micromanipulation for use as positive and negative controls. The phosphate-buffered saline overlying the section was sampled periodically to serve as the negative control for the supernatant.
PCR Amplification of Single Cells
The heavy-chain CDR3 of each single cell was amplified after digestion with proteinase K by a seminested PCR using consensus VH and JH primers under hot-start conditions.20,23 The details of this procedure and of its use with formalin-fixed archival tissue have been described previously.22 The amplified products were subjected to electrophoresis on 8 percent polyacrylamide gels and visualized with ultraviolet light after staining with ethidium bromide.
DNA Sequencing
For each patient, representative heavy-chain CDR3 PCR products from cells that could be amplified were sequenced to determine their clonal relation. For this purpose, the original CDR3 PCR product was reamplified in a volume of 50 μl with VH and JH nested primers with M13 sequences attached to their 5
ends (sequences, M13+VH, TGTAAAACGACGGCCAGTCTGTCGACACGGCCGTGTATTACTG; M13R+JH, GGAAACAGCTATGACCATGACCAGGGTCCCTTGGCCCCA). The products were gel-purified and directly sequenced with primers to M13 in forward orientation and M13R in reverse orientation and a cycle-sequencing procedure that used fluorescent dideoxynucleotide chain terminators (Applied Biosystems, Foster City, Calif.).24 The sequences were analyzed with a model 373A sequencer (Applied Biosystems).
Results
PCR was performed to amplify the CDR3 of the rearranged heavy-chain genes of the cells isolated from tissues affected by nodular lymphocyte-predominant Hodgkin's disease. The procedure yielded products for 5 to 38 percent of the L&H cells, 25 to 44 percent of the small B cells, and none of 80 T cells (Table 1Table 1
Results of PCR Amplification of Single Cells for Heavy-Chain CDR3.).The results of the analyses of the single cells from each patient are shown in Table 2Table 2
Results of PCR and Sequence Analysis of Single L&H Cells. and Table 3Table 3
Nucleotide Sequences of the Heavy-Chain CDR3 of Single L&H Cells.. For Patient 1, CDR3 PCR products were obtained from 17 of 100 L&H cells in the first tissue block and 13 of 40 L&H cells in the second tissue block (Table 2). PCR products of identical lengths were found in 22 cells from different nodules in the two tissue blocks. Seven of these 22 products, from nodules 1, 2, 3, 5, and 6, were sequenced and found to be identical, indicating that clonal L&H cells were present in different nodules in both tissue blocks from the same tumor. The second tissue block from this patient was studied again after a 12-month interval (Table 2). The same clonal population was again identified, and sequence analysis showed that the sequences were identical to those determined previously.For Patient 2, CDR3 PCR products were obtained from 21 of 90 L&H cells. Two sets of products, each with identical lengths, were detected (Figure 1Figure 1
Results of Polyacrylamide-Gel Electrophoresis of the Heavy-Chain CDR3 PCR Products from Each of the Single L&H Cells from Patient 2.): 2 cells from nodule 2 (lanes 3 and 4) and 13 cells from nodules 1, 2, and 4. Sequence analysis of the two products (lanes 3 and 4, Figure 1) from nodule 2 showed that they were unrelated. Eight of the 13 products from nodules 1, 2, and 4 were sequenced, and all were found to be related; 4 had identical nucleotides, and 4 contained nucleotide substitutions (Table 3). These findings indicated that there was a clonal population of L&H cells with intraclonal mutations in three nodules from the same tumor.For Patient 3, in whom two inguinal lymph nodes were studied, CDR3 PCR products were obtained from 6 of 40 L&H cells from the first lymph node and from 2 of 39 L&H cells from the second. PCR products of identical lengths were found in two cells, one from each lymph node. Sequence analysis showed that the two cells were related, but there were multiple nucleotide substitutions, indicating that a clonal population of L&H cells with intraclonal mutations was present in the two inguinal lymph nodes.
For Patient 4, CDR3 PCR products were obtained from 27 of 72 single L&H cells. PCR products of identical lengths were found in 23 cells from four different nodules. Sequence analysis of eight of the products (two from each nodule) (Figure 2Figure 2
Results of Polyacrylamide-Gel Electrophoresis of the Heavy-Chain CDR3 PCR Products from the Single L&H Cells from Patient 4 That Had Related Sequences.) confirmed the presence of a clonal population with frequent intraclonal mutations in all the nodules. One additional, smaller clone was found in nodule 3 (Figure 2). The sequence of this minor clone (lanes 5 and 6, Figure 2) was related to that of the major clone (typified by cell 8, Table 3). Two additional PCR products from nodule 3 were also identical in size (Table 2), but the sequences were unrelated to each other and to the two related clones found in the same specimen.For Patient 5, CDR3 PCR products were obtained from 20 of 100 L&H cells. Fourteen of the PCR products were classified into three groups in which the products had almost identical lengths (Figure 3Figure 3
Results of Polyacrylamide-Gel Electrophoresis of the Heavy-Chain CDR3 PCR Products from 14 Single L&H Cells from Patient 5.), and all 14 products were sequenced. Only 2 of the 14 PCR products (lanes 1 and 4, Figure 3) had identical sequences (Table 3). All the other sequences appeared unrelated. This patient differed from Patients 1 through 4 in having fewer L&H cells and more abundant small B lymphocytes.Discussion
The detection of B-cell antigens, such as the J-chain, CD19, CD20, and CD79a, was the first indication of the B-cell origin of L&H cells.5-9 However, whether nodular lymphocyte-predominant Hodgkin's disease is a monoclonal or a polyclonal B-cell disorder has been controversial. Southern blot and PCR analyses for immunoglobulin-gene rearrangements have detected only occasional cases of monoclonal immunoglobulin-gene rearrangements in all studies,10-15,17,18 with a single exception.16 These studies are difficult to interpret because of the admixture of numerous reactive cells in addition to the L&H cells. Some investigations using in situ hybridization have found messenger RNA with a single light-chain isotype in a predominance of L&H cells, as is consistent with a clonal population.25,26 The detection of clonality by the analysis of single L&H cells in one patient with nodular lymphocyte-predominant Hodgkin's disease has been reported recently.19 In a previous study, we did not find clonal heavy-chain–gene rearrangements in L&H cells from two patients with nodular lymphocyte-predominant Hodgkin's disease.20 In that study, single L&H cells were obtained from cell suspensions and a relatively small number of cells were analyzed, which may have hampered the detection of a clonal population of L&H cells. In this study, however, using PCR analysis of single cells obtained by micromanipulation, we have demonstrated clonal populations of L&H cells in all five patients with nodular lymphocyte-predominant Hodgkin's disease. These populations appeared to be present throughout the tumor in four of the five patients, since L&H cells with identical or related heavy-chain CDR3 sequences were found in different nodules in the same tissue section, in different tissue blocks from the same tumor, and in two separate lymph nodes in one patient. Patient 1 was unusual in that all the CDR3 sequences from the clonal population were identical. The sample from this patient was studied again after a 12-month interval. The presence of the initial clonal population of L&H cells was confirmed, and the sequences were identical to those obtained previously.
It has been proposed that L&H cells originate from B cells in germinal centers, because of the presence of follicular dendritic cells and CD57+ T-helper cells in the tumor nodules.27-29 The clonal sequences in three of the specimens we studied and in the case reported by Küppers et al.19 showed nucleotide substitutions in individual cells belonging to the clone, indicating intraclonal mutation. In Patient 4, an apparent second clonal population was detected, but sequence analysis (Table 3) suggested that one of the clones was derived from the other, either by deletion or by the insertion of the central portion of the sequence. The frequent mutation of heavy-chain genes we found in L&H cells is also characteristic of normal B cells in the germinal center30-32 and suggests that the L&H cells are altered centroblasts in which hypermutation of heavy-chain genes takes place in a germinal-center–like environment.
In each of the five patients we also found L&H cells with heavy-chain–gene rearrangements that were unrelated to the clonal population we identified. This may indicate the concurrent presence of polyclonal L&H cells, but the possibility that the polyclonal heavy-chain–gene rearrangements were due to contamination by normal B cells should also be considered. No heavy-chain CDR3 products were amplified in any of the T cells or supernatant controls we studied, but this does not rule out an occasional contamination by B cells or the misidentification of L&H cells. The specimens from Patients 1, 2, 3, and 4 were selected because there were moderately abundant L&H cells and relatively few small B lymphocytes in the nodules, which would minimize contamination of the L&H cells by normal B lymphocytes, but the selection criteria may have led to the inclusion of specimens in which a dominant clonal population was more likely. The specimen from Patient 5, on the other end of the spectrum, had few L&H cells and numerous small B lymphocytes. Only a small clonal population was detected in this patient, a fact that seems to support the existence of an early polyclonal phase of the disease. This hypothesis would be much strengthened if multiple unrelated clones were detected.33
Supported by a grant (LB595) from the Department of Health, State of Nebraska, and by a grant (RO1 CA61453) from the National Institutes of Health.
We are indebted to K. Hansen for secretarial assistance and to D. Daley and M. Lambert for technical assistance.
Source Information
Presented in abstract form at the Annual Meeting of the American Society of Hematology, Orlando, Fla., December 6–10, 1996.
From the Department of Pathology and Microbiology, University of Nebraska Medical Center, 600 S. 42nd St., P.O. Box 983135, Omaha, NE 68198-3135, where reprint requests should be addressed to Dr. Chan.
- References
References
1
Lukes RJ ,Butler JJ . The pathology and nomenclature of Hodgkin's disease. Cancer Res 1966;26:1063-1081
Web of Science | Medline2
Lukes RJ ,Carver LF ,Hall TC ,Rappaport H ,Ruben P . Report of the Nomenclature Committee. Cancer Res 1966;26:1311-1311
Web of Science3
Regula DP Jr ,Hoppe RT ,Weiss LM . Nodular and diffuse types of lymphocyte predominance Hodgkin's disease. N Engl J Med 1988;318:214-219
Full Text | Web of Science | Medline4
Borg-Grech A ,Radford JA ,Crowther D ,Swindell R ,Harris M . A comparative study of the nodular and diffuse variants of lymphocyte-predominant Hodgkin's disease. J Clin Oncol 1989;7:1303-1309
Web of Science | Medline5
Poppema S . The diversity of the immunohistological staining pattern of Sternberg-Reed cells. J Histochem Cytochem 1980;28:788-791
CrossRef | Web of Science | Medline6
Stein H ,Hansmann ML ,Lennert K ,Brandtzaeg P ,Gatter KC ,Mason DY . Reed-Sternberg and Hodgkin cells in lymphocyte-predominant Hodgkin's disease of nodular subtype contain J chain. Am J Clin Pathol 1986;86:292-297
Web of Science | Medline7
Angel CA ,Warford A ,Campbell AC ,Pringle JH ,Lauder I . The immunohistology of Hodgkin's disease -- Reed-Sternberg cells and their variants. J Pathol 1987;153:21-30
CrossRef | Web of Science | Medline8
Pinkus GS ,Said JW . Hodgkin's disease, lymphocyte predominance type, nodular -- further evidence for a B cell derivation: L & H variants of Reed-Sternberg cells express L26, a pan B cell marker. Am J Pathol 1988;133:211-217
Web of Science | Medline9
Kuzu I ,Delsol G ,Jones M ,Gatter KC ,Mason DY . Expression of the Ig-associated heterodimer (mb-1 and B29) in Hodgkin's disease. Histopathology 1993;22:141-144
CrossRef | Web of Science | Medline10
Knowles DM II ,Neri A ,Pelicci PG , et al. Immunoglobulin and T-cell receptor β-chain gene rearrangement analysis of Hodgkin's disease: implications for lineage determination and differential diagnosis. Proc Natl Acad Sci U S A 1986;83:7942-7946
CrossRef | Web of Science | Medline11
Angel CA ,Pringle JH ,Naylor J ,West KP ,Lauder I . Analysis of antigen receptor genes in Hodgkin's disease. J Clin Pathol 1993;46:337-340
CrossRef | Web of Science | Medline12
Linden MD ,Fishleder AJ ,Katzin WE ,Tubbs RR . Absence of B-cell or T-cell clonal expansion in nodular, lymphocyte predominant Hodgkin's disease. Hum Pathol 1988;19:591-594
CrossRef | Web of Science | Medline13
Said JW ,Sassoon AF ,Shintaku IP ,Kurtin PJ ,Pinkus GS . Absence ofbcl-2 major breakpoint region and JH gene rearrangement in lymphocyte predominance Hodgkin's disease: results of Southern blot analysis and polymerase chain reaction. Am J Pathol 1991;138:261-264
Web of Science | Medline14
Angel CA ,Pringle JH ,Primrose L ,Lauder I . Detection of immunoglobulin heavy chain gene rearrangements in Hodgkin's disease using PCR. J Clin Pathol 1993;46:940-942
CrossRef | Web of Science | Medline15
Manzanal A ,Santon A ,Oliva H ,Bellas C . Evaluation of clonal immunoglobulin heavy chain rearrangements in Hodgkin's disease using the polymerase chain reaction (PCR). Histopathology 1995;27:21-25
CrossRef | Web of Science | Medline16
Tamaru J ,Hummel M ,Zemlin M ,Kalvelage B ,Stein H . Hodgkin's disease with a B-cell phenotype often shows a VDJ rearrangement and somatic mutations in the VH genes. Blood 1994;84:708-715
Web of Science | Medline17
Pan LX ,Diss TC ,Peng HZ ,Norton AJ ,Isaacson PG . Nodular lymphocyte predominance Hodgkin's disease: a monoclonal or polyclonal B-cell disorder? Blood 1996;87:2428-2434
Web of Science | Medline18
Greiner TC ,Gascoyne RD ,Anderson ME , et al. Nodular lymphocyte-predominant Hodgkin's disease associated with large-cell lymphoma: analysis of Ig gene rearrangements by V-J polymerase chain reaction. Blood 1996;88:657-666
Web of Science | Medline19
Kuppers R ,Rajewsky K ,Zhao M , et al. Hodgkin disease: Hodgkin and Reed-Sternberg cells picked from histological sections show clonal immunoglobulin gene rearrangements and appear to be derived from B cells at various stages of development. Proc Natl Acad Sci U S A 1994;91:10962-10966
CrossRef | Web of Science | Medline20
Delabie J ,Tierens A ,Wu G ,Weisenburger DD ,Chan WC . Lymphocyte predominance Hodgkin's disease: lineage and clonality determination using a single-cell assay. Blood 1994;84:3291-3298
Web of Science | Medline21
Hsu SM ,Raine L ,Fanger H . Use of avidin-biotin-peroxidase complex (ABC) in immunoperoxidase techniques: a comparison between ABC and unlabeled antibody (PAP) procedures. J Histochem Cytochem 1981;29:577-580
CrossRef | Web of Science | Medline22
d'Amore F ,Stribley JA ,Ohno T , et al. Molecular studies on single cells harvested by micromanipulation from archival tissue sections previously stained by immunohistochemistry or nonisotopic in situ hybridization. Lab Invest 1997;76:219-224
Web of Science | Medline23
Yamada M ,Hudson S ,Tournay O , et al. Detection of minimal disease in hematopoietic malignancies of the B-cell lineage by using third-complementarity-determining region (CDR-III)-specific probes. Proc Natl Acad Sci U S A 1989;86:5123-5127
CrossRef | Web of Science | Medline24
Wu G, Greiner TC, Chan WC. Obtaining clone-specific primer and probe for the immunoglobulin heavy chain gene from paraffin-embedded tissue of B-cell lymphoma: technical considerations. Diagn Mol Pathol (in press).
25
Hell K ,Pringle JH ,Hansmann ML , et al. Demonstration of light chain mRNA in Hodgkin's disease. J Pathol 1993;171:137-143
CrossRef | Web of Science | Medline26
Stoler MH ,Nichols GE ,Symbula M ,Weiss LM . Lymphocyte predominance Hodgkin's disease: evidence for a κ light chain-restricted monotypic B-cell neoplasm. Am J Pathol 1995;146:812-818
Web of Science | Medline27
Alavaikko MJ ,Hansmann ML ,Nebendahl C ,Parwaresch MR ,Lennert K . Follicular dendritic cells in Hodgkin's disease. Am J Clin Pathol 1991;95:194-200
Web of Science | Medline28
Poppema S . The nature of the lymphocytes surrounding Reed-Sternberg cells in nodular lymphocyte predominance and in other types of Hodgkin's disease. Am J Pathol 1989;135:351-357
Web of Science | Medline29
Timens W ,Visser L ,Poppema S . Nodular lymphocyte predominance type of Hodgkin's disease is a germinal center lymphoma. Lab Invest 1986;54:457-461
Web of Science | Medline30
Berek C . The development of B cells and the B-cell repertoire in the microenvironment of the germinal center. Immunol Rev 1992;126:5-19
CrossRef | Web of Science | Medline31
Kuppers R ,Zhao M ,Hansmann ML ,Rajewsky K . Tracing B cell development in human germinal centres by molecular analysis of single cells picked from histological sections. EMBO J 1993;12:4955-4967
Web of Science | Medline32
Chang B ,Casali P . The CDR1 sequences of a major proportion of human germline Ig VH genes are inherently susceptible to amino acid replacement. Immunol Today 1994;15:367-373
CrossRef | Medline33
Wickert RS ,Weisenburger DD ,Tierens A ,Greiner TC ,Chan WC . Clonal relationship between lymphocytic predominance Hodgkin's disease and concurrent or subsequent large-cell lymphoma of B lineage. Blood 1995;86:2312-2320
Web of Science | Medline
- Citing Articles (44)
Citing Articles
1
Claudiu V Cotta, Joshua F Coleman, Shiyong Li, Eric D Hsi. (2011) Nodular lymphocyte predominant Hodgkin lymphoma and diffuse large B-cell lymphoma: a study of six cases concurrently involving the same site. Histopathology 59:6, 1194-1203
CrossRef2
Eun Kyung Lee, Ji Hye Chae, Myung-Soo Kang. (2011) Nuclear factor-κB2 represses Sp1-Mediated Transcription at the CD99 promoter. Molecules and Cells
CrossRef3
K. B. Jones, V. Piombo, C. Searby, G. Kurriger, B. Yang, F. Grabellus, P. J. Roughley, J. A. Morcuende, J. A. Buckwalter, M. R. Capecchi, A. Vortkamp, V. C. Sheffield. (2010) From the Cover: A mouse model of osteochondromagenesis from clonal inactivation of Ext1 in chondrocytes. Proceedings of the National Academy of Sciences 107:5, 2054-2059
CrossRef4
Bertram Schnitzer. (2009) Hodgkin Lymphoma. Hematology/Oncology Clinics of North America 23:4, 747-768
CrossRef5
Roland Schmitz, Jens Stanelle, Martin-Leo Hansmann, Ralf Küppers. (2009) Pathogenesis of Classical and Lymphocyte-Predominant Hodgkin Lymphoma. Annual Review of Pathology: Mechanisms of Disease 4:1, 151-174
CrossRef6
Andrew M Evens, Martin Hutchings, Volker Diehl. (2008) Treatment of Hodgkin lymphoma: the past, present, and future. Nature Clinical Practice Oncology 5:9, 543-556
CrossRef7
Matthew J. Matasar, Andrew D. Zelenetz. (2008) Overview of Lymphoma Diagnosis and Management. Radiologic Clinics of North America 46:2, 175-198
CrossRef8
S Tedoldi, A Mottok, J Ying, JC Paterson, Y Cui, F Facchetti, JHJM van Krieken, M Ponzoni, S Özkal, N Masir, Y Natkunam, SA Pileri, M-L Hansmann, DY Mason, Q Tao, T Marafioti. (2007) Selective loss of B-cell phenotype in lymphocyte predominant Hodgkin lymphoma. The Journal of Pathology 213:4, 429-440
CrossRef9
Michele R Roullet, Adam Bagg. (2007) Recent insights into the biology of Hodgkin lymphoma: unraveling the mysteries of the Reed–Sternberg cell. Expert Review of Molecular Diagnostics 7:6, 805-820
CrossRef10
Michael Hummel. (2007) World Health Organization and Beyond: New Aspects in the Pathology of an Old Disease. Hematology/Oncology Clinics of North America 21:5, 769-786
CrossRef11
Randall S. Davis. (2007) Fc Receptor-Like Molecules. Annual Review of Immunology 25:1, 525-560
CrossRef12
Sonam Prakash, Thomas Fountaine, Mark Raffeld, Elaine S. Jaffe, Stefania Pittaluga. (2006) IgD Positive L&H Cells Identify a Unique Subset of Nodular Lymphocyte Predominant Hodgkin Lymphoma. The American Journal of Surgical Pathology 30:5, 585-592
CrossRef13
Andrew Wirth, Kally Yuen, Michael Barton, Daniel Roos, Kumar Gogna, Gary Pratt, Craig MacLeod, Sean Bydder, Graeme Morgan, David Christie. (2005) Long-term outcome after radiotherapy alone for lymphocyte-predominant Hodgkin lymphoma. Cancer 104:6, 1221-1229
CrossRef14
Christoph Renné, José Ignacio Martín-Subero, Martin-Leo Hansmann, Reiner Siebert. (2005) Molecular Cytogenetic Analyses of Immunoglobulin Loci in Nodular Lymphocyte Predominant Hodgkin's Lymphoma Reveal a Recurrent IGH-BCL6 Juxtaposition. The Journal of Molecular Diagnostics 7:3, 352-356
CrossRef15
M Sitki Copur, Peter Ledakis, Daniel Novinski, Kai Fu, Mark Hutchins, Scot Frankforter, Kris Mleczko, Warren G Sanger, Wing C Chan. (2004) An Unusual Case of Composite Lymphoma Involving Chronic Lymphocytic Leukemia Follicular Lymphoma and Hodgkin Disease. Leukemia & Lymphoma 45:5, 1071-1076
CrossRef16
Zhen Fan, Yasodha Natkunam, Eric Bair, Robert Tibshirani, Roger A. Warnke. (2003) Characterization of Variant Patterns of Nodular Lymphocyte Predominant Hodgkin Lymphoma with Immunohistologic and Clinical Correlation. The American Journal of Surgical Pathology 27:10, 1346-1356
CrossRef17
Bradley C. Ekstrand, Sandra J. Horning. (2002) Lymphocyte predominant Hodgkin’s disease. Current Oncology Reports 4:5, 424-433
CrossRef18
M Fraga, A García-Rivero, L Sánchez-Verde, J Forteza, M A Piris. (2002) T-cell/histiocyte-rich large B-cell lymphoma is a disseminated aggressive neoplasm: differential diagnosis from Hodgkin's lymphoma. Histopathology 41:3, 216-229
CrossRef19
Paul J. Kurtin. (2002) Lymphocyte Predominant Hodgkin Lymphoma. Pathology Case Reviews 7:3, 97-104
CrossRef20
Emina Torlakovic, Anne Tierens, Hien D. Dang, Jan Delabie. (2001) The Transcription Factor PU.1, Necessary for B-Cell Development Is Expressed in Lymphocyte Predominance, But Not Classical Hodgkin’s Disease. The American Journal of Pathology 159:5, 1807-1814
CrossRef21
Dennis D. Weisenburger, Grant Wu, MD, James Z. Huang, MD, Wing C. Chan, MD, Kwang Hwa Park, MD, Toshiyuki Ohno, MD. (2001) The Tumor Cells in Nodular Lymphocyte-Predominant Hodgkin Disease Are Clonally Related to the Large Cell Lymphoma Occurring in the Same Individual: Direct Demonstration by Single Cell Analysis. American Journal of Clinical Pathology 116:4, 506-511
CrossRef22
Eric D. Hsi, Subramanian Yegappan. (2001) Lymphoma Immunophenotyping: A New Era in Paraffin-Section Immunohistochemistry. Advances in Anatomic Pathology 8:4, 218-239
CrossRef23
Motoko Yamaguchi, Toshiyuki Ohno, Eri Miyata, Hideki Toyoda, Kazuhiro Nishii, Masahiro Masuya, Kenkichi Kita, Hiroshi Shiku. (2001) Analysis of Clonal Relationship Using Single-Cell Polymerase Chain Reaction in a Patient with Concomitant Mantle Cell Lymphoma and Multiple Myeloma. International Journal of Hematology 73:3, 383-385
CrossRef24
Sibrand Poppema, Anke van den Berg. (2000) Interaction between host T cells and Reed–Sternberg cells in Hodgkin lymphomas. Seminars in Cancer Biology 10:5, 345-350
CrossRef25
Madeleine D. Kraus, Jane Haley. (2000) Lymphocyte Predominance Hodgkin's Disease. The American Journal of Surgical Pathology 24:8, 1068-1078
CrossRef26
Watanabe, Yamashita, Nakayama, Hasegawa, Kojima, Nagasawa, Mori. (2000) Varied B-cell immunophenotypes of Hodgkin/Reed-Sternberg cells in classic Hodgkin's disease. Histopathology 36:4, 353-361
CrossRef27
L. M. Staudt. (2000) The Molecular and Cellular Origins of Hodgkin's Disease. Journal of Experimental Medicine 191:2, 207-212
CrossRef28
Epstein, Franklin H., , Küppers, Ralf, Klein, Ulf, Hansmann, Martin-Leo, Rajewsky, Klaus, . (1999) Cellular Origin of Human B-Cell Lymphomas. New England Journal of Medicine 341:20, 1520-1529
Full Text29
Kevin G Kempers, Joseph W Foote, Robert L Zimmerman, John K Choi. (1999) Hodgkin's disease presenting as a submental mass. Journal of Oral and Maxillofacial Surgery 57:11, 1363-1366
CrossRef30
Michele Spina, Simonetta Sandri, Umberto Tirelli. (1999) Hodgkin’s disease in HIV-infected individuals. Current Opinion in Oncology 11:6, 522
CrossRef31
U. Hasse, M. Tinguely, E. O. Leibundgut, J.-F. Cajot, A. M. Garvin, A. Tobler, B. Borisch, M. F. Fey. (1999) Clonal Loss of Heterozygosity in Microdissected Hodgkin and Reed-Sternberg Cells. JNCI Journal of the National Cancer Institute 91:18, 1581-1583
CrossRef32
A. van den Berg, L. Visser, S. Poppema. (1999) High Expression of the CC Chemokine TARC in Reed-Sternberg Cells. The American Journal of Pathology 154:6, 1685-1691
CrossRef33
Manuela Födinger, Karin Winkler, Christine Mannhalter, Andreas Chott. (1999) Combined Polymerase Chain Reaction Approach for Clonality Detection in Lymphoid Neoplasms. Diagnostic Molecular Pathology 8:2, 80-91
CrossRef34
Manis, John P, . (1999) Precursors of Hodgkin's Disease and B-Cell Lymphomas. New England Journal of Medicine 340:16, 1280-1282
Full Text35
Isao Sakuma, Tadashi Yoshino, Kunihiro Omonishi, Ritsuo Nishiuchi, Norihiro Teramoto, Hiroyuki Yanai, Kunimitsu Kawahara, Ichiro Kubonishi, Yoshinobu Matsuo, Tadaatsu Akagi. (1999) CD95 ligand is expressed in Reed-Sternberg cells of Hodgkin's disease. Pathology International 49:2, 103-109
CrossRef36
Roberto Chiarle, Antonello Podda, Gabriel Prolla, Jerry Gong, G.Jeanette Thorbecke, Giorgio Inghirami. (1999) CD30 in Normal and Neoplastic Cells. Clinical Immunology 90:2, 157-164
CrossRef37
Jens Krugmann, Hans Feichtinger, Richard Greil, Falko Fend. (1999) Thymic Hodgkin's Disease — A Histological and Immunohistochemical Study of Three Cases. Pathology - Research and Practice 195:10, 681-687
CrossRef38
Jo Spencer, Deborah K. Dunn-Walters. (1999) Somatic hypermutation and B-cell malignancies. The Journal of Pathology 187:2, 158-163
CrossRef39
Ralf Küppers, Klaus Rajewsky. (1998) THE ORIGIN OF HODGKIN AND REED/STERNBERG CELLS IN HODGKIN'S DISEASE. Annual Review of Immunology 16:1, 471-493
CrossRef40
Christos Kosmas, Kostas Stamatopoulos, Theodora Papndoki, Chrysoula Belessi, Xenophon Yataganas, Dimitra Anagnostou, Dimitris Loukopoulos. (1998) Somatic hypermutation of immunoglobulin variable region genes: focus on follicular lymphoma and multiple myeloma. Immunological Reviews 162:1, 281-292
CrossRef41
Ulf Klien, Tina Goasens, Motthias Fischer, Holger Kanzler, Andreas Braeuninger, Klaus Rajewsky, Ralf Kuppers. (1998) Somatic hypermutation in normal and transformed human B cells. Immunological Reviews 162:1, 261-280
CrossRef42
Audrey E. Evans, Margaret H. Collins, Eli Glatstein, G. Peter Feola. (1998) Hodgkin disease?. Medical and Pediatric Oncology 30:4, 252-258
CrossRef43
Andrea Jox, Jürgen Wolf, Volker Diehl. (1997) Hodgkin's disease biology: recent advances. Hematological Oncology 15:4, 165-171
CrossRef44
Schwartz, Robert S., . (1997) Hodgkin's Disease — Time for a Change. New England Journal of Medicine 337:7, 495-496
Full Text
