Original Article
Vitamin D–Receptor Gene Polymorphisms and Bone Density in Prepubertal American Girls of Mexican Descent
N Engl J Med 1997; 337:77-82July 10, 1997
- Abstract
Background
Bone mass is under strong genetic control, and recent studies in adults have suggested that allelic differences in the gene for the vitamin D receptor may account for inherited variability in bone mass. We studied the relations of the vitamin D–receptor genotype to skeletal development and variation in the size, volume, and density of bone in children.
Methods
We identified three allelic variants of the vitamin D–receptor gene using the polymerase chain reaction and three restriction enzymes (ApaI, BsmI, and TaqI) in 100 normal prepubertal American girls of Mexican descent. We then determined the relations of the different vitamin D–receptor genotypes (AA, Aa, aa, BB, Bb, bb, TT, Tt, and tt) to the cross-sectional area, cortical area, and cortical bone density of the femoral shaft and the cross-sectional area and density of the lumbar vertebrae.
Results
The vitamin D–receptor genotype was associated with femoral and vertebral bone density. Girls with aa and bb genotypes had 2 to 3 percent higher femoral bone density (P = 0.008 and P = 0.04, respectively) and 8 to 10 percent higher vertebral bone density (P = 0.01 and P = 0.03, respectively) than girls with AA and BB genotypes. There was no association between the cross-sectional area of the vertebrae or the cross-sectional or cortical area of the femur and the vitamin D–receptor genotype. The chronologic age, bone age, height, weight, body-surface area, and body-mass index did not differ significantly among girls with different vitamin D–receptor genotypes.
Conclusions
Vitamin D–receptor gene alleles predict the density of femoral and vertebral bone in prepubertal American girls of Mexican descent.
Media in This Article
Figure 1
Femoral Cortical (Panel A) and Vertebral Cancellous (Panel B) Bone Density in Relation to Vitamin D–Receptor Genotypes Determined with the Restriction Enzymes ApaI and BsmI in 100 Normal Prepubertal American Girls of Mexican Descent.Table 1
Vitamin D–Receptor Genotype, Age, and Anthropometric Characteristics in 100 Normal Prepubertal American Girls of Mexican Descent.Article Activity
- Article
Defining the genetic and environmental factors responsible for variations in bone mass during skeletal growth should aid in the identification of children at risk for osteoporosis and fractures later in life.1 Although the influence of environmental factors such as nutrition and physical exercise on the amount of bone that is gained during childhood has been the subject of several studies,2 knowledge of the genetic components of bone mass is limited to studies of mother–daughter pairs and twins.3-5 Consequently, great interest was generated by a recent report suggesting that allelic differences in the gene for the vitamin D receptor account for inherited variability in bone mass.6 However, not all subsequent studies confirmed the relation, and the results of positive studies differed with regard to the magnitude of the association.7-9 Further controversy arose from data suggesting that vitamin D–receptor gene polymorphisms were not related to bone mass but were related to variations in diaphyseal cross-sectional growth resulting from periosteal apposition of new bone.10-12 These discrepancies could, in part, be due to the technique used to study bone. Measurements of bone density by absorptiometry are based on a two-dimensional projection of a three-dimensional structure, cannot accurately account for variations in cross-sectional area, and are influenced not only by bone mass, but also by the size of the bone.13
Quantitative computed tomography (CT) allows accurate assessment of both the size of the bones and the various components that influence bone mass.14 In this study, we used quantitative CT to investigate whether there is an association between vitamin D–receptor genotype and the skeletal development of prepubertal girls and, if so, whether this link is related to variations in the size of the femurs or the lumbar vertebrae, the volume of cortical bone in the femurs, or the density of cortical bone in the femurs or of cancellous bone in the vertebrae.
Methods
Subjects
We studied 100 normal, prepubertal, American girls of Mexican descent who were between 6.7 and 11.7 years of age and were recruited from schools in Los Angeles County, California. The protocol was approved by the Children's Hospital of Los Angeles Institutional Review Board, and informed consent was obtained from all subjects and their parents or guardians.
Subjects were excluded if they had any chronic illness, had been ill for more than two weeks during the previous six months, had ever been hospitalized, or had taken any medications, vitamin preparations, or calcium supplements within the previous six months. Girls were also excluded if their parents or grandparents were not of Mexican descent.
All the children underwent a physical examination by a pediatric endocrinologist to determine their stage of sexual development. Only girls who were prepubertal and whose height and weight were between the 5th and 95th percentiles for the mean age-adjusted normal values for white girls were enrolled. Body-surface area and body-mass index were calculated as previously described.15 Skeletal maturation was determined by the method of Greulich and Pyle16; girls whose chronologic and bone age differed by more than one year were also excluded.
Genotypic Analysis of Polymorphisms of the Vitamin D–Receptor Gene
The genotype for three restriction-fragment–length polymorphisms of the vitamin D–receptor gene was determined by polymerase-chain-reaction (PCR) amplification and enzymatic digestion of the products with ApaI, BsmI, and TaqI. The primers for the BsmI polymorphism have been described previously.6 The forward primer for the ApaI and TaqI polymorphisms, located in exon 7, was the same as that used for amplification of the BsmI polymorphism:5'CAACCAAGACTACAAGTACCGCGTCAGTGA3'. The reverse primer for the ApaI and TaqI polymorphisms was located in exon 9: 5'CACTTCGAGCACAAGGGGCGTTAGC3'. PCR was performed with a Biometra Trio thermoblock (Floral City, Fla.) under standard conditions, for 35 cycles, and with 65°C as annealing temperature. With the enzymes ApaI, BsmI, and TaqI, the respective genotypes were defined as A, B, T (indicating the absence of the restriction site) or a, b, t (indicating the presence of the restriction site). The PCR product for the BsmI polymorphism was 825 base pairs (bp) long, and the restriction fragments were 650 bp and 175 bp long. The PCR products for the ApaI and TaqI polymorphisms were 2000 bp long; the lengths of the fragments after digestion with ApaI were 1700 and 300 bp, and the lengths of the fragments after digestion with TaqI were 1800 and 200 bp.
Biochemical Studies
After an overnight fast, blood was taken for measurement of serum biochemical values, calciotropic hormones, and markers of bone turnover. Serum parathyroid hormone, 25-hydroxyvitamin D, 1,25-dihydroxyvitamin D, alkaline phosphatase, bone-specific alkaline phosphatase, and osteocalcin were measured at Corning Nichols Institute, San Juan Capistrano, California.
Techniques and Definitions of Bone Measurements
All CT bone measurements were performed with the same instrument (CT-T 9800, General Electric, Milwaukee) and mineral reference phantom (CT-T bone densitometry package, General Electric). The density of cancellous bone and the cross-sectional area of the vertebrae were measured at the midportion of vertebral bodies L1 through L3, and the cross-sectional area, the area of cortical bone, and the density of cortical bone were measured at the midshaft of both femurs, as previously described.17,18
The size of the axial skeleton was defined as the cross-sectional area at the midportion of the vertebral body in square centimeters, and the density of cancellous bone was defined as the amount of bone and marrow in milligrams per cubic centimeter per pixel, the CT unit of measurement. Because of the small size of the trabeculae as compared with that of the pixel, the CT values for cancellous bone density reflect not only the amount of mineralized bone and osteoid, but also the amount of marrow per pixel.14 These measurements are analogous to in vitro determinations of the volumetric density of trabecular bone, which are obtained by washing the marrow from the pores of a specimen of cancellous bone, weighing it, and dividing the weight by the volume of the specimen, including the pores.19
The size of the appendicular skeleton was defined as the cross-sectional area at the midshaft of the femur in square centimeters, the volume of cortical bone as the cortical bone area at the midshaft of the femur in square centimeters, and the density of cortical bone as the amount of bone in milligrams per cubic centimeter per pixel. Because of the thickness and relative lack of porosity of cortical bone at the midshaft of the femur, the CT values reflect the density of the bone (the amount of collagen and mineral in a given volume of bone).17 These measurements are analogous to in vitro determinations of the intrinsic mineral density of bone, which are commonly expressed as the ash weight per unit volume of bone.20
The coefficients of variation for repeated CT measurements of femoral cortical bone density, cortical bone area, and cross-sectional area and of vertebral cancellous bone density and cross-sectional area were 0.6 to 2 percent.17,18 The time required for the procedure was approximately 10 minutes, and the radiation exposure was approximately 100 to 200 mrem (1 to 2 mJ per kilogram), localized to the midportions of the first three lumbar vertebrae and the femurs; the effective radiation dose was approximately 8 mrem (0.08 mJ per kilogram).21,22
Statistical Analysis
Anthropometric, biochemical, and bone measurements were assessed by analysis of variance with the Bonferroni correction for multiple comparisons and by linear regression analysis.23 Linkage disequilibrium was assessed by a chi-square test with the null hypothesis of no linkage disequilibrium between the different polymorphic alleles. To estimate haplotype frequencies, the computer program Estimated Haplotype (Linkage Program version 5.1) was used.24 All statistical tests were two-sided.
Results
Characteristics of the Study Population
Table 1Table 1
Vitamin D–Receptor Genotype, Age, and Anthropometric Characteristics in 100 Normal Prepubertal American Girls of Mexican Descent. shows the anthropometric characteristics of the 100 girls. By design, the average values for bone age were similar to those for chronologic age. Also by design, the heights and weights of the girls were between the 5th and 95th percentiles for age; mean height was at the 50th percentile, and mean weight was at the 70th percentile.The most common vitamin D–receptor genotypes were Aa (55 percent), Bb (42 percent), and TT (54 percent). Genotypes aa and bb were more frequent (24 percent and 44 percent, respectively) than AA and BB (21 percent and 14 percent, respectively). When the genotypes for all polymorphisms were combined, the most frequent were AaBbTt (29 percent) and aabbTT (23 percent).
Genotype, Phenotype, and Biochemical Association
There were no significant differences in developmental status among girls with different vitamin D–receptor genotypes, and the mean values for age, bone age, height, weight, body-surface area, and body-mass index were similar in all groups (Table 1). There were significant relations between vitamin D–receptor genotype and the range of values for bone density in both the femurs and the vertebrae. Girls with genotypes aa and bb had 2 to 3 percent higher femoral bone density (P = 0.008 and P = 0.04, respectively) and 8 to 10 percent higher vertebral bone density (P = 0.01 and P = 0.03, respectively) than those with AA and BB genotypes (Figure 1AFigure 1
Femoral Cortical (Panel A) and Vertebral Cancellous (Panel B) Bone Density in Relation to Vitamin D–Receptor Genotypes Determined with the Restriction Enzymes ApaI and BsmI in 100 Normal Prepubertal American Girls of Mexican Descent. and Figure 1B). The presence of these homozygous genotypes predicted higher femoral (r = 0.35, P = 0.03) and vertebral (r = 0.44, P = 0.02) bone density. Although the bone densities did not differ according to TaqI genotype, there was a trend toward higher values for vertebral and femoral bone density in girls with the TT genotype, and toward lower values in girls with the homozygous tt genotype (Table 2Table 2
Vitamin D–Receptor Genotype and CT Measurements of the Femoral Shafts and Lumbar Vertebrae in 100 Normal Prepubertal American Girls of Mexican Descent.).The 23 girls with the most favorable genotype (aabb) had 2 percent higher femoral bone density (P = 0.03) and 12 percent higher vertebral bone density (P = 0.01) than the 14 girls with the least favorable genotype (AABB). The estimated frequencies of the AB and ab haplotypes indicate that these alleles were in linkage disequilibrium (P<0.001).24 Neither age nor anthropometric measurements contributed to the variance in bone density (data not shown).
In contrast to the findings for bone density, the vitamin D–receptor alleles in the three genotypic groups were not associated with vertebral cross-sectional area or with femoral cross-sectional or cortical bone area (Table 2). However, these dimensions correlated strongly with age and with all anthropometric measurements; the strongest correlation was with body weight (r = 0.76 to 0.80). In the multivariate analysis, once weight was included in the regression model, the predictive power was not improved by the addition of chronologic age, bone age, or height.
The vitamin D–receptor alleles in the three genotypic groups were not associated with the serum concentrations of calcium or other biochemical values, calciotropic hormones, or markers of bone turnover (data not shown). Similarly, there was no relation between the measurements of bone density and any of the biochemical variables. However, femoral and vertebral cross-sectional areas were weakly correlated with serum concentrations of osteocalcin, alkaline phosphatase, and bone-specific alkaline phosphatase (r = 0.24 to 0.28).
Discussion
We found that in normal, prepubertal, American girls of Mexican descent, polymorphisms in the vitamin D–receptor gene accounted for a significant proportion of the variance in the bone density of the femoral shaft and the lumbar vertebrae. The polymorphisms accounted for a difference of more than 1 SD in femoral and vertebral bone density between the groups of homozygotes defined by restriction enzymes BsmI and ApaI. However, because of the very narrow range of values for femoral bone density, girls with the aa and bb genotypes had femoral bone density that was an average of only 2 percent higher than that in girls with the AA and BB genotypes, whereas vertebral bone density differed by about 9 percent between the same groups.
Femoral bone density was eight times as high as vertebral bone density, a finding consistent with histomorphometric studies indicating an equivalent difference in the porosity of these two forms of bone.19,20 Chronologic age, bone age, height, and weight did not influence bone density at either site, a finding that corroborates previous results indicating that skeletal growth in prepubertal children is not associated with significant changes in bone density.17,25
Two characteristics of the population studied should be noted. First, the girls were of Mexican-American heritage, and previous studies have suggested a large degree of genetic homogeneity in this population.26 The genotypic frequencies were very similar to those previously found in France and in people of European descent in Australia and the United States.27-29 Second, we chose to study prepubertal children to avoid the confounding effect of the pubertal growth spurt on skeletal development. Differences among girls with different vitamin D–receptor gene alleles might be more difficult to demonstrate if the studies were done during puberty, when large increases in skeletal size and bone mass occur within a short period.25,30
The mechanism or mechanisms by which the vitamin D–receptor genotypes are linked to bone density have yet to be determined, but they are probably related to the established actions of vitamin D. Premenopausal women with the bb genotype have a greater decrease in the serum parathyroid hormone concentration after the administration of calcitriol than women with the BB genotype.31 Vitamin D–receptor genotypes have also been linked to the regulation of the intestinal absorption of calcium: when the dietary intake of calcium is low, women with BB alleles may absorb calcium less efficiently than those with bb alleles.32 Thus, differences in allelic status may be related to bone mineralization through the effects of the vitamin D–receptor genotype on the intestinal absorption of calcium.
We found that vitamin D–receptor genotypes were associated with bone density but not with the volume of femoral bone or the cross-sectional area of the femurs or the vertebrae. Our results differ from those of previous studies that used projectional techniques and that were limited by the assumption that the cross-sectional areas of the vertebral bodies and the femoral shaft have a uniform shape.10-12 Our results also differ from those of previous studies suggesting that the b allele of the vitamin D–receptor gene is associated with lower serum osteocalcin and calcitriol concentrations6,28 but agree with the results of other studies that found no such relation.27,33,34
The variations in bone density according to allelic status found in this study have important implications with regard to the structural strength of bone, and they provide guidelines for identifying a subgroup of normal girls who may be at risk for osteoporosis later in life. However, several investigators have been unable to find an association between bone mass and vitamin D–receptor polymorphisms in elderly women, and others have suggested that the association is present only before menopause.9,34,35 Determination of the reasons for possible age-related changes in this association is likely to yield valuable information regarding other factors that determine the strength of bones in adults.
In conclusion, vitamin D–receptor gene alleles predict the density of the lumbar vertebrae and the femoral shaft in prepubertal American girls of Mexican descent. Careful evaluation of the genetic mechanism responsible for the differences in bone density among normal girls may provide a method for identifying girls who are at risk for fractures later in life.
Supported in part by grants from the National Institute of Arthritis and Musculoskeletal and Skin Diseases (R01-AR4-1853-01A1) and the National Cancer Institute (1K11 CA61870 02).
We are indebted to Ms. Cara L. Beck for technical assistance and comments on the manuscript.
Source Information
From the Departments of Radiology (J.S., M.L.L., V.G.) and Pediatrics (J.M.V.T., T.F.R.), Children's Hospital of Los Angeles and the University of Southern California; and the Department of Biostatistics, University of California, Los Angeles, School of Medicine (J.S.) — all in Los Angeles.
Address reprint requests to Dr. Gilsanz at the Radiology Dept., Children's Hospital of Los Angeles, 4650 Sunset Blvd., M.S. 81, Los Angeles, CA 90027.
- References
References
1
Riggs BL ,Melton LJ III . Involutional osteoporosis. N Engl J Med 1986;14:1676-1686
Full Text | Web of Science2
Dawson-Hughes B. Prevention. In: Riggs LB, Melton LJ III, eds. Osteoporosis: etiology, diagnosis, and management. 2nd ed. Philadelphia: Lippincott-Raven, 1995:335-50.
3
Seeman E ,Hopper JL ,Bach LA , et al. Reduced bone mass in daughters of women with osteoporosis. N Engl J Med 1989;320:554-558
Full Text | Web of Science | Medline4
Christian JC ,Yu PL ,Slemenda CW ,Johnston CC Jr . Heritability of bone mass: a longitudinal study in aging male twins. Am J Hum Genet 1989;44:429-433
Web of Science | Medline5
Sambrook PN ,Kelly PJ ,Morrison NA ,Eisman JA . Genetics of osteoporosis. Br J Rheumatol 1994;33:1007-1011
CrossRef | Medline6
Morrison NA ,Qi JC ,Tokita A , et al. Prediction of bone density from vitamin D receptor alleles. Nature 1994;367:284-287
CrossRef | Web of Science | Medline7
Eisman JA . Vitamin D receptor gene alleles and osteoporosis: an affirmative view. J Bone Miner Res 1995;10:1289-1293
CrossRef | Web of Science | Medline8
Peacock M . Vitamin D receptor gene alleles and osteoporosis: a contrasting view. J Bone Miner Res 1995;10:1294-1297
CrossRef | Web of Science | Medline9
Cooper GS ,Umbach DM . Are vitamin D receptor polymorphisms associated with bone mineral density? A meta-analysis. J Bone Miner Res 1996;11:1841-1849
CrossRef | Web of Science | Medline10
Barger-Lux MJ ,Heaney RP ,Hayes J ,DeLuca HF ,Johnson ML ,Gong G . Vitamin D receptor gene polymorphism, bone mass, body size, and vitamin D receptor density. Calcif Tissue Int 1995;57:161-162
CrossRef | Web of Science | Medline11
Matkovic V . Skeletal development and bone turnover revisited. J Clin Endocrinol Metab 1996;81:2013-2016
CrossRef | Web of Science | Medline12
Need AG ,Horowitz M ,Stiliano A ,Scopacasa F ,Morris HA ,Chatterton BE . Vitamin D receptor genotypes are related to bone size and bone density in men. Eur J Clin Invest 1996;26:793-796
CrossRef | Web of Science | Medline13
Carter DR ,Brouxsein ML ,Marcus R . New approaches for interpreting projected bone densitometry data. J Bone Miner Res 1992;7:137-145
CrossRef | Web of Science | Medline14
Genant HK ,Engelke K ,Fuerst T , et al. Noninvasive assessment of bone mineral and structure: state of the art. J Bone Miner Res 1996;11:707-730
CrossRef | Web of Science | Medline15
Behrman RE, Vaughan VC III, eds. Nelson textbook of pediatrics. 13th ed. Philadelphia: W.B. Saunders, 1987:24-33.
16
Greulich WW, Pyle SI. Radiographic atlas of skeletal development of the hand and wrist. Stanford, Calif.: Stanford University Press, 1950.
17
Hangartner T ,Gilsanz V . Evaluation of cortical bone by computed tomography. J Bone Miner Res 1996;11:1518-1525
CrossRef | Web of Science | Medline18
Gilsanz V ,Boechat MI ,Roe TF ,Loro ML ,Sayre JW ,Goodman WG . Gender differences in vertebral body sizes in children and adolescents. Radiology 1994;190:673-677
Web of Science | Medline19
Dyson ED ,Jackson CK ,Whitehouse WJ . Scanning electron microscope studies of human trabecular bone. Nature 1970;225:957-959
CrossRef | Web of Science | Medline20
Gong JK ,Arnold JS ,Cohn SH . Composition of trabecular and cortical bone. Anat Rec 1964;149:325-331
CrossRef | Web of Science | Medline21
Kalender WA . Effective dose values in bone mineral measurements by photon absorptiometry and computed tomography. Osteoporos Int 1992;2:82-87
CrossRef | Web of Science | Medline22
Cann CE. Why, when and how to measure bone mass: a guide for the beginning user. In: Frey GD, Yester MV, eds. Expanding the role of medical physics in nuclear medicine. Colchester, Vt.: American Physics Institute, 1991:250-79.
23
Dixon WJ, Massey FJ Jr. Introduction to statistical analysis. 4th ed. New York: McGraw-Hill, 1983.
24
Terwilliger JD, Ott J. Handbook of human genetic linkage. Baltimore: Johns Hopkins University Press, 1994.
25
Gilsanz V ,Roe TF ,Mora S ,Costin G ,Goodman WG . Changes in vertebral bone density in black girls and white girls during childhood and puberty. N Engl J Med 1991;325:1597-1600
Full Text | Web of Science | Medline26
Shohat T ,Shaw SJ ,Sparkes RS ,Vadheim CM ,Rotter JI ,Zeidler A . Polymorphic gene markers in Mexican-Americans residing in southern California. Hum Hered 1995;45:150-156
CrossRef | Web of Science | Medline27
Garnero P ,Borel O ,Sornay-Rendu E ,Delmas PD . Vitamin D receptor gene polymorphisms do not predict bone turnover and bone mass in healthy premenopausal women. J Bone Miner Res 1995;10:1283-1288
CrossRef | Web of Science | Medline28
Morrison NA ,Yeoman R ,Kelly PJ ,Eisman JA . Contribution of trans-acting factor alleles to normal physiological variability: vitamin D receptor gene polymorphism and circulating osteocalcin. Proc Natl Acad Sci U S A 1992;89:6665-6669
CrossRef | Web of Science | Medline29
Hustmyer FG ,Peacock M ,Hui S ,Johnston CC ,Christian JC . Bone mineral density in relation to polymorphism at the vitamin D receptor gene locus. J Clin Invest 1994;94:2130-2134
CrossRef | Web of Science | Medline30
Bonjour J-P ,Theintz G ,Buchs B ,Slosman D ,Rizzoli R . Critical years and stages of puberty for spinal and femoral bone mass accumulation during adolescence. J Clin Endocrinol Metab 1991;73:555-563
CrossRef | Web of Science | Medline31
Howard G ,Nguyen T ,Morrison N , et al. Genetic influences on bone density: physiological correlates of vitamin D receptor gene alleles in premenopausal women. J Clin Endocrinol Metab 1995;80:2800-2805
CrossRef | Web of Science | Medline32
Dawson-Hughes B ,Harris SS ,Finneran S . Calcium absorption on high and low calcium intakes in relation to vitamin D receptor genotype. J Clin Endocrinol Metab 1995;80:3657-3661
CrossRef | Web of Science | Medline33
Melhus H ,Kindmark A ,Amer S ,Wilen B ,Lindh E ,Ljunghall S . Vitamin D receptor genotypes in osteoporosis. Lancet 1994;344:949-950
CrossRef | Web of Science | Medline34
Fleet JC ,Harris SS ,Wood RJ ,Dawson-Hughes B . The BsmI vitamin D receptor restriction fragment length polymorphism (BB) predicts low bone density in premenopausal black and white women. J Bone Miner Res 1995;10:985-990
CrossRef | Web of Science | Medline35
Viitanen AM ,Karkkainen M ,Laitinen K , et al. Common polymorphism of the vitamin D receptor gene is associated with variation of peak bone mass in young Finns. Calcif Tissue Int 1996;59:231-234
CrossRef | Web of Science | Medline
- Citing Articles (84)
Citing Articles
1
Jean-Philippe Bonjour, Thierry Chevalley, Serge Ferrari, Rene Rizzoli. 2012. Peak Bone Mass and Its Regulation. , 189-221.
CrossRef2
Zudin Puthucheary, James R.A. Skipworth, Jai Rawal, Mike Loosemore, Ken Van Someren, Hugh E. Montgomery. (2011) Genetic Influences in Sport and Physical Performance. Sports Medicine 41:10, 845-859
CrossRef3
Liliana Silvano, Mirta Miras, Adriana Pérez, Gabriela Picotto, Gabriela Díaz de Barboza, Liliana Muñoz, Silvia Martin, Gabriela Sobrero, Pedro Armelini, Verónica Mericq, Nori Tolosa de Talamoni. (2011) Comparative analysis of clinical, biochemical and genetic aspects associated with bone mineral density in small for gestational age children. Journal of Pediatric Endocrinology and Metabolism 24:7-8, 511-517
CrossRef4
Raj Mitra. (2011) Adverse Effects of Corticosteroids on Bone Metabolism: A Review. PM&R 3:5, 466-471
CrossRef5
Xiao-Dan Yu, Xiao-Ming Shen, Ming-Bao Xue, Chong-Huai Yan. (2011) Vitamin D receptor gene polymorphism and bone mineral density in 0–6-year-old Han children. Journal of Bone and Mineral Metabolism 29:1, 54-61
CrossRef6
Mine Durusu Tanriover, Gamze Bora Tatar, Tenzile Deniz Uluturk, Didem Dayangac Erden, Altug Tanriover, Alpaslan Kilicarslan, S. Gul Oz, Hayat Erdem Yurter, Tumay Sozen, Gulay Sain Guven. (2010) Evaluation of the effects of vitamin D receptor and estrogen receptor 1 gene polymorphisms on bone mineral density in postmenopausal women. Clinical Rheumatology 29:11, 1285-1293
CrossRef7
Jose A. Balsa, Borja Iglesias, Roberto Peromingo, Silvia Conde, Clotilde Vazquez, Jose L. San-Millan, Jose I. Botella-Carretero. (2010) Vitamin D Receptor Polymorphisms in Secondary Hyperparathyroidism After Scopinaro's Biliopancreatic Diversion. Obesity Surgery 20:10, 1415-1421
CrossRef8
Eda Özaydın, Didem Dayangac-Erden, Hayat Erdem-Yurter, Orhan Derman, Turgay Coşkun. (2010) The Relationship between Vitamin D Receptor Gene Polymorphisms and Bone Density, Osteocalcin Level and Growth in Adolescents. Journal of Pediatric Endocrinology and Metabolism 23:5, 491-496
CrossRef9
Rama Devi Mittal, D. K. Mishra, P. Srivastava, P. Manchanda, H. K. Bid, R. Kapoor. (2010) Polymorphisms in the vitamin D receptor and the androgen receptor gene associated with the risk of urolithiasis. Indian Journal of Clinical Biochemistry 25:2, 119-126
CrossRef10
Maria Eduarda L. Diogenes, Flávia Fioruci Bezerra, Giselda M. K. Cabello, Pedro H. Cabello, Laura M. C. Mendonça, Astrogildo V. Oliveira Júnior, Carmen M. Donangelo. (2010) Vitamin D receptor gene FokI polymorphisms influence bone mass in adolescent football (soccer) players. European Journal of Applied Physiology 108:1, 31-38
CrossRef11
Mohammad Mehdi Banoei, Mehdi Seyed Mirsaeidi, Massoud Houshmand, Payam Tabarsi, Golnaz Ebrahimi, Laleh Zargari, Baharak Houshiar Kashani, Mohammad Reza Masjedi, Seyed Davood Mansouri, Julio Ramirez. (2010) Vitamin D receptor homozygote mutant tt and bb are associated with susceptibility to pulmonary tuberculosis in the Iranian population. International Journal of Infectious Diseases 14:1, e84-e85
CrossRef12
Hyung Jin Choi, Ji Yeob Choi, Sun Wook Cho, Daehee Kang, Ki Ok Han, Sang Wan Kim, Seong Yeon Kim, Yoon-Sok Chung, Chan Soo Shin. (2010) Genetic Polymorphism of Geranylgeranyl Diphosphate Synthase (GGSP1) Predicts Bone Density Response to Bisphosphonate Therapy in Korean Women. Yonsei Medical Journal 51:2, 231
CrossRef13
S MORA. 2010. Pubertal Growth of the Male Skeleton. , 95-103.
CrossRef14
Qing Xiong, Yan Jiao, Karen A. Hasty, S. Terry Canale, John M. Stuart, Wesley G. Beamer, Hong-Wen Deng, David Baylink, Weikuan Gu. (2009) Quantitative trait loci, genes, and polymorphisms that regulate bone mineral density in mouse. Genomics 93:5, 401-414
CrossRef15
Sue C. Kaste, Monika L. Metzger, Anum Minhas, Zang Xiong, Shesh N. Rai, Kirsten K. Ness, Melissa M. Hudson. (2009) Pediatric Hodgkin lymphoma survivors at negligible risk for significant bone mineral density deficits. Pediatric Blood & Cancer 52:4, 516-521
CrossRef16
P. Ranganathan. (2009) Genetics of bone loss in rheumatoid arthritis--role of vitamin D receptor polymorphisms. Rheumatology 48:4, 342-346
CrossRef17
Ali Rıza Uysal, Mustafa Sahin, Alptekin Gürsoy, Sevim Güllü. (2008) Vitamin D Receptor Gene Polymorphism and Osteoporosis in the Turkish Population. Genetic Testing 12:4, 591-594
CrossRef18
K. Bogunia-Kubik, P. Middleton, J. Norden, A. Dickinson, A. Lange. (2008) Association of vitamin D receptor polymorphisms with the outcome of allogeneic haematopoietic stem cell transplantation. International Journal of Immunogenetics 35:3, 207-213
CrossRef19
Albert Parés, Núria Guañabens. (2008) Osteoporosis in Primary Biliary Cirrhosis: Pathogenesis and Treatment. Clinics in Liver Disease 12:2, 407-424
CrossRef20
J. R. Garcia-Lozano, M. F. Gonzalez-Escribano, A. Valenzuela, A. Garcia, A. Núñez-Roldán. (2008) Association of vitamin D receptor genotypes with early onset rheumatoid arthritis. European Journal of Immunogenetics 28:1, 89
CrossRef21
Hugh Montgomery, Latif Safari. (2007) Genetic Basis of Physical Fitness. Annual Review of Anthropology 36:1, 391-405
CrossRef22
Struan FA Grant, Hakon Hakonarson. (2007) Recent development in pharmacogenomics: from candidate genes to genome-wide association studies. Expert Review of Molecular Diagnostics 7:4, 371-393
CrossRef23
Chia-Chu Liu, Chun-Hsiung Huang, Wen-Jeng Wu, Shu-Pin Huang, Yii-Her Chou, Ching-Chia Li, Chee-Yin Chai, Ming-Tsang Wu. (2007) Association of vitamin D receptor (Fok-I) polymorphism with the clinical presentation of calcium urolithiasis. BJU International 99:6, 1534-1538
CrossRef24
Wataru Obara, Yasushi Suzuki, Karen Kato, Susumu Tanji, Ryuichiro Konda, Tomoaki Fujioka. (2007) Vitamin D receptor gene polymorphisms are associated with increased risk and progression of renal cell carcinoma in a Japanese population. International Journal of Urology 14:6, 483-487
CrossRef25
David A. Stevenson, Laurie J. Moyer-Mileur, Mary Murray, Hillarie Slater, Xiaoming Sheng, John C. Carey, Bukhosi Dube, David H. Viskochil. (2007) Bone Mineral Density in Children and Adolescents with Neurofibromatosis Type 1. The Journal of Pediatrics 150:1, 83-88
CrossRef26
Vincent J. Vigorita. (2006) Osteoporosis. Techniques in Foot & Ankle Surgery 5:4, 210-221
CrossRef27
Jose M. Valdivielso, Elvira Fernandez. (2006) Vitamin D receptor polymorphisms and diseases. Clinica Chimica Acta 371:1-2, 1-12
CrossRef28
Siobhan Cusack, Christian Mølgaard, Kim F. Michaelsen, Jette Jakobsen, Christel J.E. Lamberg-Allardt, Kevin D. Cashman. (2006) Vitamin D and estrogen receptor-α genotype and indices of bone mass and bone turnover in Danish girls. Journal of Bone and Mineral Metabolism 24:4, 329-336
CrossRef29
Sezgin Gunes, Cenk Yucel Bilen, Nurten Kara, Ramazan Asci, Hasan Bagci, Ali Faik Yilmaz. (2006) Vitamin D receptor gene polymorphisms in patients with urolithiasis. Urological Research 34:1, 47-52
CrossRef30
Sue C. Kaste, Shesh N. Rai, Katherine Fleming, Elizabeth A. McCammon, Frances A. Tylavsky, Robert K. Danish, Susan R. Rose, Cheri D. Sitter, Ching-Hon Pui, Melissa M. Hudson. (2006) Changes in bone mineral density in survivors of childhood acute lymphoblastic leukemia. Pediatric Blood & Cancer 46:1, 77-87
CrossRef31
Brad T. Tinkle, Richard J. Wenstrup. (2005) A genetic approach to fracture epidemiology in childhood. American Journal of Medical Genetics Part C: Seminars in Medical Genetics 139C:1, 38-54
CrossRef32
Stefano Palomba, Francesco Orio, Tiziana Russo, Angela Falbo, Achille Tolino, Francesco Manguso, Vincenzo Nunziata, Pasquale Mastrantonio, Gaetano Lombardi, Fulvio Zullo. (2005) BsmI vitamin D receptor genotypes influence the efficacy of antiresorptive treatments in postmenopausal osteoporotic women. A 1-year multicenter, randomized and controlled trial. Osteoporosis International 16:8, 943-952
CrossRef33
Domenico Rendina, Giuseppe Mossetti, Roberto Viceconti, Mariangela Sorrentino, Rosaria Castaldo, Giuseppe Manno, Vincenzo Guadagno, Pasquale Strazzullo, Vincenzo Nunziata. (2004) Association between vitamin D receptor gene polymorphisms and fasting idiopathic hypercalciuria in recurrent stone-forming patients. Urology 64:4, 833-838
CrossRef34
André G. Uitterlinden, Yue Fang, Joyce B.J. van Meurs, Hans van Leeuwen, Huibert A.P. Pols. (2004) Vitamin D receptor gene polymorphisms in relation to Vitamin D related disease states. The Journal of Steroid Biochemistry and Molecular Biology 89-90, 187-193
CrossRef35
Armando Torres, Sagrario Garcia, Angeles Gomez, Antonieta Gonzalez, Ysamar Barrios, Maria Teresa Concepcion, Domingo Hernandez, Jose J. Garcia, Maria Dolores Checa, Victor Lorenzo, Eduardo Salido. (2004) Treatment with intermittent calcitriol and calcium reduces bone loss after renal transplantation. Kidney International 65:2, 705-712
CrossRef36
P Selvaraj, SM Kurian, G Chandra, AM Reetha, N Charles, PR Narayanan. (2004) Vitamin D receptor gene variants of BsmI, ApaI, TaqI, and FokI polymorphisms in spinal tuberculosis. Clinical Genetics 65:1, 73-76
CrossRef37
Yuan-Yuan Zhang, Ji-Rong Long, Peng-Yuan Liu, Yong-Jun Liu, Hui Shen, Lan-Juan Zhao, Hong-Wen Deng. (2003) Estrogen receptor α and vitamin D receptor gene polymorphisms and bone mineral density: association study of healthy pre- and postmenopausal Chinese women. Biochemical and Biophysical Research Communications 308:4, 777-783
CrossRef38
Ozan Özkaya, Oğuz Söylemezoğlu, Müge Mısırlıoğlu, Sevim Gönen, Necla Buyan, Enver Hasanoğlu. (2003) Polymorphisms in the Vitamin D Receptor Gene and the Risk of Calcium Nephrolithiasis in Children. European Urology 44:1, 150-154
CrossRef39
K. Douroudis, K. Tarassi, G. Ioannidis, F. Giannakopoulos, P. Moutsatsou, N. Thalassinos, Chr. Papasteriades. (2003) Association of vitamin D receptor gene polymorphisms with bone mineral density in postmenopausal women of Hellenic origin. Maturitas 45:3, 191-197
CrossRef40
Stefano Palomba, Fabio Giuliano Numis, Giuseppe Mossetti, Domenico Rendina, Pietro Vuotto, Tiziana Russo, Fulvio Zullo, Carmine Nappi, Vincenzo Nunziata. (2003) Effectiveness of alendronate treatment in postmenopausal women with osteoporosis: relationship with BsmI vitamin D receptor genotypes. Clinical Endocrinology 58:3, 365-371
CrossRef41
Stefano Mora, Vicente Gilsanz. (2003) Establishment of peak bone mass. Endocrinology & Metabolism Clinics of North America 32:1, 39-63
CrossRef42
G. Mossetti, P. Vuotto, D. Rendina, F. G. Numis, R. Viceconti, F. Giordano, M. Cioffi, F. Scopacasa, V. Nunziata. (2003) Association between vitamin D receptor gene polymorphisms and tubular citrate handling in calcium nephrolithiasis. Journal of Internal Medicine 253:2, 194-200
CrossRef43
Bojana Pinter, Andreja Kocijancic, Janja Marc, Lidija Andolsek-Jeras, Janez Prezelj. (2003) Vitamin D receptor gene polymorphism and bone metabolism during low-dose oral contraceptive use in young women. Contraception 67:1, 33-37
CrossRef44
S. Palomba. (2003) Raloxifene administration in post-menopausal women with osteoporosis: effect of different BsmI vitamin D receptor genotypes. Human Reproduction 18:1, 192-198
CrossRef45
MR Bazrafshani, AH Hajeer, WER Ollier, MH Thornhill. (2002) Recurrent aphthous stomatitis and gene polymorphisms for the inflammatory markers TNF-alpha, TNF-beta and the vitamin D receptor: no association detected. Oral Diseases 8:6, 303-307
CrossRef46
André G Uitterlinden, Yue Fang, Arjan P Bergink, Joyce B.J van Meurs, Hans P.T.M van Leeuwen, Huibert A.P Pols. (2002) The role of vitamin D receptor gene polymorphisms in bone biology. Molecular and Cellular Endocrinology 197:1-2, 15-21
CrossRef47
Ego Seeman. (2002) Pathogenesis of bone fragility in women and men. The Lancet 359:9320, 1841-1850
CrossRef48
Richard Eastell, Helen Lambert. (2002) Plenary Lecture: Strategies for skeletal health in the elderly. Proceedings of the Nutrition Society 61:02, 173-180
CrossRef49
L. Gennari, L. Becherini, A. Falchetti, L. Masi, F. Massart, M.L. Brandi. (2002) Genetics of osteoporosis: role of steroid hormone receptor gene polymorphisms. The Journal of Steroid Biochemistry and Molecular Biology 81:1, 1-24
CrossRef50
Bonny Specker. (2002) Are Activity and Diet Really Important for Children’s Bones?. Nutrition Today 37:2, 44-49
CrossRef51
Helen J. Woodhead, Allan F. Kemp, Cameron J. R. Blimkie, Julie N. Briody, Craig S. Duncan, Madeleine Thompson, Albert Lam, Robert Howman-Giles, Christopher T. Cowell. (2001) Measurement of Midfemoral Shaft Geometry: Repeatability and Accuracy Using Magnetic Resonance Imaging and Dual-Energy X-ray Absorptiometry. Journal of Bone and Mineral Research 16:12, 2251-2259
CrossRef52
Francesco Massart, Jean Yves Reginster, Maria Luisa Brandi. (2001) Genetics of menopause-associated diseases. Maturitas 40:2, 103-116
CrossRef53
J. R. Garcia-Lozano, M. F. Gonzalez-Escribano, A. Valenzuela, A. Garcia, A. Nunez-Roldan. (2001) Association of vitamin D receptor genotypes with early onset rheumatoid arthritis. European Journal of Immunogenetics 28:1, 89-93
CrossRef54
Emma E. Hobson, Stuart H. Ralston. (2001) Role of genetic factors in the pathophysiology and management of osteoporosis. Clinical Endocrinology 54:1, 1-9
CrossRef55
Laura K. Bachrach. (2001) Acquisition of optimal bone mass in childhood and adolescence. Trends in Endocrinology & Metabolism 12:1, 22-28
CrossRef56
Mattias Lorentzon, Ronny Lorentzon, Peter Nordström. (2000) Interleukin-6 Gene Polymorphism Is Related to Bone Mineral Density During and After Puberty in Healthy White Males: A Cross-Sectional and Longitudinal Study. Journal of Bone and Mineral Research 15:10, 1944-1949
CrossRef57
Barbara M. Obermayer-Pietsch, Gerwig E. Frühauf, Kornelia Chararas, Sabine Mikhail-Reinisch, Wilfried Renner, Andrea Berghold, Lukas Kenner, Carolin Lackner. (2000) Association of the Vitamin D Receptor Genotype BB with Low Bone Density in Hyperthyroidism. Journal of Bone and Mineral Research 15:10, 1950-1955
CrossRef58
Eduard Cabré, Miguel A Gassull. (2000) Nutritional and metabolic issues in cirrhosis and liver transplantation. Current Opinion in Clinical Nutrition and Metabolic Care 3:5, 345-354
CrossRef59
R. M. Kanan, S. S. Varanasi, R. M. Francis, L. Parker, H. K. Datta. (2000) Vitamin D receptor gene start codon polymorphism (FokI) and bone mineral density in healthy male subjects. Clinical Endocrinology 53:1, 93-98
CrossRef60
L. B. Henderson, J. S. Adams, D. R. Goldstein, G. D. Braunstein, J. I. Rotter, M. T. Scheuner. (2000) A familial risk profile for osteoporosis. Genetics in Medicine 2:4, 222-225
CrossRef61
M.E Greene, J Pitts, M.A McCarville, X.S Wang, J.A Newport, C Edelstein, F Lee, S Ghosh, S Chu. (2000) PPARγ: observations in the hematopoietic system
. Prostaglandins & Other Lipid Mediators 62:1, 45-73
CrossRef62
Laurence A. Rubin, Millan S. Patel, David E. C. Cole. (2000) Genetic determinants of bone mass acquisition and risk for osteoporosis. Drug Development Research 49:3, 216-226
CrossRef63
Brian S. Schwartz, Walter F. Stewart, Karl T. Kelsey, David Simon, Sunyeong Park, Jonathan M. Links, Andrew C. Todd. (2000) Associations of Tibial Lead Levels with BsmI Polymorphisms in the Vitamin D Receptor in Former Organolead Manufacturing Workers. Environmental Health Perspectives 108:3, 199-203
CrossRef64
Joanne E. Curran, Tanya Vaughan, Rod A. Lea, Stephen R. Weinstein, Nigel A. Morrison, Lyn R. Griffiths. (1999) Association of a vitamin D receptor polymorphism with sporadic breast cancer development. International Journal of Cancer 83:6, 723-726
CrossRef65
Sue C. Kaste, Russell W. Chesney, Melissa M. Hudson, Robert H. Lustig, Susan R. Rose, Laura D. Carbone. (1999) Bone Mineral Status During and After Therapy of Childhood Cancer: An Increasing Population with Multiple Risk Factors for Impaired Bone Health. Journal of Bone and Mineral Research 14:12, 2010-2014
CrossRef66
Gilberto Jaramillo-Rangel, Ricardo M. Cerda-Flores, Lilia Cardenas-Ibarra, Juan Tamayo-Orozco, Nigel Morrison, Hugo A. Barrera-Salda
a. (1999) Vitamin D receptor polymorphisms and bone mineral density in Mexican women without osteoporosis. American Journal of Human Biology 11:6, 793-797
CrossRef67
Maria Paz Marco, Isabel Martinez, Maria Luisa Amoedo, Merce Borras, Ramon Saracho, Jaume Almirall, Joan Fibla, Elvira Fernandez. (1999) Vitamin D receptor genotype influences parathyroid hormone and calcitriol levels in predialysis patients. Kidney International 56:4, 1349-1353
CrossRef68
Glinda S. Cooper. (1999) Genetic Studies of Osteoporosis: What Have We Learned?. Journal of Bone and Mineral Research 14:10, 1646-1648
CrossRef69
1999. Dairy Foods and Osteoporosis. .
CrossRef70
Luigi Gennari, Lucia Becherini, Riccardo Mansani, Laura Masi, Alberto Falchetti, Annamaria Morelli, Emanuela Colli, Stefano Gonnelli, Chiara Cepollaro, Maria Luisa Brandi. (1999) FokI Polymorphism at Translation Initiation Site of the Vitamin D Receptor Gene Predicts Bone Mineral Density and Vertebral Fractures in Postmenopausal Italian Women. Journal of Bone and Mineral Research 14:8, 1379-1386
CrossRef71
Serge Ferrari, René Rizzoli, Jean-Philippe Bonjour. (1999) Genetic aspects of osteoporosis. Current Opinion in Rheumatology 11:4, 294-300
CrossRef72
Artemis P. Simopoulos. (1999) Genetic Variation and Nutrition. Nutrition Reviews 57:5, 10-19
CrossRef73
Sharla K. Ames, Kenneth J. Ellis, Sheila K. Gunn, Kenneth C. Copeland, Steven A. Abrams. (1999) Vitamin D Receptor Gene Fok1 Polymorphism Predicts Calcium Absorption and Bone Mineral Density in Children. Journal of Bone and Mineral Research 14:5, 740-746
CrossRef74
Michiko Kanzawa, Toshitsugu Sugimoto, Tatsuya Kobayashi, Akira Kobayashi, Kazuo Chihara. (1999) Parathyroid hormone gene polymorphisms in primary hyperparathyroidism. Clinical Endocrinology 50:5, 583-588
CrossRef75
Robert D. Blank. (1999) Linkage, Association, and the Genetic Analysis of Bone Mineral Density and Related Phenotypes. Journal of Clinical Densitometry 2:1, 59-70
CrossRef76
Serge Ferrari, Jean-Philippe Bonjour, René Rizzoli. (1998) The Vitamin D Receptor Gene and Calcium Metabolism. Trends in Endocrinology & Metabolism 9:7, 259-265
CrossRef77
Vicente Gilsanz. (1998) Phenotype and Genotype of Osteoporosis. Trends in Endocrinology & Metabolism 9:5, 184-190
CrossRef78
Richard J. Wood, James C. Fleet. (1998) THE GENETICS OF OSTEOPOROSIS: Vitamin D Receptor Polymorphisms. Annual Review of Nutrition 18:1, 233-258
CrossRef79
Serge Ferrari, René Rizzoli, Danielle Manen, Daniel Slosman, Jean-Philippe Bonjour. (1998) Vitamin D Receptor Gene Start Codon Polymorphisms (FokI) and Bone Mineral Density: Interaction with Age, Dietary Calcium, and 3′-End Region Polymorphisms. Journal of Bone and Mineral Research 13:6, 925-930
CrossRef80
A.W.C Kung, S.S.C Yeung, K.S Lau. (1998) Vitamin D Receptor Gene Polymorphisms and Peak Bone Mass In Southern Chinese Women. Bone 22:4, 389-393
CrossRef81
Brian D. Golden. (1998) The prevention and treatment of osteoporosis. Arthritis Care & Research 11:2, 124-134
CrossRef82
S. L. Ferrari, R. Rizzoli, D. O. Slosman, J.-P. Bonjour. (1998) Do Dietary Calcium and Age Explain the Controversy Surrounding the Relationship Between Bone Mineral Density and Vitamin D Receptor Gene Polymorphisms?. Journal of Bone and Mineral Research 13:3, 363-370
CrossRef83
A. Goulding, R. Cannan, S. M. Williams, E. J. Gold, R. W. Taylor, N. J. Lewis-Barned. (1998) Bone Mineral Density in Girls with Forearm Fractures. Journal of Bone and Mineral Research 13:1, 143-148
CrossRef84
Riggs, B. Lawrence, . (1997) Vitamin D–Receptor Genotypes and Bone Density. New England Journal of Medicine 337:2, 125-126
Full Text
