Original Article
Differential Contributions of BRCA1 and BRCA2 to Early-Onset Breast Cancer
N Engl J Med 1997; 336:1416-1422May 15, 1997
- Abstract
Background
Germ-line mutations in the BRCA1 and BRCA2 genes predispose women to breast cancer. BRCA1 mutations are found in approximately 12 percent of women with breast cancer of early onset, and the specific mutation causing a deletion of adenine and guanine (185delAG), which is present in 1 percent of the Ashkenazi Jewish population, contributes to 21 percent of breast cancers among young Jewish women. The contribution of BRCA2 mutations to breast cancer of early onset is unknown.
Methods
Lymphocyte specimens from 73 women with breast cancer diagnosed by the age of 32 were studied for heterozygous mutations of BRCA2 by a complementary-DNA–based protein-truncation assay, followed by automated nucleotide sequencing. In addition, specimens from 39 Jewish women with breast cancer diagnosed by the age of 40 were tested for specific mutations by an allele-specific polymerase chain reaction.
Results
Definite BRCA2 mutations were found in 2 of the 73 women with early-onset breast cancer (2.7 percent; 95 percent confidence interval, 0.4 to 9.6 percent), suggesting that BRCA2 is associated with fewer cases than BRCA1 (P = 0.03). The specific BRCA2 mutation causing a deletion of thymine (6174delT), which is found in 1.3 percent of the Ashkenazi Jewish population, was observed in 1 of the 39 young Jewish women with breast cancer (2.6 percent; 95 percent confidence interval, 0.09 to 13.5 percent), indicating that it has a small role as a risk factor for early-onset breast cancer. Among young women with breast cancer, there are BRCA2 mutations that cause truncation of the extreme C terminus of the protein and that may be functionally silent, along with definite truncating mutations.
Conclusions
Germ-line mutations in BRCA2 contribute to fewer cases of breast cancer among young women than do mutations in BRCA1. Carriers of BRCA2 mutations may have a smaller increase in the risk of early-onset breast cancer.
Media in This Article
Figure 1
Identification and Location of BRCA2 Mutations That Truncate the Polypeptide Chain.Table 1
BRCA2 Mutations in 73 Women with Early-Onset Breast Cancer.Article Activity
- Article
Studies of large families many of whose members have cancer have led to the identification of two genes, BRCA1 and BRCA2, that, when mutated, predispose family members to breast cancer.1-4 Members of such kindreds who are heterozygous carriers of a germ-line mutation have a high probability of breast cancer.5,6 Families in which breast cancer is linked to a BRCA1 mutation also have increased susceptibility to ovarian cancer,1 and families in which the link is to a BRCA2 mutation include cases of male breast cancer.7 As in other syndromes involving a predisposition to cancer, familial cases of breast cancer occur at a considerably younger age than in the general population.8,9 In families with breast cancer, age-specific penetrance refers to the likelihood that breast cancer will develop in a carrier of a predisposing mutation by a certain age. For example, in these families this likelihood is approximately 20 percent by the age of 40 and 80 percent by the age of 70.5,6 However, it is difficult to infer the age-specific penetrance of BRCA1 and BRCA2 mutations in the general population from an analysis of kindreds with breast cancer, since these families were selected specifically because they have multiple affected members. In the general population, however, women with breast cancer at an early age are more likely than others to have a genetic predisposition, and we can define the relative contributions of mutant BRCA1 and BRCA2 genes in these women.
Mutations in the BRCA1 gene have been linked to half of all cases of familial breast cancer.2,10-14 Among women with cancer of early onset, who were not selected because of a family history, the frequency of germ-line BRCA1 mutations is approximately 12 percent.15,16 The frequency of such mutations in the general population is unknown, making it difficult to calculate the increase in the risk of breast cancer in a carrier who does not have a strong family history of breast cancer. However, the frequency of a specific BRCA1 mutation has been measured in the Ashkenazi Jewish population, both in otherwise unselected subjects and in a cohort of Jewish women with early-onset breast cancer. This mutation, which causes a deletion of adenine and guanine (185delAG), has been found in 1 percent of the Ashkenazi Jewish population17 and 21 percent of young Jewish women with breast cancer.16,18-20 It is calculated that the risk of early-onset breast cancer among carriers of the 185delAG mutation is 27 times higher than among noncarriers, suggesting that the age-specific penetrance of this BRCA1 mutation in the Jewish population generally is similar to that predicted from analyses of kindreds with breast cancer.16,17
Genetic-linkage analysis initially suggested that mutations in BRCA2 account for most cases of familial breast cancer in which there is no mutation of BRCA1.3,4,7 However, BRCA2 mutations have been found in only a fraction of kindreds in which BRCA1 mutations are absent,21,22 suggesting that the number of familial cases attributed to BRCA2 mutations has been overestimated. In the kindreds studied to date, BRCA2 mutations appear to confer a high probability of early-onset breast cancer.3,4,21,22 However, a specific BRCA2 mutation that causes a deletion of thymine (6174delT) has been reported in 1.3 percent of the Ashkenazi population23,24 but only 8 percent of Ashkenazi Jewish women with early-onset breast cancer, suggesting that its age-specific penetrance is lower than predicted.25 The relative contributions of BRCA1 and BRCA2 mutations to breast cancer in the general population are thus uncertain. To address this question, we screened the entire coding region of BRCA2 for truncating mutations in a cohort of women with breast cancer diagnosed at or before the age of 32; these women are presumed to be highly likely to have a genetic predisposition.
Methods
Study Patients
A cohort of 418 women with early-onset breast cancer (age at diagnosis, <40 years) has been described.16 This cohort was drawn from women with breast cancer diagnosed between 1981 and 1992 at Boston-area hospitals who provided blood samples for genetic analysis and to whom the results of the analyses were not disclosed. Pathological confirmation of the diagnosis and a clinical and family history were available in every case, along with lymphoblasts immortalized by infection with the Epstein–Barr virus (EBV). The entire BRCA2 coding region was screened for truncating mutations in 73 women with breast cancer diagnosed at or before the age of 32, who represented the subgroup at highest risk for a genetic predisposition. The specific BRCA1 and BRCA2 mutations that are prevalent in the Ashkenazi population were sought in 39 Jewish women with breast cancer diagnosed at or before the age of 40. To determine the population prevalence of the C-terminus–truncating mutations in BRCA2 that appear to be silent polymorphisms, we screened specimens from 130 anonymous blood donors. All the specimens used in the study were coded, and the patients' confidentiality was preserved, in accordance with the guidelines for studies of human subjects.
Analysis of Mutations
Since virtually all the BRCA2 mutations reported to date in kindreds with breast cancer result in premature termination of the polypeptide chain, we developed a complementary DNA (cDNA) –based protein-truncation assay to screen EBV-immortalized lymphoblasts from women with breast cancer. Total cellular messenger RNA (mRNA) was isolated by standard procedures and reverse-transcribed into cDNA with random hexanucleotide primers.
The entire coding region of BRCA2 spans 10 kilobases (kb); the region was divided into three overlapping fragments (Figure 1Figure 1
Identification and Location of BRCA2 Mutations That Truncate the Polypeptide Chain.) and amplified by the polymerase chain reaction (PCR) in a single multiplex reaction. The primers used were as follows: for fragment I, TGACCGGCGCGGTTTTTGTCAGC (sense) and TGATTATCTAATGCCAAGGTATT (antisense); for fragment II, CTGTCAATCCAGACTCTGAAG (sense) and CAGAAATTCTTGACCAGGTGCGG (antisense); and for fragment III, AACTGACAGATTCTAAACTGC (sense) and AACTGGAAAGGTTAAGCGTCA (antisense). The PCR conditions consisted of 5 cycles (94°C for 20 seconds, 64°C for 1 minute, and 68°C for 8 minutes) followed by 30 cycles (94°C for 20 seconds, 60°C for 1 minute, and 68°C for 7.5 minutes).The three products of the multiplex PCR were then used in a nested, internal PCR to generate eight overlapping fragments of approximately 1.5 kb each. Each sense primer used in this reaction contained the 5' extension GGATCCTAATACGACTCACTATAGGGAGACCACCATG, which encoded a T7 RNA polymerase recognition site, a start codon, and a Kozak translation-initiation consensus sequence, to allow efficient in vitro transcription and translation. The primers used were as follows: fragment 1, ATGCCTATTGGATCCAAAGAGAG (sense) and GATACCCTGAAATGAAGAAGCCAC (antisense); fragment 2, TCTATATTCAGAATAAGAGAATC (sense) and TGATTATCTAATGCCAAGGTATT (antisense); fragment 3, TTAGGAAATACTAAGGAACTTCA (sense) and ATTACCATGACATGCTTCTTGA (antisense); fragment 4, ACTGATCAGCACAACATATGTC (sense) and GGATTTTACCACTGGCTATCCTA (antisense); fragment 5, CCACAAACTGTAAATG-AAGATAT (sense) and ATGATGCATAAACAATCTTCGA (antisense); fragment 6, AAGGCTTCAAAAAGCACTCCA (sense) and AACTGGGCCTTAACAGCATACC (antisense); fragment 7, ACACTTGTTCTCTGTGTTTCT (sense) and TCTGCTTCATTGCAAAGTATGT (antisense); and fragment 8, GAAAGAGCTAACATACAGTTAGCA (sense) and AACTGGAAAGGTTAAGCGTCA (antisense). The PCR conditions consisted of 45 cycles (94°C for 30 seconds, 55 to 61°C for 30 seconds, and 72°C for 3 minutes).
One microgram of the PCR product was incubated with T7 polymerase, rabbit reticulocyte lysate, and [35S]methionine (Amersham) in a coupled transcription–translation reaction (Promega), followed by electrophoresis with 12 percent polyacrylamide–sodium dodecyl sulfate gel. The PCR products that gave rise to truncated peptides were analyzed by automated nucleotide sequencing of both strands, with dye-labeled dideoxy terminators (Applied Biosystems). Uncloned PCR products were analyzed to ensure that both alleles were represented and to avoid Taq polymerase–induced errors that might be present in individual PCR products. When necessary, potential mutations were confirmed by sequencing multiple cloned PCR products.
To detect the 6174delT mutation, an allele-specific PCR reaction was designed that used four primers in a single reaction. The primers were as follows: primer 1, TGGCAGGTTGTTACGAGGCATTGG (sense); primer 2, TAAATGTTCTGGAGTACGTATAGC (antisense); primer 3, GTGGGATTTTTAGCACAGCAAGTG (sense); and primer 4, CTGATACCTGGACAGATTTTCCCT (antisense). The PCR conditions consisted of 40 cycles (94°C for 30 seconds, 58°C for 30 seconds, and 72°C for 30 seconds). This reaction produces a PCR fragment containing 194 base pairs (bp) that is specific for the wild-type allele, a fragment of 299 bp that is specific for the mutant allele, and a control fragment of 448 or 449 bp that is common to both alleles.
To detect the mutation that causes a substitution of guanine for cytosine (C10152G), an allele-specific reverse-transcription PCR was designed that used the following primers: primer 1, TCTGTTTCCACACCTGTCTCAGC (sense); primer 2, TTTATTGTCGCCTTTGCAAATGC (antisense); primer 3, ACCAAGGAGTTGTGGCACCAAATAC (sense); and primer 4, CAGTTCTTTTTTCTTTATGGGTGTTTCC (antisense). The conditions were identical to those of the 6174delT PCR, except that the annealing temperature was 61°C. This reaction produces a 381-bp fragment specific for the wild-type allele, a 235-bp fragment specific for the mutant allele, and a control fragment of 566 bp common to both alleles.
The mutation that causes a substitution of thymine for adenine at position 10,204 (A10204T) was also detected by an allele-specific reverse-transcription PCR that used primers 1 and 2 as described in the preceding paragraph along with TTCTCCTCAGATGACTCCATTTA (sense) and ttccaaaagagaaattcattgaattttta (antisense). The PCR conditions were identical to those of the 6174delT reaction. This reaction produces a 321-bp fragment specific for the wild-type allele, a 290-bp fragment specific for the mutant allele, and a control fragment of 566 bp common to both alleles.
The BRCA1 mutation at position 5382 that causes an insertion of cytosine (5382insC) was detected by an allele-specific genomic PCR that used the following primers: primer 1, TAAAATGGACGTGTCTGCT (sense); primer 2, CTGCAAAGGGGAGTGGAATACAG (antisense); primer 3, CAAAGCGAGCAAGAGAATCCCA (sense); and primer 4, GAGCTTTACCTTTCTGTCC-TGGGGA (antisense). The PCR conditions were identical to those of the 6174delT reaction. This reaction produces a 100-bp fragment specific for the wild-type allele, a 175-bp fragment specific for the mutant allele, and a control fragment of 233 or 234 bp common to both alleles.
To identify definite mutations in the BRCA1 gene in 43 women who had breast cancer diagnosed between the ages of 30 and 32, we used a novel yeast-based truncation assay.26 In brief, the BRCA1 transcript was divided into three overlapping fragments (comprising codons 1 to 263, 224 to 1365, and 1324 to 1863) that were amplified by reverse-transcription PCR and inserted in the correct reading frame of the yeast gene URA3 by homologous recombination. The URA3 gene confers the ability to grow in the absence of uracil; yeast cells that contain a BRCA1–URA3 fusion protein derived from wild-type BRCA1 grow in the absence of uracil, whereas those containing a fusion protein derived from a BRCA1 fragment with a truncating mutation depend for their growth on the presence of uracil. This assay identifies carriers of heterozygous BRCA1 mutations, since in such carriers an average (± SD) of 49 ± 6 percent of the yeast cells containing the BRCA1–URA3 fusion protein require uracil for growth.
Statistical Analysis
The prevalence of BRCA1 mutations in the study patients was compared with that of BRCA2 mutations by Fisher's exact test. Exact 95 percent confidence intervals for these prevalence rates were calculated with StatXact 3 (Cytel Software). The risks associated with the two mutations were compared by testing the homogeneity of the odds ratios from tables comparing the rates of each mutation among cases and controls (cohorts of Ashkenazi Jewish women). This test assumes that the mutations are independent (an assumption that is believed to be biologically sound). A test that did not make this assumption but instead assumed that the cohorts are large enough to provide population rates gave similar results.
Results
We have previously described the clinical characteristics of a cohort of 418 women with breast cancer diagnosed at or before the age of 40.16 Among these women, bilateral breast cancer (in 5 percent) and a strong family history of breast cancer (in 7 percent) were clinical features indicating an increased risk for a genetic predisposition. Since virtually all the known BRCA2 mutations (32 of 33) in kindreds with breast cancer result in premature chain terminations,3,4,21,22 we used a protein-truncation assay that detects premature stop codons in the coding sequence of the gene, as described in the Methods section. Mutations identified by this approach were confirmed by nucleotide sequencing.
We initially studied the BRCA2 gene in the youngest subgroup of our cohort, 30 women who had breast cancer diagnosed before the age of 30 and had previously been screened for BRCA1 mutations.16 No BRCA2 mutations were detected. We therefore studied an additional 43 women whose breast cancer was diagnosed between the ages of 30 and 32. We detected two definite BRCA2 mutations in this group. Patient 110 had a deletion of four nucleotides, and Patient 420 had a deletion of two nucleotides. Both deletions were in exon 11 (Table 1Table 1
BRCA2 Mutations in 73 Women with Early-Onset Breast Cancer.), and both caused shifts in the codon reading frame that resulted in premature stop codons. Both women had a history of bilateral breast cancer, but neither had a family history of breast cancer.In addition to these two definite BRCA2 mutations, we detected two mutations in the last exon of the gene that resulted in truncation of the extreme C terminus of the protein (Table 1 and Figure 1). One of these two nonsense mutations in exon 27, A10204T, causes a deletion of 93 amino acids from the BRCA2 protein, which contains 3418 amino acids. The second nonsense mutation, C10152G, causes a deletion of 111 amino acids. A10204T (also called 3326ter, since it causes a deletion from amino acid 3326 to the C terminus) has recently been described as a silent polymorphism because a European study has found it to have a prevalence of 2.2 percent in both the general population and the population with breast cancer.27 This mutation was also reported in 1 of 115 controls from the United States,27 but we did not detect it in 130 healthy women in the Boston area. C10152G has not been reported previously, nor did we detect it in the 130 controls we studied. However, since this mutation causes truncation of the extreme C terminus of the BRCA2 protein, as does A10204T, C10152G is also likely to be functionally silent.
We compared the frequency of BRCA1 mutations with that of BRCA2 mutations in the cohort of 73 women with breast cancer diagnosed at or before the age of 32. We have previously reported16 four definite BRCA1 mutations in 30 women with breast cancer diagnosed before the age of 30. Using a yeast-based assay for truncating mutations,26 we identified BRCA1 mutations in 5 of 43 women with breast cancer diagnosed between the ages of 30 and 32 (Table 2Table 2
Definite BRCA1 Mutations in 73 Women with Early-Onset Breast Cancer.). Unlike mutations in the extreme C terminus of BRCA2, those in the extreme C terminus of BRCA1 are associated with a high likelihood of breast cancer (Breast Cancer Information Core electronic data base; Internet address, http://www.nchgr.nih.gov/dir/lab_transfer/bic/), indicating that all BRCA1 mutations that cause protein truncation can be considered definite mutations.The presence of common BRCA1 and BRCA2 mutations in the Ashkenazi Jewish population allows the relative risk of breast cancer associated with specific mutations to be calculated. We used an allele-specific PCR technique to test for specific mutations in 39 Jewish women who had breast cancer diagnosed at or before the age of 40. The BRCA2 mutation 6174delT, found in 1.3 percent of the Ashkenazi population overall,23,24 was detected in 1 of the 39 Jewish women with early-onset breast cancer (2.6 percent; 95 percent confidence interval, 0.09 to 13.5 percent). Two recurrent BRCA1 mutations in the Ashkenazi population are more strongly associated with breast cancer. The 5382insC mutation, which is present in 0.1 percent of the Ashkenazi population,23 was found in 1 of the 39 Jewish women with early-onset breast cancer (2.6 percent), and we have previously reported finding the 185delAG mutation, present in 1 percent of the Ashkenazi Jewish population,17 in 8 of these 39 women (21 percent)16 (Table 3Table 3
BRCA1 and BRCA2 Mutations in Women with Early-Onset Breast Cancer.).Discussion
We detected definite germ-line mutations in BRCA2 in 2 of 73 women with breast cancer diagnosed at or before the age of 32 (2.7 percent; 95 percent confidence interval, 0.4 to 9.6 percent). By contrast, in our analysis of the same cohort, we identified definite BRCA1 mutations in 9 of 73 women (12 percent; 95 percent confidence interval, 5.8 to 22 percent), including 4 of 30 women with breast cancer diagnosed before the age of 3016 and 5 of 43 women with breast cancer diagnosed between the ages of 30 and 32. Germ-line mutations in BRCA2 appear to contribute to a smaller fraction of cases of early-onset breast cancer in the general population than do germ-line mutations in BRCA1 (P = 0.03). Although this observation is unexpected, it is consistent with recent studies of kindreds with breast cancer. BRCA1 mutations are present in approximately half of such kindreds,2,10-14 but two recent studies found BRCA2 mutations in only 10 of 75 kindreds in which BRCA1 mutations were absent.21,22 Among patients with early-onset breast cancer in the general population, as well as in selected kindreds with breast cancer, BRCA2 mutations therefore occur approximately one fifth as often as BRCA1 mutations.
The infrequency of BRCA2 mutations among women with early-onset breast cancer may result simply from a low prevalence of these mutations in the population. From epidemiologic models, a frequency ranging from 1 in 400 to 1 in 800 has been calculated for all mutations predisposing women to breast cancer,5 but this estimate has yet to be confirmed by molecular studies, and the relative distribution of BRCA1 and BRCA2 mutations is unknown. However, studies of recurrent mutations in the Ashkenazi Jewish population suggest that mutations in these two genes differ not in their prevalence in the population, but rather in their associated risk for the development of breast cancer. Our analysis of three different mutations in 39 Jewish women with breast cancer diagnosed at or before the age of 40 showed considerable differences in age-specific penetrance. The common BRCA1 mutation 185delAG (which appears in 1 percent of the population17) is associated with an increase in the risk of early-onset breast cancer by a factor of 27 (95 percent confidence interval, 8 to 89). With the less common BRCA1 mutation 5382insC (which appears in 0.1 percent of the population23), the risk may increase by a factor of 20 (95 percent confidence interval, 0.4 to 212). In contrast, the risk of early-onset breast cancer associated with the common BRCA2 mutation 6174delT (which appears in 1.3 percent of the population23,24) is probably only doubled (95 percent confidence interval, 0.05 to 12) (P = 0.0166 for the comparison between the relative risks associated with the two common mutations, 185delAG in BRCA1 and 6174delT in BRCA2). The proportion of BRCA2 mutations as compared with BRCA1 mutations in our cohort of Jewish women with early-onset breast cancer is consistent with that in a large study of familial cases28 and somewhat lower than that in another study of cases with early onset.25 Taken together, these observations suggest that the risk of early-onset breast cancer associated with the BRCA2 mutation 6174delT is 1/10 to 1/5 of the risk associated with recurrent BRCA1 mutations in the Ashkenazi population.
The fact that virtually all BRCA2 mutations cause premature chain termination suggests that their effect on protein function may depend on where they truncate the protein. Like the BRCA2 mutations in Patients 110 and 420 (Table 1), the 6174delT mutation occurs within the large exon 11 and results in the loss of half the encoded protein (Figure 1). For this reason, it and many other BRCA2 mutations that truncate protein segments of comparable size probably have the same age-specific penetrance. In contrast, mutations that truncate the protein at the extreme C terminus, such as C10152G and A10204T in the terminal exon 27, may affect protein function minimally and thus have no effect on the development of breast cancer. These two adjacent mutations were each present in 1 of the 73 women with early-onset breast cancer whom we studied (1.4 percent). Although we did not detect either mutation in 130 healthy persons from the Boston area, A10204T has recently been reported in 2.2 percent of both patients with breast cancer and controls in a study in the United Kingdom, indicating that it is not a risk factor for breast cancer, but rather a silent polymorphism.26
In the absence of information on the functional domains of the protein encoded by BRCA2, further studies will be needed to determine whether silent mutations are restricted to exon 27 or whether other mutations in distal BRCA2 exons are associated with intermediate increases in the risk of breast cancer. The possibilities that the increase in the risk of early-onset breast cancer is smaller with BRCA2 mutations than with BRCA1 mutations and that a number of C terminus–truncating mutations in BRCA2 may be functionally silent call for caution in formulating clinical recommendations for carriers of BRCA2 mutations.
Supported by grants from Massachusetts General Hospital and the Monell Foundation (to Drs. Haber and Isselbacher), by a grant (CA60650) from the National Institutes of Health (to Dr. Bowcock), and from the Fonds zur Förderung der Wissenschaftlichen Forschung (Austria) (to Dr. Krainer).
We are indebted to the patients and volunteers who participated in this study and to their referring physicians; to Dr. S. Friend for establishing the germ-line tissue bank; and to S. Hegde, J. Bean, and S. Osborne-Lawrence for technical assistance.
Source Information
From the Center for Cancer Risk Analysis and the Massachusetts General Hospital Cancer Center, Charlestown, Mass. (M.K., S.S.-A., M.G.F., D.J.M., H.U., K.J.I., D.A.H.); the Divisions of Biostatistics (D.M.F.) and Hematology–Oncology (D.A.H.), Massachusetts General Hospital and Harvard Medical School, Boston; the Department of Clinical Oncology, Tohoku University, Sendai, Japan (A.S., C.I., R.K.); and the Division of Pediatric Hematology–Oncology, University of Texas Southwestern Medical Center, Dallas (A.B.).
Address reprint requests to Dr. Haber at the Laboratory of Molecular Genetics, Massachusetts General Hospital Cancer Center, CNY 7, Bldg. 149, 13th St., Charlestown, MA 02129.
- References
References
1
Hall JM ,Lee MK ,Newman B , et al. Linkage of early-onset familial breast cancer to chromosome 17q21. Science 1990;250:1684-1689
CrossRef | Web of Science | Medline2
Miki Y ,Swensen J ,Shattuck-Eidens D , et al. A strong candidate for the breast and ovarian cancer susceptibility gene BRCA1. Science 1994;266:66-71
CrossRef | Web of Science | Medline3
Wooster R ,Bignell G ,Lancaster J , et al. Identification of the breast cancer susceptibility gene BRCA2. Nature 1995;378:789-792
CrossRef | Web of Science | Medline4
Tavtigian SV ,Simard J ,Rommens J , et al. The complete BRCA2 gene and mutations in chromosome 13q-linked kindreds. Nat Genet 1996;12:333-337
CrossRef | Web of Science | Medline5
Easton DF ,Bishop DT ,Ford D ,Crockford GP . Genetic linkage analysis in familial breast and ovarian cancer: results from 214 families. Am J Hum Genet 1993;52:678-701
Web of Science | Medline6
Rowell S ,Newman B ,Boyd J ,King MC . Inherited predisposition to breast and ovarian cancer. Am J Hum Genet 1994;55:861-865
Web of Science | Medline7
Wooster R ,Neuhausen SL ,Mangion J , et al. Localization of a breast cancer susceptibility gene, BRCA2, to chromosome 13q12-13. Science 1994;265:2088-2090
CrossRef | Web of Science | Medline8
Ries LAG, Miller BA, Hankey BF, Kosary CL, Harras A, Edwards BK, eds. SEER cancer statistics review, 1973-1991: tables and graphs. Bethesda, Md.: National Cancer Institute, 1994. (NIH publication no. 94-2789.)
9
Claus EB ,Risch N ,Thompson WD . Genetic analysis of breast cancer in the Cancer and Steroid Hormone Study. Am J Hum Genet 1991;48:232-242
Web of Science | Medline10
Futreal PA ,Liu Q ,Shattuck-Eidens D , et al. BRCA1 mutations in primary breast and ovarian carcinomas. Science 1994;266:120-122
CrossRef | Web of Science | Medline11
Castilla LH ,Couch FJ ,Erdos MR , et al. Mutations in the BRCA1 gene in families with early-onset breast and ovarian cancer. Nat Genet 1994;8:387-391
CrossRef | Web of Science | Medline12
Simard J ,Tonin P ,Durocher F , et al. Common origins of BRCA1 mutations in Canadian breast and ovarian cancer families. Nat Genet 1994;8:392-398
CrossRef | Web of Science | Medline13
Friedman LS ,Ostermeyer EA ,Szabo CI , et al. Confirmation of BRCA1 by analysis of germline mutations linked to breast and ovarian cancer in ten families. Nat Genet 1994;8:399-404
CrossRef | Web of Science | Medline14
Shattuck-Eidens D ,McClure M ,Simard J , et al. A collaborative survey of 80 mutations in the BRCA1 breast and ovarian cancer susceptibility gene: implications for presymptomatic testing and screening. JAMA 1995;273:535-541
CrossRef | Web of Science | Medline15
Langston AA ,Malone KE ,Thompson JD ,Daling JR ,Ostrander EA . BRCA1 mutations in a population-based sample of young women with breast cancer. N Engl J Med 1996;334:137-142
Full Text | Web of Science | Medline16
FitzGerald MG ,MacDonald DJ ,Krainer M , et al. Germ-line BRCA1 mutations in Jewish and non-Jewish women with early-onset breast cancer. N Engl J Med 1996;334:143-149
Full Text | Web of Science | Medline17
Struewing JP ,Abeliovich D ,Peretz T , et al. The carrier frequency of the BRCA1 185delAG mutation is approximately 1 percent in Ashkenazi Jewish individuals. Nat Genet 1995;11:198-200
CrossRef | Web of Science | Medline18
Offit K ,Gilewski T ,McGuire P , et al. Germline BRCA1 185delAG mutations in Jewish women with breast cancer. Lancet 1996;347:1643-1645
CrossRef | Web of Science | Medline19
Muto MG ,Cramer DW ,Tangir J ,Berkowitz R ,Mok S . Frequency of the BRCA1 185delAG mutation among Jewish women with ovarian cancer and matched population controls. Cancer Res 1996;56:1250-1252
Web of Science | Medline20
Berman DB ,Wagner-Costalas J ,Schultz DC ,Lynch HT ,Daly M ,Godwin AK . Two distinct origins of a common BRCA1 mutation in breast-ovarian cancer families: a genetic study of 15 185delAG-mutation kindreds. Am J Hum Genet 1996;58:1166-1176
Web of Science | Medline21
Couch FJ ,Farid LM ,DeShano ML , et al. BRCA2 germline mutations in male breast cancer cases and breast cancer families. Nat Genet 1996;13:123-125
CrossRef | Web of Science | Medline22
Phelan CM ,Lancaster JM ,Tonin P , et al. Mutation analysis of the BRCA2 gene in 49 site-specific breast cancer families. Nat Genet 1996;13:120-122
CrossRef | Web of Science | Medline23
Roa BB ,Boyd AA ,Volcik K ,Richards CS . Ashkenazi Jewish population frequencies for common mutations in BRCA1 and BRCA2. Nat Genet 1996;14:185-187
CrossRef | Web of Science | Medline24
Oddoux C ,Struewing JP ,Clayton CM , et al. The carrier frequency of the BRCA2 6174delT mutation among Ashkenazi Jewish individuals is approximately 1%. Nat Genet 1996;14:188-190
CrossRef | Web of Science | Medline25
Neuhausen S ,Gilewski T ,Norton L , et al. Recurrent BRCA2 6174delT mutations in Ashkenazi Jewish women affected by breast cancer. Nat Genet 1996;13:126-128
CrossRef | Web of Science | Medline26
Ishioka C ,Suzuki T ,FitzGerald M , et al. Detection of heterozygous truncating mutations in the BRCA1 and APC genes by using a rapid screening assay in yeast. Proc Natl Acad Sci U S A 1997;94:2449-2453
CrossRef | Web of Science | Medline27
Mazoyer S ,Dunning A ,Serova O , et al. A polymorphic stop codon in BRCA2. Nat Genet 1996;14:253-254
CrossRef | Web of Science | Medline28
Tonin P ,Weber B ,Offit K , et al. Frequency of recurrent BRCA1 and BRCA2 mutations in Ashkenazi Jewish breast cancer families. Nat Med 1996;11:1179-1183
CrossRef | Web of Science
- Citing Articles (65)
Citing Articles
1
Rohini Roy, Jarin Chun, Simon N. Powell. (2011) BRCA1 and BRCA2: different roles in a common pathway of genome protection. Nature Reviews Cancer 12:1, 68-78
CrossRef2
D G R Evans, A Moran, R Hartley, J Dawson, B Bulman, F Knox, A Howell, F Lalloo. (2010) Long-term outcomes of breast cancer in women aged 30 years or younger, based on family history, pathology and BRCA1/BRCA2/TP53 status. British Journal of Cancer 102:7, 1091-1098
CrossRef3
Mariko D. DeWire, David W. Ellison, Zoltan Patay, Peter J. McKinnon, Robert P. Sanders, Amar Gajjar. (2009) Fanconi anemia and biallelic BRCA2 mutation diagnosed in a young child with an embryonal CNS tumor. Pediatric Blood & Cancer 53:6, 1140-1142
CrossRef4
E Hiripi, J Lorenzo Bermejo, X Li, J Sundquist, K Hemminki. (2009) Familial association of pancreatic cancer with other malignancies in Swedish families. British Journal of Cancer 101:10, 1792-1797
CrossRef5
Kannan Vaidyanathan, Smita Lakhotia, H. M. Ravishankar, Umaira Tabassum, Geetashree Mukherjee, Kumaravel Somasundaram. (2009) BRCA1 and BRCA2 germline mutation analysis among Indian women from south India: identification of four novel mutations and high-frequency occurrence of 185delAG mutation. Journal of Biosciences 34:3, 415-422
CrossRef6
Xiao-Yun Yang, Ming-Rong Xi, Kai-Xuan Yang, Hai Yu. (2009) Prognostic value of estrogen receptor and progesterone receptor status in young Chinese ovarian carcinoma patients. Gynecologic Oncology 113:1, 99-104
CrossRef7
J. Veltman, R. Mann, T. Kok, I. M. Obdeijn, N. Hoogerbrugge, J. G. Blickman, C. Boetes. (2008) Breast tumor characteristics of BRCA1 and BRCA2 gene mutation carriers on MRI. European Radiology 18:5, 931-938
CrossRef8
Daphne W. Bell, Sang H. Kim, Andrew K. Godwin, Taryn A. Schiripo, Patricia L. Harris, Sara M. Haserlat, Doke C.R. Wahrer, Christopher A. Haiman, Mary B. Daly, Kristin B. Niendorf, Matthew R. Smith, Dennis C. Sgroi, Judy E. Garber, Olufunmilayo I. Olopade, Loic Le Marchand, Brian E. Henderson, David Altshuler, Daniel A. Haber, Matthew L. Freedman. (2007) Genetic and functional analysis ofCHEK2 (CHK2) variants in multiethnic cohorts. International Journal of Cancer 121:12, 2661-2667
CrossRef9
James D. Fackenthal, Olufunmilayo I. Olopade. (2007) Breast cancer risk associated with BRCA1 and BRCA2 in diverse populations. Nature Reviews Cancer 7:12, 937-948
CrossRef10
Antonino Musolino, Maria A. Bella, Beatrice Bortesi, Maria Michiara, Nadia Naldi, Paola Zanelli, Marzia Capelletti, Debora Pezzuolo, Roberta Camisa, Mario Savi, Tauro M. Neri, Andrea Ardizzoni. (2007) BRCA mutations, molecular markers, and clinical variables in early-onset breast cancer: A population-based study. The Breast 16:3, 280-292
CrossRef11
M.S. Moran, B.G. Haffty. (2007) 1–51 The prevalence of germline BRCA1 and BRCA2 mutations in young women with breast cancer undergoing breast-conservation therapy. Breast Diseases: A Year Book Quarterly 18:1, 86-87
CrossRef12
Francesco Sardanelli, Franca Podo. (2007) Breast MR imaging in women at high-risk of breast cancer. Is something changing in early breast cancer detection?. European Radiology 17:4, 873-887
CrossRef13
Giuseppe Giannini, Carlo Capalbo, Elisabetta Ristori, Enrico Ricevuto, Tina Sidoni, Amelia Buffone, Enrico Cortesi, Paolo Marchetti, Giovanni Scambia, Silverio Tomao, Christian Rinaldi, Massimo Zani, Sergio Ferraro, Luigi Frati, Isabella Screpanti, Alberto Gulino. (2006) Novel BRCA1 and BRCA2 germline mutations and assessment of mutation spectrum and prevalence in Italian breast and/or ovarian cancer families. Breast Cancer Research and Treatment 100:1, 83-91
CrossRef14
Mehra Golshan, Alex Miron, Asa J. Nixon, Judy E. Garber, Ethan P. Cash, James Dirk Iglehart, Jay R. Harris, Julia S. Wong. (2006) The prevalence of germline BRCA1 and BRCA2 mutations in young women with breast cancer undergoing breast-conservation therapy. The American Journal of Surgery 192:1, 58-62
CrossRef15
Orland Díez, Sara Gutiérrez-Enríquez, Teresa Ramón Cajal. (2006) Genes de susceptibilidad al cáncer de mama. Medicina Clínica 126:8, 304-310
CrossRef16
Eduardo Nagore, Alegr??a Montoro, Silvestre Oltra, Eduardo Ledesma, Rafael Botella-Estrada, Jos?? M. Mill??n, Vicente Oliver, Jos?? M. Fortea, Carlos Guill??n. (2005) Age does not appear to be a major indicator of CDKN2A or CDK4 mutations in melanoma patients in Spain. Melanoma Research 15:6, 555-558
CrossRef17
Grazia Palomba, Marina Pisano, Antonio Cossu, Mario Budroni, Maria F. Dedola, Antonio Farris, Antonio Contu, Paola Baldinu, Francesco Tanda, Giuseppe Palmieri. (2005) Spectrum and prevalence ofBRCA1 andBRCA2 germline mutations in Sardinian patients with breast carcinoma through hospital-based screening. Cancer 104:6, 1172-1179
CrossRef18
Sean T Martin, Hiroyuki Matsubayashi, Carmelle D Rogers, Juliet Philips, Fergus J Couch, Kieran Brune, Charles J Yeo, Scott E Kern, Ralph H Hruban, Michael Goggins. (2005) Increased prevalence of the BRCA2 polymorphic stop codon K3326X among individuals with familial pancreatic cancer. Oncogene 24:22, 3652-3656
CrossRef19
Kathleen K. Oros, Parviz Ghadirian, Celia M.T Greenwood, Chantal Perret, Zhen Shen, Yosabeth Paredes, Suzanna L. Arcand, Anne-Marie Mes-Masson, Steven A. Narod, William D. Foulkes, Diane Provencher, Patricia N. Tonin. (2004) Significant proportion of breast and/or ovarian cancer families of French Canadian descent harbor 1 of 5BRCA1 andBRCA2 mutations. International Journal of Cancer 112:3, 411-419
CrossRef20
Peter Berg, Ann-Marie Wennberg, Rainer Tuominen, Birgitta Sander, Barbro Lundh Rozell, Anton Platz, Johan Hansson. (2004) Germline CDKN2A mutations are rare in child and adolescent cutaneous melanoma. Melanoma Research 14:4, 251-255
CrossRef21
André Nkondjock, Parviz Ghadirian. (2004) Epidemiology of breast cancer among BRCA mutation carriers: an overview. Cancer Letters 205:1, 1-8
CrossRef22
Wendy S. Rubinstein. (2004) Hereditary breast cancer in Jews. Familial Cancer 3:3-4, 249-257
CrossRef23
G Hirsh-Yechezkel, A Chetrit, F Lubin, E Friedman, T Peretz, R Gershoni, S Rizel, J.P Struewing, B Modan. (2003) Population attributes affecting the prevalence of BRCA mutation carriers in epithelial ovarian cancer cases in israel. Gynecologic Oncology 89:3, 494-498
CrossRef24
Elizabeth B. Claus, Meredith Stowe, Darryl Carter. (2003) Family History of Breast and Ovarian Cancer and the Risk of Breast Carcinoma in situ. Breast Cancer Research and Treatment 78:1, 7-15
CrossRef25
G. Marie Swanson, Sandra Z. Haslam, Faouzi Azzouz. (2003) Breast cancer among young African-American women. Cancer 97:S1, 273-279
CrossRef26
Shou-Tung Chen, Ruei-A Chen, Shou-Jen Kuo, Yi-Chih Chien. (2003) Mutational Screening of Breast Cancer Susceptibility Gene 1 from Early Onset, Bi-lateral, and Familial Breast Cancer Patients in Taiwan. Breast Cancer Research and Treatment 77:2, 133-143
CrossRef27
Madeleine Tilanus-Linthorst, Leon Verhoog, Inge-Marie Obdeijn, Karina Bartels, Marian Menke-Pluymers, Alexander Eggermont, Jan Klijn, Hanne Meijers-Heijboer, Theo van der Kwast, Cecile Brekelmans. (2002) A BRCA1/2 mutation, high breast density and prominent pushing margins of a tumor independently contribute to a frequent false-negative mammography. International Journal of Cancer 102:1, 91-95
CrossRef28
James D. Fackenthal, Luca Cartegni, Adrian R. Krainer, Olufunmilayo I. Olopade. (2002) BRCA2 T2722R Is a Deleterious Allele That Causes Exon Skipping. The American Journal of Human Genetics 71:3, 625-631
CrossRef29
I BARNESKEDAR, S PLON. (2002) Counseling the at risk patient in the and Era. Obstetrics and Gynecology Clinics of North America 29:2, 341-366
CrossRef30
Kristen M. Shannon, Marcie L. Lubratovich, Dianne M. Finkelstein, Barbara L. Smith, Simon N. Powell, Michael V. Seiden. (2002) Model-based predictions of BRCA1/2 mutation status in breast carcinoma patients treated at an academic medical center. Cancer 94:2, 305-313
CrossRef31
Nelson L.S Tang, K.W Choy, C.P Pang, W Yeo, P.J Johnson. (2001) Prevalence of breast cancer predisposition gene mutations in Chinese women and guidelines for genetic testing. Clinica Chimica Acta 313:1-2, 179-185
CrossRef32
Patricia N. Tonin, Chantal Perret, Julie A. Lambert, Anne-Jos
e Paradis, Tania Kantemiroff, Marie-H
CrossRef33
Christine M. Velicer, Stephen Taplin. (2001) Genetic testing for breast cancer: Where are health care providers in the decision process?. Genetics in Medicine 3:2, 112-119
CrossRef34
Noriko Ikeda, Yasuo Miyoshi, Kohri Yoneda, Eiichi Shiba, Yoshizo Sekihara, Moritoshi Kinoshita, Shinzaburo Noguchi. (2001) Frequency ofBRCA1 andBRCA2 germline mutations in Japanese breast cancer families. International Journal of Cancer 91:1, 83-88
CrossRef35
Alfonso Lopez-Touza, Jorge F. Cameselle-Teijeiro, Avelino Senra-Varela. (2001) Familial Breast Cancer: Proposal of New Criteria. The Breast Journal 7:1, 70-71
CrossRef36
J. Kollias, S. Man, M. Marafie, K. Carpenter, S. Pinder, I.O. Ellis, R.W. Blamey, G. Cross, J.D. Brook. (2000) Loss of Heterozygosity in Bilateral Breast Cancer. Breast Cancer Research and Treatment 64:3, 241-251
CrossRef37
Ellen T Matloff. (2000) The breast surgeon’s role in BRCA1 and BRCA2 testing. The American Journal of Surgery 180:4, 294-298
CrossRef38
D Turchetti, L Cortesi, M Federico, C Bertoni, L Mangone, Se Ferrari, V Silingardi. (2000) BRCA1 mutations and clinicopathological features in a sample of Italian women with early-onset breast cancer. European Journal of Cancer 36:16, 2083-2089
CrossRef39
Dwight E. Heron, Lydia T. Komarnicky, Terry Hyslop, Gordon F. Schwartz, Carl M. Mansfield. (2000) Bilateral breast carcinoma. Cancer 88:12, 2739-2750
CrossRef40
Sozos J. Fasouliotis, Joseph G. Schenker. (2000) BRCA1 and BRCA2 Gene Mutations: Decision-Making Dilemmas Concerning Testing and Management. Obstetrical & Gynecological Survey 55:6, 373-384
CrossRef41
Pierre O. Chappuis, Victoria Nethercot, William D. Foulkes. (2000) Clinico-pathological characteristics of BRCA1- and BRCA2-related breast cancer. Seminars in Surgical Oncology 18:4, 287-295
CrossRef42
Kathleen E. Malone, Janet R. Daling, Cassandra Neal, Nicola M. Suter, Cecilia O'Brien, Kara Cushing-Haugen, Thora J. Jonasdottir, Jennifer D. Thompson, Elaine A. Ostrander. (2000) Frequency ofBRCA1/BRCA2 mutations in a population-based sample of young breast carcinoma cases. Cancer 88:6, 1393-1402
CrossRef43
M Tilanus-Linthorst. (2000) Earlier detection of breast cancer by surveillance of women at familial risk. European Journal of Cancer 36:4, 514-519
CrossRef44
Joel S. Solomon, Charles F. Brunicardi, Jeffrey D. Friedman. (2000) Evaluation and Treatment of BRCA-Positive Patients. Plastic & Reconstructive Surgery 105:2, 714-719
CrossRef45
John F. Stratton, Deborah Thompson, Lynda Bobrow, Neha Dalal, Martin Gore, D.T. Bishop, Ian Scott, Gareth Evans, Peter Daly, Douglas F. Easton, Bruce A.J. Ponder. (1999) The Genetic Epidemiology of Early-Onset Epithelial Ovarian Cancer: A Population-Based Study. The American Journal of Human Genetics 65:6, 1725-1732
CrossRef46
Maryse Fiche, Hervé Avet-Loiseau, Marie-Françoise Heymann, Frédéric Moussaly, Christine Digabel, Madeleine Joubert, Jean-Marc Classe, François Dravet, Pierre Fumoleau, Jeffrey Ross, Christine M. Maugard. (1999) Genetic alterations in early-onset invasive breast carcinomas: Correlation of c-erbB-2 amplification detected by fluorescenceIn situ hybridization with p53 accumulation and tumor phenotype. International Journal of Cancer 84:5, 511-515
CrossRef47
E. Warner, W. Foulkes, P. Goodwin, W. Meschino, J. Blondal, C. Paterson, H. Ozcelik, P. Goss, D. Allingham-Hawkins, N. Hamel, L. Di Prospero, V. Contiga, C. Serruya, M. Klein, R. Moslehi, J. Honeyford, A. Liede, G. Glendon, J.-S. Brunet, S. Narod. (1999) Prevalence and Penetrance of BRCA1 and BRCA2 Gene Mutations in Unselected Ashkenazi Jewish Women With Breast Cancer. JNCI Journal of the National Cancer Institute 91:14, 1241-1247
CrossRef48
J. Peto, N. Collins, R. Barfoot, S. Seal, W. Warren, N. Rahman, D. F. Easton, C. Evans, J. Deacon, M. R. Stratton. (1999) Prevalence of BRCA1 and BRCA2 Gene Mutations in Patients With Early-Onset Breast Cancer. JNCI Journal of the National Cancer Institute 91:11, 943-949
CrossRef49
P. Devilee. (1999) BRCA1 and BRCA2 Testing: Weighing the Demand against the Benefits. The American Journal of Human Genetics 64:4, 943-948
CrossRef50
John Bell. (1998) Medical implications of understanding complex disease traits. Current Opinion in Biotechnology 9:6, 573-577
CrossRef51
Nazneen Rahman, Michael R. Stratton. (1998) THE GENETICS OF BREAST CANCER SUSCEPTIBILITY. Annual Review of Genetics 32:1, 95-121
CrossRef52
I. Craig Henderson, Anthony J. Patek. (1998) The relationship between prognostic and predictive factors in the management of breast cancer. Breast Cancer Research and Treatment 52:1-3, 261-288
CrossRef53
Beverly J Lynch, Joseph A Holden, Saundra S Buys, Susan L Neuhausen, David K Gaffney. (1998) Pathobiologic characteristics of hereditary breast cancer. Human Pathology 29:10, 1140-1144
CrossRef54
Albert de la Chapelle, Päivi Peltomäki. (1998) The genetics of hereditary common cancers. Current Opinion in Genetics & Development 8:3, 298-303
CrossRef55
Daniel A Haber, Eric R Fearon. (1998) The promise of cancer genetics. The Lancet 351, SII1-SII8
CrossRef56
G. Bruce Mann, Patrick I. Borgen. (1998) Breast cancer genes and the surgeon. Journal of Surgical Oncology 67:4, 267-274
CrossRef57
Kim E. Nichols, Frederick P. Li, Daniel A. Haber, Lisa Diller. (1998) Childhoood cancer predisposition: Applications of molecular testing and future implications. The Journal of Pediatrics 132:3, 389-397
CrossRef58
Leif W. Ellisen, MD, PhD, Daniel A. Haber, MD, PhD. (1998) HEREDITARY BREAST CANCER. Annual Review of Medicine 49:1, 425-436
CrossRef59
FRED GILBERT, MARY KAY DABNEY, KAREN DIEMER, SAMANTHA LUDWIG, GLADYS ROSENTHAL, MICHAEL P. OSBORNE. (1997) BRCA1/BRCA2 Mutations and Breast Cancer in Ashkenazi Jewish Women. Annals of the New York Academy of Sciences 833:1 Cancer, 198-203
CrossRef60
AJ Swerdlow, BL De Stavola, MA Swanwick, NES Maconochie. (1997) Risks of breast and testicular cancers in young adult twins in England and Wales: evidence on prenatal and genetic aetiology. The Lancet 350:9093, 1723-1728
CrossRef61
(1997) Risk of Breast Cancer in Carriers of BRCA Gene Mutations. New England Journal of Medicine 337:11, 787-789
Full Text62
Healy, Bernadine, . (1997) BRCA Genes — Bookmaking, Fortunetelling, and Medical Care. New England Journal of Medicine 336:20, 1448-1449
Full Text63
Schrag, Deborah, Kuntz, Karen M., Garber, Judy E., Weeks, Jane C., . (1997) Decision Analysis — Effects of Prophylactic Mastectomy and Oophorectomy on Life Expectancy among Women with BRCA1 or BRCA2 Mutations. New England Journal of Medicine 336:20, 1465-1471
Full Text64
MOHAMMAD R. ABBASZADEGAN, JEFFERY P. STRUEWING, KEVIN M. BROWN, JIM V. SNIDER, FREDRICO GOODSAID, ROBERT GORE-LANGTON, MARK R. HUGHES. (1997) Automated Detection of Prevalent Mutations in BRCA1 and BRCA2 Genes, Using a Fluorogenic PCR Allelic Discrimination Assay. Genetic Testing 1:3, 171-180
CrossRef65
SUSAN L. NEUHAUSEN, ELAINE A. OSTRANDER. (1997) Mutation Testing of Early-Onset Breast Cancer Genes BRCA1 and BRCA2. Genetic Testing 1:2, 75-83
CrossRef
