Correspondence
Mutations of the Hereditary Hemochromatosis Candidate Gene HLA-H in Porphyria Cutanea Tarda
N Engl J Med 1997; 336:1327-1328May 1, 1997
- Article
To the Editor:
Porphyria cutanea tarda is characterized by reduced activity of uroporphyrinogen decarboxylase, with hepatic accumulation of uroporphyrins, and photosensitive skin lesions. The clinical symptoms are effectively treated by phlebotomy. Excess hepatic iron, together with inappropriately high iron absorption, also occurs in porphyria cutanea tarda.1 An association between this disorder and HLA-linked hereditary hemochromatosis has been suggested2 but also contested.3 Recently, a new major-histocompatibility-complex (MHC) class I–like gene, HLA-H, has been identified, and two missense variants were found in 87 percent of unselected patients with hereditary hemochromatosis.4 That this gene has a role in hemochromatosis is supported by studies implicating MHC class I–like proteins in iron metabolism.5
We assessed the role of HLA-H mutations in porphyria cutanea tarda by an allelic-association study between porphyria cutanea tarda and the two described HLA-H mutations. Fifteen unselected, unrelated patients with porphyria cutanea tarda being treated with regular phlebotomy were studied. The diagnosis was based on the typical symptoms of photosensitive skin and elevated urinary uroporphyrin levels. The controls were 23 anonymous blood donors and 71 patients with hereditary hemochromatosis.
Genomic DNA was extracted from blood leukocytes. Polymerase-chain-reaction (PCR) amplification of exons 2 and 4 (encoding the α1 and α3 domains) was performed with primers 5
CACACTCTCTGCACTACCTCTTCA3
We found that 6 of the 15 patients with porphyria cutanea tarda were homozygous for either the α1 or the α3 mutation; 2 were compound heterozygous carriers of the α1 mutation and the α3 mutation, and 5 were heterozygous for either mutation; 2 patients had no detectable mutations. The allelic frequency of the α1 and α3 mutations in the normal blood donors, patients with porphyria cutanea tarda, and patients with hereditary hemochromatosis is shown in Table 1Table 1
HLA-H Mutations in Patients with Hereditary Hemochromatosis, Patients with Porphyria Cutanea Tarda, and Normal Blood Donors..The high prevalence of these mutations in our patients suggests the involvement of the HLA-H gene in the pathogenesis of porphyria cutanea tarda. Our results suggest that all first-degree relatives of patients with porphyria cutanea tarda should be screened for hereditary hemochromatosis.
5 ReferencesManuela Santos, M.Sc.
Hans C. Clevers, M.D., Ph.D.
Joannes J.M. Marx, M.D., Ph.D.
University Hospital Utrecht, 3508 GA Utrecht, the Netherlands1
Turnbull A ,Baker H ,Vernon-Roberts B ,Magnus IA . Iron metabolism in porphyria cutanea tarda and in erythropoietic protoporphyria. Q J Med 1973;42:341-355
Web of Science | Medline2
Kushner JP ,Edwards CQ ,Dadone MM ,Skolnick MH . Heterozygosity for HLA-linked hemochromatosis as a likely cause of the hepatic siderosis associated with sporadic porphyria cutanea tarda. Gastroenterology 1985;88:1232-1238
Web of Science | Medline3
Beaumont C ,Nordmann Y ,Fauchet R . HLA-linked hemochromatosis and sporadic porphyria cutanea tarda. Gastroenterology 1986;90:800-800
Web of Science | Medline4
Feder JN ,Gnirke A ,Thomas W , et al. A novel MHC class I-like gene is mutated in patients with hereditary haemochromatosis. Nat Genet 1996;13:399-408
CrossRef | Web of Science | Medline5
Santos M ,Schilham MW ,Rademakers LH ,Marx JJ ,de Sousa M ,Clevers H . Defective iron homeostasis in β2-microglobulin knockout mice recapitulates hereditary hemochromatosis in man. J Exp Med 1996;184:1975-1985
CrossRef | Web of Science | Medline
- Citing Articles (24)
Citing Articles
1
Daniel F. Wallace, V. Nathan Subramaniam. (2009) Co-factors in liver disease: The role of HFE-related hereditary hemochromatosis and iron. Biochimica et Biophysica Acta (BBA) - General Subjects 1790:7, 663-670
CrossRef2
A. Ramírez-Santos, D. González-Vilas, J. García-Gavín, J. Concheiro, D. Sánchez-Aguilar, J. Toribio. (2009) Porphyria Cutanea Tarda and Hemochromatosis in Spain. Actas Dermo-Sifiliográficas (English Edition) 100:4, 329-331
CrossRef3
A. Ramírez-Santos, D. González-Vilas, J. García-Gavín, J. Concheiro, D. Sánchez-Aguilar, J. Toribio. (2009) Porfiria cutánea tarda y hemocromatosis en España. Actas Dermo-Sifiliográficas 100:4, 329-331
CrossRef4
A Toll, R Celis, MD Ozalla, M Bruguera, C Herrero, MG Ercilla. (2006) The prevalence of HFE C282Y gene mutation is increased in Spanish patients with porphyria cutanea tarda without hepatitis C virus infection. Journal of the European Academy of Dermatology and Venereology 20:10, 1201-1206
CrossRef5
P. Harper, Y. Floderus, P. Holmstrom, G. Eggertsen, M. Gafvels. (2004) Enrichment of HFE mutations in Swedish patients with familial and sporadic form of porphyria cutanea tarda. Journal of Internal Medicine 255:6, 684-688
CrossRef6
Zsuzsanna Nagy, Ferenc Koszo, Alajos Par, Gabriella Emri, Iren Horkay, Margit Horanyi, Oszkar Karadi, Gyorgy Rumi, Marta Morvay, Viktoria Varga, Attila Dobozy, Gyula Mozsik. (2004) Hemochromatosis (HFE) gene mutations and hepatitis C virus infection as risk factors for porphyria cutanea tarda in Hungarian patients. Liver International 24:1, 16-20
CrossRef7
D.J. Eedy, J.S.C. English. (2004) Updates from the British Association of Dermatologists 83rd Annual Meeting, 1-4 July 2003, Brighton, U.K.. British Journal of Dermatology 150:1, 11-32
CrossRef8
O. Dereure, P. Aguilar-Martinez, D. Bessis, P. Perney, C. Vallat, B. Guillot, F. Blanc, J-J. Guilhou. (2001) HFE mutations and transferrin receptor polymorphism analysis in porphyria cutanea tarda: a prospective study of 36 cases from southern France. British Journal of Dermatology 144:3, 533-539
CrossRef9
B de Valk, R.S.G.M Witlox, Y.T van der Schouw, J.J.M Marx. (2000) Biochemical expression of heterozygous hereditary hemochromatosis. European Journal of Internal Medicine 11:6, 317-321
CrossRef10
Narelle R Bleasel, George A Varigos. (2000) Porphyria cutanea tarda. Australasian Journal of Dermatology 41:4, 197-208
CrossRef11
Jennifer J. Brady, Helen A. Jackson, Andrew G. Roberts, Rhian R. Morgan, Sharon D. Whatley, Gareth Lloyd Rowlands, Cindy Darby, Emma Shudell, Rosemarie Watson, Janice Paiker, Mark W. Worwood, George H. Elder. (2000) Co-Inheritance of Mutations in the Uroporphyrinogen Decarboxylase and Hemochromatosis Genes Accelerates the Onset of Porphyria Cutanea Tarda. Journal of Investigative Dermatology 115:5, 868-874
CrossRef12
de Valk, Addicks, Gosriwatana, Lu, Hider, M. Marx. (2000) Non-transferrin-bound iron is present in serum of hereditary haemochromatosis heterozygotes. European Journal of Clinical Investigation 30:3, 248-251
CrossRef13
Omar Racchi, Rosa Mangerini, Davide Rapezzi, Gian Franco Gaetani, Maria Teresa Nobile, Antonino Picciotto, Anna Maria Ferraris. (1999) Mutations of the HFE Gene and the Risk of Hepatocellular Carcinoma. Blood Cells, Molecules, and Diseases 25:6, 350-353
CrossRef14
Kenneth W. Alanen, Subrata Chakrabarti, Jenna J. Rawlins, William Howson, Gary Jeffrey, Paul C. Adams. (1999) Prevalence of the C282Y mutation of the hemochromatosis gene in liver transplant recipients and donors. Hepatology 30:3, 665-669
CrossRef15
Mauro D’Amato, Annelisa Macri′, Daniela Griso, Gianfranco Biolcati, Franco Ameglio. (1998) Are His63Asp or Cys282Tyr HFE Mutations Associated with Porphyria Cutanea Tarda? Data of Patients from Central and Southern Italy. Journal of Investigative Dermatology 111:6, 1241-1242
CrossRef16
Manuel Mendez, Lonnie Sorkin, Maria Victoria Rossetti, Kenneth H. Astrin, Alcira M. del C. Batlle, Victoria E. Parera, Gerardo Aizencang, Robert J. Desnick. (1998) Familial Porphyria Cutanea Tarda: Characterization of Seven Novel Uroporphyrinogen Decarboxylase Mutations and Frequency of Common Hemochromatosis Alleles. The American Journal of Human Genetics 63:5, 1363-1375
CrossRef17
JJM Marx, PCJ Vergouwen. (1998) Packed-cell volume in elite athletes. The Lancet 352:9126, 451
CrossRef18
Wylie Burke, Nancy Press, Sharon M McDonnell. (1998) Hemochromatosis: genetics helps to define a multifactorial disease. Clinical Genetics 54:1, 1-9
CrossRef19
Herbert L. Bonkovsky, Maureen Poh-Fitzpatrick, Neville Pimstone, Jorge Obando, Adrian Di Bisceglie, Christine Tattrie, Kristina Tortorelli, Paula LeClair, Mary G. Mercurio, Richard W. Lambrecht. (1998) Porphyria cutanea tarda, hepatitis C, and HFE gene mutations in north america. Hepatology 27:6, 1661-1669
CrossRef20
C. Herrero, M. Lecha. (1998) Management of patients with porphyria cutanea tarda. Photodermatology, Photoimmunology & Photomedicine 14:2, 64-65
CrossRef21
Glenn S. Gerhard, Amy E. Ten Elshof, Michael J. Chorney. (1998) HEREDITARY HAEMOCHROMATOSIS AS AN IMMUNOLOGICAL DISEASE. British Journal of Haematology 100:2, 247-255
CrossRef22
Moura, Verheul, Marx. (1998) A functional defect in hereditary haemochromatosis monocytes and monocyte-derived macrophages. European Journal of Clinical Investigation 28:2, 164-173
CrossRef23
Maria Jose Moran, Antonio Fontanellas, Eric Brudieux, Isabelle Hombrados, Victor de Ledinghen, Patrice Couzigou, Hubert de Verneuil, Rafael Enriquez De Salamanca. (1998) Hepatic uroporphyrinogen decarboxylase activity in porphyria cutanea tarda patients: The influence of virus C infection. Hepatology 27:2, 584-589
CrossRef24
George H. Elder, Mark Worwood. (1998) Mutations in the hemochromatosis gene, porphyria cutanea tarda, and iron overload. Hepatology 27:1, 289-291
CrossRef
