Original Article
The Incidence of Transfusion-Associated Hepatitis G Virus Infection and Its Relation to Liver Disease
N Engl J Med 1997; 336:747-754March 13, 1997
- Abstract
Background
The role of hepatitis G virus (HGV) in transfusion-associated infection and its relation to liver disease are not well understood.
Methods
Serum samples collected between 1972 and 1995 from 357 transfusion recipients, 157 controls who did not receive transfusions, 500 randomly selected volunteer blood donors, and 230 donors of blood received by HGV-infected patients were tested for HGV RNA by qualitative and quantitative polymerase-chain-reaction assays. Samples obtained before transfusion and serially after transfusion from 79 of the 81 transfusion recipients who had transfusion-associated non-A, non-B hepatitis were available for testing.
Results
Of the 79 patients with transfusion-associated hepatitis, 63 (80 percent) had infections related to the hepatitis C virus (HCV) and 3 had preexisting HCV and the cause of their acute hepatitis could not be determined; of the remaining 13 patients, 3 had acute HGV infection, and 10 were infected with unidentified agents. Six of the 63 patients with HCV infection who were tested (10 percent) were also infected with HGV. The three patients infected only with HGV had mild hepatitis (mean peak alanine aminotransferase level, 198 U per liter; none had jaundice); the levels of alanine aminotransferase and HGV RNA were not well correlated. The combined HCV and HGV infections were no more severe than HCV infections alone; the alanine aminotransferase values paralleled the levels of HCV RNA, but not those of HGV RNA. There were 35 HGV infections among the 357 transfusion recipients; only 3 had hepatitis with HGV as the sole viral marker. One of the 157 controls and 7 of the 500 randomly selected blood donors (1.4 percent) had detectable HGV RNA. In all eight instances in which a transfusion recipient had acute HGV infection after transfusion and samples from all donors could be tested, at least one HGV-positive donor was identified.
Conclusions
HGV was common in a group of volunteer blood donors, and it can be transmitted by transfusion. Most HGV infections were not associated with hepatitis. HGV did not worsen the course of concurrent HCV infection. No causal relation between HGV and hepatitis has been established.
Media in This Article
Figure 3
Frequency of HGV Infection in Transfusion Recipients with and without Hepatitis and in Controls Who Did Not Receive Transfusions.Figure 1
HGV Infection in Three Patients with Transfusion-Associated Hepatitis.Article Activity
- Article
Cloning of the hepatitis C virus (HCV)1 and sensitive serologic and molecular assays established HCV as the predominant cause of non-A, non-B hepatitis.2,3 Conversely, it has been shown that approximately 20 percent of cases of community-acquired hepatitis4 and 10 percent of cases of transfusion-transmitted hepatitis5 are unrelated to HCV infection. Serum samples from patients with non-A, non-B, non-C hepatitis were used in molecular amplification and cloning that led to the discovery of a new member of the Flaviviridae family, the hepatitis G virus (HGV).6 HGV is almost identical to another newly cloned agent that has been designated GB virus, type C; the two are considered to be different isolates of the same virus.7
Methods
Selection of Patients and Donor Samples
We used stored serum samples from donors and recipients that were obtained in the course of prospective studies of transfusion-associated hepatitis at the National Institutes of Health from October 1972 through December 1995. The method of enrollment, frequency and duration of follow-up, and criteria for the diagnosis of hepatitis have been described previously.3,8 The study protocol was reviewed and approved by the institutional review board of the National Heart, Lung, and Blood Institute, and all the study subjects gave written, informed consent.
Between 1972 and 1995, 81 patients with transfusion-associated non-A, non-B hepatitis were identified. Serum samples obtained before transfusion and serial samples obtained after transfusion were available for HGV RNA testing from 79 of these patients (98 percent). We also tested 281 of 887 patients who received transfusions but did not contract hepatitis (32 percent) and 157 of 374 controls who did not have transfusions (42 percent). For the patients identified as having transfusion-associated HGV infection, all available samples from donors were tested for HGV RNA (a total of 230 donors); samples from 500 consecutive volunteer blood donors were also tested. The samples were stored at -70°C before testing for HGV RNA.
Detection of HGV RNA and HCV RNA by the Polymerase Chain Reaction
To detect HGV RNA in a sample, nucleic acids were isolated from 100 μl of serum by the acid guanidinium thiocyanate–phenol–chloroform extraction method. A reverse-transcription polymerase chain reaction (PCR) was carried out with an RNA PCR kit (Perkin-Elmer, Norwalk, Conn.) and a kit to prevent PCR carryover contamination (Perkin-Elmer) with the following primers (0.4 mM each) from the putative nonstructural region 5 (NS5) of the HGV genome: 5'CGAATGAGTCAGAGGACGGGGTAT3' (sense) and 5'CTCTTTGTGGTAGTAGCCGAGAGAT3' (antisense). Forty-five cycles of PCR (94°C for one minute, 55°C for one minute, and 72°C for one minute for each cycle) were performed, followed by the extension reaction at 72°C for seven minutes. PCR products were analyzed by dot blot hybridization with a 32P-labeled oligonucleotide probe (5'TGCGTTACTGAGAGCAGCTCAGATGAG3'). The sensitivity of this assay was 1 copy of HGV RNA per reaction, corresponding to approximately 20 copies per milliliter of the initial serum. PCR for HCV RNA was performed as described elsewhere.9
Quantitation of HGV RNA and HCV RNA
HGV RNA was quantitated with external standards containing known concentrations of HGV RNA that ranged from 1 to 10,000 copies per 50 μl. After reverse-transcription PCR and dot blot hybridization of the samples and standards, the radioactivity of each blot was measured (Radioanalytic Imaging System, AMBIS, San Diego, Calif.). The total radioactive count of each standard was plotted against the HGV RNA copy number to establish a standard curve; the counts of radioactivity and the copy number were correlated linearly in a range from 10 to 10,000 copies per 50 μl (P<0.05; correlation coefficient, >0.9). The copy number of each sample was determined in relation to the standard curve and was expressed as the number of copies per milliliter. HCV RNA was quantitated by a commercial assay (Monitor, Roche Molecular Systems, Branchburg, N.J.) according to the directions of the manufacturer.
Serologic and Biochemical Assays
In the absence of reliable serologic assays, all HGV determinations were based on the PCR findings. Antibodies to HCV were measured by a second-version enzyme immunoassay according to the directions of the manufacturer (Abbott HCV EIA 2.0, Abbott Laboratories, North Chicago, Ill.). Antibody to hepatitis E virus was measured by the method of Tsarev et al.10 Alanine aminotransferase was measured by a three-point kinetic assay with an automated photometric analyzer (model 917, Hitachi–Boehringer Mannheim, Indianapolis), and the values were expressed in international units (normal range, 5 to 41 U per liter).
Statistical Analysis
All reported P values are two-sided. Standard least-squares regression analysis was used to fit a linear equation to the relation between radioactive counts and copy numbers of HGV RNA. Fisher's exact test11 was used to compare proportions in two-by-two tables. All confidence intervals for binomial proportions are exact.
The chi-square test for homogeneity in R-by-C contingency tables was used to compare four groups of transfusion recipients (those with non-A, non-B, non-C hepatitis; those with hepatitis C; those with low-level elevations of alanine aminotransferase; and those with no hepatitis) with respect to the proportion of patients testing positive for HGV RNA. Because we did not have resources to ascertain the HGV RNA status of all patients, we sampled three of the four groups (the recipients with hepatitis C, those with low-level elevations of alanine aminotransferase, and those with no hepatitis), and estimated the overall number of HGV-infected patients in each group by making projections based on the sample tested. The projected counts were added to the actual count in the fully assayed group (the recipients with non-A, non-B, non-C hepatitis) to estimate the overall number of HGV infections. Exact confidence intervals for the projected counts were derived from the hypergeometric distribution12 and were selected so that the confidence intervals for the grand total and for the percentages derived therefrom were at least 95 percent.13 In the quantitative analysis of HGV RNA levels in the four groups, geometric means are reported because of the wide variability in values. In determining whether the four groups had similar RNA levels, we used a standard analysis of variance on the logarithms of the RNA values, again to stabilize variances and reduce the influence of extreme values.
Results
Incidence of Hepatitis G in Transfusion Recipients Followed Prospectively
Of the 79 transfusion recipients originally classified as having non-A, non-B hepatitis and for whom there were adequate blood samples obtained before and after transfusion, 63 (80 percent) had acute HCV infections that were considered to account for their hepatitis; 6 (10 percent) of these HCV-infected patients were also infected with HGV. Three patients were found to have been infected with HCV before their transfusions; the role of HCV in their post-transfusion hepatitis could not be ascertained. Only 3 of the 79 patients (4 percent) had HGV as the only viral marker. Ten of the 79 patients (13 percent) had no serologic or molecular markers for any established hepatitis virus (A through G). Thus, infection with HGV but no other hepatitis virus was present in only 4 percent of the overall group of 79 patients with non-A, non-B hepatitis and 23 percent of patients with non-A, non-B, non-C hepatitis (3 of 13). Hepatitis with no known causative agent was considerably more common.
Clinical Course of HGV-Associated Hepatitis
Figure 1AFigure 1
HGV Infection in Three Patients with Transfusion-Associated Hepatitis., Figure 1B, and Figure 1C shows the clinical course of the three patients who had acute HGV infection after transfusion but were not coinfected with HCV. In each patient, HGV RNA was detectable within two weeks after the transfusion. All the infections were mild, with peak alanine aminotransferase levels less than 230 U per liter; no patient had jaundice, symptoms, or extrahepatic manifestations of HGV infection. The duration of the infections differed. One patient had a complete resolution of infection, with normalization of the alanine aminotransferase level within 12 weeks and clearance of HGV RNA within 40 weeks (Figure 1A). In another patient, intermittent elevations of alanine aminotransferase and HGV RNA were noted for 80 and 92 weeks, respectively. Subsequently, the alanine aminotransferase level became normal and there was clearance of HGV RNA, but the timing of these events was imprecise because the patient was lost to follow-up for a lengthy period (Figure 1B). In the third patient, chronic infection and chronic hepatitis (peak alanine aminotransferase level, 200 U per liter) persisted for four years, after which the patient died of unrelated causes (Figure 1C). The interpretation of this patient's alanine aminotransferase elevations was complicated by his daily use of acetaminophen throughout follow-up, by a carcinoma of the bowel that was surgically resected, and by a primary lung cancer, which was the cause of death.Quantitative levels of HGV RNA were studied in relation to the biochemical evidence of hepatocellular injury. In the first patient (Figure 1A), the HGV RNA level correlated with the alanine aminotransferase level at first, but then continued to rise as the alanine aminotransferase level became normal. The HGV RNA level did not peak (at 14 million copies per milliliter) until 10 weeks after the alanine aminotransferase level had decreased to normal, and it remained detectable for almost 20 weeks after the normalization of alanine aminotransferase. In the second patient (Figure 1B), the HGV RNA and alanine aminotransferase levels could not be correlated precisely because of limited sampling. Nonetheless, at week 28 the HGV RNA level was high when the alanine aminotransferase level was normal, and at week 80 HGV RNA was undetectable but the alanine aminotransferase level was rising. In the third patient (Figure 1C), almost 20 weeks elapsed between the appearance of HGV RNA and the first elevation of alanine aminotransferase.
Severity of Hepatitis G and Other Hepatitis Infections
The patients infected only with HGV had less severe hepatitis than those infected only with HCV (mean peak alanine aminotransferase level, 198 vs. 726 U per liter) (Table 1Table 1
Severity of Infection with HGV Alone, as Compared with the Other Types of Infection in the Study Patients.). No patient with HGV had an alanine aminotransferase level more than 10 times the upper limit of normal, as compared with 82 percent of those with hepatitis C. Similarly, no patient with HGV had jaundice, as compared with 32 percent of those with HCV.The severity of liver disease in the 10 patients without established virologic markers for hepatitis viruses A through G (non-A–G) was intermediate between that of patients with HGV infection and that of patients with HCV infection (Table 1). Among these 10 patients, the mean peak alanine aminotransferase level was 418 U per liter, and 2 patients had alanine aminotransferase levels more than 10 times the upper limit of normal. None of the 10 patients had jaundice.
Alanine aminotransferase elevations more than two times the upper limit of normal that persisted for more than one year were found in 2 of the 3 patients with HGV alone, 40 of the 56 with HCV alone, 3 of the 6 with combined HCV and HGV infection, and 3 of the 10 with non-A–G hepatitis (Table 1).
Acute Infection with Both HGV and HCV
On the basis of peak alanine aminotransferase levels and the percentage of patients with jaundice, the severity of hepatitis in patients coinfected with HGV and HCV was indistinguishable from that in patients with HCV infection alone (Table 1). This suggests that the extent of liver disease in patients with combined infection was related to infection with HCV, not HGV.
Figure 2AFigure 2
Combined HGV and HCV Infection in Two Patients with Transfusion-Associated Hepatitis. and Figure 2B shows HCV and HGV viremia in relation to alanine aminotransferase levels in two of the six patients with combined infection. In both, the hepatitis resolved rapidly. Although HGV RNA and HCV RNA became detectable two to three weeks after transfusion in each patient, the subsequent course of viremia differed markedly between the two agents. HCV RNA levels declined just before the decrease in the alanine aminotransferase level and remained undetectable throughout the period of normal alanine aminotransferase levels. In contrast, there was no correlation between HGV RNA and alanine aminotransferase. As in one of the patients infected only with HGV (Figure 1A), HGV RNA levels in the two patients with HCV–HGV coinfection remained persistently high despite the normalization of alanine aminotransferase levels.Proportion of HGV Infections Associated with Liver Disease
The frequency of HGV infection among the 357 transfusion recipients who did or did not contract hepatitis is shown in Figure 3Figure 3
Frequency of HGV Infection in Transfusion Recipients with and without Hepatitis and in Controls Who Did Not Receive Transfusions.. Although 3 of the 13 patients with non-A, non-B, non-C hepatitis had evidence of acute HGV infection (23 percent), so too did 6 of the 63 patients with hepatitis C (10 percent), 12 of the 100 patients with minor elevations of alanine aminotransferase who did not meet the study criteria for hepatitis (12 percent), and 14 of the 181 patients who had persistently normal alanine aminotransferase levels after transfusion (8 percent). Among these four groups, there was no significant difference in the proportion with HGV infection (P = 0.26). In contrast, only 1 of 157 controls who did not receive transfusions tested positive for HGV RNA (P<0.001 by Fisher's exact test when the four groups of transfusion recipients were compared with the controls). Although HGV infection appeared to be associated with transfusion, the patients who contracted hepatitis were no more likely to be infected with HGV than those without hepatitis.There were 35 HGV infections in the four groups of transfusion recipients (Figure 3). Each of the 13 recipients with non-A, non-B, non-C hepatitis was tested for HGV RNA, but limits on resources or the availability of samples allowed PCR testing of only 63 of 65 recipients with hepatitis C, 100 of 111 with minor alanine aminotransferase elevations, and 181 of 776 who did not contract hepatitis. A statistical extrapolation (explained in the Methods section) was used to estimate the overall number of HGV infections that would have been detected had all the transfusion recipients been tested. As a result, we projected that in the hepatitis C group there were 6 HGV infections (100 percent confidence interval, 6 to 8); in the group with minor elevations of alanine aminotransferase, 13 infections (99 percent confidence interval, 12 to 18), and in the group with no hepatitis, 60 infections (96 percent confidence interval, 35 to 96). When the group with non-A, non-B, non-C hepatitis was included in the calculation, the total projected number of HGV infections in all four groups was 82 (95 percent confidence interval, 56 to 125). Of these 82 infections, 4 percent (95 percent confidence interval, 2 to 5 percent) were projected to occur in the group with non-A, non-B, non-C hepatitis; 7 percent (95 percent confidence interval, 5 to 14 percent) in the group with hepatitis C; 16 percent (95 percent confidence interval, 10 to 29 percent) in the group with minor elevations of alanine aminotransferase; and 73 percent (95 percent confidence interval, 55 to 82 percent) in the group with no biochemical evidence of hepatitis.
Viremia and Clinical Outcome
To relate the severity of hepatitis to the viral burden, we performed quantitative PCR on blood samples obtained 6 to 10 weeks after exposure to HGV. The geometric-mean titer of HGV RNA did not differ significantly among the four groups when we studied the 3 patients who contracted hepatitis G, the 6 who were infected with HGV and HCV, the 12 who had minor elevations of alanine aminotransferase, and the 14 who had no biochemical evidence of liver disease (P = 0.48). The geometric-mean titers of HGV RNA ranged from 102 to 7568 copies of RNA per milliliter. In individual patients, the HGV RNA titers varied by as much as 5 log. The highest observed titer in the acute-phase sample (six to eight weeks) from the 35 HGV-infected patients was 2.5 million copies of RNA per milliliter.
Persistent HGV Infection
All 35 patients with acute HGV infection were followed for six months; 32 (91 percent) had persistent HGV RNA during that period. Most patients were not followed further because they had no evidence of hepatitis. However, eight of these patients were tested serially for up to 6 years (mean, 4.6). There was clearance of HGV within one year in one, and within three years in two others. Of the remaining five patients, two were positive for HGV RNA at the time of their deaths from causes unrelated to liver disease four to five years after their transfusions; one was positive for four years and was then lost to follow-up; and the remaining two were positive throughout follow-up. Overall, five of the eight patients had persistent viremia for four to six years, and three had viral clearance within three years.
Prevalence of HGV among Randomly Selected Blood Donors and among Donors to Infected Recipients
HGV RNA was detected in 7 of the 500 randomly selected blood donors (1.4 percent) who otherwise met all the standard eligibility criteria for donation. This proportion was similar to one we found previously (1.7 percent) in a separate group of 769 eligible volunteer donors, 13 of whom had HGV RNA.6
Samples were available from all donors in eight cases in which the recipient had an acute HGV infection after transfusion. At least one HGV-positive donor was identified in every case; four patients had two HGV-positive donors, and one had three. Even when samples from only some of the donors were available (that is, samples from 50 to 90 percent of the donors of blood received by a given patient), HGV-positive donors were identified in four of seven cases.
Discussion
HGV infection was highly prevalent among the volunteer blood donors we studied. The rate of HGV viremia was at least five times higher than the previously reported rate of HCV viremia among blood donors.14 Although HGV infection was generally persistent, approximately one third of patients (three of eight) had clearance of the virus within three years after becoming infected. This suggests that the number of exposures to HGV considerably exceeds the number of active infections detected by PCR. Furthermore, rates of viral exposure and infection among highly selected donors may underestimate the rate in the general population.
Several of our findings give strong evidence that HGV can be transmitted by transfusion: patients negative for HGV RNA became positive shortly after transfusion; HGV RNA–positive donors were identified retrospectively for all patients with HGV infection for whom samples from all blood donors were available; and the incidence of HGV was markedly lower among patients who did not receive transfusions. Ten percent of recipients (35 of 357) were found to be infected with HGV after their transfusions. The current rate of HGV transmission is not known; transmission to at least 1 percent of recipients is probable, given the 1 to 2 percent prevalence of viremia among donors and the absence of a practical screening assay.
Despite the high rate of HGV transmission, HCV was the predominant cause of transfusion-associated hepatitis, accounting for at least 80 percent of the cases we studied. To what extent does HGV account for the residual cases? Only 3 of the 13 patients with hepatitis unrelated to HCV had acute HGV infections. We believe that the majority of cases of non-A, non-B, non-C hepatitis are due to an as yet undiscovered hepatitis agent or agents or to nonviral causes. Furthermore, even in the three patients with hepatitis who were infected only with HGV, there was a dissociation between the level of HGV RNA in serum and biochemical evidence of hepatocellular injury. This was even more striking in the patients infected with both HGV and HCV (Figure 2A and Figure 2B), whose levels of alanine aminotransferase closely paralleled those of HCV RNA but were asynchronous with the levels of HGV RNA.
Perhaps the main reason to question the clinical effect of HGV infection is that an estimated 73 percent of such infections were unaccompanied by evidence of hepatocellular injury, and an additional 16 percent were associated with such minor elevations of alanine aminotransferase that the patients did not meet our criteria for the diagnosis of hepatitis. Given that the vast majority of HGV infections were not associated with hepatitis, that HGV had no effect on the severity of coexisting HCV infection, and that there may be unidentified agents that are more strongly associated with hepatitis than HGV, it is difficult to conclude that HGV had a causal role in the few cases of hepatitis in which it was the only identified agent. It is equally tenable to argue that these patients had clinically silent HGV infections in which the hepatitis was due to an unidentified, coexisting infectious agent or to a noninfectious cause of liver-cell injury. Indeed, one could question whether using the term “hepatitis virus” to refer to HGV is appropriate. Documentation that HGV replicates in the liver and conclusive evidence that it causes liver disease are needed before it can properly be classified as a hepatitis virus.
Supported by intramural funds at the National Institutes of Health and by Genelabs Technologies, Inc.
Source Information
From the Departments of Transfusion Medicine (H.J.A., Y.N., J.M., J.W.-K.S.) and Information Systems (R.W.), Warren Grant Magnuson Clinical Center, National Institutes of Health, Bethesda, Md.; and Genelabs Technologies, Redwood City, Calif. (J.W., J.P.K.).
Address reprint requests to Dr. Alter at the Department of Transfusion Medicine, Bldg. 10, Rm. 1C-711, National Institutes of Health, Bethesda, MD 20892.
- References
References
1
Choo Q-L ,Kuo G ,Weiner AJ ,Overby LR ,Bradley DW ,Houghton M . Isolation of a cDNA clone derived from a blood-borne non-A, non-B viral hepatitis genome. Science 1989;244:359-362
CrossRef | Web of Science | Medline2
Kou G ,Choo Q-L ,Alter HJ , et al. An assay for circulating antibodies to a major etiologic virus of human non-A, non-B hepatitis. Science 1989;244:362-364
CrossRef | Web of Science3
Alter HJ ,Purcell RH ,Shih JW , et al. Detection of antibody to hepatitis C virus in prospectively followed transfusion recipients with acute and chronic non-A, non-B hepatitis. N Engl J Med 1989;321:1494-1500
Full Text | Web of Science | Medline4
Alter MJ ,Margolis HS ,Krawczynski K , et al. The natural history of community-acquired hepatitis C in the United States. N Engl J Med 1989;327:1899-1905
Full Text | Web of Science5
Alter HJ, Jett BW, Polito AJ, et al. Analysis of the role of hepatitis C virus in transfusion-associated hepatitis. In: Hollinger FB, Lemon SM, Margolis H, eds. Viral hepatitis and liver disease. Baltimore: Williams & Wilkins, 1991:396-402.
6
Linnen J ,Wages J Jr ,Zhang-Keck Z-Y , et al. Molecular cloning and disease association of hepatitis G virus: a transfusion-transmissible agent. Science 1996;271:505-508
CrossRef | Web of Science | Medline7
Masuko K ,Mitsui T ,Iwano K , et al. Infection with hepatitis GB virus C in patients on maintenance hemodialysis. N Engl J Med 1996;334:1485-1490
Full Text | Web of Science | Medline8
Koziol DE ,Holland PV ,Alling DW , et al. Antibody to hepatitis B core antigen as a paradoxical marker for non-A, non-B hepatitis agents in donated blood. Ann Intern Med 1986;104:488-495
Web of Science | Medline9
Alter HJ ,Sanchez-Pescador R ,Urdea MS , et al. Evaluation of branched DNA signal amplification for the detection of hepatitis C virus RNA. J Viral Hepat 1995;2:121-132
CrossRef | Web of Science | Medline10
Tsarev SA ,Tsarev TS ,Emerson SU , et al. ELISA for antibody to hepatitis E virus (HEV) based on complete open-reading frame-2 protein expressed in insect cells: identification of HEV infection in primates. J Infect Dis 1993;168:369-378
CrossRef | Web of Science | Medline11
Armitage P. Statistical methods in medical research. New York: John Wiley, 1971:135-8.
12
Kotz S, Johnson NL, eds. Encyclopedia of statistical sciences. New York: John Wiley, 1983:709-10.
13
Bickel PJ, Doksum KA. Mathematical statistics: basic ideas and selected topics. San Francisco: Holden-Day, 1977:162.
14
Weiner AJ ,Truett MA ,Rosenblatt J , et al. HCV testing in low-risk population. Lancet 1990;336:695-695
CrossRef | Web of Science | Medline
- Citing Articles (236)
Citing Articles
1
2011. Transfusion-Transmitted Diseases. , 414-445.
CrossRef2
Jonathan B. Courtney, Fred Cushner, William J. Long, Michael P. Nett. (2011) An Effective Bloodless Surgery Protocol. Techniques in Knee Surgery 10:4, 188-197
CrossRef3
Sabrina Nicolosi Guidicelli, Armando Lopez-Guillermo, Umberto Falcone, Annarita Conconi, Alexandre Christinat, Delvys Rodriguez-Abreu, Salvatore Grisanti, Chiara Lobetti-Bodoni, Jean Claude Piffaretti, Peter W. Johnson, Giorgio Mombelli, Andreas Cerny, Emili Montserrat, Franco Cavalli, Emanuele Zucca. (2011) Hepatitis C virus and GBV-C virus prevalence among patients with B-cell lymphoma in different European regions: a case-control study of the International Extranodal Lymphoma Study Group. Hematological Oncologyn/a-n/a
CrossRef4
Linlin Li, Eric Delwart. (2011) From orphan virus to pathogen: the path to the clinical lab. Current Opinion in Virology 1:4, 282-288
CrossRef5
Chintamani Atreya, Hira Nakhasi, Paul Mied, Jay Epstein, James Hughes, Marta Gwinn, Steven Kleinman, Roger Dodd, Susan Stramer, Mark Walderhaug, Peter Ganz, Raymond Goodrich, Clark Tibbetts, David Asher. (2011) FDA workshop on emerging infectious diseases: evaluating emerging infectious diseases (EIDs) for transfusion safety. Transfusion 51:8, 1855-1871
CrossRef6
J. T. Stapleton, S. Foung, A. S. Muerhoff, J. Bukh, P. Simmonds. (2011) The GB viruses: a review and proposed classification of GBV-A, GBV-C (HGV), and GBV-D in genus Pegivirus within the family Flaviviridae. Journal of General Virology 92:2, 233-246
CrossRef7
R.O. Abu Odeh. (2011) Detection and genotyping of GB virus-C in dromedary camels in the United Arab Emirates. Veterinary Microbiology 147:3-4, 226-230
CrossRef8
Rima Fawaz, Maureen M. Jonas. 2011. Acute and Chronic Hepatitis. , 811-828.
CrossRef9
Flavien Bernardin, Eva Operskalski, Mike Busch, Eric Delwart. (2010) Transfusion transmission of highly prevalent commensal human viruses. Transfusion 50:11, 2474-2483
CrossRef10
Gisela Enders. 2010. Viral Infections of the Fetus and Neonate, other than Rubella. .
CrossRef11
M. Tayyeb Ayyoubi, Terri Konstenius, Jeffrey C. McCullough, Ted Eastlund, Mary Clay, Robert Bowman, Ahmad Masoud Rahmani, William Riley, Jeffrey McCullough. (2010) BLOOD DONORS AND BLOOD COLLECTION: Status of blood banking and the blood supply in Afghanistan. Transfusion 50:3, 566-574
CrossRef12
Mel Krajden, Amanda Yu, Heather Braybrook, Agnes S. Lai, Annie Mak, Ron Chow, Darrel Cook, Raymond Tellier, Martin Petric, Randy D. Gascoyne, Joseph M. Connors, Angela R. Brooks-Wilson, Richard P. Gallagher, John J Spinelli. (2010) GBV-C/hepatitis G virus infection and non-Hodgkin lymphoma: a case control study. International Journal of CancerNA-NA
CrossRef13
Shimian Zou, Yanyun Wu, Ritchard Cable, Kerri Dorsey, Yanlin Tang, Cheryl Anne Hapip, Russell Melmed, Jonathan Trouern-Trend, Donna Carrano, Melanie Champion, Karen Fujii, Chyang Fang, Roger Dodd. (2010) A prospective study of multiple donor exposure blood recipients: surveillance value and limitations for hemovigilance. Transfusion 50:1, 128-138
CrossRef14
Dragan Delic, Nikola Mitrovic, Aleksandra Radovanovic-Spurnic, Neda Stojkovic-Svirtlih, Jasmina Simonovic-Babic. (2010) Epidemiological characteristics and clinical manifestations of acute non-A-E hepatitis. Vojnosanitetski pregled 67:11, 903-909
CrossRef15
ELIZABETH I. HARRIS, KAY WASHINGTON, LAURA W. LAMPS. 2009. Acute and Chronic Infectious Hepatitis. , 1003-1033.
CrossRef16
Giovana Lotici Baggio-Zappia, Celso Francisco Hernandes Granato. (2009) HIV-GB virus C co-infection: an overview. Clinical Chemistry and Laboratory Medicine 47:1, 12-19
CrossRef17
Esaki Muthu Shankar, Sunil Suhas Solomon, Ramachandran Vignesh, Kailapuri G. Murugavel, Muthu Sundaram, Suniti Solomon, Pachamuthu Balakrishnan, Nagalingeswaran Kumarasamy. (2008) GB virus infection: a silent anti-HIV panacea within?. Transactions of the Royal Society of Tropical Medicine and Hygiene 102:12, 1176-1180
CrossRef18
Maren Moenkemeyer, Reinhold E. Schmidt, Heiner Wedemeyer, Hans L. Tillmann, Hans Heiken. (2008) GBV-C coinfection is negatively correlated to Fas expression and Fas-mediated apoptosis in HIV-1 infected patients. Journal of Medical Virology 80:11, 1933-1940
CrossRef19
Rakesh Aggarwal, Kris Kowdley, Geoffrey McCaughan, Christian Trautwein. (2008) Hepatitis E: Does it cause chronic hepatitis?. Hepatology 48:4, 1328-1330
CrossRef20
Nicolaos C Tassopoulos, George V Papatheodoridis, Ioanna Delladetsima, Angelos Hatzakis. (2008) Clinicopathological features and natural history of acute sporadic non-(A-E) hepatitis. Journal of Gastroenterology and Hepatology 23:8pt1, 1208-1215
CrossRef21
J.-J. Lefrère, S. Laperche, F. Roudot-Thoraval. (2008) Hepatitis G virus: a suitable marker of in vivo efficacy for pathogen inactivation. Vox Sanguinis 95:1, 76-78
CrossRef22
Mohammad Asim, Sai Kiran Potukuchi, Ashu Arora, Bhimo Singh, P. Kar. (2008) Hepatitis-G Virus Infection in Multi-transfused Patients and Intravenous Drug Abusers: New Delhi Experience. Digestive Diseases and Sciences 53:5, 1383-1389
CrossRef23
Christopher L. Washenberger, Jian-Qiu Han, Katherina J. Kechris, Babal Kant Jha, Robert H. Silverman, David J. Barton. (2007) Hepatitis C virus RNA: Dinucleotide frequencies and cleavage by RNase L. Virus Research 130:1-2, 85-95
CrossRef24
Ali Eslamifar, Rasool Hamkar, Amitis Ramezani, Farrokhlagha Ahmadi, Latif Gachkar, Somayeh Jalilvand, Ladan Adibi, Shahnaz Atabak, Ali Khameneh, Ramin Ghadimi, Arezoo Aghakhani. (2007) Hepatitis G virus exposure in dialysis patients. International Urology and Nephrology 39:4, 1257-1263
CrossRef25
Stanley J. Chetcuti, Paul M. Grossman, Eva M. Kline-Rogers, Cecelia Montoye, Dean Smith, Mauro Moscucci. (2007) Improving Outcomes of Percutaneous Coronary Intervention through the Application of Guidelines and Benchmarking: Reduction of Major Bleeding and Blood Transfusion as a Model. Clinical Cardiology 30:S2, II44-II48
CrossRef26
Ali Eslamifar, Rasool Hamkar, Amitis Ramezani, Farrokhlagha Ahmadi, Latif Gachkar, Somayeh Jalilvand, Ladan Adibi, Ali Khameneh, Shahnaz Atabak, Ramin Ghadimi, Arezoo Aghakhani. (2007) Hepatitis G Virus Exposure in Dialysis Staff. Therapeutic Apheresis and Dialysis 11:5, 370-374
CrossRef27
Hugo Bonatti, Robert Sawyer, Rolland C Dickson, Raymond Razonable, Timothy Schmitt, Julio Mendez, Nina Singh, Timothy Pruett. (2007) Transmission of viral disease to the recipient through the donor liver. Current Opinion in Organ Transplantation 12:3, 231-241
CrossRef28
Masahiko Kaito, Hideaki Tanaka, Shinichiro Horiike, Naoki Fujita, Motoh Iwasa, Yoshinao Kobayashi, Esteban Cesar Gabazza, Yukihiko Adachi, Masayoshi Konishi, Shozo Watanabe. (2007) Unidentified virus-like particles are detected in plasmas with elevated ALT levels: are they significant of etiological agent(s) of non-B, non-C hepatitis?. Medical Molecular Morphology 40:1, 23-28
CrossRef29
W.-H. Sheng, C.-C. Hung, R.-J. Wu, J.-T. Wang, P.-J. Chen, S.-C. Chang, J.-H. Kao. (2007) Clinical Impact of GB Virus C Viremia on Patients with HIV Type 1 Infection in the Era of Highly Active Antiretroviral Therapy. Clinical Infectious Diseases 44:4, 584-590
CrossRef30
Manfred Vogt, Barbara Klostermann, Siegmund Braun, Raymonde Busch, John Hess, Gert Frösner, Thomas Lang. (2006) Prevalence and clinical role of GBV-C infection after cardiac surgery in childhood: A study on 414 patients. Journal of Infection 53:1, 43-48
CrossRef31
Brian Woodcock. 2006. Blood, Artificial. .
CrossRef32
Chengyao Li, Paul Collini, Kwabena Danso, Shirley Owusu-Ofori, Albert Dompreh, Daniel Candotti, Ohene Opare-Sem, Jean-Pierre Allain. (2006) GB virus C and HIV-1 RNA load in single virus and co-infected West African individuals. AIDS 20:3, 379-386
CrossRef33
Keith Nemergut, Edward C. Littlewood. 2006. Liver Diseases. , 151-201.
CrossRef34
IE Souza, W Zhang, RS Diaz, K Chaloner, D Klinzman, JT Stapleton. (2006) Effect of GB virus C on response to antiretroviral therapy in HIV-infected Brazilians*. HIV Medicine 7:1, 25-31
CrossRef35
NAOMI L.C. LUBAN. (2005) Transfusion Safety: Where Are We Today?. Annals of the New York Academy of Sciences 1054:1, 325-341
CrossRef36
AK Praharaj, S Tripathy, AK Kalghatgi, A Nagendra. (2005) Hepatitis G virus: Prevalence in blood donors in armed forces. Medical Journal Armed Forces India 61:4, 333-335
CrossRef37
Bernd Kupfer, Torsten Ruf, Bertfried Matz, Jacob Nattermann, Ulrich Spengler, Jürgen K. Rockstroh, Hans H. Brackmann, Johannes Blümel, Michael Tacke, Rolf Kaiser. (2005) Comparison of GB virus C, HIV, and HCV infection markers in hemophiliacs exposed to non-inactivated or inactivated factor concentrates. Journal of Clinical Virology 34:1, 42-47
CrossRef38
Raed O. Abu Odeh, Moslih I. Al-Moslih, Mohammed Wafi Al-Jokhdar, Sinda A. Ezzeddine. (2005) Detection and genotyping of GBV-C virus in the United Arab Emirates. Journal of Medical Virology 76:4, 534-540
CrossRef39
Mark D. Berzsenyi, D. Scott Bowden, Stuart K. Roberts. (2005) GB virus C: Insights into co-infection. Journal of Clinical Virology 33:4, 257-266
CrossRef40
Jun Akiba, Takeji Umemura, Harvey J. Alter, Masamichi Kojiro, Edward Tabor. (2005) SEN virus: epidemiology and characteristics of a transfusion-transmitted virus. Transfusion 45:7, 1084-1088
CrossRef41
S.H. Kleinman, S.A. Glynn, M.J. Higgins, D.J. Triulzi, J.W. Smith, C.C. Nass, George Garratty, E.L. Murphy, G.F. LeParc, G.B. Schreiber, M.R. King, M.E. Chamberland, G.J. Nemo. (2005) The RADAR repository: a resource for studies of infectious agents and their transmissibility by transfusion. Transfusion 45:7, 1073-1083
CrossRef42
Abdurrahman Sagir, Ortwin Adams, Mark Oette, Andreas Erhardt, Tobias Heintges, Dieter Häussinger. (2005) SEN virus seroprevalence in HIV positive patients: association with immunosuppression and HIV-replication. Journal of Clinical Virology 33:3, 183-187
CrossRef43
Jinhua Xiang, Christina Martinez-Smith, Michael Gale, Qing Chang, Douglas R. Labrecque, Warren N. Schmidt, Jack T. Stapleton. (2005) GB Virus Type C NS5A Sequence Polymorphisms: Association with Interferon Susceptibility and Inhibition of PKR-Mediated eIF2α Phosphorylation. Journal of Interferon & Cytokine Research 25:5, 261-270
CrossRef44
C. Guney, A. Kadayifci, M.C. Savas, A. Uygun, A. Balkan, A. Kubar. (2005) Frequency of hepatitis G virus and transfusion-transmitted virus infection in type II diabetes mellitus. International Journal of Clinical Practice 59:2, 206-209
CrossRef45
(2005) GB Virus Type C (GBV-C), Alternative Denomination Hepatitis G Virus (HGV). Transfusion Medicine and Hemotherapy 32:3-4, 128-131
CrossRef46
Sarah L. George, Dino Varmaz. (2005) What you need to know about GB virus C. Current Gastroenterology Reports 7:1, 54-62
CrossRef47
Frances V. White, Louis P. Dehner. (2004) Viral Diseases of the Liver in Children: Diagnostic and Differential Diagnostic Considerations. Pediatric and Developmental Pathology 7:6, 552-567
CrossRef48
H. L. Tillmann, M. P. Manns, C. Claes, H. Heiken, R. E. Schmidt, M. Stoll. (2004) GB virus C infection and quality of life in HIV-positive patients. AIDS Care 16:6, 736-743
CrossRef49
V. Vargas Blasco. (2004) Hepatitis por otros virus hepatotropos. Medicine - Programa de Formación Médica Continuada Acreditado 9:11, 666-673
CrossRef50
Tokio Sugiura, Kenji Goto, Hiroki Imamine, Toshihiro Ando, Kyoko Ban, Kohachiro Sugiyama, Hajime Togari. (2004) Prevalence of SEN virus among children in Japan. Virus Research 100:2, 223-228
CrossRef51
Carola Seifried, Marijke Weber, Heike Bialleck, Erhard Seifried, Hubert Schrezenmeier, W. Kurt Roth. (2004) High prevalence of GBV-C/HGV among relatives of GBV-C/HGV-positive blood donors in blood recipients and in patients with aplastic anemia. Transfusion 44:2, 268-274
CrossRef52
E. Giannoulis, T. Economopoulos, K. Mandraveli, K. Giannoulis, C. Nikolaides, E. Zervou, E. Papageorgiou, D. Zoulas, A. Tourkantonis, G. Giannopoulos, G. Fountzilas. (2004) The Prevalence of Hepatitis C and Hepatitis G Virus Infection in Patients with B Cell Non-Hodgkin Lymphomas in Greece: A Hellenic Cooperative Oncology Group Study. Acta Haematologica 112:4, 189-193
CrossRef53
Roel Sentjens, Miren Basaras, Peter Simmonds, Hans Vrielink, Henk Reesink. (2003) HGV/GB virus C transmission by blood components in patients undergoing open-heart surgery. Transfusion 43:11, 1558-1562
CrossRef54
JIUN-GUEY LIN, TAKASHI GOTO, KUNIO NAKANE, KOUICHI MIURA, KEN-ICHIRO MIKAMI, SHIGETOSHI OHSHIMA, KAZUO YONEYAMA, SUMIO WATANABE. (2003) Clinical significance of SEN-virus on interferon response in chronic hepatitis C patients. Journal of Gastroenterology and Hepatology 18:10, 1144-1149
CrossRef55
Matthias Schröter, Rainer Laufs, Bernhard Zöllner, Bärbel Knödler, Peter Schäfer, Heinz-Hubert Feucht. (2003) A novel DNA virus (SEN) among patients on maintenance hemodialysis: prevalence and clinical importance. Journal of Clinical Virology 27:1, 69-73
CrossRef56
E. Alonso-Rubiano, M. Gerber, P. Friedman, S. Hodges, C. Leissinger. (2003) Hepatitis G virus in clotting factor concentrates. Haemophilia 9:1, 110-115
CrossRef57
P. Vanhems, N. Voirin, C. Trépo, M.A. Trabaud, D. Yzèbe, C. Del Signore, C. Régis, J. Fabry. (2003) The risk of hospital-acquired GB virus C infection: a pilot case–control study. Journal of Hospital Infection 53:1, 72-75
CrossRef58
Maria Angelica Ehara Watanabe, Cristiane Maria Milanezi, Wilson Araújo Silva, Ivan de Lucena Ângulo, Gil Santis, Simone Kashima, José Abrão Cardeal da Costa, Miguel Abrão Neto, Dimas Tadeu Covas. (2003) Molecular Investigation of GB Virus C RNA in Hemodialysis and Thalassemics Patients from Brazil. Renal Failure 25:1, 67-75
CrossRef59
Sarah L. George, Sabina Wünschmann, James McCoy, Jinhua Xiang, Jack T. Stapleton. (2002) Interactions between GB virus type C and HIV. Current Infectious Disease Reports 4:6, 550-558
CrossRef60
D. Prati. (2002) Transmission of viral hepatitis by blood and blood derivatives: current risks, past heritage. Digestive and Liver Disease 34:11, 812-817
CrossRef61
A. Lazo, J. Tassello, V. Jayarama, A. Ohagen, V. Gibaja, E. Kramer, A. Marmorato, D. Billia-Shaveet, A. Purmal, F. Brown, J. Chapman. (2002) Broad-spectrum virus reduction in red cell concentrates using INACTINE™ PEN110 chemistry. Vox Sanguinis 83:4, 313-323
CrossRef62
K. V. Narayanan Menon. (2002) Non-A to E hepatitis. Current Opinion in Infectious Diseases 15:5, 529-534
CrossRef63
Thomas Berg, Ruth Neuhaus, Reinhild Klein, Korinna Leder, Hartmut Lobeck, Wolf-Otto Bechstein, Andrea R. Müller, Bertram Wiedenmann, Uwe Hopf, Peter A. Berg, Peter Neuhaus. (2002) DISTINCT ENZYME PROFILES IN PATIENTS WITH CRYPTOGENIC CIRRHOSIS REFLECT HETEROGENEOUS CAUSES WITH DIFFERENT OUTCOMES AFTER LIVER TRANSPLANTATION (OLT): A LONG-TERM DOCUMENTATION BEFORE AND AFTER OLT. Transplantation 74:6, 792-798
CrossRef64
Avram J. Smukler, Lee Ratner. (2002) Hepatitis viruses and hepatocellular carcinoma in HIV-infected patients. Current Opinion in Oncology 14:5, 538-542
CrossRef65
Silvia Pirovano, Marco Bellinzoni, Alberto Matteelli, Cristina Ballerini, Alberto Albertini, Luisa Imberti. (2002) High prevalence of a variant of SENV in intravenous drug user HIV-infected patients. Journal of Medical Virology 68:1, 18-23
CrossRef66
J.-P. Allain, I. Thomas, S. Sauleda. (2002) Nucleic acid testing for emerging viral infections. Transfusion Medicine 12:4, 275-283
CrossRef67
Sharon E. Frey, Sharon M. Homan, Marcia Sokol‐Anderson, Margarita Torralba Cayco, Prospero Cortorreal, Cora E. Musial, Adrian Di Bisceglie. (2002) Evidence for Probable Sexual Transmission of the Hepatitis G Virus. Clinical Infectious Diseases 34:8, 1033-1038
CrossRef68
M. E. Chamberland. (2002) Emerging Infectious Agents: Do They Pose a Risk to the Safety of Transfused Blood and Blood Products?. Clinical Infectious Diseases 34:6, 797-805
CrossRef69
Giovanni Lodi, Cristina Bez, Stephen R. Porter, Crispian Scully, Joel B. Epstein. (2002) Infectious hepatitis C, hepatitis G, and TT virus: review and implications for dentists. Special Care in Dentistry 22:2, 53-58
CrossRef70
Nada Kuljic-Kapulica. (2002) Virus hepatitisa G - novi hepatotropni virus. Vojnosanitetski pregled 59:3, 305-308
CrossRef71
Marcello Grassi, Antonio Mammarella, Giovanni Sagliaschi, Lucia Granati, Antonio Musca, Fiore Traditi, Mario Pezzella. (2001) Persistent Hepatitis G Virus (HGV) Infection in Chronic Hemodialysis Patients and Non-B, Non-C Chronic Hepatitis. Clinical Chemistry and Laboratory Medicine 39:10, 956-960
CrossRef72
Xiang, Jinhua, Wünschmann, Sabina, Diekema, Daniel J., Klinzman, Donna, Patrick, Kevin D., George, Sarah L., Stapleton, Jack T., . (2001) Effect of Coinfection with GB Virus C on Survival among Patients with HIV Infection. New England Journal of Medicine 345:10, 707-714
Full Text73
Stosor, Valentina, Wolinsky, Steven, . (2001) GB Virus C and Mortality from HIV Infection. New England Journal of Medicine 345:10, 761-762
Full Text74
HJ. Mischinger, H. Cerwenka, H. Bacher, G. Werkgartner, A. El-Shabrawi, G. Hoss. (2001) Komplikationen in der Leberchirurgie und ihre Vermeidung. European Surgery-Acta Chirurgica Austriaca 33:4, 181-184
CrossRef75
Betty H. Robertson. (2001) Viral hepatitis and primates: historical and molecular analysis of human and nonhuman primate hepatitis A, B, and the GB-related viruses. Journal of Viral Hepatitis 8:4, 233-242
CrossRef76
Cristiane A. Villela Nogueira, Susie A. Nogueira, Carmen M. Nogueira, Henrique S
rgio M. Coelho, Fassil Ketema, Daniel C. Edelman, John S. Lambert, Niel T. Constantine. (2001) The incidence of GB virus C / hepatitis G virus infection in Brazilian patients who received blood transfusion during cardiac surgery. Journal of Medical Virology 63:3, 237-241
CrossRef77
Scott Bowden. (2001) New hepatitis viruses: Contenders and pretenders. Journal of Gastroenterology and Hepatology 16:2, 124-131
CrossRef78
Yoshinobu Kanda, Hisamaru Hirai. (2001) TT Virus in Hematological Disorders and Bone Marrow Transplant Recipients. Leukemia & Lymphoma 40:5-6, 483-489
CrossRef79
Ming-Lung Yu, Wan-Long Chuang, Liang-Yen Wang, Chia-Yen Dai, Shyh-Shin Chiou, Ming-Hsing Sung, Chao-Sung Chang, Shinn-Cherng Chen, Ching-Shan Wang, Tai-Tsung Chang, Wen-Yu Chang. (2000) Status and natural course of GB virus C/hepatitis G virus infection among high-risk groups and volunteer blood donors in Taiwan. Journal of Gastroenterology and Hepatology 15:12, 1404-1410
CrossRef80
Klaus Stark, Gabriele Poggensee, Marina H
CrossRef81
A. Giulivi, R. Slinger, M. Tepper, G. Sher, V. Scalia, G. Kessler, P. Gill. (2000) Prevalence of GBV-C/Hepatitis G Virus Viremia and Anti-E2 in Canadian Blood Donors. Vox Sanguinis 79:4, 201-205
CrossRef82
Alan D. Kitchen, John A.J. Barbara. (2000) Which agents threaten blood safety in the future?. Best Practice & Research Clinical Haematology 13:4, 601-614
CrossRef83
J.-P. Allain. (2000) Emerging viral infections relevant to transfusion medicine. Blood Reviews 14:4, 173-181
CrossRef84
K. Whitby, R.B. Ferns, J.A. Garson, M. Bailey, D. Howell, J.A.J. Barbara, R.S. Tedder. (2000) GBV-C Prevalence in Blood Donors and Transfusion Recipients in South East England. Vox Sanguinis 79:4, 246-246
CrossRef85
Steven H. Kleinman, Michael P. Busch. (2000) The risks of transfusion-transmitted infection: direct estimation and mathematical modelling. Best Practice & Research Clinical Haematology 13:4, 631-649
CrossRef86
Chun-Jen Liu, Jia-Horng Kao, Wendy Chen, Ruey-Jen Tsai, Pei-Jer Chen, Ming-Yang Lai, Ding-Shinn Chen. (2000) Interspousal transmission of TT virus: Low efficiency and lack of apparent risk factors. Journal of Gastroenterology and Hepatology 15:11, 1287-1291
CrossRef87
Christoph Sarrazin, Brigitte R
CrossRef88
Shinn-Jang Hwang, Chen-Wei Chu, Rei-Hwa Lu, Keng-Hsin Lan, Jaw-Ching Wu, Yuan-Jan Wang, Full-Young Chang, Shou-Dong Lee. (2000) Seroprevalence of GB virus C/hepatitis G virus-RNA and anti-envelope antibody in high-risk populations in Taiwan. Journal of Gastroenterology and Hepatology 15:10, 1171-1175
CrossRef89
M. A. Sathar, P. N. Soni, D. York. (2000) GB Virus C/Hepatitis G Virus (GBV-C/HGV): still looking for a disease. International Journal of Experimental Pathology 81:5, 305-322
CrossRef90
Premashish Kar, Patwinder Bedi, Nidhika Berry, Anita Chakravorty, Ram K Gupta, Renuka Saha, Bhudev C Das. (2000) Hepatitis G virus (HGV) infection in voluntary and commercial blood donors in India. Diagnostic Microbiology and Infectious Disease 38:1, 7-10
CrossRef91
Tatsuo Kanda, Osamu Yokosuka, Shigenobu Kawal, Fumio Imazeki, Hiromitsu Saisho. (2000) Sequence-motif analysis of 5'-untranslated region of GB virus-C in Japanese patients. Journal of Gastroenterology and Hepatology 15:9, 1048-1053
CrossRef92
Benjamin G Fanson, Patricia Osmack, Adrian M Di Bisceglie. (2000) A comparison between the phenol–chloroform method of RNA extraction and the QIAamp viral RNA kit in the extraction of hepatitis C and GB virus-C/hepatitis G viral RNA from serum. Journal of Virological Methods 89:1-2, 23-27
CrossRef93
Daniel A. Carrasco, Catherine Newman, Stephen K. Tyring. (2000) Treatment of viral hepatitis. Dermatologic Therapy 13:3, 318-325
CrossRef94
D. Shang, Y.H. Lin, I. Rigopoulou, B. Chen, G.J.M. Alexander, J.-P. Allain. (2000) Detection of TT virus DNA in patients with liver disease and recipients of liver transplant. Journal of Medical Virology 61:4, 455-461
CrossRef95
Rosangela Teixeira, Sabrina Pastacaldi, George V. Papatheodoridis, Andrew K. Burroughs. (2000) Recurrent hepatitis C after liver transplantation. Journal of Medical Virology 61:4, 443-454
CrossRef96
Ahmet Uygun, Abdurrahman Kadayifci, Ayhan Kubar, Ahmet Tuzun, Ahmet Erdil, Mustafa Gulsen, Sait Bagci, Necmettin Karaeren, Kemal Dagalp. (2000) Insignificant Role of Hepatitis G Virus Infection in Patients with Liver Enzyme Elevations of Unknown Etiology. Journal of Clinical Gastroenterology 31:1, 73-76
CrossRef97
Andrew J. Pollard, Simon R. Dobson. (2000) Emerging infectious diseases in the 21st century. Current Opinion in Infectious Diseases 13:3, 265-275
CrossRef98
Michiari Okuda, Keisuke Hino, Masaaki Korenaga, Yuhki Yamaguchi, Yoshiharu Katoh, Motokazu Mukaide, Yoshitaka Kaneda, Takashi Minaminozono, Kiwamu Okita. (2000) GB Virus C/Hepatitis G Viremia and Antibody Response to the E2 Protein of Hepatitis G Virus in Hemodialysis Patients. Journal of Clinical Gastroenterology 30:4, 425-428
CrossRef99
J.T. Wang, C.Z. Lee, J.H. Kao, J.C. Sheu, T.H. Wang, D.S. Chen. (2000) Incidence and clinical presentation of posttransfusion TT virus infection in prospectively followed transfusion recipients: emphasis on its relevance to hepatitis. Transfusion 40:5, 596-601
CrossRef100
Timothy J. Tucker, Heidi E.M. Smuts, Christopher Eedes, Gideon D. Knobel, Peter Eickhaus, Simon C. Robson, Ralph E. Kirsch. (2000) Evidence that the GBV-C/hepatitis G virus is primarily a lymphotropic virus. Journal of Medical Virology 61:1, 52-58
CrossRef101
Mireia Giménez-Barcons, Alberto Sánchez-Fueyo, Sergi Ampurdanés, Francesc Puig-Basagoiti, Magdalena Guilera, Angela Ibáñez, Bonaventura Clotet, Miguel-Angel Martı́nez, Juan Rodés, Juan-Carlos Saiz, José-Marı́a Sánchez-Tapias. (2000) Genetic evolution of GB virus C/hepatitis G virus (GBV-C/HGV) under interferon pressure. Antiviral Research 46:2, 157-170
CrossRef102
Jia-Horng Kao, Wendy Chen, Pei-Jer Chen, Ming-Yang Lai, Ding-Shinn Chen. (2000) TT virus infection in patients with chronic hepatitis B or C: Influence on clinical, histological and virological features. Journal of Medical Virology 60:4, 387-392
CrossRef103
Dámaso Infante, Margarita Pich, Ramon Tormo, Silvia Sauleda, Carlos Montané, Juan Ignacio Esteban, Rafael Esteban. (2000) Prevalence of Hepatitis G Virus in Healthy Children in Liver Disease, and Human Immunodeficiency Virus-1 Infection: Response to Interferon. Journal of Pediatric Gastroenterology and Nutrition 30:4, 385-390
CrossRef104
Per Bjorkman, Gunnar Sundstrom, Bela Veress, Anders Widell. (2000) Assessment of Liver Disease and Biochemical and Immunological Markers in Swedish Blood Donors with Isolated GB Virus C/Hepatitis G Virus Viremia. Vox Sanguinis 78:3, 143-148
CrossRef105
Anthony E. T. Yeo, Akihiro Matsumoto, Janes W. Shih, Harvey J. Alter, James J. Goedert. (2000) Prevalence of Hepatitis G Virus in Patients with Hemophilia and Their Steady Female Sexual Partners. Sexually Transmitted Diseases 27:3, 178-182
CrossRef106
S. Ohshima, M. Komatsu, K. Nakane, X.Wei Meng, T. Goto, T. Fujii, K. Yoneyama, Y. Wada, F. Tobori, M. Mukaide, O. Masamune, S. Watanabe. (2000) Iatrogenic GB virus C/hepatitis G virus infection in an area endemic for hepatitis C virus. Journal of Hospital Infection 44:3, 179-185
CrossRef107
Jean-Jacques Lefrère, Joëlle Lerable, Martine Mariotti, Marc Bogard, Vincent Thibault, Lionel Frangeul, Pascale Loiseau, Françoise Bouchardeau, Syria Laperche, Jean-Michel Pawlotsky, Jean-François Cantaloube, Philippe Biagini, Xavier de Lamballerie, Jacques Izopet, Christine Defer, Isabelle Lepot, Jean-Dominique Poveda, Elisabeth Dussaix, Victoria Gerolami, Philippe Halfon, Claudine Buffet-Janvresse, Claude Férec, Bernard Mercier, Patrick Marcellin, Michèle Martinot-Peignoux, Michèle Gassain, Patrick Mérel, Jérôme Lamoril, Joliette Coste, Françoise Roudot-Thoraval. (2000) Lessons from a multicentre study of the detectability of viral genomes based on a two-round quality control of GB virus C (GBV-C)/hepatitis G virus (HGV) polymerase chain reaction assay. Journal of Virological Methods 85:1-2, 117-124
CrossRef108
A. Handa, R. F. Jubran, B. Dickstein, A. Boylan, N. L. C. Luban, N. S. Young, K. E. Brown. (2000) GB Virus C/Hepatitis G Virus Infection Is Frequent in American Children and Young Adults. Clinical Infectious Diseases 30:3, 569-571
CrossRef109
P. Halfon, P. Cacoub. (2000) Quantification virale du virus de l'hépatite C : présent et avenir. La Revue de Médecine Interne 21:2, 174-181
CrossRef110
Dennis Goldfinger. (2000) The pitfalls of cost-effectiveness analyses in guiding patient care. Transfusion 40:1, 125-127
CrossRef111
Fumihiko Mizutani, Kohachiro Sugiyama, Kenji Goto, Toshihiro Ando, Koji Terabe, Yoshiro Wada. (2000) The Prevalence of Serum GB Virus C/Hepatitis G Virus RNA and Anti-E2 in Japanese Children without a History of Blood Transfusion. The Tohoku Journal of Experimental Medicine 190:3, 185-192
CrossRef112
K. V. Narayanan Menon, Nizar N. Zein. (2000) What do we need to know about nonA—to-E viral hepatitis?. Current Gastroenterology Reports 2:1, 33-39
CrossRef113
U. Desselberger. (2000) Emerging and Re-emerging Infectious Diseases. Journal of Infection 40:1, 3-15
CrossRef114
Kamal G. Ishak, MD, PhD. (2000) Pathologic Features of Chronic Hepatitis. American Journal of Clinical Pathology 113:1, 40-55
CrossRef115
Ronald A Sacher, George B Schreiber, Steven H Kleinman. (2000) Prevention of transfusion-transmitted hepatitis. The Lancet 355:9201, 331-332
CrossRef116
E Palomba, A Bairo, P-A Tovo. (1999) High rate of maternal-infant transmission of hepatitis G virus in HIV-1 and hepatitis C virus-infected women. Acta Paediatrica 88:12, 1392-1395
CrossRef117
Jia-Horng Kao, Wendy Chen, Sheng-Chun Hsiang, Pei-Jer Chen, Ming-Yang Lai, Ding-Shinn Chen. (1999) Prevalence and implication of TT virus infection: Minimal role in patients with non-A-E hepatitis in Taiwan. Journal of Medical Virology 59:3, 307-312
CrossRef118
E. Brojer, P. Grabarczyk, W. Kryczka, W. Kucharski, J. Kubicka, B. Z.upanska. (1999) Analysis of hepatitis G virus infection markers in blood donors and patients with hepatitis. Journal of Viral Hepatitis 6:6, 471-475
CrossRef119
Mahomed A Sathar, Paresh N Soni, Rosemary Pegoraro, Peter Simmonds, Donald B Smith, Amar P Dhillon, Geoffery M Dusheiko. (1999) A new variant of GB virus C/hepatitis G virus (GBV-C/HGV) from South Africa. Virus Research 64:2, 151-160
CrossRef120
Klaus Stark, Carl D. Doering, Ulrich Bienzle, Georg Pauli, Osamah Hamouda, Alfred M. Engel, Eckart Schreier. (1999) Risk and clearance of GB virus C/hepatitis G virus infection in homosexual men: A longitudinal study. Journal of Medical Virology 59:3, 303-306
CrossRef121
Haruki Komatsu, Tomoo Fujisawa, Ayano Inui, Tsuyoshi Sogo, Youichi Morinishi, Yoshihiro Miyagawa, Michio Inui. (1999) GBV-C/HGV infection in children with chronic hepatitis C. Journal of Medical Virology 59:2, 154-159
CrossRef122
Helen M. Chapel. (1999) Safety and availability of immunoglobulin replacement therapy in relation to potentially transmissable agents. Clinical and Experimental Immunology 118:S1, 29-34
CrossRef123
James W. Mosley, Jorge Rakela. (1999) Foundling viruses and transfusion medicine. Transfusion 39:10, 1041-1044
CrossRef124
Jian-Min Yuan, Sugantha Govindarajan, Ronald K. Ross, Mimi C. Yu. (1999) Chronic infection with hepatitis G virus in relation to hepatocellular carcinoma among non-Asians in Los Angeles County, California. Cancer 86:6, 936-943
CrossRef125
Silvia Sauleda, Herre J. Reesink, Juan Ignacio Esteban, Georg Hess, Rafael Esteban, Jaime Guardia. (1999) Profiles of GBV-C/hepatitis G virus markers in patients coinfected with hepatitis C virus. Journal of Medical Virology 59:1, 45-51
CrossRef126
Chuan He, Fumio Nomura, Nobuyasu Yukimasa, Sakae Itoga, Maki Yamada-Osaki, Ryo Sumazaki, Toshiaki Nakai. (1999) Transfusion-transmitted virus infection in China: Prevalence in blood donors and in patients with liver diseases. Journal of Gastroenterology and Hepatology 14:9, 899-903
CrossRef127
Mahomed A. Sathar, Paresh N. Soni, Sarala Naicker, Jan Conradie, Fathima Lockhat, Eleanor Gouws. (1999) GB virus C/hepatitis G virus infection in KwaZulu Natal, South Africa. Journal of Medical Virology 59:1, 38-44
CrossRef128
Michael Busch, Mary Chamberland, Jay Epstein, Steven Kleinman, Rima Khabbaz, George Nemo. (1999) Oversight and Monitoring of Blood Safety in the United States. Vox Sanguinis 77:2, 67-76
CrossRef129
J.-J. Lefr
CrossRef130
Timothy J. Tucker, Heidi Smuts, Peter Eickhaus, Simon C. Robson, Ralph E. Kirsch. (1999) Molecular characterization of the 5? non-coding region of South African GBV-C/HGV isolates: Major deletion and evidence for a fourth genotype. Journal of Medical Virology 59:1, 52-59
CrossRef131
Thomas Bourlet, Claire Guglielminotti, Marie Evrard, Philippe Berthelot, Florence Grattard, Anne Fr
CrossRef132
Takafumi Saito, Haruhide Shinzawa, Toshikazu Uchida, Osamu Kawamata, Sayaka Honma, Hisayoshi Watanabe, Li Shao, Koji Saito, Hitoshi Togashi, Tsuneo Takahashi. (1999) Quantitative DNA analysis of low-level hepatitis B viremia in two patients with serologically negative chronic hepatitis B. Journal of Medical Virology 58:4, 325-331
CrossRef133
Akihiro Matsumoto, Anthony E. Yeo, J. Wai Shih, Eiji Tanaka, Kendo Kiyosawa, Harvey J. Alter. (1999) Transfusion-associated TT virus infection and its relationship to liver disease. Hepatology 30:1, 283-288
CrossRef134
J. Xiang, K.J. Daniels, D.R. Soll, W.N. Schmidt, D.R. LaBrecque, J.T. Stapleton. (1999) Visualization and characterization of GB virus-C particles: evidence for a nucleocapsid. Journal of Viral Hepatitis 6:s1, 16-22
CrossRef135
Jia-Horng Kao, Ding-Shinn Chen. (1999) GB virus-C/hepatitis G virus infection in Taiwan: A virus that fails to cause a disease?. Journal of Biomedical Science 6:4, 220-225
CrossRef136
C. Muller. (1999) Pathogenicity of GBV-C/HGV infection. Journal of Viral Hepatitis 6:s1, 49-52
CrossRef137
Abdel Rahman El-Zayadi, Kenji Abe, Osaima Selim, Hideo Naito, Georg Hess, Adham Ahdy. (1999) Prevalence of GBV-C/hepatitis G virus viraemia among blood donors, health care personnel, chronic non-B non-C hepatitis, chronic hepatitis C and hemodialysis patients in Egypt. Journal of Virological Methods 80:1, 53-58
CrossRef138
Xiaofeng Fan, Yanjuan Xu, Harvey Solomon, Sanjay Ramrakhiani, Brent A. Neuschwander-Tetri, Adrian M. Di Bisceglie. (1999) Is hepatitis G/GB virus-C virus hepatotropic? Detection of hepatitis G/GB virus-C viral RNA in liver and serum. Journal of Medical Virology 58:2, 160-164
CrossRef139
M. Basaras, E. Arrese, F. Cabrera, C.Ezpeleta and R. Cisterna. (1999) Detection of HGV in serum and peripheral blood mononuclear cells of maintenance haemodialysis patients.. Journal of Hospital Infection 42:2, 155-159
CrossRef140
Soon-Boon Justin Wong, Soh-Ha Chan, EE-Chee Ren. (1999) Diversity of GB virus C/Hepatitis G virus isolates in Singapore: Predominance of group 2a and the Asian group 3 variant. Journal of Medical Virology 58:2, 145-153
CrossRef141
Magdalena Robaczewska, Lucyna Cova, Anna J. Podhajska, Bogdan Falkiewicz. (1999) Hepatitis G virus: Molecular organization, methods of detection, prevalence, and disease association. International Journal of Infectious Diseases 3:4, 220-233
CrossRef142
Shigenobu Takayama, Takuma Miura, Tomonari Tominaga, Masashi Taki, Sumitaka Matsuo, Shunji Sugii, Kunitada Shimotohno. (1999) Partial nucleotide sequencing of the NS3/helicase region of hepatitis G virus to prove vertical transmission. FEMS Microbiology Letters 175:2, 273-279
CrossRef143
Andrea E. Reid, Margaret James Koziel, Ignasio Aiza, Lennox Jeffers, Rajender Reddy, Eugene Schiff, Johnson Y.N. Lau, Jules L. Dienstag, T. Jake Liang. (1999) Hepatitis c virus genotypes and viremia and hepatocellular carcinoma in the united states. The American Journal of Gastroenterology 94:6, 1619-1626
CrossRef144
ORIT ELKAYAM, HOWAYDA M. HASSOBA, LINDA D. FERRELL, RICHARD GARCIA-KENNEDY, ROBERT G. GISH, TERESA L. WRIGHT, TOM LAFFLER, DENA TRAYLOR, GEFFREY HUNT, PHILIP ROSENTHAL. (1999) GB Virus C (GBV-C/HGV) and E2 Antibodies in Children Preliver and Postliver Transplant. Pediatric Research 45:6, 795-798
CrossRef145
Robert J. Fontana. (1999) Acute liver failure. Current Opinion in Gastroenterology 15:3, 270-277
CrossRef146
Fanghua Liu, Glenn B. Knight, György Ábel, Vincent Agnello. (1999) A competitive reverse transcription-polymerase chain reaction assay for quantitation of GB virus C/hepatitis G virus RNA that circumvents heteroduplex artifact. Journal of Virological Methods 79:2, 149-159
CrossRef147
K. Itoh, K. Hirakawa, H. Okamoto, M. Ukita, H. Tanaka, N. Sawada, F. Tsuda, Y. Miyakawa, M. Mayumi. (1999) Infection by an unenveloped DNA virus associated with non-A to -G hepatitis in Japanese blood donors with or without elevated ALT levels. Transfusion 39:5, 522-526
CrossRef148
Patrick Goubau, Francisco Braga Andrade, Hsin-Fu Liu, Francisco Placido Basilio, Luc Croonen, Vania A. F. Barreto-Gomes. (1999) Prevalence of GB virus C/hepatitis G virus among blood donors in north-eastern Brazil. Tropical Medicine and International Health 4:5, 365-367
CrossRef149
A. Love, B. Stanzeit, S. Gudmundsson, A. Widell. (1999) Hepatitis G virus infections in Iceland. Journal of Viral Hepatitis 6:3, 255-260
CrossRef150
K. Bjoro, T. Haaland, K. Skaug, S. S. Froland. (1999) The spectrum of hepatobiliary disease in primary hypogammaglobulinaemia. Journal of Internal Medicine 245:5, 517-524
CrossRef151
B. Mercier, A. Barclais, C. Botte, J.F. Cantalube, J. Coste, C. Defer, C. Gautreau, C. Giannoli, P. Halfon, I. Lepot, P. Loiseau, J. Martial, P. Montcharmont, P. Merel, D. Ouzan, N. Ravera, J. Follana, R. Cesaire, C. Janot, J.M. Lemaire, P. Micco, G. Vezon, C. Ferec. (1999) Prevalence of GBV C/HGV RNA and GBV C/HGV Antibodies in French Volunteer Blood Donors: Results of a Collaborative Study. Vox Sanguinis 76:3, 166-169
CrossRef152
Roger G. Perez, Nizar N. Zein, Deborah K. Freese, Jean J. Perrault, Jeffery L. Steers, Harvey L. Sharp, David H. Persing. (1999) No Evidence of Hepatitis G Virus in Fulminant Hepatic Failure in Children. Journal of Pediatric Gastroenterology & Nutrition 28:4, 400-403
CrossRef153
Thomas D. Schiano, Maria Isabel Fiel, Kenji Abe, Swan N. Thung, Henry C. Bodenheimer. (1999) ABSENCE OF HEPATITIS G VIRUS WITHIN LIVER TISSUE OF PATIENTS UNDERGOING LIVER TRANSPLANTATION FOR CRYPTOGENIC CIRRHOSIS1. Transplantation 67:8, 1193-1197
CrossRef154
Paul Griffiths. (1999) Time to consider the concept of a commensal virus?. Reviews in Medical Virology 9:2, 73-74
CrossRef155
Borislava G. Pavlova, Renate Heinz, Ursula Selim, Heinz T
CrossRef156
Y. Fukuda, I. Nakano, Y. Katano, T. Kumada, K. Hayashi, S. Nakano, T. Hayakawa. (1999) TT virus (TTV) is not associated with acute sporadic hepatitis. Infection 27:2, 125-127
CrossRef157
Thomas R. Frieden, Lisa Ozick, Colin McCord, Omana V. Nainan, Sara Workman, Gail Comer, Tai Ping Lee, Kwan-Soo Byun, Dhiren Patel, Kelly J. Henning. (1999) Chronic liver disease in central harlem: The role of alcohol and viral hepatitis. Hepatology 29:3, 883-888
CrossRef158
Christian Niel, Jaqueline M. de Oliveira, Rudolf S. Ross, Selma A. Gomes, Michael Roggendorf, Sergei Viazov. (1999) High prevalence of TT virus infection in Brazilian blood donors. Journal of Medical Virology 57:3, 259-263
CrossRef159
Matthias Schr
CrossRef160
J.M. Jongerius, G.J. Boland, C.L. Poel, M.C. Rasch, E. Italiaander, J.J. Reijden, P.N. Friedman, J.J. Cockerill, E.F. Leeuwen, J. Hattum. (1999) GB Virus Type C Viremia and Envelope Antibodies among Population Subsets in The Netherlands. Vox Sanguinis 76:2, 81-84
CrossRef161
Birgit Kallinowski, Manuela Janicki, Renate Seelig, Stefanie Seipp, Jens Hagel, Thomas Dengler, Peter Schnitzler, Lorenz Theilmann, Wolfgang Stremmel. (1999) Clinical relevance of hepatitis G virus (HGV) infection in heart transplant patients. The Journal of Heart and Lung Transplantation 18:3, 190-193
CrossRef162
Maurizio Aricò, Morena Bissolati, Grazia Bossi, Margherita Asti, Antonella Cerino, Désirée Caselli, Antonio Ricci, Catherine Klersy, Enrico Silini, Mario U. Mondelli. (1999) GB virus type C infection in patients treated for childhood acute lymphoblastic leukemia. Transfusion 39:2, 212-217
CrossRef163
Alessandro Tagger, Maria Lisa Ribero, Alberto Larghi, Francesco Donato, Massimo Zuin, Roberta Chiesa, Giampiero Benetti, Giuliano Ramella, Mauro Borzio, Mauro Podda. (1999) Prevalence of GB virus-C/hepatitis G virus infection in patients with cryptogenic chronic liver disease and in patients with primary biliary cirrhosis or Wilson's disease. The American Journal of Gastroenterology 94:2, 484-488
CrossRef164
Lionel Rostaing, Jacques Izopet, Catherine Arnaud, Jean-Marc Cisterne, Laurent Alric, Jean-Louis Rumeau, Michel Duffaut, Dominique Durand. (1999) LONG-TERM IMPACT OF SUPERINFECTION BY HEPATITIS G VIRUS IN HEPATITIS C VIRUS-POSITIVE RENAL TRANSPLANT PATIENTS. Transplantation 67:4, 556-560
CrossRef165
Y. Horsmans, P. Karayiannis, J.L. Christophe, J.M. Pickering, C. Debauche, C. Cornu, J. Rahier, G. Hess, H.C. Thomas, A.P. Geubel. (1999) Severe exacerbation of liver disease during pregnancy in a thalassemic GBV-C/HGV-positive patient and neonatal hepatitis in offspring. Journal of Medical Virology 57:2, 122-125
CrossRef166
Shinn-Jang Hwang, Rei-Hwa Lu, Cho-Yu Chan, Full-Young Chang, Shou-Dong Lee. (1999) Detection of antibodies to E2-protein of GB virus-C/hepatitis G virus in patients with acute posttransfusion hepatitis. Journal of Medical Virology 57:1, 85-89
CrossRef167
Laurence Corash. (1999) Inactivation of viruses, bacteria, protozoa, and leukocytes in platelet concentrates: Current research perspectives. Transfusion Medicine Reviews 13:1, 18-30
CrossRef168
Jean-François Cantaloube, Pierre Gallian, Philippe Biagini, Houssam Attoui, Jacqueline Escher, Jean-Pierre Zappitelli, Yves Delord, Philippe De Micco, Xavier De Lamballerie. (1999) Prevalence of GB virus type C/hepatitis G virus RNA and anti-E2 among blood donors in Southeastern France. Transfusion 39:1, 95-102
CrossRef169
Anne C. E. Moor, Tom M. A. R. Dubbelman, John VanSteveninck, Anneke Brand. (1999) Transfusion-transmitted diseases: risks, prevention and perspectives. European Journal of Haematology 62:1, 1-18
CrossRef170
Thomas Berg, Andrea R. M
CrossRef171
D. Rey, S. Fraize, J. Vidinic, P. Meyer, S. Fritsch, N. Labouret, C. Schmitt, J.M. Lang, F. Stoll-Keller. (1999) High prevalence of GB virus C/hepatitis G virus RNA in patients infected with human immunodeficiency virus. Journal of Medical Virology 57:1, 75-79
CrossRef172
Jean-Jacques Lefrère, Françoise Roudot-Thoraval, Laurence Morand-Joubert, Yvon Brossard, Françoise Parnet-Mathieu, Martine Mariotti, Franz Agis, François Rouet, Joelle Lerable, Guillaume Lefèvre, Robert Girot, Pascale Loiseau. (1999) Prevalence of GB virus type C/hepatitis G virus RNA and of anti-E2 in individuals at high or low risk for blood-borne or sexually transmitted viruses: evidence of sexual and parenteral transmission. Transfusion 39:1, 83-94
CrossRef173
KENJI GOTO, KOHACHIRO SUGIYAMA, ROU LI, YOSHISHIGE MIYAKE, TOSHIHIRO ANDO, FUMIHIKO MIZUTANI, KOJI TERABE, KANTARO MIZUNO, YOSHIRO WADA. (1999) Prevalence of GB Virus C/Hepatitis G Virus Ribonucleic Acid and Anti-Hepatitis G Virus-E2 Antibodies among Japanese Children with Histories of Transfusions or with Liver Diseases. Pediatric Research 45:1, 128-132
CrossRef174
I. Woolley, H. Valdez, C. Walker, A. Landay, D. Zdunek, G. Hess, M. M. Lederman. (1998) Hepatitis G Virus RNA Is Common in AIDS Patients' Plasma but Is Not Associated With Abnormal Liver Function Tests or Other Clinical Syndromes. Journal of Acquired Immune Deficiency Syndromes and Human Retrovirology 19:4, 408-412
CrossRef175
E.S. Berg, L.M. Jarvis, P. Simmonds, H. Bell, K. Skaug. (1998) Detection of GB virus C RNA by GBV-C LCx and two PCR assays with primers from the 5′ non-coding and NS5B region. Journal of Virological Methods 76:1-2, 43-49
CrossRef176
Sergei Viazov, R Stefan Ross, Carola Varenholz, Reinhard Lange, Marianne Holtmann, Christian Niel, Michael Roggendorf. (1998) Lack of evidence for an association between TTV infection and severe liver disease. Journal of Clinical Virology 11:3, 183-187
CrossRef177
F. Lunel, L. Frangeul, C. Chuteau, C. Fretz, V. Thiers, N. Azar, J.M. Bidet, J.-M. Huraux, C. Bréchot, D. Valla, P. Opolon. (1998) Transfusion-associated or nosocomial hepatitis G virus infection in patients undergoing surgery. Transfusion 38:11-12, 1097-1103
CrossRef178
Mario G. Pessoa, Norah A. Terrault, Linda D. Ferrell, Jill Detmer, Janice Kolberg, Mark L. Collins, Maurene Viele, John R. Lake, John P. Roberts, Nancy L. Ascher, Teresa L. Wright. (1998) Hepatitis after liver transplantation: The role of the known and unknown viruses. Liver Transplantation and Surgery 4:6, 461-468
CrossRef179
P. Clevenbergh, J. Durant, P. Halfon, A. Tran, T. Manos, V. Rahelinirina, G. Yang, S. Benzaken, D. Ouzan, P. Rampal, P. Dellamonica. (1998) High prevalence of GB virus C/hepatitis G virus infection in different risk groups of HIV-infected patients. Clinical Microbiology and Infection 4:11, 644-647
CrossRef180
Howayda M. Hassoba, Mario G. Pessoa, Norah A. Terrault, Nancy J. Lewis, Mark Hayden, Jeffrey C. Hunt, Xiaoxing Qiu, Sheng C. Lou, Teresa L. Wright. (1998) Antienvelope antibodies are protective against GBV-C reinfection: Evidence from the liver transplant model. Journal of Medical Virology 56:3, 253-258
CrossRef181
Giovanna Fattovich, Maria Lisa Ribero, Susanna Favarato, Franco Azzario, Francesco Donato, Giuliano Giustina, Michele Fasola, Maurizio Pantalena, Giuseppe Portera, Alessandro Tagger. (1998) Influence of GB virus-C/hepatitis G virus infection on the long-term course of chronic hepatitis B. Liver 18:5, 360-365
CrossRef182
Albert Tran, Patrick Hastier, Guang Yang, Fabrice Longo, Denis Ouzan, Jacques Durant, Rene Follana, Martin Buckley, Marie-Christine Saint-Paul, Alain Doglio, Patrick Rampal, Sylvia Benzaken. (1998) Hepatitis G Virus (HGV) and Antibodies to a Putative HGV Envelope Protein in Alcoholic Patients in South-Eastern France. The American Journal of Gastroenterology 93:9, 1599-1600
CrossRef183
P. Fabris, M. R. Biasin, D. Infantolino, L. Romanó, P. Benedetti, G. Tositti, G. P. Pellizzer, A. R. Zanetti, C. Stecca, G. Marchelle, F. Lalla. (1998) HGV/GBV-C in liver tissue and in sera from patients with chronic hepatitis C. Infection 26:5, 283-287
CrossRef184
N. Kennedy, C.Y.W. Tong, N.J. Beeching, K. Lamden, H. Williams, K.J. Mutton, C.A. Hart. (1998) Hepatitis G virus infection in drug users in liverpool. Journal of Infection 37:2, 140-147
CrossRef185
P. Simmonds. (1998) Transfusion virology: progress and challenges. Blood Reviews 12:3, 171-177
CrossRef186
José L. Rodríguez Agulló, Avelina Suárez, José M. Ladero, Gustavo López-Alonso, Juan J. Picazo, Manuel Díaz-Rubio. (1998) Hepatitis G virus infection in Spanish patients with hepatocellular carcinoma. Liver 18:4, 255-258
CrossRef187
Kenji Abe, Yoshihiro Edamoto, Young Nyun Park, Abraham M. Nomura, Teresa Casanovas Taltavull, Masayoshi Tani, Swan N. Thung. (1998) In situ detection of hepatitis B, C, and G virus nucleic acids in human hepatocellular carcinoma tissues from different geographic regions. Hepatology 28:2, 568-572
CrossRef188
Angela Ibáñez, Mireia Giménez-Barcons, Angel Tajahuerce, Cristina Tural, Guillem Sirera, Bonaventura Clotet, José-María Sánchez-Tapias, Juan Rodés, Miguel-Angel Martínez, Juan-Carlos Saiz. (1998) Prevalence and genotypes of GB virus C/hepatitis G virus (GBV-C/HGV) and hepatitis C virus among patients infected with human immunodeficiency virus: Evidence of GBV-C/HGV sexual transmission. Journal of Medical Virology 55:4, 293-299
CrossRef189
P Karayiannis. (1998) Natural history and molecular biology of hepatitis G virus/GB virus C. Clinical and Diagnostic Virology 10:2-3, 103-111
CrossRef190
Yvonne Cossart. (1998) TTV a common virus, but pathogenic?. The Lancet 352:9123, 164
CrossRef191
Nikolai V Naoumov, Elena P Petrova, Mark G Thomas, Roger Williams. (1998) Presence of a newly described human DNA virus (TTV) in patients with liver disease. The Lancet 352:9123, 195-197
CrossRef192
Martina F. Scallan, Dan Clutterbuck, Lisa M. Jarvis, Gordon R. Scott, Peter Simmonds. (1998) Sexual transmission of GB virus C/hepatitis G virus. Journal of Medical Virology 55:3, 203-208
CrossRef193
Jun Takamatsu, Fumio Tsuda, Masahiko Okudaira. (1998) Infection with GB virus C, hepatitis C and B viruses in 1,044 cases autopsied at the medical examiner's office in Tokyo. Journal of Medical Virology 55:2, 123-128
CrossRef194
P.V. Holland. (1998) Post-Transfusion Hepatitis: Current Risks and Causes. Vox Sanguinis 74:S2, 135-141
CrossRef195
J.E. Menitove. (1998) Hemovigilance in the United States of America. Vox Sanguinis 74:S2, 447-455
CrossRef196
Tatsunori Nakano, Masashi Mizokami, Kun Cao, Seiji Noguchi, Michio Sata, Young-Min Park, Boo-Sung Kim, Tsendsuren Oyunsuren, Leila Beltrao Pereira, Ruslan Ruzibakiev, Vladimir Gurtsevitch, Masanori Hayami. (1998) Lack of anti-GOR antibody among subjects with GB virus C/hepatitis G virus RNA. Journal of Medical Virology 55:2, 129-133
CrossRef197
J-P. Allain. (1998) Emerging Viruses in Blood Transfusion. Vox Sanguinis 74:S2, 125-129
CrossRef198
Murthy, A. Scott Muerhoff, Suresh M. Desai, Svetlozar N. Natov, Beth A. Bouthot, Robin Ruthazer, Christopher H. Schmid, Andrew S. Levey, Isa K. Mushahwar, Brian J.G. Pereira. (1998) Predictors of GBV-C infection among patients referred for renal transplantation. Kidney International 53:6, 1769-1774
CrossRef199
E. Tanaka, K. Kiyosawa, K. Shimoda, K. Hino, M. Tacke, S. Schmolke, A. M. Engel, G. Hess. (1998) Evolution of hepatitis G virus infection and antibody response to envelope protein in patients with transfusion-associated non-A, non-B hepatitis. Journal of Viral Hepatitis 5:3, 153-159
CrossRef200
Albert J. Czaja, Ahmad S. Abdulkarim, Herschel A. Carpenter, Rogelio G. Perez, David H. Persing, Nizar N. Zein. (1998) GB Virus-C Infection in Type 1 Autoimmune Hepatitis. Mayo Clinic Proceedings 73:5, 412-418
CrossRef201
Joachim Woelfle, Thomas Berg, Klaus M. Keller, Eckhard Schreier, Michael J. Lentze. (1998) Persistent Hepatitis G Virus Infection After Neonatal Transfusion. Journal of Pediatric Gastroenterology & Nutrition 26:4, 402-407
CrossRef202
Kenneth G. Hadlock, Steven K.H. Foung. (1998) GBV-C/HGV: A new virus within the Flaviviridae and its clinical implications. Transfusion Medicine Reviews 12:2, 94-108
CrossRef203
CHRISTOPHER J GRESENS, PAUL V HOLLAND. (1998) Current risks of viral hepatitis from blood transfusions. Journal of Gastroenterology and Hepatology 13:4, 443-449
CrossRef204
V. Carnelli, R. Cimaz, E. Tanzi, L. Romano, A.R. Zanetti. (1998) High Prevalence of HGV/GBV-C Infection in Polytransfused Patients with Thalassemia Major. Vox Sanguinis 74:3, 212-212
CrossRef205
XH. Zhang, H. Shinzawa, L. Shao, M. Ishibashi, QH. Jiang, K. Saito, H. Misawa, H. Togashi, T. Takahashi. (1998) Epidemiological study and genetic analysis of GB virus C infection in general population from an area endemic for hepatitis C. Journal of Medical Virology 54:4, 237-242
CrossRef206
L. Bélec, N. Cancré, A. Si Mohamed, K. Habibatou, M. Matta, J. Pillot, A. Diallo. (1998) Lack of association between chronic hepatitis and hepatitis G virus infection in Senegal. Clinical Microbiology and Infection 4:4, 222-223
CrossRef207
Shinichi Kakumu, Katsuhiko Sato, Takayuki Morishita, Trinh Kim Anh, Nguyen Huu Binh, Banh Vu Dien, Do Huu Chinh, Nguyen Huu Phuc, Nguyen Van Thinh, Le Tuyet Trinh, Naohiko Yamamoto, Haruhisa Nakao, Shin Isomura. (1998) Prevalence of hepatitis B, hepatitis C, and GB virus C/hepatitis G virus infections in liver disease patients and inhabitants in Ho Chi Minh, Vietnam. Journal of Medical Virology 54:4, 243-248
CrossRef208
H. G. Heuft, T. Berg, E. Schreier, U. Kunkel, M. Tacke, N. Schwella, U. Hopf, A. Salama, D. Huhn. (1998) Epidemiological and Clinical Aspects of Hepatitis G Virus Infection in Blood Donors and Immunocompromised Recipients of HGV-Contaminated Blood. Vox Sanguinis 74:3, 161-167
CrossRef209
B. Cacopardo, A. Berger, S. Cosentino, S. Lombardo, M.L. Morrone, V. Boscia, G. Vinci, R. Restivo, G. Brancati, H.W. Doerr, A. Nunnari. (1998) Serum hepatitis G virus (HGV) RNA in multitransfused thalassemics from Eastern Sicily. Journal of Infection 36:2, 179-183
CrossRef210
Hidenori Toyoda, Yoshihide Fukuda, Tetsuo Hayakawa, Junki Takamatsu, Hidehiko Saito. (1998) Effect of GB Virus C/Hepatitis G Virus Coinfection on the Course of HIV Infection in Hemophilia Patients in Japan. Journal of Acquired Immune Deficiency Syndromes and Human Retrovirology 17:3, 209-213
CrossRef211
Mary Chamberland, Rima F. Khabbaz. (1998) EMERGING ISSUES IN BLOOD SAFETY. Infectious Disease Clinics of North America 12:1, 217-229
CrossRef212
J
CrossRef213
Mario G. Pessoa, Norah A. Terrault, Jill Detmer, Janice Kolberg, Mark Collins, Howayda M. Hassoba, Teresa L. Wright. (1998) Quantitation of hepatitis G and C viruses in the liver: evidence that hepatitis G virus is not hepatotropic. Hepatology 27:3, 877-880
CrossRef214
M Poljak, K Seme. (1998) Simple one-tube reverse transcription-polymerase chain reaction protocol containing anticontamination procedure for detection of GB virus C/hepatitis G virus RNA. Journal of Virological Methods 71:1, 1-6
CrossRef215
(1998) GB-Virus Typ C (GBV-C). Bundesgesundheitsblatt 41:2, 88-90
CrossRef216
R. S. Ross, S. Viazov, U. Schmitt, S. Schmolke, M. Tacke, B. Ofenloch-Haehnle, M. Holtmann, N. Müller, G. Da Villa, C. F. Yoshida, J. M. Oliveira, A. Szabo, N. Paladi, J. P. Kruppenbacher, Th. Philipp, M. Roggendorf. (1998) Distinct prevalence of antibodies to the E2 protein of GB virus C/hepatitis G virus in different parts of the world. Journal of Medical Virology 54:2, 103-106
CrossRef217
Alessandro R. Zanetti, Elisabetta Tanzi, Luisa Romanó, Nicola Principi, Giovanna Zuin, Eliseo Minola, Barbara Zapparoli, Marina Palmieri, Antonio Marini, Daniela Ghisotti, Paula Friedman, Jeffrey Hunt, Thomas Laffler, . (1998) Multicenter trial on mother-to-infant transmission of GBV-C virus. Journal of Medical Virology 54:2, 107-112
CrossRef218
Stephen D. H. Malnick, Yoav Lurie, Nadia Sokolowski, Ayella Orr, Avinoam Kaftoury, Svetlana Gorevitz, Yaakov Bar-Khaim, Erica Sigler, Marc Beergabel, David Bass. (1998) Hepatitis G Virus Infection in Israel. Journal of Clinical Gastroenterology 26:1, 88-89
CrossRef219
M. R. Charlton, D. Brandhagen, R. H. Wiesner, J. B. Gross, J. Detmer, M. Collins, J. Kolberg, R. A.F. Krom, D. H. Persing. (1998) HEPATITIS G VIRUS INFECTION IN PATIENTS TRANSPLANTED FOR CRYPTOGENIC CIRRHOSIS. Transplantation 65:1, 73-76
CrossRef220
Leda Bassit, Bernhard Kleter, Gabriela Ribeiro-dos-Santos, Geert Maertens, Ester Sabino, Dalton Chamone, Wim Quint, Amadeo Sáez-Alquézar. (1998) Hepatitis G Virus: Prevalence and Sequence Analysis in Blood Donors of São Paulo, Brazil. Vox Sanguinis 74:2, 83-87
CrossRef221
Jean-Michel Pawlotsky, Françoise Roudot-Thoraval, A. Scott Muerhoff, Muriel Pellerin, Georgios Germanidis, Suresh M. Desai, Anne Bastie, Françoise Darthuy, Jocelyne Rémiré, Elie-Serge Zafrani, Claude-James Soussy, Isa K. Mushahwar, Daniel Dhumeaux. (1998) GB virus C (GBV-C) infection in patients with chronic hepatitis C. Influence on liver disease and on hepatitis virus behaviour: Effect of interferon alfa therapy. Journal of Medical Virology 54:1, 26-37
CrossRef222
Birgit Kallinowski, Christine Buhrmann, Stefanie Seipp, Tobias Goeser, Wolfgang Stremmel, Gerd Otto, Lorenz Theilmann. (1998) Incidence, prevalence, and clinical outcome of hepatitis GB-C virus infection in liver transplant patients. Liver Transplantation and Surgery 4:1, 28-33
CrossRef223
S. J. Hadziyannis. (1998) Fulminant hepatitis and the new G/GBV-C flavivirus. Journal of Viral Hepatitis 5:1, 15-19
CrossRef224
I. D. Diamantis, E. Kouroumalis, M. Koulentaki, E. Fasler-Kan, P. A. Schmid, H. H. Hirsch, H. Bühler, K. Gyr, M. Battegay. (1997) Influence of hepatitis G virus infection on liver disease. European Journal of Clinical Microbiology & Infectious Diseases 16:12, 916-919
CrossRef225
Jia-Horng Kao, Chun-Jen Liu, Pei-Jer Chen, Wendy Chen, Sheng-Chun Hsiang, Ming-Yang Lai, Ding-Shinn Chen. (1997) Interspousal transmission of GB virus-C/hepatitis G virus: A comparison with hepatitis C virus. Journal of Medical Virology 53:4, 348-353
CrossRef226
HUEY-LING CHEN, MEI-HWEI CHANG, YEN-HSUAN NI, HONG-YUAN HSU, JIA-HORNG KAO, PEI-JER CHEN. (1997) Hepatitis G Virus Infection in Normal and Prospectively Followed Posttransfusion Children. Pediatric Research 42:6, 784-787
CrossRef227
TADASHI IDEURA, EIJI TANAKA, YOSHIYUKI NAKATSUJI, MAMORU KOBAYASHI, YUTAKA KANNO, HISAO OGUCHI, KAZUHIKO HORA. (1997) Clinical significance of hepatitis G virus infection in patients on long-term haemodialysis. Journal of Gastroenterology and Hepatology 12:11, 762-765
CrossRef228
James Versalovic. (1997) Hepatitis G virus. Clinical Microbiology Newsletter 19:21, 161-164
CrossRef229
Robin A. Gutierrez, George J. Dawson, Mark F. Knigge, Susan L. Melvin, Cynthia A. Heynen, Charles R. Kyrk, Charles E. Young, Robert J. Carrick, George G. Schlauder, Teresa K. Surowy, Bruce J. Dille, Paul F. Coleman, Dwain L. Thiele, Joseph R. Lentino, Constance Pachucki, Isa K. Mushahwar. (1997) Seroprevalence of GB virus C and persistence of RNA and antibody. Journal of Medical Virology 53:2, 167-173
CrossRef230
Santosh Man Shrestha, Shobhana Shrestha, Fumio Tsuda, Naoto Sawada, Takeshi Tanaka, Hiroaki Okamoto, Yuzo Miyakawa, Makoto Mayumi. (1997) Infection with GB virus C and hepatitis C virus in drug addicts, patients on maintenance hemodialysis, or with chronic liver disease in Nepal. Journal of Medical Virology 53:2, 157-161
CrossRef231
Sheng Lou, Xiaoxing Qiu, Gary Tegtmeier, Sandra Leitza, John Brackett, Kristen Cousineau, Amit Varma, Heidi Seballos, Samar Kundu, Steve Kuemmerlea, J.C. Hunt. (1997) Immunoassays to study prevalence of antibody against GB virus C in blood donors. Journal of Virological Methods 68:1, 45-55
CrossRef232
(1997) Hepatitis-Associated Aplastic Anemia. New England Journal of Medicine 337:6, 424-425
Full Text233
(1997) Hepatitis G Infection. New England Journal of Medicine 337:4, 276-277
Full Text234
Miyakawa, Yuzo, , Mayumi, Makoto, . (1997) Hepatitis G Virus — A True Hepatitis Virus or an Accidental Tourist?. New England Journal of Medicine 336:11, 795-796
Full Text235
Alter, Miriam J., Gallagher, Margaret, Morris, Timothy T., Moyer, Linda A., Meeks, Emory L., Krawczynski, Krzysztof, Kim, Jungsuh P., Margolis, Harold S., . (1997) Acute Non-A–E Hepatitis in the United States and the Role of Hepatitis G Virus Infection. New England Journal of Medicine 336:11, 741-746
Full Text236
Tomoo Kobayashi, Motoyasu Ishii, Hirofumi Niitsuma, Kumiko Kikuchi, Chiaki Suzuki, Hiroko Gama, Koji Kobayashi, Yoshiyuki Ueno, Takayoshi Toyota. (1997) Genoepidemiology and Pathogenicity of Hepatitis G Virus in Japan. The Tohoku Journal of Experimental Medicine 183:2, 101-112
CrossRef
- Letters
