Original Article
Acute Non-A–E Hepatitis in the United States and the Role of Hepatitis G Virus Infection
N Engl J Med 1997; 336:741-746March 13, 1997
- Abstract
Background
Little is known about the relation of the newly discovered hepatitis G virus (HGV) to the cause and clinical course of acute and chronic viral hepatitis.
Methods
We selected patients from a surveillance study of acute viral hepatitis in four U.S. counties who had acute disease during 1985 to 1986 or 1991 to 1995. Serum samples were tested for HGV RNA by the polymerase chain reaction.
Results
HGV RNA was detected in 4 of 45 patients with a diagnosis of non-A–E hepatitis (9 percent), 23 of 116 patients with hepatitis C (20 percent), 25 of 100 patients with hepatitis A (25 percent), and 32 of 100 patients with hepatitis B (32 percent) (P<0.05 for the comparison of hepatitis B with hepatitis non-A–E or C). The clinical characteristics of the acute illness were similar for patients with HGV alone and those with hepatitis A, B, or C with or without HGV infection. During a follow-up period of one to nine years, chronic hepatitis did not develop in any of the patients with HGV alone, but 75 percent were persistently positive for HGV RNA, as were 87 percent of those with both hepatitis C and HGV infection. The rates of chronic hepatitis were similar in patients with hepatitis C alone (60 percent) and those with both hepatitis C and HGV infection (61 percent).
Conclusions
The evidence from this surveillance study does not implicate HGV as an etiologic agent of non-A–E hepatitis. Persistent infection with HGV was common, but it did not lead to chronic disease and did not affect the clinical course in patients with hepatitis A, B, or C.
Media in This Article
Figure 1
HGV Infection and the Clinical Course of Hepatitis.Table 1
Demographic and Clinical Characteristics of Patients with Acute Non-A, Non-B Hepatitis According to Their HGV and HCV Infection Status.Article Activity
- Article
About 10 to 15 percent of patients with parenterally transmitted non-A, non-B hepatitis have no evidence of hepatitis C virus (HCV) infection after extensive evaluation and can therefore be classified as having non-A–E hepatitis.1-4 As compared with patients with acute hepatitis C, patients with acute non-A–E hepatitis are less likely to be jaundiced, have lower peak alanine aminotransferase levels, and have a lower frequency of chronic hepatitis (0 to 29 percent).1,3,4
Recently, two isolates of a new virus, designated hepatitis GB virus C or hepatitis G virus (HGV), were identified from patients with viral hepatitis.5-7 The amino acid sequences of the two isolates are 95 percent homologous, and the genomic organization of this virus places it in the family Flaviviridae, which includes HCV.6,7 Because no antigenic epitopes have been identified that can be used to develop a serologic test that detects current infection, studies of HGV infection are dependent on polymerase-chain-reaction (PCR) techniques.
To determine the characteristics of acute non-A–E hepatitis in the United States and the possibility that it is caused by HGV, we analyzed data from patients with acute, clinically apparent viral hepatitis who were identified through a sentinel surveillance system involving counties in four states since 1982.1,8,9
Methods
Enrollment
The Sentinel Counties Study of Viral Hepatitis enrolls all patients with acute viral hepatitis reported to the county health departments involved in the study: Jefferson County (Birmingham), Alabama; Denver County (Denver), Colorado; Pinellas County (St. Petersburg), Florida; and Pierce County (Tacoma), Washington.1,8,9 The current study included a subgroup of patients identified during two time periods who were at least 18 years old and had serum samples available for testing: all patients with acute non-A, non-B hepatitis during 1985 to 1986 who participated in a prospective study of the natural history of the disease,1 and all patients with acute non-A, non-B hepatitis during 1991 to 1995 as well as a sample of 100 consecutively identified patients with acute hepatitis A and 100 with acute hepatitis B during this period. The groups with hepatitis A and B were balanced to include the same proportion of injection-drug users as that found among all the patients with hepatitis C.
Clinical criteria for inclusion in the study were a physician's diagnosis of acute viral hepatitis that was based on the discrete onset of signs and symptoms, serum aminotransferase activity that was more than 2.5 times the upper limit of normal, and the exclusion of other causes of liver disease.1,8 Serum samples were collected from all patients within six weeks after the onset of illness. Hepatitis A was defined by the presence of IgM antibody against hepatitis A virus (HAV); hepatitis B by the presence of both hepatitis B surface antigen and IgM antibody against hepatitis B core antigen or of IgM antibody against hepatitis B core antigen; and hepatitis C by the presence of antibody against HCV (anti-HCV), HCV RNA, or antibody against HCV native antigens in the initial or follow-up serum samples obtained from patients negative for IgM antibody against HAV and hepatitis B core antigen.1,10 Patients who were negative for all these viral hepatitis markers (non-A, non-B, non-C hepatitis) were then tested for antibody against hepatitis E virus (HEV), and all were negative, defining this group as having non-A–E hepatitis. All the patients were interviewed to identify risk factors for hepatitis during the six months preceding the onset of illness.1,8,9
Follow-up
For the cohort of patients with hepatitis C or non-A–E hepatitis identified during 1985 to 1986 who provided written informed consent, serum samples were collected beginning six months after the onset of acute illness, every three months thereafter for four years, and then yearly for up to nine years. A subgroup of these patients underwent clinical evaluation for chronic liver disease, including liver biopsy.1 For the cohort of patients with hepatitis C or non-A–E hepatitis identified during 1991 to 1995 who provided written informed consent, serum samples were collected beginning six months after the onset of acute illness and every six months thereafter for up to three years. All follow-up samples were tested for alanine aminotransferase activity and markers of HAV, hepatitis B virus (HBV), and HCV infection. Chronic hepatitis was defined as a finding of two or more abnormal alanine aminotransferase values at least nine months after the onset of acute illness.1
Laboratory Studies
Serum samples were tested with commercially available radioimmunoassays (Abbott Laboratories, North Chicago, Ill.) for hepatitis B surface antigen, antibody against hepatitis B core antigen, and antibody against hepatitis B surface antigen and enzyme immunoassays (Abbott Laboratories) for IgM antibody against HAV, IgM antibody against hepatitis B core antigen, and anti-HCV (a second-version assay was used). Samples negative for anti-HCV were retested by a third-version enzyme immunoassay (Ortho Diagnostic Systems, Raritan, N.J.).11 Samples that were repeatedly reactive for anti-HCV with the use of either assay were tested by the appropriate supplemental anti-HCV assay (Matrix HCV, Abbott Laboratories, or RIBA 3.0, Chiron, Emeryville, Calif.). Testing by reverse-transcriptase PCR for HCV RNA and by fluorescent-antibody blocking for antibody against HCV native antigens was carried out as described previously.1,10 Testing for antibody against HEV was performed with an enzyme immunoassay that detects antibodies against capsid proteins.12
Available serum samples (initial and follow-up) from patients with hepatitis C or non-A–E hepatitis were tested for HGV RNA after nucleic acid amplification by reverse-transcriptase PCR. RNA was extracted from 100 μl of serum with a guanidinium–isothiocyanate–acid phenol procedure (RNAzol, Biotecx Laboratories, Houston) and reverse-transcribed with Moloney murine-leukemia virus with primer 211R located in nonstructural region 5 (NS5) of the HGV genome.7 The resulting complementary DNA was amplified for 45 cycles with primers 211R and 77F as previously reported,7 and the specificity of the PCR products was confirmed by Southern blot hybridization with a 32P-labeled probe (5'CTCCATCGCCAGCACTTATCTCGGTTAC3'). To monitor each run, human serum samples found to be negative for HGV RNA on at least five occasions were tested in duplicate to check for cross-contamination, and the sensitivity was assessed by the inclusion of an end-point dilution series of the cloning-source plasma.7 Samples that tested negative with NS5 primers were retested with primers located in the 5' untranslated region (UTR-1F: 5'GTAGGTCGTAAATCCCGGTCAC3', and UTR-1R: 5'CCCACTGGTCCTTGTCAACTCG3'), and products were confirmed by hybridization with a 32P-labeled probe (5'GTCTCTCTTGACCAATAGGCGTAGCCG3').
Serum samples from patients with acute hepatitis A or hepatitis B were tested for HGV RNA by reverse-transcriptase PCR, and PCR products were detected fluorogenically (TaqMan, Perkin-Elmer, Applied Biosystems, Foster City, Calif.) by methods used to detect HCV RNA.13 Briefly, reverse-transcriptase PCR was performed with the primers for the NS5 region described above, and the PCR product was detected spectrophotometrically (model LS50 luminescent spectrometer, Perkin Elmer) with a probe synthesized with the reporter dye 6-carboxyfluorescein covalently attached to the 5' end and the quencher dye 6-carboxy-tetramethyl-rhodamine attached by a linker downstream from the 6-carboxyfluorescein.
Statistical Analysis
Frequency distributions were compared with the two-tailed Mantel–Haenszel chi-square test or two-tailed Fisher's exact test, and means were compared with Student's t-test. Stratified and logistic-regression analyses were performed to control for confounding variables. P values of less than 0.05 were considered to indicate statistical significance.
Results
A total of 10,533 patients with acute viral hepatitis were reported to the Sentinel Counties surveillance system during 1982 to 1995: 5033 had hepatitis A (48 percent; 95 percent confidence interval, 47 to 49 percent), 3598 had hepatitis B (34 percent; 95 percent confidence interval, 33 to 35 percent), 1580 had hepatitis C (15 percent; 95 percent confidence interval, 15 to 16 percent), and 322 had non-A–E hepatitis (3 percent; 95 percent confidence interval, 2.7 to 3.4 percent).
HGV Infection in Patients with Acute Non-A–E Hepatitis or Hepatitis C
During the two periods selected for this study (1985 to 1986 and 1991 to 1995), serum samples were available for HGV testing from 45 of 98 patients identified as having acute non-A–E hepatitis (46 percent) and 116 of 266 patients identified as having acute hepatitis C (44 percent). HGV RNA was detected in 4 patients with non-A–E hepatitis (9 percent) and 23 patients with hepatitis C (20 percent). There was no difference in the prevalence of HGV infection between the two time periods, although all four patients with HGV infection alone were identified in 1985.
The demographic and clinical characteristics of these patients were compared on the basis of their HGV status (Table 1Table 1
Demographic and Clinical Characteristics of Patients with Acute Non-A, Non-B Hepatitis According to Their HGV and HCV Infection Status.). The patients with HGV infection alone were younger (all but one were less than 30 years old), but their acute clinical characteristics were similar to those of the patients with HCV alone or those infected with both HCV and HGV. Three of the four patients with HGV infection alone were jaundiced, and three (including one without jaundice) had other nonspecific symptoms of viral hepatitis (fatigue, nausea, and loss of appetite). The patients with no evidence of infection with a known hepatitis virus (non-A–G) were older and had milder acute disease with significantly lower alanine aminotransferase activity, but they were more likely to be hospitalized for their acute illness (P<0.05, adjusted for age).HGV Infection in Patients with Hepatitis A or B
HGV RNA was detected in 25 of 100 patients with hepatitis A (25 percent) and 32 of 100 patients with hepatitis B (32 percent). The prevalence of HGV infection was significantly higher among patients with hepatitis B than among patients with hepatitis C or non-A–E hepatitis (P<0.05). Most (70 to 80 percent) of the HGV infections occurred in persons younger than 40 years old. The clinical characteristics of patients with HGV and either hepatitis A or hepatitis B were similar to those of patients with hepatitis A or B alone (data not shown).
Clinical Outcome of Patients with HGV Infection
During a follow-up period of one to nine years, no biochemical evidence of chronic hepatitis developed in the four patients with HGV infection alone (Table 1). In contrast, chronic hepatitis developed in 60 percent of the patients with HCV infection and in a similar proportion (61 percent) of the patients with both HCV and HGV infections. Chronic hepatitis also developed in 32 percent of the group with non-A–G hepatitis. HGV infection persisted in 75 percent of the group infected with HGV alone and in 87 percent of the group infected with both HCV and HGV. In both groups of patients, detection of HGV RNA was intermittent, with two or more negative determinations preceded and followed by positive determinations.
Only nine of the patients with persistently abnormal alanine aminotransferase levels in this study had undergone liver biopsy. In the HCV-infected group, five patients (one of whom was also infected with HGV) had mild hepatitis, and one patient (with HCV infection alone) had cirrhosis. In the group with non-A–G hepatitis, two patients had mild hepatitis and one had chronic active hepatitis. Because all the patients with HGV infection alone had persistently normal alanine aminotransferase activity, none had undergone liver biopsy.
The typical clinical course of a patient with HGV infection alone is shown in Figure 1AFigure 1
HGV Infection and the Clinical Course of Hepatitis.. This patient had a relatively mild acute illness with complete biochemical resolution of hepatitis, whereas assays for HGV RNA remained positive for nine years. The patient whose course is shown in Figure 1B had a relatively severe illness, with slowly resolving hepatitis, and initially was positive for HGV RNA alone. During follow-up, HGV RNA was detected in all samples tested, whereas alanine aminotransferase activity remained normal until 30 months after the initial illness. At that time the patient had a second episode of acute hepatitis, during which HCV RNA was detected, followed by the appearance of anti-HCV. Alanine aminotransferase activity again returned to normal for more than five years, when it increased to a level of 86 U per liter, suggesting the presence of chronic hepatitis presumably due to HCV infection.Potential Sources of Infection
Factors present in the six months before the onset of illness that are known to be associated with a risk of acquiring non-A, non-B hepatitis8,14 were evaluated with the use of mutually exclusive categories in the patients with HGV alone, HCV alone, HCV and HGV, and non-A–G hepatitis (Table 2Table 2
Factors Associated with a Risk of Non-A, Non-B Hepatitis in the Six Months before the Onset of Illness among the Patients, According to Their HGV and HCV Infection Status.). Transfusion-associated hepatitis occurred among patients in all groups. Injection-drug users were found in all of the groups except the group with non-A–G hepatitis. One patient with HGV infection alone had a history of multiple sex partners. The group with non-A–G hepatitis had a disproportionate number of patients who denied having most of the risk factors; for most of these patients, the only distinguishing characteristic was low socioeconomic level. Evidence of prior HBV infection was found more often in patients infected with HCV alone or with HCV and HGV than in patients with HGV infection alone (P>0.05) or patients with non-A–G hepatitis (P<0.01) (Table 2).When analyses were stratified according to injection-drug use, there was a significantly higher prevalence of HGV infection among the drug users with hepatitis A or hepatitis B than among patients with hepatitis A or B who reported no use of injection drugs (Table 3Table 3
Prevalence of HGV Infection among Patients with Acute Hepatitis A, B, or C, According to Injection-Drug Use.). We found no such difference for patients with hepatitis C (even after multivariate analysis), although in all three groups, at least 40 percent of the HGV infections were among injection-drug users.Discussion
The epidemiologic data obtained from sentinel surveillance for acute viral hepatitis in the four counties have been shown to be representative of the United States with respect to clinically overt viral hepatitis.8,9 If the data from this study are applied to all cases of acute viral hepatitis identified during the past 14 years, they suggest that approximately 0.3 percent (95 percent confidence interval, 0.2 to 0.4 percent) of persons with acute viral hepatitis may be infected with HGV alone. However, this study did not implicate HGV as an etiologic agent of non-A–E hepatitis. Although there was a high proportion of injection-drug users among the patients with hepatitis A, B, or C, the proportion of patients with non-A–E hepatitis who were found to be positive for HGV RNA was similar to or lower than that of patients with other types of viral hepatitis, even when injection-drug users were excluded. Published case series have claimed an association between HGV and acute and chronic liver disease as well as fulminant hepatitis,7,15,16 but case–control studies are required to confirm whether or not HGV is an etiologic agent of viral hepatitis or any other disease. However, the ability to carry out such studies is limited by the small number of patients with HGV infection alone.
The data from this study suggest that HGV may not be primarily a hepatotropic agent; instead, it may induce hepatitis only under certain circumstances, as is observed with other viruses (e.g., cytomegalovirus and yellow fever virus). That HGV does not replicate primarily in the liver is supported by the absence of disease in chimpanzees that were intravenously inoculated with HGV17 and by data from prospective studies of transfusion recipients showing that rates of HGV infection are similar among persons in whom hepatitis develops and those in whom it does not.18
The presence of HGV infection had no apparent effect on the clinical course of acute disease among the patients with hepatitis A, B, or C or on the frequency and severity with which chronic hepatitis developed in patients with hepatitis C, a finding confirmed by other studies.19 Most patients with HGV infection had viremia for long periods, but none of the patients with HGV infection alone had biochemical evidence of chronic hepatitis. However, our sample was small and included only patients with clinically apparent disease, so we cannot draw definitive conclusions regarding the course and outcome of all persons infected with HGV alone.
Although the association of HGV with disease remains unclear, there is no question that HGV is a unique virus that can be transmitted by blood.7,17,18 In addition to transmission by transfusion or experimental inoculation, there have been reports of presumed blood-borne transmission of HGV from infected women to their newborns and possibly among patients on hemodialysis.20-22 We cannot draw conclusions about risk factors for acquiring HGV infection, both because of the small number of patients with HGV infection alone in the study and because only patients with disease were included as controls. However, in this and other studies, HGV infection appeared to be acquired at younger ages than other known types of viral hepatitis,19 and of the patients with HGV infection alone, only one reported injection-drug use and none had evidence of prior exposure to HBV. In addition, the high prevalence of HGV infection among patients with hepatitis A or B who had no history of drug use raises the possibility that other routes of transmission for HGV may be important.
Persistent infection with HGV appears to be quite prevalent in the general population, with almost 2 percent of blood donors7 and 14 to 52 percent of patients with other types of viral hepatitis being positive for HGV RNA. Since blood donors are a highly selected group, they are not representative of the general population and the estimated prevalence of HGV in this group, as of HBV and HCV infection,23,24 probably represents the lower end of the range, just as estimates of prevalence among patients with viral hepatitis who have high-risk behavior probably represent the upper end.
The cause of acute non-A–E viral hepatitis in the United States remains unknown, and in this study the characteristics of patients in this group were distinctly different from those of patients with known types of viral hepatitis. The patients were older, had milder illness, were more likely to be hospitalized for their hepatitis independent of their age, and had few identifiable sources of disease. The heterogeneous nature of the demographic, clinical, and epidemiologic characteristics of this group suggests that there are multiple etiologic factors, some of which may not be viral.
Source Information
From the Hepatitis Branch, Division of Viral and Rickettsial Diseases, National Center for Infectious Diseases, Centers for Disease Control and Prevention, Atlanta (M.J.A., M.G., T.T.M., L.A.M., E.L.M., K.K., H.S.M.); and Genelabs Technologies, Redwood City, Calif. (J.P.K.).
Address reprint requests to Dr. Alter at the Hepatitis Branch, Mailstop G37, Centers for Disease Control and Prevention, Atlanta, GA 30333.
Other members of the Sentinel Counties Viral Hepatitis Study Team are listed in the Appendix.
Appendix
The following are other members of the Sentinel Counties Viral Hepatitis Study Team: M. Fleenor, T. Greene, S. Hill, F. Judson, J. Kaluba, B. Laird, S. Lambert, R. Massie, C. Miron, K. Mottram, O. Nainan, B.R. Pixley, K. Schomer, J. Shaw, G. Tillman, L. Wafer, and I. Williams.
- References
References
1
Alter MJ ,Margolis HS ,Krawczynski K , et al. The natural history of community-acquired hepatitis C in the United States. N Engl J Med 1992;327:1899-1905
Full Text | Web of Science | Medline2
Alter HJ. Posttransfusion hepatitis in the United States. In: Nishioka K, Suzuki H, Mishiro S, Oda T, eds. Viral hepatitis and liver disease. Tokyo, Japan: Springer-Verlag, 1994:551-3.
3
Aach RD ,Stevens CE ,Hollinger FB , et al. Hepatitis C virus infection in post-transfusion hepatitis: an analysis with first- and second-generation assays. N Engl J Med 1991;325:1325-1329
Full Text | Web of Science | Medline4
Koretz RL ,Brezina M ,Polito AJ , et al. Non-A, non-B posttransfusion hepatitis: comparing C and non-C hepatitis. Hepatology 1993;17:361-365
CrossRef | Web of Science | Medline5
Simons JN ,Leary TP ,Dawson GJ , et al. Isolation of novel virus-like sequences associated with human hepatitis. Nat Med 1995;1:564-569
CrossRef | Web of Science | Medline6
Pilot-Matias TJ ,Muerhoff S ,Simons JN , et al. Identification of antigenic regions in the GB hepatitis viruses GBV-A, GBV-B, and GBV-C. J Med Virol 1996;48:329-338
CrossRef | Web of Science | Medline7
Linnen J ,Wages J Jr ,Zhang-Keck ZY , et al. Molecular cloning and disease association of hepatitis G virus: a transfusion-transmissible agent. Science 1996;271:505-508
CrossRef | Web of Science | Medline8
Alter MJ ,Hadler SC ,Judson FN , et al. Risk factors for acute non-A, non-B hepatitis in the United States and association with hepatitis C virus infection. JAMA 1990;264:2231-2235
CrossRef | Web of Science | Medline9
Alter MJ ,Hadler SC ,Margolis HS , et al. The changing epidemiology of hepatitis B in the United States: need for alternative vaccination strategies. JAMA 1990;263:1218-1222
CrossRef | Web of Science | Medline10
Krawczynski K ,Beach MJ ,Bradley DW , et al. Hepatitis C virus antigen in hepatocytes: immunomorphologic detection and identification. Gastroenterology 1992;103:622-629
Web of Science | Medline11
Lee SR ,Wood CL ,Lane MJ , et al. Increased detection of hepatitis C virus infection in commercial plasma donors by a third-generation screening assay. Transfusion 1995;35:845-849
CrossRef | Web of Science | Medline12
Favorov MO ,Khudyakov YE ,Mast EE , et al. IgM and IgG antibodies to hepatitis E virus (HEV) detected by an enzyme immunoassay based on an HEV-specific artificial recombinant mosaic protein. J Med Virol 1996;50:50-58
CrossRef | Web of Science | Medline13
Morris T ,Robertson B ,Gallagher M . Rapid reverse transcription-PCR detection of hepatitis C virus RNA in serum by using the TaqMan fluorogenic detection system. J Clin Microbiol 1996;34:2933-2936
Web of Science | Medline14
Alter MJ ,Coleman PJ ,Alexander WJ , et al. Importance of heterosexual activity in the transmission of hepatitis B and non-A, non-B hepatitis. JAMA 1989;262:1201-1205
CrossRef | Web of Science | Medline15
Fiordalisi G ,Zanella I ,Mantero G , et al. High prevalence of GB virus C infection in a group of Italian patients with hepatitis of unknown etiology. J Infect Dis 1996;174:181-183
CrossRef | Web of Science | Medline16
Yoshiba M ,Okamoto H ,Mishiro S . Detection of the GBV-C hepatitis virus genome in serum from patients with fulminant hepatitis of unknown etiology. Lancet 1995;346:1131-1132
CrossRef | Web of Science | Medline17
Krawczynski K, Gallagher M, Spelbring J, et al. Experimental HGV infection in primates. In: IX Triennial International Symposium on Viral Hepatitis and Liver Disease: abstract volume, Rome, April 21–25, 1996: 39. abstract.
18
Alter HJ ,Nakatsuji Y ,Melpolder J , et al. The incidence of transfusion-associated hepatitis G virus infection and its relation to liver disease. N Engl J Med 1997;336:747-754
Full Text | Web of Science | Medline19
Tanaka E ,Alter HJ ,Nakatsuji Y , et al. Effect of hepatitis G virus infection on chronic hepatitis C. Ann Intern Med 1996;125:740-743
Web of Science | Medline20
Feucht HH ,Zollner B ,Polywka S ,Laufs R . Vertical transmission of hepatitis G. Lancet 1996;347:615-616
CrossRef | Web of Science | Medline21
Moaven LD ,Tennakoon PS ,Bowden DS ,Locarnini SA . Mother-to-baby transmission of hepatitis G virus. Med J Aust 1996;165:84-85
Web of Science | Medline22
Masuko K ,Mitsui T ,Iwano K , et al. Infection with hepatitis GB virus C in patients on maintenance hemodialysis. N Engl J Med 1996;334:1485-1490
Full Text | Web of Science | Medline23
McQuillan GM ,Townsend TR ,Fields HA ,Carroll M ,Leahy M ,Polk BF . Seroepidemiology of hepatitis B virus infection in the United States: 1976 to 1980. Am J Med 1989;87:Suppl 3A:3A-5S24
McQuillan G, Alter M, Moyer L, Lambert S, Margolis H. A population based serologic study of hepatitis C virus infection in the United States. In: IX Triennial International Symposium on Viral Hepatitis and Liver Disease: abstract volume, Rome, April 21–25, 1996:8. abstract.
- Citing Articles (159)
Citing Articles
1
Patrick Duff. 2012. Hepatitis. , 238-242.
CrossRef2
Antonio Craxì, Rosa Di Stefano. 2011. Hepatitis Due to Non-A-E Viruses. , 427-437.
CrossRef3
J. T. Stapleton, S. Foung, A. S. Muerhoff, J. Bukh, P. Simmonds. (2011) The GB viruses: a review and proposed classification of GBV-A, GBV-C (HGV), and GBV-D in genus Pegivirus within the family Flaviviridae. Journal of General Virology 92:2, 233-246
CrossRef4
Esaki Muthu Shankar, Pachamuthu Balakrishnan, Ramachandran Vignesh, Vijayakumar Velu, Palanisamy Jayakumar, Suniti Solomon. (2011) Current Views on the Pathophysiology of GB Virus C Coinfection with HIV-1 Infection. Current Infectious Disease Reports 13:1, 47-52
CrossRef5
Kuan-Ta Wu, Kun-Ming Chung, I.-Che Feng, Ming-Jen Sheu, Hsing-Tao Kuo, Lok-Beng Koay, Chin-Yih Lin, Ling-Yu Tang, Sun-Lung Tsai. (2009) Acute hepatitis E virus infection in Taiwan 2002-2006 revisited: PCR shows frequent co-infection with multiple hepatitis viruses. Journal of Medical Virology 81:10, 1734-1742
CrossRef6
ELIZABETH I. HARRIS, KAY WASHINGTON, LAURA W. LAMPS. 2009. Acute and Chronic Infectious Hepatitis. , 1003-1033.
CrossRef7
Nicolaos C Tassopoulos, George V Papatheodoridis, Ioanna Delladetsima, Angelos Hatzakis. (2008) Clinicopathological features and natural history of acute sporadic non-(A-E) hepatitis. Journal of Gastroenterology and Hepatology 23:8pt1, 1208-1215
CrossRef8
M.-W. Welker, W.-P. Hofmann, C. Welsch, M. von Wagner, E. Herrmann, T. Lengauer, S. Zeuzem, C. Sarrazin. (2007) Correlation of amino acid variations within nonstructural 4B protein with initial viral kinetics during interferon-alpha-based therapy in HCV-1b-infected patients. Journal of Viral Hepatitis 14:5, 338-349
CrossRef9
Masahiko Kaito, Hideaki Tanaka, Shinichiro Horiike, Naoki Fujita, Motoh Iwasa, Yoshinao Kobayashi, Esteban Cesar Gabazza, Yukihiko Adachi, Masayoshi Konishi, Shozo Watanabe. (2007) Unidentified virus-like particles are detected in plasmas with elevated ALT levels: are they significant of etiological agent(s) of non-B, non-C hepatitis?. Medical Molecular Morphology 40:1, 23-28
CrossRef10
Nikolaos Pyrsopoulos, Lennox Jeffers. (2007) Hepatitis C in African Americans. Journal of Clinical Gastroenterology 41:2, 185-193
CrossRef11
Li-Yu Wang, Tzu-Ying Ho, Ming-Che Chen, Chi-Shun Yi, Chi-Tan Hu, Hans Hsienhong Lin. (2007) Prevalence and determinants of SENV viremia among adolescents in an endemic area of chronic liver diseases. Journal of Gastroenterology and Hepatology 22:2, 171-176
CrossRef12
AK Praharaj, AT Kalghatgi, A Nagendra. (2006) Hepatitis G virus infection in healthy individuals, acute viral hepatitis and persons at risk for parenteral transmission. Medical Journal Armed Forces India 62:4, 321-324
CrossRef13
Manfred Vogt, Barbara Klostermann, Siegmund Braun, Raymonde Busch, John Hess, Gert Frösner, Thomas Lang. (2006) Prevalence and clinical role of GBV-C infection after cardiac surgery in childhood: A study on 414 patients. Journal of Infection 53:1, 43-48
CrossRef14
Brian Woodcock. 2006. Blood, Artificial. .
CrossRef15
A. Scott Muerhoff, George J. Dawson, Suresh M. Desai. (2006) A previously unrecognized sixth genotype of GB virus C revealed by analysis of 5′-untranslated region sequences. Journal of Medical Virology 78:1, 105-111
CrossRef16
B. L. Pearlman. (2006) Hepatitis C Virus Infection in African Americans. Clinical Infectious Diseases 42:1, 82-91
CrossRef17
NAOMI L.C. LUBAN. (2005) Transfusion Safety: Where Are We Today?. Annals of the New York Academy of Sciences 1054:1, 325-341
CrossRef18
Bernd Kupfer, Torsten Ruf, Bertfried Matz, Jacob Nattermann, Ulrich Spengler, Jürgen K. Rockstroh, Hans H. Brackmann, Johannes Blümel, Michael Tacke, Rolf Kaiser. (2005) Comparison of GB virus C, HIV, and HCV infection markers in hemophiliacs exposed to non-inactivated or inactivated factor concentrates. Journal of Clinical Virology 34:1, 42-47
CrossRef19
Jinhua Xiang, Christina Martinez-Smith, Michael Gale, Qing Chang, Douglas R. Labrecque, Warren N. Schmidt, Jack T. Stapleton. (2005) GB Virus Type C NS5A Sequence Polymorphisms: Association with Interferon Susceptibility and Inhibition of PKR-Mediated eIF2α Phosphorylation. Journal of Interferon & Cytokine Research 25:5, 261-270
CrossRef20
Abdurrahman Sagir, Dieter Häussinger. (2005) Significance of SEN virus in post-transfusion hepatitis. Bedeutung von SEN-Viren für die Posttransfusionshepatitis. LaboratoriumsMedizin 29:2, 104-107
CrossRef21
Michele Quarto, Maria Chironna. 2004. Hepatitis A. .
CrossRef22
H. L. Tillmann, M. P. Manns, C. Claes, H. Heiken, R. E. Schmidt, M. Stoll. (2004) GB virus C infection and quality of life in HIV-positive patients. AIDS Care 16:6, 736-743
CrossRef23
Carola Seifried, Marijke Weber, Heike Bialleck, Erhard Seifried, Hubert Schrezenmeier, W. Kurt Roth. (2004) High prevalence of GBV-C/HGV among relatives of GBV-C/HGV-positive blood donors in blood recipients and in patients with aplastic anemia. Transfusion 44:2, 268-274
CrossRef24
Raymundo Paraná, Liana Codes, Zilton Andrade, Luiz A.R. de Freitas, Rogério Santos-Jesus, Mitermayer Reis, Helma Cotrim, Simone Cunha, Christian Trepo. (2003) Clinical, histologic and serologic evaluation of patients with acute non-A-E hepatitis in north-eastern Brazil: is it an infectious disease?. International Journal of Infectious Diseases 7:3, 222-230
CrossRef25
E. Alonso-Rubiano, M. Gerber, P. Friedman, S. Hodges, C. Leissinger. (2003) Hepatitis G virus in clotting factor concentrates. Haemophilia 9:1, 110-115
CrossRef26
Sarah L. George, Sabina Wünschmann, James McCoy, Jinhua Xiang, Jack T. Stapleton. (2002) Interactions between GB virus type C and HIV. Current Infectious Disease Reports 4:6, 550-558
CrossRef27
Silvia Pirovano, Marco Bellinzoni, Alberto Matteelli, Cristina Ballerini, Alberto Albertini, Luisa Imberti. (2002) High prevalence of a variant of SENV in intravenous drug user HIV-infected patients. Journal of Medical Virology 68:1, 18-23
CrossRef28
Chiu-Ching Huang. (2002) Hepatitis infection in haemodialysis patients. Nephrology 7:3, 101-109
CrossRef29
Sharon E. Frey, Sharon M. Homan, Marcia Sokol‐Anderson, Margarita Torralba Cayco, Prospero Cortorreal, Cora E. Musial, Adrian Di Bisceglie. (2002) Evidence for Probable Sexual Transmission of the Hepatitis G Virus. Clinical Infectious Diseases 34:8, 1033-1038
CrossRef30
M. E. Chamberland. (2002) Emerging Infectious Agents: Do They Pose a Risk to the Safety of Transfused Blood and Blood Products?. Clinical Infectious Diseases 34:6, 797-805
CrossRef31
Chia-Ming Chu, Deng-Yn Lin, Chau-Ting Yeh, I-Shyan Sheen, Yun-Fan Liaw. (2001) Epidemiological characteristics, risk factors, and clinical manifestations of acute non-A-E hepatitis. Journal of Medical Virology 65:2, 296-300
CrossRef32
Xiang, Jinhua, Wünschmann, Sabina, Diekema, Daniel J., Klinzman, Donna, Patrick, Kevin D., George, Sarah L., Stapleton, Jack T., . (2001) Effect of Coinfection with GB Virus C on Survival among Patients with HIV Infection. New England Journal of Medicine 345:10, 707-714
Full Text33
Stosor, Valentina, Wolinsky, Steven, . (2001) GB Virus C and Mortality from HIV Infection. New England Journal of Medicine 345:10, 761-762
Full Text34
Betty H. Robertson. (2001) Viral hepatitis and primates: historical and molecular analysis of human and nonhuman primate hepatitis A, B, and the GB-related viruses. Journal of Viral Hepatitis 8:4, 233-242
CrossRef35
Marianne Cloeren, Trish M. Perl. (2001) Occupationally Acquired Infections and the Healthcare Worker *. Infectious Diseases in Clinical Practice 10:5, 261-270
CrossRef36
Ling Lu, Mun Hon Ng, Bei-Ping Zhou, Hong-Tao Luo, Tatsunori Nakano, Betty H. Robertson, Stanley W.K. Im. (2001) Detection and genotyping of GBV-C/HGV variants in China. Virus Research 73:2, 131-144
CrossRef37
Cristiane A. Villela Nogueira, Susie A. Nogueira, Carmen M. Nogueira, Henrique S
rgio M. Coelho, Fassil Ketema, Daniel C. Edelman, John S. Lambert, Niel T. Constantine. (2001) The incidence of GB virus C / hepatitis G virus infection in Brazilian patients who received blood transfusion during cardiac surgery. Journal of Medical Virology 63:3, 237-241
CrossRef38
Scott Bowden. (2001) New hepatitis viruses: Contenders and pretenders. Journal of Gastroenterology and Hepatology 16:2, 124-131
CrossRef39
Yoshinobu Kanda, Hisamaru Hirai. (2001) TT Virus in Hematological Disorders and Bone Marrow Transplant Recipients. Leukemia & Lymphoma 40:5-6, 483-489
CrossRef40
Robert Halasz, Ola Weiland, Matti S. (2001) GB Virus C/Hepatitis G Virus. Scandinavian Journal of Infectious Diseases 33:8, 572-580
CrossRef41
Ming-Lung Yu, Wan-Long Chuang, Liang-Yen Wang, Chia-Yen Dai, Shyh-Shin Chiou, Ming-Hsing Sung, Chao-Sung Chang, Shinn-Cherng Chen, Ching-Shan Wang, Tai-Tsung Chang, Wen-Yu Chang. (2000) Status and natural course of GB virus C/hepatitis G virus infection among high-risk groups and volunteer blood donors in Taiwan. Journal of Gastroenterology and Hepatology 15:12, 1404-1410
CrossRef42
A. Giulivi, R. Slinger, M. Tepper, G. Sher, V. Scalia, G. Kessler, P. Gill. (2000) Prevalence of GBV-C/Hepatitis G Virus Viremia and Anti-E2 in Canadian Blood Donors. Vox Sanguinis 79:4, 201-205
CrossRef43
Shinn-Jang Hwang, Chen-Wei Chu, Rei-Hwa Lu, Keng-Hsin Lan, Jaw-Ching Wu, Yuan-Jan Wang, Full-Young Chang, Shou-Dong Lee. (2000) Seroprevalence of GB virus C/hepatitis G virus-RNA and anti-envelope antibody in high-risk populations in Taiwan. Journal of Gastroenterology and Hepatology 15:10, 1171-1175
CrossRef44
Christoph Sarrazin, Brigitte R
CrossRef45
Benjamin G Fanson, Patricia Osmack, Adrian M Di Bisceglie. (2000) A comparison between the phenol–chloroform method of RNA extraction and the QIAamp viral RNA kit in the extraction of hepatitis C and GB virus-C/hepatitis G viral RNA from serum. Journal of Virological Methods 89:1-2, 23-27
CrossRef46
Nyingi M. Kemmer, Emil P. Miskovsky. (2000) HEPATITIS A. Infectious Disease Clinics of North America 14:3, 605-615
CrossRef47
Daniel A. Carrasco, Catherine Newman, Stephen K. Tyring. (2000) Treatment of viral hepatitis. Dermatologic Therapy 13:3, 318-325
CrossRef48
Cleo G. Anastassopoulou, Dimitrios Paraskevis, Nicholas C. Tassopoulos, John Boletis, Vassiliki-Anastasia Sypsa, Georg Hess, Angelos Hatzakis. (2000) Molecular epidemiology of GB virus C/hepatitis G virus in Athens, Greece. Journal of Medical Virology 61:3, 319-326
CrossRef49
H. Ohto, N. Ujiie, A. Sato, H. Okamoto, M. Mayumi, . (2000) Mother-to-infant transmission of GB virus type C/HGV. Transfusion 40:6, 725-730
CrossRef50
Ann L. Silverman, Jatinder S. Sekhon, Steven J. Saginaw, Daniel Wiedbrauk, Mamtha Balasubramaniam, Stuart C. Gordon. (2000) Tattoo application is not associated with an increased risk for chronic viral hepatitis. The American Journal of Gastroenterology 95:5, 1312-1315
CrossRef51
J.T. Wang, C.Z. Lee, J.H. Kao, J.C. Sheu, T.H. Wang, D.S. Chen. (2000) Incidence and clinical presentation of posttransfusion TT virus infection in prospectively followed transfusion recipients: emphasis on its relevance to hepatitis. Transfusion 40:5, 596-601
CrossRef52
Mireia Giménez-Barcons, Alberto Sánchez-Fueyo, Sergi Ampurdanés, Francesc Puig-Basagoiti, Magdalena Guilera, Angela Ibáñez, Bonaventura Clotet, Miguel-Angel Martı́nez, Juan Rodés, Juan-Carlos Saiz, José-Marı́a Sánchez-Tapias. (2000) Genetic evolution of GB virus C/hepatitis G virus (GBV-C/HGV) under interferon pressure. Antiviral Research 46:2, 157-170
CrossRef53
Luisa Roman??, Paolo Fabris, Elisabetta Tanzi, Giulia Tositti, Francesco Mazzotta, Alessandro R. Zanetti. (2000) GBV-C/hepatitis G virus in acute nonA-E hepatitis and in acute hepatitis of defined aetiology in Italy. Journal of Medical Virology 61:1, 59-64
CrossRef54
Timothy J. Tucker, Heidi E.M. Smuts, Christopher Eedes, Gideon D. Knobel, Peter Eickhaus, Simon C. Robson, Ralph E. Kirsch. (2000) Evidence that the GBV-C/hepatitis G virus is primarily a lymphotropic virus. Journal of Medical Virology 61:1, 52-58
CrossRef55
Dámaso Infante, Margarita Pich, Ramon Tormo, Silvia Sauleda, Carlos Montané, Juan Ignacio Esteban, Rafael Esteban. (2000) Prevalence of Hepatitis G Virus in Healthy Children in Liver Disease, and Human Immunodeficiency Virus-1 Infection: Response to Interferon. Journal of Pediatric Gastroenterology and Nutrition 30:4, 385-390
CrossRef56
Per Bjorkman, Gunnar Sundstrom, Bela Veress, Anders Widell. (2000) Assessment of Liver Disease and Biochemical and Immunological Markers in Swedish Blood Donors with Isolated GB Virus C/Hepatitis G Virus Viremia. Vox Sanguinis 78:3, 143-148
CrossRef57
Osamu Yokosuka. (2000) Molecular biology of hepatitis A virus: Significance of various substitutions in the hepatitis A virus genome. Journal of Gastroenterology and Hepatology 15:s1, 91-97
CrossRef58
A. Handa, R. F. Jubran, B. Dickstein, A. Boylan, N. L. C. Luban, N. S. Young, K. E. Brown. (2000) GB Virus C/Hepatitis G Virus Infection Is Frequent in American Children and Young Adults. Clinical Infectious Diseases 30:3, 569-571
CrossRef59
Hatim Hassan, Bahar Bastani. (2000) Hepatitis G Virus Infection Among Hemodialysis Patients: True Infection or Innocent Bystander?. Seminars in Dialysis 13:2, 108-111
CrossRef60
Kamal G. Ishak, MD, PhD. (2000) Pathologic Features of Chronic Hepatitis. American Journal of Clinical Pathology 113:1, 40-55
CrossRef61
Neal S Young. (2000) Hematopoietic cell destruction by immune mechanisms in acquired aplastic anemia. Seminars in Hematology 37:1, 3-14
CrossRef62
E Palomba, A Bairo, P-A Tovo. (1999) High rate of maternal-infant transmission of hepatitis G virus in HIV-1 and hepatitis C virus-infected women. Acta Paediatrica 88:12, 1392-1395
CrossRef63
Peter A White, Zhengqian Li, William D Rawlinson. (1999) Sequence diversity in the 5′-UTR region of GB virus C/hepatitis G virus assessed using sequencing, heteroduplex mobility analysis and single-strand conformation polymorphism. Journal of Virological Methods 83:1-2, 91-101
CrossRef64
Mahomed A Sathar, Paresh N Soni, Rosemary Pegoraro, Peter Simmonds, Donald B Smith, Amar P Dhillon, Geoffery M Dusheiko. (1999) A new variant of GB virus C/hepatitis G virus (GBV-C/HGV) from South Africa. Virus Research 64:2, 151-160
CrossRef65
Haruki Komatsu, Tomoo Fujisawa, Ayano Inui, Tsuyoshi Sogo, Youichi Morinishi, Yoshihiro Miyagawa, Michio Inui. (1999) GBV-C/HGV infection in children with chronic hepatitis C. Journal of Medical Virology 59:2, 154-159
CrossRef66
Silvia Sauleda, Herre J. Reesink, Juan Ignacio Esteban, Georg Hess, Rafael Esteban, Jaime Guardia. (1999) Profiles of GBV-C/hepatitis G virus markers in patients coinfected with hepatitis C virus. Journal of Medical Virology 59:1, 45-51
CrossRef67
Michael Busch, Mary Chamberland, Jay Epstein, Steven Kleinman, Rima Khabbaz, George Nemo. (1999) Oversight and Monitoring of Blood Safety in the United States. Vox Sanguinis 77:2, 67-76
CrossRef68
Timothy J. Tucker, Heidi Smuts, Peter Eickhaus, Simon C. Robson, Ralph E. Kirsch. (1999) Molecular characterization of the 5? non-coding region of South African GBV-C/HGV isolates: Major deletion and evidence for a fourth genotype. Journal of Medical Virology 59:1, 52-59
CrossRef69
Mahomed A. Sathar, Paresh N. Soni, Sarala Naicker, Jan Conradie, Fathima Lockhat, Eleanor Gouws. (1999) GB virus C/hepatitis G virus infection in KwaZulu Natal, South Africa. Journal of Medical Virology 59:1, 38-44
CrossRef70
S. Sherlock. (1999) The hepatic flaviviridae: summary. Journal of Viral Hepatitis 6:s1, 1-5
CrossRef71
C. Muller. (1999) Pathogenicity of GBV-C/HGV infection. Journal of Viral Hepatitis 6:s1, 49-52
CrossRef72
J. Xiang, K.J. Daniels, D.R. Soll, W.N. Schmidt, D.R. LaBrecque, J.T. Stapleton. (1999) Visualization and characterization of GB virus-C particles: evidence for a nucleocapsid. Journal of Viral Hepatitis 6:s1, 16-22
CrossRef73
Abdel Rahman El-Zayadi, Kenji Abe, Osaima Selim, Hideo Naito, Georg Hess, Adham Ahdy. (1999) Prevalence of GBV-C/hepatitis G virus viraemia among blood donors, health care personnel, chronic non-B non-C hepatitis, chronic hepatitis C and hemodialysis patients in Egypt. Journal of Virological Methods 80:1, 53-58
CrossRef74
Xiaofeng Fan, Yanjuan Xu, Harvey Solomon, Sanjay Ramrakhiani, Brent A. Neuschwander-Tetri, Adrian M. Di Bisceglie. (1999) Is hepatitis G/GB virus-C virus hepatotropic? Detection of hepatitis G/GB virus-C viral RNA in liver and serum. Journal of Medical Virology 58:2, 160-164
CrossRef75
Tatsuo Kanda, Osamu Yokosuka, Tetsu Ikeuchi, Toshikatsu Seta, Shigenobu Kawai, Fumio Imazeki, Hiromitsu Saisho. (1999) The role of TT virus infection in acute viral hepatitis. Hepatology 29:6, 1905-1908
CrossRef76
Soon-Boon Justin Wong, Soh-Ha Chan, EE-Chee Ren. (1999) Diversity of GB virus C/Hepatitis G virus isolates in Singapore: Predominance of group 2a and the Asian group 3 variant. Journal of Medical Virology 58:2, 145-153
CrossRef77
Chia-Ming Chu, Shi-Ming Lin, Sen-Yung Hsieh, Chau-Ting Yeh, Deng-Yn Lin, I-Shyan Sheen, Yun-Fan Liaw. (1999) Etiology of sporadic acute viral hepatitis in Taiwan: The role of hepatitis C virus, hepatitis E virus and GB virus-C/hepatitis G virus in an endemic area of hepatitis A and B. Journal of Medical Virology 58:2, 154-159
CrossRef78
Magdalena Robaczewska, Lucyna Cova, Anna J. Podhajska, Bogdan Falkiewicz. (1999) Hepatitis G virus: Molecular organization, methods of detection, prevalence, and disease association. International Journal of Infectious Diseases 3:4, 220-233
CrossRef79
Andrea E. Reid, Margaret James Koziel, Ignasio Aiza, Lennox Jeffers, Rajender Reddy, Eugene Schiff, Johnson Y.N. Lau, Jules L. Dienstag, T. Jake Liang. (1999) Hepatitis c virus genotypes and viremia and hepatocellular carcinoma in the united states. The American Journal of Gastroenterology 94:6, 1619-1626
CrossRef80
ORIT ELKAYAM, HOWAYDA M. HASSOBA, LINDA D. FERRELL, RICHARD GARCIA-KENNEDY, ROBERT G. GISH, TERESA L. WRIGHT, TOM LAFFLER, DENA TRAYLOR, GEFFREY HUNT, PHILIP ROSENTHAL. (1999) GB Virus C (GBV-C/HGV) and E2 Antibodies in Children Preliver and Postliver Transplant. Pediatric Research 45:6, 795-798
CrossRef81
K. Bjoro, T. Haaland, K. Skaug, S. S. Froland. (1999) The spectrum of hepatobiliary disease in primary hypogammaglobulinaemia. Journal of Internal Medicine 245:5, 517-524
CrossRef82
D.J. Brandhagen, J.B. Gross, J.J. Poterucha, M.R. Charlton, J. Detmer, J. Kolberg, A.A. Gossard, K.P. Batts, W.R. Kim, J.J. Germer, R.H. Wiesner, D.H. Persing. (1999) The clinical significance of simultaneous infection with hepatitis G virus in patients with chronic hepatitis C. The American Journal of Gastroenterology 94:4, 1000-1005
CrossRef83
B. Mercier, A. Barclais, C. Botte, J.F. Cantalube, J. Coste, C. Defer, C. Gautreau, C. Giannoli, P. Halfon, I. Lepot, P. Loiseau, J. Martial, P. Montcharmont, P. Merel, D. Ouzan, N. Ravera, J. Follana, R. Cesaire, C. Janot, J.M. Lemaire, P. Micco, G. Vezon, C. Ferec. (1999) Prevalence of GBV C/HGV RNA and GBV C/HGV Antibodies in French Volunteer Blood Donors: Results of a Collaborative Study. Vox Sanguinis 76:3, 166-169
CrossRef84
Borislava G. Pavlova, Renate Heinz, Ursula Selim, Heinz T
CrossRef85
Roger G. Perez, Nizar N. Zein, Deborah K. Freese, Jean J. Perrault, Jeffery L. Steers, Harvey L. Sharp, David H. Persing. (1999) No Evidence of Hepatitis G Virus in Fulminant Hepatic Failure in Children. Journal of Pediatric Gastroenterology & Nutrition 28:4, 400-403
CrossRef86
Thomas R. Frieden, Lisa Ozick, Colin McCord, Omana V. Nainan, Sara Workman, Gail Comer, Tai Ping Lee, Kwan-Soo Byun, Dhiren Patel, Kelly J. Henning. (1999) Chronic liver disease in central harlem: The role of alcohol and viral hepatitis. Hepatology 29:3, 883-888
CrossRef87
J.M. Jongerius, G.J. Boland, C.L. Poel, M.C. Rasch, E. Italiaander, J.J. Reijden, P.N. Friedman, J.J. Cockerill, E.F. Leeuwen, J. Hattum. (1999) GB Virus Type C Viremia and Envelope Antibodies among Population Subsets in The Netherlands. Vox Sanguinis 76:2, 81-84
CrossRef88
Christian Niel, Jaqueline M. de Oliveira, Rudolf S. Ross, Selma A. Gomes, Michael Roggendorf, Sergei Viazov. (1999) High prevalence of TT virus infection in Brazilian blood donors. Journal of Medical Virology 57:3, 259-263
CrossRef89
Lionel Rostaing, Jacques Izopet, Catherine Arnaud, Jean-Marc Cisterne, Laurent Alric, Jean-Louis Rumeau, Michel Duffaut, Dominique Durand. (1999) LONG-TERM IMPACT OF SUPERINFECTION BY HEPATITIS G VIRUS IN HEPATITIS C VIRUS-POSITIVE RENAL TRANSPLANT PATIENTS. Transplantation 67:4, 556-560
CrossRef90
Maurizio Aricò, Morena Bissolati, Grazia Bossi, Margherita Asti, Antonella Cerino, Désirée Caselli, Antonio Ricci, Catherine Klersy, Enrico Silini, Mario U. Mondelli. (1999) GB virus type C infection in patients treated for childhood acute lymphoblastic leukemia. Transfusion 39:2, 212-217
CrossRef91
Shinn-Jang Hwang, Rei-Hwa Lu, Cho-Yu Chan, Full-Young Chang, Shou-Dong Lee. (1999) Detection of antibodies to E2-protein of GB virus-C/hepatitis G virus in patients with acute posttransfusion hepatitis. Journal of Medical Virology 57:1, 85-89
CrossRef92
Thomas Berg, Andrea R. M
CrossRef93
Jean-François Cantaloube, Pierre Gallian, Philippe Biagini, Houssam Attoui, Jacqueline Escher, Jean-Pierre Zappitelli, Yves Delord, Philippe De Micco, Xavier De Lamballerie. (1999) Prevalence of GB virus type C/hepatitis G virus RNA and anti-E2 among blood donors in Southeastern France. Transfusion 39:1, 95-102
CrossRef94
D. Rey, S. Fraize, J. Vidinic, P. Meyer, S. Fritsch, N. Labouret, C. Schmitt, J.M. Lang, F. Stoll-Keller. (1999) High prevalence of GB virus C/hepatitis G virus RNA in patients infected with human immunodeficiency virus. Journal of Medical Virology 57:1, 75-79
CrossRef95
Anne C. E. Moor, Tom M. A. R. Dubbelman, John VanSteveninck, Anneke Brand. (1999) Transfusion-transmitted diseases: risks, prevention and perspectives. European Journal of Haematology 62:1, 1-18
CrossRef96
Jean-Jacques Lefrère, Françoise Roudot-Thoraval, Laurence Morand-Joubert, Yvon Brossard, Françoise Parnet-Mathieu, Martine Mariotti, Franz Agis, François Rouet, Joelle Lerable, Guillaume Lefèvre, Robert Girot, Pascale Loiseau. (1999) Prevalence of GB virus type C/hepatitis G virus RNA and of anti-E2 in individuals at high or low risk for blood-borne or sexually transmitted viruses: evidence of sexual and parenteral transmission. Transfusion 39:1, 83-94
CrossRef97
KENJI GOTO, KOHACHIRO SUGIYAMA, ROU LI, YOSHISHIGE MIYAKE, TOSHIHIRO ANDO, FUMIHIKO MIZUTANI, KOJI TERABE, KANTARO MIZUNO, YOSHIRO WADA. (1999) Prevalence of GB Virus C/Hepatitis G Virus Ribonucleic Acid and Anti-Hepatitis G Virus-E2 Antibodies among Japanese Children with Histories of Transfusions or with Liver Diseases. Pediatric Research 45:1, 128-132
CrossRef98
Galina Zhelezova Zhelezova, Ludmila Angelova Karaivanova. (1998) GB virus C/hepatitis G virus-is it a novel human ‘hepatitis’ virus?. Clinical Microbiology and Infection 4:12, 677-681
CrossRef99
Rosalind C. Hollingsworth, Claire L. Jameson, Jane E. Minton, Mary Crowe, Rebecca Curran, Tessa Rowe, Anna M. Grabowska, Deenan Pillay, Will L. Irving, Jonathan K. Ball. (1998) GBV-C/HGV coinfection in HIV-1-positive men: Frequent detection of viral RNA in blood plasma but absence from seminal fluid plasma. Journal of Medical Virology 56:4, 321-326
CrossRef100
I. Woolley, H. Valdez, C. Walker, A. Landay, D. Zdunek, G. Hess, M. M. Lederman. (1998) Hepatitis G Virus RNA Is Common in AIDS Patients' Plasma but Is Not Associated With Abnormal Liver Function Tests or Other Clinical Syndromes. Journal of Acquired Immune Deficiency Syndromes and Human Retrovirology 19:4, 408-412
CrossRef101
Mario G. Pessoa, Norah A. Terrault, Linda D. Ferrell, Jill Detmer, Janice Kolberg, Mark L. Collins, Maurene Viele, John R. Lake, John P. Roberts, Nancy L. Ascher, Teresa L. Wright. (1998) Hepatitis after liver transplantation: The role of the known and unknown viruses. Liver Transplantation and Surgery 4:6, 461-468
CrossRef102
P. Clevenbergh, J. Durant, P. Halfon, A. Tran, T. Manos, V. Rahelinirina, G. Yang, S. Benzaken, D. Ouzan, P. Rampal, P. Dellamonica. (1998) High prevalence of GB virus C/hepatitis G virus infection in different risk groups of HIV-infected patients. Clinical Microbiology and Infection 4:11, 644-647
CrossRef103
Howayda M. Hassoba, Mario G. Pessoa, Norah A. Terrault, Nancy J. Lewis, Mark Hayden, Jeffrey C. Hunt, Xiaoxing Qiu, Sheng C. Lou, Teresa L. Wright. (1998) Antienvelope antibodies are protective against GBV-C reinfection: Evidence from the liver transplant model. Journal of Medical Virology 56:3, 253-258
CrossRef104
Giovanna Fattovich, Maria Lisa Ribero, Susanna Favarato, Franco Azzario, Francesco Donato, Giuliano Giustina, Michele Fasola, Maurizio Pantalena, Giuseppe Portera, Alessandro Tagger. (1998) Influence of GB virus-C/hepatitis G virus infection on the long-term course of chronic hepatitis B. Liver 18:5, 360-365
CrossRef105
Paul L. F. Giangrande. (1998) HEPATITIS IN HAEMOPHILIA. British Journal of Haematology 103:1, 1-9
CrossRef106
Ch. Gerard, D. Vaira, J. Delwaide, A. Lamproye, G. Maggipinto, D. Sondag, G. Rorive, J. Belaiche, B. Rentier. (1998) Does HCV Screening of Blood Donors Affect Transmission of Hepatitis G Virus in Dialysed Patients?. Vox Sanguinis 75:1, 77-77
CrossRef107
Albert Tran, Patrick Hastier, Guang Yang, Fabrice Longo, Denis Ouzan, Jacques Durant, Rene Follana, Martin Buckley, Marie-Christine Saint-Paul, Alain Doglio, Patrick Rampal, Sylvia Benzaken. (1998) Hepatitis G Virus (HGV) and Antibodies to a Putative HGV Envelope Protein in Alcoholic Patients in South-Eastern France. The American Journal of Gastroenterology 93:9, 1599-1600
CrossRef108
P. Fabris, M. R. Biasin, D. Infantolino, L. Romanó, P. Benedetti, G. Tositti, G. P. Pellizzer, A. R. Zanetti, C. Stecca, G. Marchelle, F. Lalla. (1998) HGV/GBV-C in liver tissue and in sera from patients with chronic hepatitis C. Infection 26:5, 283-287
CrossRef109
Maurizio Bonacini, Dajun Qian, Sugantha Govindarajan, Boontar Valinluck. (1998) Prevalence of Hepatitis G Virus RNA in the Sera of Patients With HIV Infection. Journal of Acquired Immune Deficiency Syndromes and Human Retrovirology 19:1, 40-43
CrossRef110
José L. Rodríguez Agulló, Avelina Suárez, José M. Ladero, Gustavo López-Alonso, Juan J. Picazo, Manuel Díaz-Rubio. (1998) Hepatitis G virus infection in Spanish patients with hepatocellular carcinoma. Liver 18:4, 255-258
CrossRef111
Kenji Abe, Yoshihiro Edamoto, Young Nyun Park, Abraham M. Nomura, Teresa Casanovas Taltavull, Masayoshi Tani, Swan N. Thung. (1998) In situ detection of hepatitis B, C, and G virus nucleic acids in human hepatocellular carcinoma tissues from different geographic regions. Hepatology 28:2, 568-572
CrossRef112
Angela Ibáñez, Mireia Giménez-Barcons, Angel Tajahuerce, Cristina Tural, Guillem Sirera, Bonaventura Clotet, José-María Sánchez-Tapias, Juan Rodés, Miguel-Angel Martínez, Juan-Carlos Saiz. (1998) Prevalence and genotypes of GB virus C/hepatitis G virus (GBV-C/HGV) and hepatitis C virus among patients infected with human immunodeficiency virus: Evidence of GBV-C/HGV sexual transmission. Journal of Medical Virology 55:4, 293-299
CrossRef113
P Karayiannis. (1998) Natural history and molecular biology of hepatitis G virus/GB virus C. Clinical and Diagnostic Virology 10:2-3, 103-111
CrossRef114
Martina F. Scallan, Dan Clutterbuck, Lisa M. Jarvis, Gordon R. Scott, Peter Simmonds. (1998) Sexual transmission of GB virus C/hepatitis G virus. Journal of Medical Virology 55:3, 203-208
CrossRef115
Yvonne Cossart. (1998) TTV a common virus, but pathogenic?. The Lancet 352:9123, 164
CrossRef116
P.V. Holland. (1998) Post-Transfusion Hepatitis: Current Risks and Causes. Vox Sanguinis 74:S2, 135-141
CrossRef117
Tatsunori Nakano, Masashi Mizokami, Kun Cao, Seiji Noguchi, Michio Sata, Young-Min Park, Boo-Sung Kim, Tsendsuren Oyunsuren, Leila Beltrao Pereira, Ruslan Ruzibakiev, Vladimir Gurtsevitch, Masanori Hayami. (1998) Lack of anti-GOR antibody among subjects with GB virus C/hepatitis G virus RNA. Journal of Medical Virology 55:2, 129-133
CrossRef118
J.E. Menitove. (1998) Hemovigilance in the United States of America. Vox Sanguinis 74:S2, 447-455
CrossRef119
J-P. Allain. (1998) Emerging Viruses in Blood Transfusion. Vox Sanguinis 74:S2, 125-129
CrossRef120
Murthy, A. Scott Muerhoff, Suresh M. Desai, Svetlozar N. Natov, Beth A. Bouthot, Robin Ruthazer, Christopher H. Schmid, Andrew S. Levey, Isa K. Mushahwar, Brian J.G. Pereira. (1998) Predictors of GBV-C infection among patients referred for renal transplantation. Kidney International 53:6, 1769-1774
CrossRef121
Takanobu Kato, Masashi Mizokami, Tatsunori Nakano, Etsuro Orito, Ken-ichi Ohba, Yutaka Kondo, Yasuhito Tanaka, Ryuzo Ueda, Motokazu Mukaide, Kaoru Fujita, Kiyomi Yasuda, Shiro Iino. (1998) Heterogeneity in E2 region of GBV-C/hepatitis G virus and hepatitis C virus. Journal of Medical Virology 55:2, 109-117
CrossRef122
E. Tanaka, K. Kiyosawa, K. Shimoda, K. Hino, M. Tacke, S. Schmolke, A. M. Engel, G. Hess. (1998) Evolution of hepatitis G virus infection and antibody response to envelope protein in patients with transfusion-associated non-A, non-B hepatitis. Journal of Viral Hepatitis 5:3, 153-159
CrossRef123
Raymond S Koff. (1998) Hepatitis A. The Lancet 351:9116, 1643-1649
CrossRef124
MEI-HWEI CHANG. (1998) Chronic hepatitis virus infection in children. Journal of Gastroenterology and Hepatology 13:5, 541-548
CrossRef125
Albert J. Czaja, Ahmad S. Abdulkarim, Herschel A. Carpenter, Rogelio G. Perez, David H. Persing, Nizar N. Zein. (1998) GB Virus-C Infection in Type 1 Autoimmune Hepatitis. Mayo Clinic Proceedings 73:5, 412-418
CrossRef126
XH. Zhang, H. Shinzawa, L. Shao, M. Ishibashi, QH. Jiang, K. Saito, H. Misawa, H. Togashi, T. Takahashi. (1998) Epidemiological study and genetic analysis of GB virus C infection in general population from an area endemic for hepatitis C. Journal of Medical Virology 54:4, 237-242
CrossRef127
Joachim Woelfle, Thomas Berg, Klaus M. Keller, Eckhard Schreier, Michael J. Lentze. (1998) Persistent Hepatitis G Virus Infection After Neonatal Transfusion. Journal of Pediatric Gastroenterology & Nutrition 26:4, 402-407
CrossRef128
Kenneth G. Hadlock, Steven K.H. Foung. (1998) GBV-C/HGV: A new virus within the Flaviviridae and its clinical implications. Transfusion Medicine Reviews 12:2, 94-108
CrossRef129
Shinichi Kakumu, Katsuhiko Sato, Takayuki Morishita, Trinh Kim Anh, Nguyen Huu Binh, Banh Vu Dien, Do Huu Chinh, Nguyen Huu Phuc, Nguyen Van Thinh, Le Tuyet Trinh, Naohiko Yamamoto, Haruhisa Nakao, Shin Isomura. (1998) Prevalence of hepatitis B, hepatitis C, and GB virus C/hepatitis G virus infections in liver disease patients and inhabitants in Ho Chi Minh, Vietnam. Journal of Medical Virology 54:4, 243-248
CrossRef130
CHRISTOPHER J GRESENS, PAUL V HOLLAND. (1998) Current risks of viral hepatitis from blood transfusions. Journal of Gastroenterology and Hepatology 13:4, 443-449
CrossRef131
V. Carnelli, R. Cimaz, E. Tanzi, L. Romano, A.R. Zanetti. (1998) High Prevalence of HGV/GBV-C Infection in Polytransfused Patients with Thalassemia Major. Vox Sanguinis 74:3, 212-212
CrossRef132
L. Bélec, N. Cancré, A. Si Mohamed, K. Habibatou, M. Matta, J. Pillot, A. Diallo. (1998) Lack of association between chronic hepatitis and hepatitis G virus infection in Senegal. Clinical Microbiology and Infection 4:4, 222-223
CrossRef133
H. G. Heuft, T. Berg, E. Schreier, U. Kunkel, M. Tacke, N. Schwella, U. Hopf, A. Salama, D. Huhn. (1998) Epidemiological and Clinical Aspects of Hepatitis G Virus Infection in Blood Donors and Immunocompromised Recipients of HGV-Contaminated Blood. Vox Sanguinis 74:3, 161-167
CrossRef134
J
CrossRef135
Mario G. Pessoa, Norah A. Terrault, Jill Detmer, Janice Kolberg, Mark Collins, Howayda M. Hassoba, Teresa L. Wright. (1998) Quantitation of hepatitis G and C viruses in the liver: evidence that hepatitis G virus is not hepatotropic. Hepatology 27:3, 877-880
CrossRef136
Hidenori Toyoda, Yoshihide Fukuda, Tetsuo Hayakawa, Junki Takamatsu, Hidehiko Saito. (1998) Effect of GB Virus C/Hepatitis G Virus Coinfection on the Course of HIV Infection in Hemophilia Patients in Japan. Journal of Acquired Immune Deficiency Syndromes and Human Retrovirology 17:3, 209-213
CrossRef137
Mary Chamberland, Rima F. Khabbaz. (1998) EMERGING ISSUES IN BLOOD SAFETY. Infectious Disease Clinics of North America 12:1, 217-229
CrossRef138
Steven Shev, Per Björkman, Gunnar Norkrans, Ulla Foberg, Aril Frydén, Gudrun Lindh, Annika Lindholm, Ola Weiland, Anders Widell. (1998) GBV-C/HGV infection in hepatitis C virus-infected deferred Swedish blood donors. Journal of Medical Virology 54:2, 75-79
CrossRef139
Alessandro R. Zanetti, Elisabetta Tanzi, Luisa Romanó, Nicola Principi, Giovanna Zuin, Eliseo Minola, Barbara Zapparoli, Marina Palmieri, Antonio Marini, Daniela Ghisotti, Paula Friedman, Jeffrey Hunt, Thomas Laffler, . (1998) Multicenter trial on mother-to-infant transmission of GBV-C virus. Journal of Medical Virology 54:2, 107-112
CrossRef140
Leda Bassit, Bernhard Kleter, Gabriela Ribeiro-dos-Santos, Geert Maertens, Ester Sabino, Dalton Chamone, Wim Quint, Amadeo Sáez-Alquézar. (1998) Hepatitis G Virus: Prevalence and Sequence Analysis in Blood Donors of São Paulo, Brazil. Vox Sanguinis 74:2, 83-87
CrossRef141
Jean-Michel Pawlotsky, Françoise Roudot-Thoraval, A. Scott Muerhoff, Muriel Pellerin, Georgios Germanidis, Suresh M. Desai, Anne Bastie, Françoise Darthuy, Jocelyne Rémiré, Elie-Serge Zafrani, Claude-James Soussy, Isa K. Mushahwar, Daniel Dhumeaux. (1998) GB virus C (GBV-C) infection in patients with chronic hepatitis C. Influence on liver disease and on hepatitis virus behaviour: Effect of interferon alfa therapy. Journal of Medical Virology 54:1, 26-37
CrossRef142
Birgit Kallinowski, Christine Buhrmann, Stefanie Seipp, Tobias Goeser, Wolfgang Stremmel, Gerd Otto, Lorenz Theilmann. (1998) Incidence, prevalence, and clinical outcome of hepatitis GB-C virus infection in liver transplant patients. Liver Transplantation and Surgery 4:1, 28-33
CrossRef143
S. J. Hadziyannis. (1998) Fulminant hepatitis and the new G/GBV-C flavivirus. Journal of Viral Hepatitis 5:1, 15-19
CrossRef144
C. A. Seemayer, S. Viazov, T. Philipp, M. Roggendorf. (1998) Detection of GBV-C/HGV RNA in saliva and serum, but not in urine of infected patients. Infection 26:1, 39-41
CrossRef145
Jia-Horng Kao, Chun-Jen Liu, Pei-Jer Chen, Wendy Chen, Sheng-Chun Hsiang, Ming-Yang Lai, Ding-Shinn Chen. (1997) Interspousal transmission of GB virus-C/hepatitis G virus: A comparison with hepatitis C virus. Journal of Medical Virology 53:4, 348-353
CrossRef146
I. D. Diamantis, E. Kouroumalis, M. Koulentaki, E. Fasler-Kan, P. A. Schmid, H. H. Hirsch, H. Bühler, K. Gyr, M. Battegay. (1997) Influence of hepatitis G virus infection on liver disease. European Journal of Clinical Microbiology & Infectious Diseases 16:12, 916-919
CrossRef147
HUEY-LING CHEN, MEI-HWEI CHANG, YEN-HSUAN NI, HONG-YUAN HSU, JIA-HORNG KAO, PEI-JER CHEN. (1997) Hepatitis G Virus Infection in Normal and Prospectively Followed Posttransfusion Children. Pediatric Research 42:6, 784-787
CrossRef148
James Versalovic. (1997) Hepatitis G virus. Clinical Microbiology Newsletter 19:21, 161-164
CrossRef149
TADASHI IDEURA, EIJI TANAKA, YOSHIYUKI NAKATSUJI, MAMORU KOBAYASHI, YUTAKA KANNO, HISAO OGUCHI, KAZUHIKO HORA. (1997) Clinical significance of hepatitis G virus infection in patients on long-term haemodialysis. Journal of Gastroenterology and Hepatology 12:11, 762-765
CrossRef150
Brian W.J Mahy. (1997) Human viral infections: an expanding frontier1This review is based on the presentation originally made at the Tenth International Conference on Antiviral Research in Atlanta, GA, USA, April 6–11, 1997.1. Antiviral Research 36:2, 75-80
CrossRef151
MATTHEW E. CRAMP, ROGER WILLIAMS. (1997) Hepatitis in alcohol and drug misusers: practical issues. Addiction Biology 2:4, 411-420
CrossRef152
Sheng Lou, Xiaoxing Qiu, Gary Tegtmeier, Sandra Leitza, John Brackett, Kristen Cousineau, Amit Varma, Heidi Seballos, Samar Kundu, Steve Kuemmerlea, J.C. Hunt. (1997) Immunoassays to study prevalence of antibody against GB virus C in blood donors. Journal of Virological Methods 68:1, 45-55
CrossRef153
Boonyos Raengsakulrach, Leena Ong-aj-yooth, Thanarak Thaiprasert, Sanga Nilwarangkur, Sompong Ong-aj-yooth, Sumitda Narupiti, Vipa Thirawuth, Chonticha Klungthong, Rapin Snitbhan, David W. Vaughn. (1997) High prevalence of hepatitis G viremia among kidney transplant patients in Thailand. Journal of Medical Virology 53:2, 162-166
CrossRef154
K KRAWCZYNSKI. (1997) Novel hepatitis agents: The significance of clinical and experimental studies. An overview. Journal of Gastroenterology and Hepatology 12:9-10, S193-S194
CrossRef155
(1997) Hepatitis-Associated Aplastic Anemia. New England Journal of Medicine 337:6, 424-425
Full Text156
Satoru Saito, Katsuaki Tanaka, Masaaki Kondo, Katsumi Morita, Takehiko Kitamura, Takayosi Kiba, Kazusi Numata, Hisahiko Sekihara. (1997) Plus- and Minus-Stranded Hepatitis G Virus RNA in Liver Tissue and in Peripheral Blood Mononuclear Cells. Biochemical and Biophysical Research Communications 237:2, 288-291
CrossRef157
(1997) Hepatitis G Infection. New England Journal of Medicine 337:4, 276-277
Full Text158
Masanori Ikeda, Kazuo Sugiyama, Tetsuya Mizutani, Torahiko Tanaka, Katsuaki Tanaka, Kunitada Shimotohno, Nobuyuki Kato. (1997) Hepatitis G Virus Replication in Human Cultured Cells Displaying Susceptibility to Hepatitis C Virus Infection. Biochemical and Biophysical Research Communications 235:3, 505-508
CrossRef159
Miyakawa, Yuzo, , Mayumi, Makoto, . (1997) Hepatitis G Virus — A True Hepatitis Virus or an Accidental Tourist?. New England Journal of Medicine 336:11, 795-796
Full Text
- Letters
