Join the 200th Anniversary Celebration

Original Article

Mutations in the Sarcoglycan Genes in Patients with Myopathy

David J. Duggan, B.S., J. Rafael Gorospe, M.D., Ph.D., Marina Fanin, M.S., Eric P. Hoffman, Ph.D., Corrado Angelini, M.D., E. Pegoraro, S. Noguchi, E. Ozawa, W. Pendlebury, A.J. Waclawik, D.A. Duenas, I. Hausmanowa-Petrusewicz, A. Fidzianska, S.C. Bean, J.S. Haller, J. Bodensteiner, C.M. Greco, A. Pestronk, A. Berardinelli, D.F. Gelinas, H. Abram, and R.W. Kuncl

N Engl J Med 1997; 336:618-625February 27, 1997

Abstract

Background

Some patients with autosomal recessive limb-girdle muscular dystrophy have mutations in the genes coding for the sarcoglycan proteins (α-, β-, γ-, and δ-sarcoglycan). To determine the frequency of sarcoglycan-gene mutations and the relation between the clinical features and genotype, we studied several hundred patients with myopathy.

Methods

Antibody against α-sarcoglycan was used to stain muscle-biopsy specimens from 556 patients with myopathy and normal dystrophin genes (the gene frequently deleted in X-linked muscular dystrophy). Patients whose biopsy specimens showed a deficiency of α-sarcoglycan on immunostaining were studied for mutations of the α-, β-, and γ-sarcoglycan genes with reverse transcription of muscle RNA, analysis involving single-strand conformation polymorphisms, and sequencing.

Results

Levels of α-sarcoglycan were found to be decreased on immunostaining of muscle-biopsy specimens from 54 of the 556 patients (10 percent); in 25 of these patients no α-sarcoglycan was detected. Screening for sarcoglycan-gene mutations in 50 of the 54 patients revealed mutations in 29 patients (58 percent): 17 (34 percent) had mutations in the α-sarcoglycan gene, 8 (16 percent) in the β-sarcoglycan gene, and 4 (8 percent) in the γ-sarcoglycan gene. No mutations were found in 21 patients (42 percent). The prevalence of sarcoglycan-gene mutations was highest among patients with severe (Duchenne-like) muscular dystrophy that began in childhood (18 of 83 patients, or 22 percent); the prevalence among patients with proximal (limb-girdle) muscular dystrophy with a later onset was 6 percent (11 of 180 patients).

Conclusions

Defects in the genes coding for the sarcoglycan proteins are limited to patients with Duchenne-like and limb-girdle muscular dystrophy with normal dystrophin and occur in 11 percent of such patients.

Media in This Article

Figure 1Organization of the Plasma-Membrane Dystrophin Cytoskeleton of Myofibers.
Figure 2α-Sarcoglycan Immunostaining of Muscle.
Article

Muscle diseases (myopathies) are most often caused by inborn errors resulting in the degeneration of muscle fibers (muscular dystrophies). The muscular dystrophies are a clinically and genetically heterogeneous group of disorders. Clinically, many of the muscular dystrophies present with proximal-limb muscle weakness or wasting and elevated serum creatine kinase concentrations. Genetically, the pattern of inheritance can be X-linked recessive (as in Duchenne's or Becker's muscular dystrophy), autosomal dominant (as in limb-girdle muscular dystrophy type 1), or autosomal recessive (as in limb-girdle muscular dystrophy type 2). Recently, many of these phenotypically similar, yet genetically distinct, disorders have been shown to be caused by abnormalities of the plasma membrane of muscle fibers. This membrane contains an extensive cytoskeleton that stabilizes the myofibrillar membrane during contraction. Part of this cytoskeleton appears to be responsible for attaching intracellular actin to the extracellular basal lamina by means of dystrophin (Figure 1Figure 1Organization of the Plasma-Membrane Dystrophin Cytoskeleton of Myofibers.).1-3

Abnormalities of dystrophin are a common cause of muscular dystrophy,4,5 and testing for the dystrophin gene or protein has become part of the routine diagnostic evaluation of patients who present with progressive proximal muscle weakness, high serum creatine kinase concentrations, and histopathological evidence of a dystrophic process. Patients who have no dystrophin abnormalities are assumed to have an autosomal recessive muscular dystrophy; most cases are isolated, and large families with multiple affected patients are uncommon.

In addition to dystrophin, other proteins, often referred to as dystrophin-associated proteins, contribute to the membrane cytoskeleton of myofibers. These proteins are divided into the dystroglycan, sarcoglycan, and syntrophin subcomplexes (Figure 1).3,6 Recently, genetic defects of the sarcoglycan complex (sarcoglycanopathies) were found in some patients with autosomal recessive muscular dystrophy.7-20 The genes and proteins corresponding to these genetic defects are α-sarcoglycan,7 β-sarcoglycan,9,10 γ-sarcoglycan,8 and δ-sarcoglycan.20 Each of these sarcoglycans is a relatively small transmembrane protein expressed either only (α, γ, and δ) or predominantly (β) in striated muscle (skeletal and cardiac).7-10,20-23 No patients with primary defects of the other dystrophin-associated proteins (dystroglycans and syntrophins) have been identified; however, the expression of these proteins is not limited to striated muscle.24,25

Studies with antibodies directed against α-, β-, γ-, and δ-sarcoglycan have revealed deficiencies of all components of the sarcoglycan complex in muscle-biopsy specimens from patients with mutations in any of the sarcoglycan genes.8-10,17,20 Apparently, mutations in a single sarcoglycan gene lead to destabilization of the entire complex and secondary deficiency of the other sarcoglycan proteins. Thus, a genetic defect of any component of the protein complex should be detectable with antibody against any of the sarcoglycan proteins.26 Because biopsy specimens from patients with dystrophin-gene abnormalities reveal secondary deficiencies of the sarcoglycans,27,28 testing for sarcoglycan proteins is informative only if dystrophin is normal. Thus, testing of biopsy specimens from patients with normal dystrophin with antibody directed against α-sarcoglycan should identify most or all patients with mutations of the α-, β-, γ-, and δ-sarcoglycan genes. We used both biochemical and molecular approaches to screen for abnormalities and genetic defects in the sarcoglycan proteins in patients with myopathy.

Methods

Selection of Patients

We selected muscle-biopsy specimens for α-sarcoglycan immunostaining from patients with myopathy whose records and biopsy specimens were available at the University of Padua (322 patients) and University of Pittsburgh (234 patients) and who had normal dystrophin on the basis of immunofluorescence or immunoblot analysis and histopathological evidence of myopathy. The Italian patients were from northeastern Italy and were examined in Padua by a single team. The patients whose biopsy specimens were studied in Pittsburgh were examined in neuromuscular clinics throughout the United States with a standard clinical-assessment protocol (manual muscle testing and muscle biopsy). The Italian patients (or their parents) provided written informed consent. The studies done in Pittsburgh were approved by the institutional review board, but did not require informed consent because the biopsy specimens were “preexisting pathological specimens” obtained for diagnostic purposes (to rule out a dystrophin abnormality).

The patients were divided into three groups on the basis of a clinical examination (Padua) or clinical summaries (Pittsburgh): those with congenital muscular dystrophy, those with a dystrophinopathy-like disorder, and those with other neuromuscular disorders (Table 1Table 1Clinical Diagnosis, Results of Immunostaining for a-Sarcoglycan, and Frequency of Sarcoglycan-Gene Mutations in 556 Patients with Myopathy.). Congenital muscular dystrophy was defined as the presence of weakness or hypotonia at birth, contractures before six months of age, and dystrophy on muscle biopsy. This category included patients with and those without central nervous system involvement. A dystrophinopathy-like disorder was defined on the basis of the presence of progressive proximal muscle weakness beginning after six months of age, high serum creatine kinase concentrations, and dystrophy on muscle biopsy. Other neuromuscular disorders were defined on the basis of findings of muscle weakness or wasting, hypotonia, calf hypertrophy, or high serum creatine kinase concentrations and included the following diagnoses: inflammatory myopathy (9 patients), metabolic myopathy (9), congenital structural myopathy (10), myoglobinuria (14), distal myopathy (2), congenital hypotonia (2), familial myopathy with high serum creatine kinase concentrations (5), isolated high serum creatine kinase concentrations (23), isolated myopathy with high serum creatine kinase concentrations or cramps (40), and other muscular dystrophies (78). An additional 32 patients from the Pittsburgh referral center had inadequate clinical information for precise classification of the neuromuscular disorder. All the patients in the group with other neuromuscular disorders had normal results of α-sarcoglycan immunostaining.

The patients with a dystrophinopathy-like disorder were subdivided on the basis of their age at presentation into those with Duchenne-like muscular dystrophy (also known as severe childhood autosomal recessive muscular dystrophy) if they presented at or before the age of 10 years and those with limb-girdle muscular dystrophy (similar to Becker's muscular dystrophy) if they presented after 10 years of age. All patients with Duchenne-like muscular dystrophy had Gowers' sign (rising from the floor by pushing one's hands against the shins, knees, and then thighs) before losing the ability to walk, and all patients with either type of muscular dystrophy had high serum creatine kinase concentrations.

Biochemical Analysis

Frozen sections (4 to 6 μm) of muscle obtained by biopsy were stained with α-sarcoglycan antibody (NCL-50DAG, Novocastra Laboratories, Newcastle, United Kingdom) as previously described.15 The sections were scored as being completely or partially deficient in α-sarcoglycan relative to results in muscle tissue obtained and processed in parallel from subjects with no histologic evidence of muscle disease, as previously described.15 The identification of partial deficiencies of α-sarcoglycan was subjective, but interobserver reliability was increased by the use of only two observers for all biopsy specimens (one each in Padua and Pittsburgh), who were unaware of the clinical diagnosis.

Molecular Analyses

RNA Extraction and Reverse Transcription

Total RNA was isolated from the muscle-biopsy specimens of patients with decreased or no α-sarcoglycan staining and reverse transcribed as previously described.15

Polymerase Chain Reaction

Overlapping polymerase-chain-reaction (PCR) products for the complete coding sequences of complementary DNA for the α-, β-, and γ-sarcoglycan genes were generated. The α-sarcoglycan PCR products, primers, and conditions have been described previously.14,15 The β-sarcoglycan PCR products were generated with two primer pairs in addition to those previously described9: primer pairs 5 (nucleotides -40 to 267; 5'ACAGTCGGGCGGGGAGCT3' and 5'CACGGCCCAAATAACAAGTG3') and 6 (nucleotides 773 to 982; 5'ATGGATCTGTATGGTCAGC3' and 5'CATGTTGGTGACCTCTGGG3'), designed on the basis of the β-sarcoglycan messenger RNA sequence9 with use of the Primer program (Daly MJ, et al.: unpublished data). PCR conditions were as described previously,9,15 except that an annealing temperature of 60°C and 5 percent dimethylsulfoxide were used for primer pair 5. The γ-sarcoglycan PCR products, primers, and conditions have been described previously.8,17

Analysis Involving Single-Strand Conformation Polymorphisms

Radiolabeled PCR product was mixed with an equal volume of stop solution, and the samples were denatured and analyzed with three single-strand conformation polymorphism (SSCP) gels as described previously.15,29

DNA Sequencing

Bands showing an electrophoretic shift in mobility on the basis of SSCP analysis were directly sequenced with the original PCR primers and the prism Ready Reaction Dyedeoxy Terminator Cycle Sequencing Kit (Applied Biosystems, Foster City, Calif.) according to the manufacturer's recommendations.15

Confirmation of Nucleotide Changes

Nucleotide changes and an autosomal recessive pattern of inheritance were confirmed in the genomic DNA of the patients and their parents with exon-specific PCR primers.18,19 When the identified sequence variant destroyed or created a restriction-enzyme site, the appropriate PCR product was digested with a specific restriction endonuclease. When the identified sequence variant did not change a restriction-enzyme site, amplification-refractory mutation tests were designed.30 Insertions, duplications, and deletions were analyzed by size fractionation with denaturing polyacrylamide-gel electrophoresis.

DNA Analysis

Genomic DNA was isolated from peripheral-blood lymphocytes of the patients and their parents or the patients' muscle-biopsy specimens as described previously.31,32 Approximately 100 ng of DNA was used for PCR amplification.

Results

Muscle-biopsy specimens from 556 patients with myopathy and normal dystrophin were available for immunostaining for α-sarcoglycan (Figure 2AFigure 2α-Sarcoglycan Immunostaining of Muscle. and Figure 2B). The clinical classifications of these patients and the staining results are shown in Table 1. Deficiency of α-sarcoglycan was evident in biopsy specimens from 54 patients (10 percent). The deficiency was complete in 25 patients (4.5 percent) and partial in 29 patients (5.2 percent). Fifty-two of the 54 patients with α-sarcoglycan deficiency had clinical manifestations of either Duchenne-like or limb-girdle muscular dystrophy (a dystrophinopathy-like disorder). Two of the 69 patients with congenital muscular dystrophy had a partial deficiency of α-sarcoglycan. The prevalence of α-sarcoglycan deficiency in the three groups of patients was similar in the Italian and American patients.

RNA was isolated from the muscle-biopsy specimens of 50 of the 54 patients with abnormal α-sarcoglycan immunostaining and screened for mutations in the α-, β-, and γ-sarcoglycan genes. Mutations were detected in 29 (58 percent) of the patients (Table 1, Table 2Table 2Sarcoglycan-Gene Mutations Identified in 50 Patients with a-Sarcoglycan Deficiency. and Table 3Table 3Sarcoglycan-Gene Mutations in the Patients with Abnormal Results of a-Sarcoglycan Immunostaining.): 18 of 29 patients with Duchenne-like muscular dystrophy (62 percent) and 11 of 19 patients with limb-girdle muscular dystrophy (58 percent). The homozygous or compound heterozygous status of the 25 patients who had mutations of both sarcoglycan-gene alleles was confirmed by tests on genomic DNA from all the patients and, when available, both their parents (17 of 25 patients); in each case their parents were heterozygous for one of the two identified mutant alleles. In four patients (Patients 6, 18, 39, and 40), only one mutant allele was identified. In Patient 6, only mutant RNA (T371C) was present in the muscle-biopsy specimen, whereas analysis of genomic DNA revealed the patient to be heterozygous (one wild-type and one mutant allele) at this nucleotide position. This patient probably had a second undetected mutation that prevented the expression of the wild-type allele, allowing only the mutant allele to be detected in the RNA of the muscle. Because all patients with a primary sarcoglycanopathy are assumed to have an autosomal recessive pattern of inheritance with two mutant alleles, Patients 18, 39, and 40 were presumed to have a second, unidentified mutation. One hundred normal chromosomes were examined for all novel mutations, and all tested negative. Thus, among the 50 patients with a deficiency of α-sarcoglycan on immunostaining, mutations in the α-sarcoglycan gene were detected in 17 (34 percent), mutations in the β-sarcoglycan gene were detected in 8 (16 percent), and mutations in the γ-sarcoglycan gene were detected in 4 (8 percent).

The mean (±SD) age at presentation or the diagnosis of myopathy in the patients with mutations in the α-sarcoglycan gene was 6±4 years; it was 3±2 and 6±4 years, respectively, in the patients with mutations in the β-sarcoglycan and γ-sarcoglycan genes. All patients presented with clinical findings that included calf hypertrophy, Gowers' sign, and a deficit in motor skills. The mean serum creatine kinase concentrations in the patients with mutations in the α-sarcoglycan, β-sarcoglycan, and γ-sarcoglycan genes were 13,732±6196, 15,226±12,528, and 16,900±8224 IU per liter, respectively (normal, <200).

Discussion

Mutations of any component of the sarcoglycan complex result in the secondary loss of the other components of the complex. Thus, we hypothesized that we could identify patients who were likely to have mutations in the α-, β-, or γ-sarcoglycan gene by immunostaining for α-sarcoglycan. Among the 556 patients with normal dystrophin whom we studied, 54 had a deficiency of α-sarcoglycan on immunostaining. Molecular studies were performed in 50 of these 54 patients and revealed that 58 percent had mutations of the α-, β-, or γ-sarcoglycan gene. It is therefore clear that a mutation in these genes does not account for all cases of α-sarcoglycan deficiency, even after adjustment for the secondary deficiency of the sarcoglycan complex in Duchenne's and Becker's muscular dystrophies.

Some patients with primary sarcoglycan deficiency (that involving a mutation) might have been missed by our use of α-sarcoglycan immunostaining as the initial screening test. However, the available data suggest that we should have identified most if not all patients with sarcoglycan-gene mutations using this approach.8-10 Previous studies have identified two unrelated families with mutations in the β-sarcoglycan gene and four unrelated families with mutations in the γ-sarcoglycan gene; all patients had α-sarcoglycan deficiency in muscle, even though this deficiency was not a criterion for the identification of the study patients. Moreover, the patients with mutations in the β- or γ-sarcoglycan gene in this study all had marked reductions in the levels of these proteins on immunostaining (data not shown).

We may not have detected all sarcoglycan mutations in the biopsy specimens tested, but we think that this possibility is unlikely. In autosomal recessive disorders there are mutations in both alleles of the particular gene, and if the mutation-detection strategy lacks sensitivity, then only one mutation will be detected in some patients (they will appear to be heterozygous). We found only 4 of 29 patients to be heterozygous in this study, suggesting that the sensitivity of our mutation analysis was approximately 93 percent (54 of 58 possible mutant alleles detected) and that our ability to identify patients with at least one mutant allele exceeded 99 percent.

The large number of patients studied allowed us to estimate the frequencies of sarcoglycan-gene mutations in patients with myopathies and normal dystrophin (Table 1). We found a deficiency of α-sarcoglycan protein in 10 percent of patients with normal dystrophin. If we include only patients with Duchenne-like or limb-girdle muscular dystrophy in the analysis, this figure rises to 20 percent. In the patients with α-sarcoglycan deficiency on immunostaining, a complete deficiency (absence of staining) was more specific for mutations in the α-sarcoglycan gene than for mutations in the β- or γ-sarcoglycan gene (Table 2). On the other hand, a partial deficiency of α-sarcoglycan on immunostaining was not specific for mutations of any one of the three genes, and the majority (61 percent) of patients with a partial deficiency had no mutations.

We, like others, found that patients with a primary sarcoglycanopathy are clinically indistinguishable from those with either Duchenne's or Becker's muscular dystrophy.7-17 Cognitive function was normal in all patients with sarcoglycan-gene mutations. Although sarcoglycans are normally present in both skeletal and cardiac muscle, there were no electrocardiographic or echocardiographic abnormalities in the seven patients tested. There were differences in the clinical severity, in that all patients with mutations in the β-sarcoglycan gene had severe dystrophy, whereas half those with mutations in the α- or γ-sarcoglycan gene had milder disease.

Many genes are known to cause muscular dystrophy, including the genes for dystrophin (Duchenne's or Becker's muscular dystrophy), calpain III (limb-girdle muscular dystrophy type 2A), merosin (congenital muscular dystrophy with merosin deficiency), and α-, β-, γ-, and δ-sarcoglycan (limb-girdle muscular dystrophy types 2D, 2E, 2C, and 2F, respectively). Molecular genetic analyses can now identify the disease-causing mutations in all these genes.

The muscular dystrophies characterized by progressive muscle weakness of the pelvic and shoulder girdle (Duchenne's, Becker's, and limb-girdle muscular dystrophies) are a clinically and genetically heterogeneous group of diseases. The elucidation of the genetic defect leading to the dystrophy has implications for the diagnosis and care of affected patients (and their families). Because defects in several genes can cause phenotypically similar clinical and biochemical manifestations, a definitive diagnosis can only be made by testing of candidate genes or proteins.

Supported by grants from the National Institutes of Health (NS-28403 [to Dr. Hoffman]), the Muscular Dystrophy Association (to Dr. Hoffman), and Telethon–Italy (695 [to Ms. Fanin] and 552 [to Dr. Angelini]). Dr. Hoffman is an Established Investigator of the American Heart Association.

Source Information

From the Departments of Human Genetics, Molecular Genetics and Biochemistry, Pediatrics, and Neurology, University of Pittsburgh, Pittsburgh (D.J.D., J.R.G., E.P.H.); and the Regional Neuromuscular Center, Department of Neurology, University of Padua, Padua, Italy (M.F., C.A.).

Address reprint requests to Dr. Hoffman at Biomedical Science Tower W1211, Department of Molecular Genetics and Biochemistry, University of Pittsburgh School of Medicine, Pittsburgh, PA 15261.

References

References

  1. 1

    Tinsley JM, Blake DJ, Zuellig RA, Davies KE. Increasing complexity of the dystrophin-associated protein complex. Proc Natl Acad Sci U S A 1994;91:8307-8313
    CrossRef | Web of Science | Medline

  2. 2

    Worton R. Muscular dystrophies: diseases of the dystrophin-glycoprotein complex. Science 1995;270:755-756
    CrossRef | Web of Science | Medline

  3. 3

    Ozawa E, Yoshida M, Suzuki A, Mizuno Y, Hagiwara Y, Noguchi S. Dystrophin-associated proteins in muscular dystrophy. Hum Mol Genet 1995;4:1711-1716
    Web of Science | Medline

  4. 4

    Hoffman EP, Fischbeck KH, Brown RH, et al. Characterization of dystrophin in muscle-biopsy specimens from patients with Duchenne's or Becker's muscular dystrophy. N Engl J Med 1988;318:1363-1368
    Full Text | Web of Science | Medline

  5. 5

    Hoffman EP, Arahata K, Minetti C, Bonilla E, Rowland LP. Dystrophinopathy in isolated cases of myopathy in females. Neurology 1992;42:967-975
    Web of Science | Medline

  6. 6

    Yoshida M, Suzuki A, Yamamoto H, Noguchi S, Mizuno Y, Ozawa E. Dissociation of the complex of dystrophin and its associated proteins into several unique groups by n-octyl β-D-glucoside. Eur J Biochem 1994;222:1055-1061
    CrossRef | Medline

  7. 7

    Roberds SL, Leturcq F, Allamand V, et al. Missense mutations in the adhalin gene linked to autosomal recessive muscular dystrophy. Cell 1994;78:625-633
    CrossRef | Web of Science | Medline

  8. 8

    Noguchi S, McNally EM, Ben Othmane K, et al. Mutations in the dystrophin-associated protein γ-sarcoglycan in chromosome 13 muscular dystrophy. Science 1995;270:819-822
    CrossRef | Web of Science | Medline

  9. 9

    Bonnemann CG, Modi R, Noguchi S, et al. β-Sarcoglycan (A3b) mutations cause autosomal recessive muscular dystrophy with loss of the sarcoglycan complex. Nat Genet 1995;11:266-273
    CrossRef | Web of Science | Medline

  10. 10

    Lim LE, Duclos F, Broux O, et al. β-Sarcoglycan: characterization and role in limb-girdle muscular dystrophy linked to 4q12. Nat Genet 1995;11:257-265
    CrossRef | Web of Science | Medline

  11. 11

    Piccolo F, Roberds SL, Jeanpierre M, et al. Primary adhalinopathy: a common cause of autosomal recessive muscular dystrophy of variable severity. Nat Genet 1995;10:243-245
    CrossRef | Web of Science | Medline

  12. 12

    Passos Bueno MR, Moreira ES, Vainzof M, et al. A common missense mutation in the adhalin gene in three unrelated Brazilian families with a relatively mild form of autosomal recessive limb-girdle muscular dystrophy. Hum Mol Genet 1995;4:1163-1167
    CrossRef | Web of Science | Medline

  13. 13

    Kawai H, Akaike M, Endo T, et al. Adhalin gene mutations in patients with autosomal recessive childhood onset muscular dystrophy with adhalin deficiency. J Clin Invest 1995;96:1202-1207
    CrossRef | Web of Science | Medline

  14. 14

    Ljunggren A, Duggan DJ, McNally E, et al. Primary adhalin deficiency as a cause of muscular dystrophy in patients with normal dystrophin. Ann Neurol 1995;38:367-372
    CrossRef | Web of Science | Medline

  15. 15

    Duggan DJ, Fanin M, Pegoraro E, Angelini C, Hoffman EP. α-Sarcoglycan (adhalin) deficiency: complete deficiency patients are 5% of childhood-onset dystrophin-normal muscular dystrophy and most partial deficiency patients do not have gene mutations. J Neurol Sci 1996;140:30-39
    CrossRef | Web of Science | Medline

  16. 16

    Fanin M, Martinello F, Duggan DJ, et al. A severe case of Duchenne-like muscular dystrophy due to a mutation in the α-sarcoglycan (adhalin) gene. Basic Appl Myol 1996;6:95-100

  17. 17

    McNally EM, Duggan D, Gorospe JR, et al. Mutations that disrupt the carboxyl-terminus of γ-sarcoglycan cause muscular dystrophy. Hum Mol Genet 1996;5:1841-1847
    CrossRef | Web of Science | Medline

  18. 18

    McNally EM, Passos-Bueno MR, Bonnemann CG, et al. Mild and severe muscular dystrophy caused by a single γ-sarcoglycan gene mutation. Am J Hum Genet 1996;59:1040-1047
    Web of Science | Medline

  19. 19

    Bonnemann CG, Passos-Bueno MR, McNally EM, et al. Genomic screening for β-sarcoglycan gene mutations: missense mutations may cause severe limb-girdle muscular dystrophy type 2E (LGMD 2E). Hum Mol Genet 1996;5:1953-1961
    CrossRef | Web of Science | Medline

  20. 20

    Nigro V, Moreira ES, Piluso G, et al. Autosomal recessive limb-girdle muscular dystrophy, LGMD2F, is caused by a mutation in the delta-sarcoglycan gene. Nat Genet 1996;13:195-198
    CrossRef | Web of Science

  21. 21

    Mizuno Y, Yoshida M, Yamamoto H, Hirai S, Ozawa E. Distribution of dystrophin isoforms and dystrophin-associated proteins 43DAG (A3a) and 50DAG (A2) in various monkey tissues. J Biochem (Tokyo) 1993;114:936-941
    Web of Science | Medline

  22. 22

    Yamamoto H, Mizuno Y, Hayashi K, Nonaka I, Yoshida M, Ozawa E. Expression of dystrophin-associated protein 35DAG (A4) and 50DAG (A2) is confined to striated muscles. J Biochem (Tokyo) 1994;115:162-167
    Web of Science | Medline

  23. 23

    McNally EM, Yoshida M, Mizuno Y, Ozawa E, Kunkel LM. Human adhalin is alternatively spliced and the gene is located on chromosome 17q21. Proc Natl Acad Sci U S A 1994;91:9690-9694
    CrossRef | Web of Science | Medline

  24. 24

    Ibraghimov-Beskrovnaya O, Ervasti JM, Leveille CJ, Slaughter CA, Sernett SW, Campbell KP. Primary structure of dystrophin-associated glycoproteins linking dystrophin to the extracellular matrix. Nature 1992;355:696-702
    CrossRef | Web of Science | Medline

  25. 25

    Ahn AH, Freener CA, Gussoni E, Yoshida M, Ozawa E, Kunkel LM. The three human syntrophin genes are expressed in diverse tissues, have distinct chromosomal locations, and each bind to dystrophin and its relatives. J Biol Chem 1996;271:2724-2730
    CrossRef | Web of Science | Medline

  26. 26

    Mizuno Y, Noguchi S, Yamamoto H, et al. Selective defect of sarcoglycan complex in severe childhood autosomal recessive muscular dystrophy muscle. Biochem Biophys Res Commun 1994;203:979-983
    CrossRef | Web of Science | Medline

  27. 27

    Ohlendieck K, Matsumura K, Ionasescu VV, et al. Duchenne muscular dystrophy: deficiency of dystrophin-associated proteins in the sarcolemma. Neurology 1993;43:795-800
    Web of Science | Medline

  28. 28

    Mizuno Y, Yoshida M, Nonaka I, Hirai S, Ozawa E. Expression of utrophin (dystrophin-related protein) and dystrophin-associated glycoproteins in muscles from patients with Duchenne muscular dystrophy. Muscle Nerve 1994;17:206-216
    CrossRef | Web of Science | Medline

  29. 29

    Spinardi L, Mazars R, Theillet C. Protocols for an improved detection of point mutations by SSCP. Nucleic Acids Res 1991;19:4009-4009
    CrossRef | Web of Science | Medline

  30. 30

    Little S. Amplification-refractory mutation system (ARMS) analysis of point mutations. In: Dracopoli NC, Haines JL, Korf BR, et al., eds. Current protocols in human genetics. New York: John Wiley, 1994:9.8.1-9.8.5.

  31. 31

    Miller SA, Dykes DD, Polesky HF. A simple salting out procedure for extracting DNA from human nucleated cells. Nucleic Acids Res 1988;16:1215-1215
    CrossRef | Web of Science | Medline

  32. 32

    Pegoraro E, Schimke RN, Garcia C, et al. Genetic and biochemical normalization in female carriers of Duchenne muscular dystrophy: evidence for failure of dystrophin production in dystrophin-competent myonuclei. Neurology 1995;45:677-690
    Web of Science | Medline

Citing Articles (73)

Citing Articles

  1. 1

    Tayebeh Soheili, Evelyne Gicquel, Jérôme Poupiot, Luu N'Guyen, Florence Le Roy, Marc Bartoli, Isabelle Richard. (2012) Rescue of sarcoglycan mutations by inhibition of endoplasmic reticulum quality control is associated with minimal structural modifications. Human Mutation 33:2, 429-439
    CrossRef

  2. 2

    Xiomara Q. Rosales, Chang-Yong Tsao. (2012) Childhood Onset of Limb-Girdle Muscular Dystrophy. Pediatric Neurology 46:1, 13-23
    CrossRef

  3. 3

    G. Meola, E. Bugiardini, R. Cardani. (2011) Muscle biopsy. Journal of Neurology
    CrossRef

  4. 4

    Janbernd Kirschner, Hanns Lochmüller. 2011. Sarcoglycanopathies. , 41-46.
    CrossRef

  5. 5

    Laura Broglio, Marta Tentorio, Maria Sofia Cotelli, Michelangelo Mancuso, Valentina Vielmi, Valeria Gregorelli, Alessandro Padovani, Massimiliano Filosto. (2010) Limb-Girdle Muscular Dystrophy-Associated Protein Diseases. The Neurologist 16:6, 340-352
    CrossRef

  6. 6

    A. Fayssoil. (2010) Cardiac diseases in sarcoglycanopathies. International Journal of Cardiology 144:1, 67-68
    CrossRef

  7. 7

    Dorianna Sandonà, Romeo Betto. (2009) Sarcoglycanopathies: molecular pathogenesis and therapeutic prospects. Expert Reviews in Molecular Medicine 11,
    CrossRef

  8. 8

    Marina Fanin, Elisabetta Tasca, Anna Chiara Nascimbeni, Corrado Angelini. (2009) Sarcolemmal Neuronal Nitric Oxide Synthase Defect in Limb-Girdle Muscular Dystrophy. Journal of Neuropathology and Experimental Neurology 68:4, 383-390
    CrossRef

  9. 9

    JAMES B. ATKINSON, MAHLON D. JOHNSON, THOMAS W. BOULDIN, WILLIAM O. WHETSELL. 2009. Muscle and Nerve Biopsy. , 2069-2088.
    CrossRef

  10. 10

    Volker Straub, Kate Bushby. (2008) Therapeutic possibilities in the autosomal recessive limb-girdle muscular dystrophies. Neurotherapeutics 5:4, 619-626
    CrossRef

  11. 11

    R. Bauer, G.A. MacGowan, A. Blain, K. Bushby, V. Straub. (2008) Steroid treatment causes deterioration of myocardial function in the  -sarcoglycan-deficient mouse model for dilated cardiomyopathy. Cardiovascular Research 79:4, 652-661
    CrossRef

  12. 12

    Stefano Gastaldello, Simona D'Angelo, Susanna Franzoso, Marina Fanin, Corrado Angelini, Romeo Betto, Dorianna Sandonà. (2008) Inhibition of Proteasome Activity Promotes the Correct Localization of Disease-Causing α-Sarcoglycan Mutants in HEK-293 Cells Constitutively Expressing β-, γ-, and δ-Sarcoglycan. The American Journal of Pathology 173:1, 170-181
    CrossRef

  13. 13

    Nailah Siddique, Robert Sufit, Teepu Siddique. 2007. Degenerative Motor, Sensory, and Autonomic Disorders. , 781-811.
    CrossRef

  14. 14

    Christian A. Shaw, Nancy Larochelle, Roy W.R. Dudley, Hanns Lochmuller, Gawiyou Danialou, Basil J. Petrof, George Karpati, Paul C. Holland, Josephine Nalbantoglu. (2006) Simultaneous Dystrophin and Dysferlin Deficiencies Associated with High-Level Expression of the Coxsackie and Adenovirus Receptor in Transgenic Mice. The American Journal of Pathology 169:6, 2148-2160
    CrossRef

  15. 15

    Marina Fanin, Anna Chiara Nascimbeni, Corrado Angelini. (2006) Muscle protein analysis in the detection of heterozygotes for recessive limb girdle muscular dystrophy type 2B and 2E. Neuromuscular Disorders 16:11, 792-799
    CrossRef

  16. 16

    Steven A. Moore, Christopher J. Shilling, Steven Westra, Cheryl Wall, Matthew P. Wicklund, Catherine Stolle, Charlotte A. Brown, Daniel E. Michele, Federica Piccolo, Thomas L. Winder, Aaron Stence, Rita Barresi, Nick King, Wendy King, Julaine Florence, Kevin P. Campbell, Gerald M. Fenichel, Hansell H. Stedman, John T. Kissel, Robert C. Griggs, Shree Pandya, Katherine D. Mathews, Alan Pestronk, Carmen Serrano, Daniel Darvish, Jerry R. Mendell. (2006) Limb-Girdle Muscular Dystrophy in the United States. Journal of Neuropathology and Experimental Neurology 65:10, 995-1003
    CrossRef

  17. 17

    Telma L.F. Gouveia, Julia F.O. Paim, Rita C. Pavanello, Mayana Zatz, Mariz Vainzof. (2006) Sarcoglycanopathies: A Multiplex Molecular Analysis for the Most Common Mutations. Diagnostic Molecular Pathology 15:2, 95-100
    CrossRef

  18. 18

    Jiwei Chen, Weixing Shi, Yuguang Zhang, Randi Sokol, Hong Cai, Mingyue Lun, Brian F. Moore, Matthew J. Farber, Joel S. Stepanchick, Carsten G. Bönnemann, Yiu-mo Michael Chan. (2006) Identification of functional domains in sarcoglycans essential for their interaction and plasma membrane targeting. Experimental Cell Research 312:9, 1610-1625
    CrossRef

  19. 19

    Charles R. Bridges, Kapil Gopal, David E. Holt, Charles Yarnall, Steven Cole, Rochelle B. Anderson, Xiaoqing Yin, Anthony Nelson, Benjamin W. Kozyak, Zhonglin Wang, James Lesniewski, Leonard T. Su, Danielle M. Thesier, Hari Sundar, Hansell H. Stedman. (2005) Efficient myocyte gene delivery with complete cardiac surgical isolation in situ. The Journal of Thoracic and Cardiovascular Surgery 130:5, 1364.e1-1364.e8
    CrossRef

  20. 20

    Seema Kapoor, Medha Tatke, Sandeep Aggarwal, Ashish Gupta. (2005) Beta-sarcoglycanopathy. The Indian Journal of Pediatrics 72:1, 71-74
    CrossRef

  21. 21

    J. Finsterer. (2004) Klinik und Genetik der Gliedergrteldystrophien. Der Nervenarzt 75:12, 1153-1166
    CrossRef

  22. 22

    Weixing Shi, Zaili Chen, Jodi Schottenfeld, Richard C. Stahl, Louis M. Kunkel, Yiu-Mo Chan. (2004) Specific assembly pathway of sarcoglycans is dependent on beta- and delta-sarcoglycan. Muscle & Nerve 29:3, 409-419
    CrossRef

  23. 23

    (2004) Limb girdle muscular dystrophy: use of dHPLC and direct sequencing to detect sarcoglycan gene mutations in a New Zealand cohort. Clinical Genetics 65:1, 55-60
    CrossRef

  24. 24

    Dirk Fischer, Stefania Aurino, Vincenzo Nigro, Rolf Schrder. (2003) On symptomatic heterozygous alpha-sarcoglycan gene mutation carriers. Annals of Neurology 54:5, 674-678
    CrossRef

  25. 25

    Mayana Zatz, Flavia de Paula, Alessandra Starling, Mariz Vainzof. (2003) The 10 autosomal recessive limb-girdle muscular dystrophies. Neuromuscular Disorders 13:7-8, 532-544
    CrossRef

  26. 26

    M. Fanin, P. Melacini, C. Boito, E. Pegoraro, C. Angelini. (2003) LGMD2E patients risk developing dilated cardiomyopathy. Neuromuscular Disorders 13:4, 303-309
    CrossRef

  27. 27

    Anthony A. Amato. 2003. Muscular Dystrophy: Limb–Girdle, Becker's, and Duchenne's. , 292-303.
    CrossRef

  28. 28

    J.C. Reijneveld, B.C.M. Te Boekhorst, M.L. Zonderland, S. Kalmijn, N.C. Notermans. (2002) Response to exercise of patients with idiopathic hyper-CK-emia. Muscle & Nerve 26:6, 832-837
    CrossRef

  29. 29

    Elena Pegoraro, Fulvio Cepollaro, Paola Prandini, Alessandra Marin, Marina Fanin, Carlo P. Trevisan, Abdul Hassib El-Messlemani, Guido Tarone, Eva Engvall, Eric P. Hoffman, Corrado Angelini. (2002) Integrin α7β1 in Muscular Dystrophy/Myopathy of Unknown Etiology. The American Journal of Pathology 160:6, 2135-2143
    CrossRef

  30. 30

    M. Fanin, C. Angelini. (2002) Defective assembly of sarcoglycan complex in patients with β-sarcoglycan gene mutations. Study of aneural and innervated cultured myotubes. Neuropathology and Applied Neurobiology 28:3, 190-199
    CrossRef

  31. 31

    Elizabeth M. McNally. 2002. Sarcoglycans. .
    CrossRef

  32. 32

    T. Dua, V. Kalra, M. C. Sharma, M. Kabra. (2001) Adhalin deficiency : An unusual cause of muscular dystrophy. The Indian Journal of Pediatrics 68:11, 1083-1085
    CrossRef

  33. 33

    Erynn S. Gordon, Eric P. Hoffman. (2001) The ABCʼs of limb-girdle muscular dystrophy: α-sarcoglycanopathy, Bethlem myopathy, calpainopathy and more. Current Opinion in Neurology 14:5, 567-573
    CrossRef

  34. 34

    L Politano, V Nigro, L Passamano, V Petretta, L.I Comi, S Papparella, Ge Nigro, P.F Rambaldi, P Raia, A Pini, M Mora, M.A.M Giugliano, M.G Esposito, G Nigro. (2001) Evaluation of cardiac and respiratory involvement in sarcoglycanopathies. Neuromuscular Disorders 11:2, 178-185
    CrossRef

  35. 35

    John D. Porter, Anita P. Merriam, Andrew A. Hack, Francisco H. Andrade, Elizabeth M. McNally. (2001) Extraocular muscle is spared despite the absence of an intact sarcoglycan complex in γ- or δ-sarcoglycan-deficient mice. Neuromuscular Disorders 11:2, 197-207
    CrossRef

  36. 36

    Eriko Wakabayashi-Takai, Satoru Noguchi, Eijiro Ozawa. (2001) Identification of myogenesis-dependent transcriptional enhancers in promoter region of mouse gamma-sarcoglycan gene. European Journal of Biochemistry 268:4, 948-957
    CrossRef

  37. 37

    Romesh Draviam, Lynn Billington, Andy Senchak, Eric P. Hoffman, Simon C. Watkins. (2001) Confocal analysis of the dystrophin protein complex in muscular dystrophy. Muscle & Nerve 24:2, 262-272
    CrossRef

  38. 38

    Robert Pogue, Louise V.B Anderson, Angela Pyle, Caroline Sewry, Christine Pollitt, Margaret A Johnson, Keith Davison, Jennifer A Moss, Eugenio Mercuri, Francesco Muntoni, Katherine M.D Bushby. (2001) Strategy for mutation analysis in the autosomal recessive limb-girdle muscular dystrophies. Neuromuscular Disorders 11:1, 80-87
    CrossRef

  39. 39

    Natasha J. Olby, Nick J.H. Sharp, Louise V.B. Anderson, Louis M. Kunkel, Carsten G. Bönnemann. (2001) Evaluation of the dystrophin–glycoprotein complex, α-actinin, dysferlin and calpain 3 in an autosomal recessive muscular dystrophy in Labrador retrievers. Neuromuscular Disorders 11:1, 41-49
    CrossRef

  40. 40

    Y.-W. Chen, P. Zhao, R. Borup, E. P. Hoffman. (2000) Expression Profiling in the Muscular Dystrophies: Identification of Novel Aspects of Molecular Pathophysiology. The Journal of Cell Biology 151:6, 1321-1336
    CrossRef

  41. 41

    Kate Bushby. (2000) Genetics and the muscular dystrophies. Developmental Medicine & Child Neurology 42:11, 780-784
    CrossRef

  42. 42

    Mayana Zatz, Mariz Vainzof, Maria Rita Passos-Bueno. (2000) Limb-girdle muscular dystrophy: one gene with different phenotypes, one phenotype with different genes. Current Opinion in Neurology 13:5, 511-517
    CrossRef

  43. 43

    Marina Fanin, Eric P. Hoffman, Corrado Angelini, Elena Pegoraro. (2000) Private ?- and ?-sarcoglycan gene mutations: Evidence of a founder effect in Northern Italy. Human Mutation 16:1, 13-17
    CrossRef

  44. 44

    A. Takano, C.G. Bnnemann, H. Honda, M. Sakai, C.A. Feener, L.M. Kunkel, G. Sobue. (2000) Intrafamilial phenotypic variation in limb-girdle muscular dystrophy type 2C with compound heterozygous mutations. Muscle & Nerve 23:5, 807-810
    CrossRef

  45. 45

    Jaap C. Reijneveld, Nicolette C. Notermans, Wim H.J.P. Linssen, John H.J. Wokke. (2000) Benign prognosis in idiopathic hyper-CK-emia. Muscle & Nerve 23:4, 575-579
    CrossRef

  46. 46

    K.J Nowak, P Walsh, R.L Jacob, R.D Johnsen, J Peverall, E.M McNally, S.D Wilton, B.A Kakulas, N.G Laing. (2000) Severe γ-sarcoglycanopathy caused by a novel missense mutation and a large deletion. Neuromuscular Disorders 10:2, 100-107
    CrossRef

  47. 47

    Andrew A. Hack, Margaret E. Groh, Elizabeth M. McNally. (2000) Sarcoglycans in muscular dystrophy. Microscopy Research and Technique 48:3-4, 167-180
    CrossRef

  48. 48

    Narihiro Minami, Ichizo Nishino, Osamu Kobayashi, Koji Ikezoe, Yu-ichi Goto, Ikuya Nonaka. (1999) Mutations of calpain 3 gene in patients with sporadic limb-girdle muscular dystrophy in Japan. Journal of the Neurological Sciences 171:1, 31-37
    CrossRef

  49. 49

    Bruce L. Patton, Anne M. Connolly, Paul T. Martin, Jeanette M. Cunningham, Shobhna Mehta, Alan Pestronk, Jeffrey H. Miner, Joshua R. Sanes. (1999) Distribution of ten laminin chains in dystrophic and regenerating muscles. Neuromuscular Disorders 9:6-7, 423-433
    CrossRef

  50. 50

    Elena Pegoraro, Marina Fanin, Corrado Angelini, Eric P. Hoffman. (1999) Prenatal diagnosis in a family affected with β-sarcoglycan muscular dystrophy. Neuromuscular Disorders 9:5, 323-325
    CrossRef

  51. 51

    Marina Fanin, Corrado Angelini. (1999) Regeneration in sarcoglycanopathies: expression studies of sarcoglycans and other muscle proteins. Journal of the Neurological Sciences 165:2, 170-177
    CrossRef

  52. 52

    P. Melacini, M. Fanin, D.J. Duggan, M.P. Freda, A. Berardinelli, G.A. Danieli, A. Barchitta, E.P. Hoffman, S. Dalla Volta, C. Angelini. (1999) Heart involvement in muscular dystrophies due to sarcoglycan gene mutations. Muscle & Nerve 22:4, 473-479
    CrossRef

  53. 53

    Mariz Vainzof, Maria Rita Passos-Bueno, Rita C.M. Pavanello, Suely K. Marie, Acary S.B. Oliveira, Mayana Zatz. (1999) Sarcoglycanopathies are responsible for 68% of severe autosomal recessive limb-girdle muscular dystrophy in the Brazilian population. Journal of the Neurological Sciences 164:1, 44-49
    CrossRef

  54. 54

    Eric P Hoffman. (1999) Counting muscular dystrophies in the post-molecular census. Journal of the Neurological Sciences 164:1, 3-6
    CrossRef

  55. 55

    Maria Rita Passos-Bueno, Mariz Vainzof, Eloisa S. Moreira, Mayana Zatz. (1999) Seven autosomal recessive limb-girdle muscular dystrophies in the Brazilian population: from LGMD2A to LGMD2G. American Journal of Medical Genetics 82:5, 392-398
    CrossRef

  56. 56

    K.M.D. Bushby. (1999) The limb-girdle muscular dystrophies: diagnostic guidelines. European Journal of Paediatric Neurology 3:2, 53-58
    CrossRef

  57. 57

    Laura R. Goldberg, Irena Hausmanowa-Petrusewicz, Anna Fidzianska, David J. Duggan, Lisa S. Steinberg, Eric P. Hoffman. (1998) A dystrophin missense mutation showing persistence of dystrophin and dystrophin-associated proteins yet a severe phenotype. Annals of Neurology 44:6, 971-976
    CrossRef

  58. 58

    Anne M. Connolly, Alan Pestronk, Shobhna Mehta, Muhammed Al-Lozi. (1998) Primary ?-sarcoglycan deficiency responsive to immunosuppression over three years. Muscle & Nerve 21:11, 1549-1553
    CrossRef

  59. 59

    Jeff P Gorski, Bjorn R Olsen. (1998) Mutations in extracellular matrix molecules. Current Opinion in Cell Biology 10:5, 586-593
    CrossRef

  60. 60

    M.F Phillips, M.T Rogers, R Barnetson, C Braun, H.G Harley, J Myring, D Stevens, C.M Wiles, P.S Harper. (1998) PROMM: the expanding phenotype. A family with proximal myopathy, myotonia and deafness. Neuromuscular Disorders 8:7, 439-446
    CrossRef

  61. 61

    Leland E. Lim, Kevin P. Campbell. (1998) The sarcoglycan complex in limb–girdle muscular dystrophy. Current Opinion in Neurology 11:5, 443-452
    CrossRef

  62. 62

    A.J van der Kooi, M de Visser, M van Meegen, H.B Ginjaar, A.J van Essen, F.G.I Jennekens, P.J.H Jongen, N.J Leschot, P.A Bolhuis. (1998) A novel γ-sarcoglycan mutation causing childhood onset, slowly progressive limb girdle muscular dystrophy. Neuromuscular Disorders 8:5, 305-308
    CrossRef

  63. 63

    Hideo Sugita. (1998) Molecular diagnosis of muscular dystrophies. Neuropathology 18:2, 123-130
    CrossRef

  64. 64

    Corrado Angelini, Marina Fanin, Elisabetta Menegazzo, Maria Pia Freda, David J. Duggan, Eric P. Hoffman. (1998) Homozygous ?-sarcoglycan mutation in two siblings: One asymptomatic and one steroid-responsive mild limb-girdle muscular dystrophy patient. Muscle & Nerve 21:6, 769-775
    CrossRef

  65. 65

    A.J. van der Kooi, H.B. Ginjaar, H.F.M. Busch, J.H.J. Wokke, P.G. Barth, M. de Visser. (1998) Limb girdle muscular dystrophy: A pathological and immunohistochemical reevaluation. Muscle & Nerve 21:5, 584-590
    CrossRef

  66. 66

    C.G Bönnemann, J Wong, Ch.Ben Hamida, M.Ben Hamida, F Hentati, L.M Kunkel. (1998) LGMD 2E in Tunisia is caused by a homozygous missense mutation in β-sarcoglycan exon 3. Neuromuscular Disorders 8:3-4, 193-197
    CrossRef

  67. 67

    ROBERT L. RUFF. (1998) Electrophysiology of Postsynaptic Activationa. Annals of the New York Academy of Sciences 841:1 MYASTHENIA GR, 57-70
    CrossRef

  68. 68

    Eijiro Ozawa, Satoru Noguchi, Yuji Mizuno, Yasuko Hagiwara, Mikiharu Yoshida. (1998) From dystrophinopathy to sarcoglycanopathy: Evolution of a concept of muscular dystrophy. Muscle & Nerve 21:4, 421-438
    CrossRef

  69. 69

    F Duclos, O Broux, N Bourg, V Straub, G.L Feldman, Y Sunada, L.E Lim, F Piccolo, S Cutshall, F Gary, F Quetier, J.-C Kaplan, C.E Jackson, J.S Beckmann, K.P Campbell. (1998) β-Sarcoglycan: genomic analysis and identification of a novel missense mutation in the LGMD2E Amish isolate. Neuromuscular Disorders 8:1, 30-38
    CrossRef

  70. 70

    Jeffrey A Towbin. (1998) The role of cytoskeletal proteins in cardiomyopathies. Current Opinion in Cell Biology 10:1, 131-139
    CrossRef

  71. 71

    Itsuro Higuchi, Hiroyuki Iwaki, Hisaomi Kawai, Takenori Endo, Makoto Kunishige, Hidetoshi Fukunaga, Masanori Nakagawa, Kimiyoshi Arimura, Mitsuhiro Osame. (1997) New missense mutation in the alpha-sarcoglycan gene in a Japanese patient with severe childhood autosomal recessive muscular dystrophy with incomplete alpha-sarcoglycan deficiency. Journal of the Neurological Sciences 153:1, 100-105
    CrossRef

  72. 72

    Ling Liu, Pierre H. Vachon, Wen Kuang, Hong Xu, Ulla M. Wewer, Per Kylsten, Eva Engvall. (1997) Mouse Adhalin: Primary Structure and Expression during Late Stages of Muscle Differentiationin Vitro. Biochemical and Biophysical Research Communications 235:1, 227-235
    CrossRef

  73. 73

    Dubowitz, Victor, . (1997) The Muscular Dystrophies — Clarity or Chaos?. New England Journal of Medicine 336:9, 650-651
    Full Text