Original Article
The Risk of Recurrent Venous Thromboembolism in Patients with an Arg506→Gln Mutation in the Gene for Factor V (Factor V Leiden)
N Engl J Med 1997; 336:399-403February 6, 1997
- Abstract
Background
A recently discovered mutation in coagulation factor V (Arg506→Gln, referred to as factor V Leiden), which results in resistance to activated protein C, is found in approximately one fifth of patients with venous thromboembolism. However, the risk of recurrent thromboembolism in heterozygous carriers of this genetic abnormality is unknown.
Methods
We searched for factor V Leiden in 251 unselected patients with a first episode of symptomatic deep-vein thrombosis diagnosed by venography. The patients were followed prospectively for a mean of 3.9 years to determine the frequency of recurrent venous thrombosis and pulmonary embolism.
Results
Factor V Leiden was found in 41 of the patients (16.3 percent; 95 percent confidence interval, 11.8 to 20.9 percent). The cumulative incidence of recurrent venous thromboembolism after follow-up of up to eight years was 39.7 percent (95 percent confidence interval, 22.8 to 56.5 percent) among carriers of the mutation, as compared with 18.3 percent (95 percent confidence interval, 12.3 to 24.3 percent) among patients without the mutation (hazard ratio, 2.4; 95 percent confidence interval, 1.3 to 4.5; P<0.01).
Conclusions
The risk of recurrent thromboembolic events is significantly higher in carriers of factor V Leiden than in patients without this abnormality. Large trials assessing the risk–benefit ratio of long-term anticoagulation in carriers of the mutation who have had a first episode of venous thromboembolism are indicated.
Media in This Article
Figure 1
Cumulative Incidence of Recurrent Venous Thromboembolism after a First Episode of Symptomatic Deep-Vein Thrombosis in Patients with and Those without Factor V Leiden.Table 1
Demographic, Clinical, and Treatment-Related Characteristics of Patients with and Those without Factor V Leiden.Article Activity
- Article
Patients who have symptomatic deep-vein thrombosis of the legs remain at risk for recurrent venous thromboembolism despite adequate treatment with heparin and warfarin.1 In a recent long-term follow-up study of a consecutive series of patients with a first episode of symptomatic deep-vein thrombosis, the cumulative incidence of recurrent venous thrombosis or pulmonary embolism exceeded 30 percent over a period of eight years.2
Venous thromboembolism can occur without apparent cause, after surgical procedures or trauma, and in the presence of cancer or molecular defects in several hemostatic components (antithrombin, protein C, protein S, plasminogen, and fibrinogen). The prevalence of these protein abnormalities among patients with venous thromboembolism, however, is only 5 to 10 percent.3,4
Recently, resistance to activated protein C, a newly discovered hereditary trait potentially accounting for a far greater proportion of patients with thromboembolic disorders, has been described.5,6 This abnormality is caused by the substitution of a single amino acid — glutamine for arginine — at position 506 (Arg506→Gln, also referred to as factor V Leiden), in the coagulation factor V molecule.7-9 In its activated form protein C is a natural anticoagulant that cleaves two activated coagulant factors, factor VIIIa and factor Va, thereby inhibiting the conversion of factor X to factor Xa and of prothrombin to thrombin. The mutation in the factor V molecule renders factor Va resistant to proteolysis by activated protein C. Venous thromboembolism develops in up to 40 percent of patients with resistance to activated protein C.10-12
Although it is important to know the risk of recurrent venous thromboembolic disease in order to make decisions about therapy in carriers of the factor V Leiden mutation, the few studies of the risk have yielded conflicting results.13,14 Therefore, we studied the prevalence of this mutation in a large cohort of unselected patients with a first episode of symptomatic deep-vein thrombosis who underwent long-term, prospective follow-up for recurrent thromboembolic events.
Methods
Identification of Study Cohort
All outpatients who were referred to the thrombosis unit of the University of Padua between January 1986 and June 1994 because of a first episode of deep-vein thrombosis diagnosed by venography and who underwent long-term follow-up were potentially eligible for the study.2 Patients were excluded from the study if they had malignant disease or confirmed abnormalities in the coagulation or fibrinolytic system (defects of antithrombin, protein C, protein S, fibrinogen, or plasminogen or the presence of lupus-like anticoagulants), or if they had received warfarin therapy for more than six months for reasons other than recurrent thromboembolic events. For all remaining patients, resistance to activated protein C was assessed.
Surviving patients who met the eligibility criteria and who provided informed consent were asked to come to the thrombosis center for assessment of factor V Leiden status. For all patients in whom the mutation was confirmed, family members were tested to determine whether the defect was familial. Laboratory tests were performed by technicians unaware of the identity of the subjects. The study protocol was approved by the ethics board of the University of Padua.
Collection of Blood Samples and Routine Coagulation Tests
Blood samples were collected by venipuncture with 21-gauge butterfly infusion sets connected to plastic tubes containing 3.8 percent sodium citrate in a ratio of 0.1:0.9 (vol/vol, anticoagulant to blood). Platelet-poor plasma was obtained by centrifugation at 2000×g for 20 minutes and stored at -80°C until it was analyzed.
The laboratory investigations included the measurement of the activated partial-thromboplastin time and prothrombin time. Assays for fibrinogen, plasminogen, antithrombin, protein C, protein S, and antiphospholipid antibodies were performed as previously described.15,16 A reference pool of normal plasma for all these assays was obtained from 40 healthy subjects of both sexes (age, 20 to 60 years). Normal values for each test were determined in 80 healthy subjects of both sexes (age, 20 to 70 years).
Assay for Resistance to Activated Protein C
The assay for resistance to activated protein C was performed as described previously.7 Briefly, 50 μl of undiluted plasma was incubated with 50 μl of NAPPT reagent (Cephotest, Immuno, Pisa, Italy) for 360 seconds at 37°C. Clot formation was started by the addition of either 50 μl of 33 mM calcium chloride, 25 mM TRIS–hydrochloric acid (pH 7.5), 50 mM sodium chloride, and 0.05 percent ovalbumin (to measure the activated partial-thromboplastin time in the absence of activated protein C) or 50 μl of the same reagent containing 1.0 μl of human activated protein C per milliliter (final concentration; Enzyme Research Laboratory, South Bend, Ind.) (to measure the activated partial-thromboplastin time in the presence of activated protein C). A normalized ratio of sensitivity to activated protein C was then calculated. Resistance to activated protein C was defined as a normalized ratio of less than 0.84.7
DNA Analysis for Factor V Leiden
High-molecular-weight DNA was extracted from 5 μl of peripheral blood with a binding matrix (Bio-Rad Laboratories, Hercules, Calif.). DNA analysis was performed as previously described with minor modifications.7-9 Briefly, the 220-bp fragment of factor V exon 10–intron 10 was amplified by the polymerase chain reaction, with 5'TGCCCAGTGCTTAACAAGACCA3' as the forward primer and 5'CTTGAAGGAAATGCCCCATTA3' as the reverse primer. Amplification involved 36 cycles consisting of denaturation at 91°C for 40 seconds, annealing at 55°C for 40 seconds, and extension at 71°C for 2 minutes in the presence of 2 U of Taq polymerase. Subsequently, the 220-bp fragment was digested by 0.4 U of MnlI at 37°C over a 16-hour period. MnlI digests the 220-bp fragment of the normal factor V allele into three fragments of 37, 67, and 116 bp each. The factor V Leiden allele was cleaved in only two fragments of 67 and 153 bp. Finally, the digestion products were separated by electrophoresis on 2 percent agarose gels stained with ethidium bromide for 30 minutes at 150 V.
Treatment
Patients were admitted to the hospital and treated with an initial course of high-dose intravenous standard heparin (a bolus of 5000 U was followed by a continuous infusion of 30,000 U per day, with the dose subsequently adjusted to maintain an activated partial-thromboplastin time between 1.5 and 2.5 times the normal value) or subcutaneous low-molecular-weight heparin (90 U of antifactor Xa per kilogram of body weight twice daily). Therapy with oral anticoagulant agents (warfarin) was started on day 5, 6, or 7 of treatment and continued for a period of three or six months; the dose was adjusted daily to maintain an international normalized ratio between 2.0 and 3.0. Treatment with low-molecular-weight heparin was discontinued on day 10 or later if the international normalized ratio was less than 2.0. All patients were instructed to wear elastic graduated-compression stockings (providing 40 mm Hg of pressure at the ankle) for at least two years.
Diagnosis of Recurrent Venous Thromboembolism
Recurrent deep-vein thrombosis was identified by venography or compression ultrasonography, according to standard methods. If the results of venography were not diagnostic, recurrent venous thrombosis was diagnosed on the basis of abnormal results on scanning of the legs with fibrinogen I 125 or on the basis of a change in the results of noninvasive tests from normal to abnormal.17-20 Patients thought to have pulmonary embolism underwent lung scanning or venography if they had concurrent symptoms of thromboembolism in the legs. Patients with lung scans indicating a low or intermediate probability of pulmonary embolism underwent pulmonary angiography. Lung scanning and pulmonary angiography were performed and interpreted according to standard procedures.21,22 A diagnosis of fatal pulmonary embolism was based on the findings at autopsy or the opinion of a physician who was not associated with the study. Recurrent venous thromboembolic events were assessed by a committee that was unaware of further clinical details (including factor V Leiden status) of the patients.
Statistical Analysis
The cumulative incidence of recurrent thromboembolic events among patients with and those without factor V Leiden was calculated according to the method of Kaplan and Meier. The Cox proportional-hazards model was used to assess the significance of the difference between groups and to determine the hazard ratios and 95 percent confidence intervals. All P values of less than 0.05 were considered to indicate statistical significance.
Results
Patients
Of the 517 patients who were referred for a first episode of deep-vein thrombosis, 170 were excluded from the study for the following reasons: 101 had malignant disease at the time of the initial diagnosis, 51 had documented abnormalities in the coagulation or fibrinolytic system, and 18 had been taking oral anticoagulants for more than six months for reasons other than venous thromboembolism. Of the remaining 347 patients, 85 were not available for genetic testing. Resistance to activated protein C was found in 13 of these 85 patients (15.3 percent). Of the remaining 262 patients, 251 gave their informed consent and were enrolled in the study.
Demographic and Clinical Characteristics
The demographic and clinical characteristics of the study patients are presented in Table 1Table 1
Demographic, Clinical, and Treatment-Related Characteristics of Patients with and Those without Factor V Leiden., according to their factor V Leiden status. Additional risk factors that may contribute to the development of deep-vein thrombosis (recent trauma or fracture, recent surgery, the use of oral contraceptive drugs, and pregnancy or childbirth) were equally distributed between the groups.A total of 112 patients (44.6 percent) completed five years of follow-up, and 45 (17.9 percent) completed eight years of follow-up. The mean duration of follow-up was 3.9 years.
Prevalence of Factor V Leiden
Factor V Leiden was found in 41 patients (16.3 percent; 95 percent confidence interval, 11.8 to 20.9 percent). The prevalence of this abnormality in patients with idiopathic deep-vein thrombosis (28 of 145, 19.3 percent) did not differ from that in patients whose thrombotic episode was associated with a well-recognized risk factor (13 of 106, 12.3 percent). All carriers of the factor V gene were heterozygous for the mutation. The hereditary nature of the defect was confirmed in all 41 patients by the identification of at least one first-degree relative who carried the mutation.
Recurrent Venous Thromboembolism in Patients with and Those without Factor V Leiden
Of the 251 patients, 49 had had one or more documented recurrent venous thromboembolic events. Fourteen patients with factor V Leiden (10 of the 28 patients with idiopathic deep-vein thrombosis [35.7 percent] and 4 of the 13 patients with risk factors for deep-vein thrombosis [30.7 percent]) had recurrent thromboembolic events. Thirty-five patients without the mutation had recurrences (29 of the 128 patients with idiopathic deep-vein thrombosis [22.7 percent] and 6 of the 82 patients with secondary deep-vein thrombosis [7.3 percent]). Of the 49 first recurrences, 25 (51.0 percent) were in the leg that was involved in the initial episode, 17 (34.7 percent) were in the contralateral leg, and 7 (14.3 percent) were pulmonary embolisms. Forty-four of the recurrences were not associated with any apparent risk factor, and 5 were associated with a (new) risk factor; 2 of these 5 recurrences were in carriers of factor V Leiden.
The cumulative incidence of recurrent thromboembolism among patients with factor V Leiden after eight years of follow-up was 39.7 percent (95 percent confidence interval, 22.8 to 56.5 percent), as compared with 18.3 percent (95 percent confidence interval, 12.3 to 24.3 percent) among patients without this mutation (Figure 1Figure 1
Cumulative Incidence of Recurrent Venous Thromboembolism after a First Episode of Symptomatic Deep-Vein Thrombosis in Patients with and Those without Factor V Leiden.). The hazard ratio for recurrent venous thromboembolism among patients with the mutation, as compared with patients without the defect, was 2.4 (95 percent confidence interval, 1.3 to 4.5; P<0.01). The hazard ratio for patients with secondary deep-vein thrombosis, as compared with those with idiopathic deep-vein thrombosis, was 0.41 (95 percent confidence interval, 0.20 to 0.82). A test for an interaction between factor V Leiden status and the type of deep-vein thrombosis was negative (P>0.15).Seventeen of the 85 patients who were not available for genetic testing had recurrent thromboembolic events: 5 of the 13 patients with resistance to activated protein C and 12 of the 72 patients without this abnormality (relative risk of a recurrence among patients with resistance to activated protein C, 2.4).
Six of the patients without the mutation had recurrent thromboembolic episodes while receiving anticoagulant therapy (2.9 percent), all within the first three months, and four of the patients with the mutation had recurrences (9.8 percent), three within the first three months.
Discussion
Hereditary abnormalities in the coagulation or fibrinolytic system are well-recognized but uncommon conditions predisposing patients to venous thrombosis. Recently, it was demonstrated that a large proportion of patients with venous thromboembolic disease have factor V Leiden.10-12 The activated form of factor V Leiden is resistant to proteolytic cleavage by the natural anticoagulant activated protein C. The results of our study in a large cohort of consecutive patients with venous thrombosis confirm that the prevalence of the genetic mutation responsible for resistance to activated protein C is higher (16.3 percent) than that of all the previously described inherited defects (5 to 10 percent). Furthermore, it is equally distributed in patients with idiopathic or secondary thrombosis.
Once factor V Leiden has been demonstrated to be associated with venous thromboembolism, it is important to know the risk of recurrent thrombotic events in carriers of this mutation to aid in decisions about widespread screening and therapeutic management in identified carriers. Studies in small and selected groups of patients have yielded conflicting results.13,14 Ridker et al. found a higher incidence of recurrent thrombosis in carriers of the mutation,13 whereas Rintelen et al. did not.14
Our study clearly shows that the risk of recurrent thromboembolic events is strongly and significantly higher in carriers of factor V Leiden than in patients without this abnormality (relative risk, 2.4), with a cumulative incidence of almost 40 percent after eight years. These results are similar to those in patients with hereditary defects of antithrombin, protein C, and protein S.2 Although in our study all the recurrent thrombotic events in patients with factor V Leiden occurred during the first three years of follow-up, this finding could be due to the small number of patients who were followed for more than three years.
We believe that our estimate of the risk of recurrence associated with the presence of factor V Leiden is accurate. Only patients referred with a first episode of objectively documented deep-vein thrombosis who did not have conditions confounding the risk of recurrence (i.e., cancer, known thrombophilic states, and other conditions requiring long-term treatment with oral anticoagulants) were enrolled. Also, although 15 percent of potentially eligible patients died during follow-up and could not be tested for the mutation, only a small minority (about 10 percent) of these patients died of pulmonary embolism.2 Furthermore, patients who declined to participate constituted a negligible proportion (4.2 percent) of the cohort. Finally, interpretation bias was avoided by having observers with no knowledge of the patients assess recurrent events and the factor V Leiden status. The relative risk of recurrent venous thromboembolic episodes associated with resistance to activated protein C in the 85 patients in whom a genetic analysis could not be performed was 2.4. This value is similar to the hazard ratio for the patients who underwent genetic testing. Therefore, it is unlikely that an important bias influenced our results.
Although recurrent venous thromboembolism is more frequent in patients with factor V Leiden, such a statistic does not automatically imply that anticoagulant treatment should be prolonged in all these patients. Because the duration of treatment is also a major determinant of the risk of hemorrhage, it is essential to balance the protective effect of these agents against their risk of inducing bleeding. A large trial evaluating the use of coumarins for more than the currently recommended three-month period in carriers of this genetic mutation is clearly warranted. This trial should include both patients with idiopathic thrombosis and those with secondary thrombosis.
We are indebted to Paolo Radossi, M.D., Daniela Tormene, M.D., and Sabrina Gavasso, M.D., for collecting blood samples and providing technical assistance in laboratory analyses.
Source Information
From the Institute of Medical Semiotics, University Hospital of Padua, Padua, Italy (P.S., P.P., A.S., C.S., S.V., F.D., A.G.); and the Center for Hemostasis, Thrombosis, Atherosclerosis, and Inflammation Research (A.W.A.L.) and the Department of Clinical Epidemiology (M.H.P.), Academic Medical Center, University of Amsterdam, Amsterdam.
Address reprint requests to Dr. Lensing at the Center for Hemostasis, Thrombosis, Atherosclerosis, and Inflammation Research, Academic Medical Center F4-237, Meibergdreef 9, 1105 AZ Amsterdam, the Netherlands.
- References
References
1
Schulman S ,Rhedin A-S ,Lindmarker P , et al. A comparison of six weeks with six months of oral anticoagulant therapy after a first episode of venous thromboembolism. N Engl J Med 1995;332:1661-1665
Full Text | Web of Science | Medline2
Prandoni P ,Lensing AWA ,Cogo A , et al. The long-term clinical course of acute deep venous thrombosis. Ann Intern Med 1996;125:1-7
Web of Science | Medline3
Heijboer H ,Brandjes DPM ,Buller HR ,Sturk A ,ten Cate JW . Deficiencies of coagulation-inhibiting and fibrinolytic proteins in outpatients with deep-vein thrombosis. N Engl J Med 1990;323:1512-1516
Full Text | Web of Science | Medline4
Pabinger I ,Brucker S ,Kyrle PA , et al. Hereditary deficiency of antithrombin III, protein C and protein S: prevalence in patients with a history of venous thrombosis and criteria for rational patient screening. Blood Coagul Fibrinolysis 1992;3:547-553
CrossRef | Web of Science | Medline5
Dahlback B ,Carlsson M ,Svensson PJ . Familial thrombophilia due to a previously unrecognized mechanism characterized by poor anticoagulant response to activated protein C: prediction of a cofactor to activated protein C. Proc Natl Acad Sci U S A 1993;90:1004-1008
CrossRef | Web of Science | Medline6
Griffin JH ,Evatt B ,Wideman C ,Fernandez JA . Anticoagulant protein C pathway defective in majority of thrombophilic patients. Blood 1993;82:1989-1993
Web of Science | Medline7
Bertina RM ,Koeleman BPC ,Koster T , et al. Mutation in blood coagulation factor V associated with resistance to activated protein C. Nature 1994;369:64-67
CrossRef | Web of Science | Medline8
Voorberg J ,Roelse J ,Koopman R , et al. Association of idiopathic venous thromboembolism with single point-mutation at Arg506 of factor V. Lancet 1994;343:1535-1536
CrossRef | Web of Science | Medline9
Zoller B ,Dahlback B . Linkage between inherited resistance to activated protein C and factor V gene mutation in venous thrombosis. Lancet 1994;343:1536-1538
CrossRef | Web of Science | Medline10
Koster T ,Rosendaal FR ,de Ronde H ,Briet E ,Vandenbroucke JP ,Bertina RM . Venous thrombosis due to poor anticoagulant response to activated protein C: Leiden Thrombophilia Study. Lancet 1993;342:1503-1506
CrossRef | Web of Science | Medline11
Svensson PJ ,Dahlback B . Resistance to activated protein C as a basis for venous thrombosis. N Engl J Med 1994;330:517-522
Full Text | Web of Science | Medline12
Ridker PM ,Hennekens CH ,Lindpaintner K ,Stampfer MJ ,Eisenberg PR ,Miletich JP . Mutation in the gene coding for coagulation factor V and the risk of myocardial infarction, stroke, and venous thrombosis in apparently healthy men. N Engl J Med 1995;332:912-917
Full Text | Web of Science | Medline13
Ridker PM ,Miletich JP ,Stampfer MJ ,Goldhaber SZ ,Lindpaintner K ,Hennekens CH . Factor V Leiden and risks of recurrent idiopathic venous thromboembolism. Circulation 1995;92:2800-2802
Web of Science | Medline14
Rintelen C ,Pabinger I ,Knobl P ,Lechner K ,Mannhalter C . Probability of recurrence of thrombosis in patients with and without factor V Leiden. Thromb Haemost 1996;75:229-232
Web of Science | Medline15
Girolami A ,Simioni P ,Girolami B , et al. A novel dysfunctional protein C (protein C Padua 2) associated with a thrombotic tendency: substitution of Cys for Arg-1 results in a strongly reduced affinity for binding of Ca++. Br J Haematol 1993;85:521-527
CrossRef | Web of Science | Medline16
Triplett DA . Antiphospholipid-protein antibodies: laboratory detection and clinical relevance. Thromb Res 1995;78:1-31
CrossRef | Web of Science | Medline17
Lensing AWA, Hirsh J, Büller HR. Diagnosis of venous thrombosis. In: Colman RW, Hirsh J, Marder VJ, Salzman EW, eds. Hemostasis and thrombosis: basic principles and clinical practice. Philadelphia: J.B. Lippincott, 1993:1297-321.
18
Prandoni P ,Cogo A ,Bernardi E , et al. A simple ultrasound approach for detection of recurrent proximal-vein thrombosis. Circulation 1993;88:1730-1735
Web of Science | Medline19
Hull RD ,Carter CJ ,Jay RM , et al. The diagnosis of acute, recurrent, deep-vein thrombosis: a diagnostic challenge. Circulation 1983;67:901-906
CrossRef | Web of Science | Medline20
Huisman MV ,Buller HR ,ten Cate JW . Utility of impedance plethysmography in the diagnosis of recurrent deep-vein thrombosis. Arch Intern Med 1988;148:681-683
CrossRef | Web of Science | Medline21
Hirsh J, Bettman M, Coates G, Hull RD. Diagnosis of pulmonary embolism. In: Colman RW, Hirsh J, Marder VJ, Salzman EW, eds. Hemostasis and thrombosis: basic principles and clinical practice. Philadelphia: J.B. Lippincott, 1993:1322-30.
22
Lensing AWA ,van Beek EJR ,Demers C , et al. Ventilation-perfusion lung scanning and the diagnosis of pulmonary embolism: improvement of observer agreement by the use of a lung segment reference chart. Thromb Haemost 1992;68:245-249
Web of Science | Medline
- Citing Articles (112)
Citing Articles
1
F. Couturaud. (2011) Durée optimale du traitement anticoagulant au décours d’une embolie pulmonaire. Revue des Maladies Respiratoires
CrossRef2
Ali A. Dashti, Mehrez M. Jadaon. (2011) Race differences in the prevalence of the factor V Leiden mutation in Kuwaiti nationals. Molecular Biology Reports 38:6, 3623-3628
CrossRef3
Valeria Bafunno, Maurizio Margaglione. (2010) Genetic basis of thrombosis. Clinical Chemistry and Laboratory Medicine 48:S1, S41-S51
CrossRef4
N. Şule Yaşar, Füsun Salgür, Döndü Ü. Cansu, Timuçin Kaşifoğlu, Cengiz Korkmaz. (2010) Combined thrombophilic factors increase the risk of recurrent thrombotic events in Behcet’s disease. Clinical Rheumatology 29:12, 1367-1372
CrossRef5
Paul Alexander Kyrle, Frits R Rosendaal, Sabine Eichinger. (2010) Risk assessment for recurrent venous thrombosis. The Lancet 376:9757, 2032-2039
CrossRef6
Mehrez M. Jadaon, Ali A. Dashti, Hend L. Lewis. (2010) High Prevalence of Activated Protein C Resistance and Factor V Leiden Mutation in an Arab Population and Patients With Venous Thrombosis in Kuwait. Diagnostic Molecular Pathology 19:3, 180-183
CrossRef7
Susanna Moskau, Kerstin Smolka, Alexander Semmler, Dirk Schweichel, Ursula Harbrecht, Jens Müller, Christoph Pohl, Thomas Klockgether, Michael Linnebank. (2010) Common genetic coagulation variants are not associated with ischemic stroke in a case-control study. Neurological Research 32:5, 519-522
CrossRef8
Ali A Dashti, Mehrez M Jadaon, Hend L Lewis. (2010) Factor V Leiden mutation in Arabs in Kuwait by real-time PCR: different values for different Arabs. Journal of Human Genetics 55:4, 232-235
CrossRef9
Simioni, Paolo, Tormene, Daniela, Tognin, Giulio, Gavasso, Sabrina, Bulato, Cristiana, Iacobelli, Nicholas P., Finn, Jonathan D., Spiezia, Luca, Radu, Claudia, Arruda, Valder R., . (2009) X-Linked Thrombophilia with a Mutant Factor IX (Factor IX Padua). New England Journal of Medicine 361:17, 1671-1675
Full Text10
Sarah H. O'Brien, Kenneth J. Smith. (2009) Using Thrombophilia Testing to Determine Anticoagulation Duration in Pediatric Thrombosis is not Cost-Effective. The Journal of Pediatrics 155:1, 100-104
CrossRef11
Suresh Vedantham, Clement J. Grassi, Hector Ferral, Nilesh H. Patel, Patricia E. Thorpe, Vittorio P. Antonacci, Bertrand M. Janne d'Othée, Lawrence V. Hofmann, John F. Cardella, Sanjoy Kundu. (2009) Reporting Standards for Endovascular Treatment of Lower Extremity Deep Vein Thrombosis. Journal of Vascular and Interventional Radiology 20:7, S391-S408
CrossRef12
Richard H. White, Robert C. Gosselin. (2009) Testing for Thrombophilia: Pitfalls, Limitations, and Marginal Impact on Treatment Duration Recommendations. Mount Sinai Journal of Medicine: A Journal of Translational and Personalized Medicine 76:3, 303-313
CrossRef13
Karen Kuehl, Christopher Loffredo, Edward J. Lammer, David M. Iovannisci, Gary M. Shaw. (2009) Association of congenital cardiovascular malformations with 33 single nucleotide polymorphisms of selected cardiovascular disease-related genes. Birth Defects Research Part A: Clinical and Molecular TeratologyNA-NA
CrossRef14
Christina M. Scifres, George A. Macones. (2008) The utility of thrombophilia testing in pregnant women with thrombosis: fact or fiction?. American Journal of Obstetrics and Gynecology 199:4, 344.e1-344.e7
CrossRef15
Mirjana Kovac, Danijela Mikovic, Nebojsa Antonijevic, Ljiljana Rakicevic, Valentina Djordjevic, Dragica Radojkovic, Ivo Elezovic. (2008) FV Leiden mutation and risk of recurrent venous thromboembolism in Serbian population. Journal of Thrombosis and Thrombolysis 25:3, 284-287
CrossRef16
Petar Ivanov, Regina Komsa-Penkova, Katia Kovacheva, Yavor Ivanov, Angelina Stoyanova, Ivan Ivanov, Plamen Pavlov, Pavlina Glogovska, Venzislav Nojarov. (2008) Impact of Thrombophilic Genetic Factors on Pulmonary Embolism: Early Onset and Recurrent Incidences. Lung 186:1, 27-36
CrossRef17
Giancarlo Agnelli, Cecilia Becattini. (2008) Treatment of DVT: how long is enough and how do you predict recurrence. Journal of Thrombosis and Thrombolysis 25:1, 37-44
CrossRef18
Anjali A. Sharathkumar, James C. Stanley. (2008) Management of a child with renal artery stenosis and homozygous factor V Leiden mutation. Journal of Pediatric Surgery 43:1, e17-e19
CrossRef19
N. A. Goldenberg. (2008) Thrombophilia States and Markers of Coagulation Activation in the Prediction of Pediatric Venous Thromboembolic Outcomes: A Comparative Analysis with Respect to Adult Evidence. Hematology 2008:1, 236-244
CrossRef20
Mark H. Meissner, Thomas W. Wakefield, Enrico Ascher, Joseph A. Caprini, Anthony J. Comerota, Bo Eklof, David L. Gillespie, Lazar J. Greenfield, Aiwu Ruth He, Peter K. Henke, Anil Hingorani, Russell D. Hull, Craig M. Kessler, Robert D. McBane, Robert McLafferty. (2007) Acute venous disease: Venous thrombosis and venous trauma. Journal of Vascular Surgery 46:6, S25-S53
CrossRef21
Elizabeth Varga. (2007) Inherited Thrombophilia: Key Points for Genetic Counseling. Journal of Genetic Counseling 16:3, 261-277
CrossRef22
Mary Cushman. (2007) Epidemiology and Risk Factors for Venous Thrombosis. Seminars in Hematology 44:2, 62-69
CrossRef23
S. Patiar, C. C. Kirwan, G. McDowell, N. J. Bundred, C. N. McCollum, G. J. Byrne. (2007) Prevention of venous thromboembolism in surgical patients with breast cancer. British Journal of Surgery 94:4, 412-420
CrossRef24
SM Naushad, Md Nurul Jain Jamal, R Angalena, C Krishna Prasad, A Radha Rama Devi. (2007) Hyperhomocysteinemia and the compound heterozygous state for methylene tetrahydrofolate reductase are independent risk factors for deep vein thrombosis among South Indians. Blood Coagulation & Fibrinolysis 18:2, 113-117
CrossRef25
Samuel Z. Goldhaber. 2007. Deep Vein Thrombosis and Pulmonary Embolism. , 245-256.
CrossRef26
N.A. Limdi, T.M. Beasley, D.B. Allison, C.A. Rivers, R.T. Acton. (2006) Racial differences in the prevalence of Factor V Leiden mutation among patients on chronic warfarin therapy. Blood Cells, Molecules, and Diseases 37:2, 100-106
CrossRef27
Suresh Vedantham, Clement J. Grassi, Hector Ferral, Nilesh H. Patel, Patricia E. Thorpe, Vittorio P. Antonacci, Bertrand M. Janne d'Othée, Lawrence V. Hofmann, John F. Cardella, Sanjoy Kundu. (2006) Reporting Standards for Endovascular Treatment of Lower Extremity Deep Vein Thrombosis. Journal of Vascular and Interventional Radiology 17:3, 417-434
CrossRef28
José Ramón González-Porras, Ramón García-Sanz, Ignacio Alberca, María Luz López, Ana Balanzategui, Oliver Gutierrez, Francisco Lozano, Jesús San Miguel. (2006) Risk of recurrent venous thrombosis in patients with G20210A mutation in the prothrombin gene or factor V Leiden mutation. Blood Coagulation & Fibrinolysis 17:1, 23-28
CrossRef29
Massimo Franchini, Dino Veneri, Gian Luca Salvagno, Franco Manzato, Giuseppe Lippi. (2006) Inherited Thrombophilia. Critical Reviews in Clinical Laboratory Sciences 43:3, 249-290
CrossRef30
A. Mansilha, F. Araújo, M. Severo, S.M. Sampaio, T. Toledo, R. Albuquerque. (2005) Genetic Polymorphisms and Risk of Recurrent Deep Venous Thrombosis in Young People: Prospective Cohort Study. European Journal of Vascular and Endovascular Surgery 30:5, 545-549
CrossRef31
Maria Gabriella Santamaria, Giancarlo Agnelli, Maria Rita Taliani, Paolo Prandoni, Marco Moia, Mario Bazzan, Giuliana Guazzaloca, Walter Ageno, Adriano Bertoldi, Mauro Silingardi, Cristina Tomasi, Giovan Battista Ambrosio. (2005) Thrombophilic abnormalities and recurrence of venous thromboembolism in patients treated with standardized anticoagulant treatment. Thrombosis Research 116:4, 301-306
CrossRef32
Armando Tripodi. (2005) Issues Concerning the Laboratory Investigation of Inherited Thrombophilia. Molecular Diagnosis 9:4, 181-186
CrossRef33
A. Gonthier, J. Bogousslavsky. (2004) Infarctus cérébraux artériels d’origine hématologique : expérience lausannoise et revue de la littérature. Revue Neurologique 160:11, 1029-1039
CrossRef34
S. Middeldorp. (2004) Trombofilie: risicofactoren voor veneuze trombo-embolie. Bijblijven 20:10, 398-405
CrossRef35
Hassan A Shehata, Henry Okosun. (2004) Neurological disorders in pregnancy. Current Opinion in Obstetrics and Gynecology 16:2, 117-122
CrossRef36
Samuel Z Goldhaber. (2004) Pulmonary embolism. The Lancet 363:9417, 1295-1305
CrossRef37
(2004) Erratum. Current Opinion in Hematology 11:2, 112
CrossRef38
R. Vink, R. A. Kraaijenhagen, M. Levi, H. R. Buller. (2003) Individualized duration of oral anticoagulant therapy for deep vein thrombosis based on a decision model. Journal of Thrombosis and Haemostasis 1:12, 2523-2530
CrossRef39
Yunden Droma, Masayuki Hanaoka, Junichi Hotta, Yoshihiko Katsuyama, Masao Ota, Toshio Kobayashi, Keishi Kubo. (2003) The R 506 Q Mutation of Coagulation Factor V Gene in High Altitude Pulmonary-Edema-Susceptible Subjects. High Altitude Medicine & Biology 4:4, 497-498
CrossRef40
N. Mc Loone, B. Lee, J. Anderson, K. McKenna. (2003) Homozygous factor V Leiden mutation in a patient with traumatic leg ulceration. Clinical and Experimental Dermatology 28:6, 608-609
CrossRef41
Michael A. Sloan, Barney J. Stern. (2003) Cerebrovascular disease in pregnancy. Current Treatment Options in Neurology 5:5, 391-407
CrossRef42
(2003) Is recurrent venous thromboembolism more frequent in homozygous patients for the factor V Leiden mutation than in heterozygous patients?. Blood Coagulation & Fibrinolysis 14:6, 523-529
CrossRef43
K. A. Bauer. (2003) Management of thrombophilia. Journal of Thrombosis and Haemostasis 1:7, 1429-1434
CrossRef44
Prandoni, Paolo, Bilora, Franca, Marchiori, Antonio, Bernardi, Enrico, Petrobelli, Francesco, Lensing, Anthonie W.A., Prins, Martin H., Girolami, Antonio, . (2003) An Association between Atherosclerosis and Venous Thrombosis. New England Journal of Medicine 348:15, 1435-1441
Full Text45
Ridker, Paul M, Goldhaber, Samuel Z., Danielson, Ellie, Rosenberg, Yves, Eby, Charles S., Deitcher, Steven R., Cushman, Mary, Moll, Stephan, Kessler, Craig M., Elliott, C. Gregory, Paulson, Rolf, Wong, Turnly, Bauer, Kenneth A., Schwartz, Bruce A., Miletich, Joseph P., Bounameaux, Henri, Glynn, Robert J., . (2003) Long-Term, Low-Intensity Warfarin Therapy for the Prevention of Recurrent Venous Thromboembolism. New England Journal of Medicine 348:15, 1425-1434
Full Text46
Georg Endler, Christine Mannhalter. (2003) Polymorphisms in coagulation factor genes and their impact on arterial and venous thrombosis. Clinica Chimica Acta 330:1-2, 31-55
CrossRef47
Stephanie L Perry, Thomas L Ortel. (2003) Clinical and laboratory evaluation of thrombophilia. Clinics in Chest Medicine 24:1, 153-170
CrossRef48
Clive Kearon. (2003) Duration of therapy for acute venous thromboembolism. Clinics in Chest Medicine 24:1, 63-72
CrossRef49
I. Martinelli. (2003) Pros and cons of thrombophilia testing: pros. Journal of Thrombosis and Haemostasis 1:3, 410-411
CrossRef50
Cecilia Becattini, Giancarlo Agnelli. (2003) Duration of Anticoagulant Treatment after VenousThromboembolism. Pathophysiology of Haemostasis and Thrombosis 33:5-6, 354-357
CrossRef51
P. Simioni. (2003) Risk of recurrent venous thromboembolism and thrombophilia: does discrepancy make complexity or vice versa?. Journal of Thrombosis and Haemostasis 1:1, 16-18
CrossRef52
Steven R Deitcher, Kandice Kottke-Marchant. (2003) Pseudo-protein S deficiency due to activated protein C resistance. Thrombosis Research 112:5-6, 349-353
CrossRef53
N. F. Dowling, H. Austin, A. Dilley, C. Whitsett, B. L. Evatt, W. C. Hooper. (2003) The epidemiology of venous thromboembolism in Caucasians and African-Americans: the GATE Study1. Journal of Thrombosis and Haemostasis 1:1, 80-87
CrossRef54
Marco Ruggeri, Heinz Gisslinger, Alberto Tosetto, Claudia Rintelen, Christine Mannhalter, Ingrid Pabinger, Navide Heis, Giancarlo Castaman, Edoardo Missiaglia, Klaus Lechner, Francesco Rodeghiero. (2002) Factor V Leiden mutation carriership and venous thromboembolism in polycythemia vera and essential thrombocythemia. American Journal of Hematology 71:1, 1-6
CrossRef55
W Perry, R.A Wiseman. (2002) Combined oral estradiol valerate-norethisterone treatment over 3 years in postmenopausal women. Maturitas 42:2, 157-164
CrossRef56
Johan R. Meinardi, Saskia Middeldorp, Pieter J. de Kam, Maria M. W. Koopman, Elisabeth C. M. van Pampus, Karly Hamulyak, Martin H. Prins, Harry R. Buller, Jan van der Meer. (2002) The incidence of recurrent venous thromboembolism in carriers of factor V Leiden is related to concomitant thrombophilic disorders. British Journal of Haematology 116:3, 625-631
CrossRef57
George R. Saade, Claire McLintock. (2002) Inherited thrombophilia and stillbirth. Seminars in Perinatology 26:1, 51-69
CrossRef58
L. Pinède. (2002) Durée du traitement anticoagulant oral dans la TVP des membres inférieurs. Annales de Cardiologie et d'Angéiologie 51:3, 158-163
CrossRef59
Peter Clark, Isobel D. Walker. (2001) The phenomenon known as acquired activated protein C resistance. British Journal of Haematology 115:4, 767-773
CrossRef60
L Pinède. (2001) Durée du traitement anticoagulant oral dans la maladie thromboembolique veineuse. La Revue de Médecine Interne 22:12, 1225-1236
CrossRef61
Gh. Jebeleanu, Lucia Procopciuc. (2001) G20210A prothrombin gene mutation identified in patients with venous leg ulcers. Journal of Cellular and Molecular Medicine 5:4, 397-401
CrossRef62
D. Turri, M. Rosselli, P. Simioni, D. Tormene, S. Grimaudo, G. Martorana, S. Siracusa, G. Mariani, M. Cottone. (2001) Factor V Leiden and prothrombin gene mutation in inflammatory bowel disease in Mediterranean area. Digestive and Liver Disease 33:7, 559-562
CrossRef63
Wylie Burke, Steven S. Coughlin, Nancy C. Lee, Douglas L. Weed, Muin J. Khoury. (2001) Application of Population Screening Principles to Genetic Screening for Adult-Onset Conditions. Genetic Testing 5:3, 201-211
CrossRef64
Isobel D Walker, M Greaves, F. E Preston. (2001) Investigation and management of heritable thrombophilia. British Journal of Haematology 114:3, 512-528
CrossRef65
Norman M. Kaplan, Biff F. Palmer, Factor V Leiden:, Ray Lee. (2001) Southwestern Internal Medicine Conference. The American Journal of the Medical Sciences 322:2, 88-102
CrossRef66
A. Gurgey, I.C. Haznedaroglu, T. Egesel, Y. Buyukas?k, O.I. Ozcebe, N. Say?nalp, S.V. Dundar, Y. Bayraktar. (2001) Two common genetic thrombotic risk factors: Factor V Leiden and prothrombin G20210A in adult Turkish patients with thrombosis. American Journal of Hematology 67:2, 107-111
CrossRef67
David Lillicrap. (2001) The genetics of venous and arterial thromboembolism. Current Atherosclerosis Reports 3:3, 209-215
CrossRef68
Maged A. Tanios, Amy R. Simon, Paul M. Hassoun. (2001) Management of Venous Thromboembolic Disease in the Chronically Critically Ill Patient. Clinics in Chest Medicine 22:1, 105-122
CrossRef69
Y. Gaber, H-J. Siemens, W. Schmeller. (2001) Resistance to activated protein C due to factor V Leiden mutation: high prevalence in patients with post-thrombotic leg ulcers. British Journal of Dermatology 144:3, 546-548
CrossRef70
Wayne W. Grody, John H. Griffin, Annette K. Taylor, Bruce R. Korf, John A. Heit. (2001) American College of Medical Genetics Consensus Statement on Factor V Leiden Mutation Testing. Genetics in Medicine 3:2, 139-148
CrossRef71
J.Shawn Miles, Joseph P Miletich, Samuel Z Goldhaber, Charles H Hennekens, Paul M Ridker. (2001) G20210A mutation in the prothrombin gene and the risk of recurrent venous thromboembolism. Journal of the American College of Cardiology 37:1, 215-218
CrossRef72
Lucia M. Procopciuc, C. Has, C. Drugan, Gh. Jebeleanu. (2000) Genetic analysis of factor V Leiden in a family with history of thrombosis and venous leg ulcers. Journal of Cellular and Molecular Medicine 4:4, 297-302
CrossRef73
(2000) Comparison of thrombotic risk between 85 homozygotes and 481 heterozygotes carriers of the factor V Leiden mutation: retrospective analysis from the Procare Study. Blood Coagulation and Fibrinolysis 11:6, 511-518
CrossRef74
Ruud Lensen, Frits Rosendaal, Jan Vandenbroucke And, Rogier Bertina. (2000) Factor V Leiden: the venous thrombotic risk in thrombophilic families. British Journal of Haematology 110:4, 939-945
CrossRef75
Francis Couturaud, Clive Kearon. (2000) Long-term treatment for venous thromboembolism. Current Opinion in Hematology 7:5, 302-308
CrossRef76
Menno V. Huisman. (2000) Recurrent venous thromboembolism: diagnosis and management. Current Opinion in Pulmonary Medicine 6:4, 330-334
CrossRef77
Sam Schulman. (2000) Duration of anticoagulants in acute or recurrent venous thromboembolism. Current Opinion in Pulmonary Medicine 6:4, 321-325
CrossRef78
Guiseppe Cella, Alberto Burlina, Alessandra Sbarai, Giovanna Motta, Antonio Girolami, Mauro Berrettini, William Strauss. (2000) Tissue Factor Pathway Inhibitor Levels in Patients with Homocystinuria. Thrombosis Research 98:5, 375-381
CrossRef79
M. Greaves, T. Baglin. (2000) Laboratory testing for heritable thrombophilia: impact on clinical management of thrombotic disease. Annotation. British Journal of Haematology 109:4, 699-703
CrossRef80
P. Simioni, D. Tormene, S. Luni, M. Caldato, A Girolami. (2000) Clinical and laboratory expression of associated thrombophilic conditions (homozygous/heterozygous factor V Leiden mutation and heterozygous prothrombin variant 20210A) in an Italian family. Blood Coagulation and Fibrinolysis 11:4, 379-384
CrossRef81
Björn Dahlbäck. (2000) Blood coagulation. The Lancet 355:9215, 1627-1632
CrossRef82
William F. Baker. (2000) Diagnosis of deep vein thrombosis and pulmonary embolism. Comprehensive Therapy 26:1, 6-16
CrossRef83
Robert B. Gherman, T. Murphy Goodwin. (2000) Obstetric Implications of Activated Protein C Resistance and Factor V Leiden Mutation. Obstetrical & Gynecological Survey 55:2, 117
CrossRef84
Paul M. Ridker. (2000) Inherited risk factors for venous thromboembolism: Implications for clinical practice. Clinical Cornerstone 2:4, 1-10
CrossRef85
Karen H Harum, Alexander H Hoon, James F Casella. (1999) Factor-V Leiden: a risk factor for cerebral palsy. Developmental Medicine & Child Neurology 41:11, 781-785
CrossRef86
De Stefano, Valerio, Martinelli, Ida, Mannucci, Pier Mannuccio, Paciaroni, Katia, Chiusolo, Patrizia, Casorelli, Ida, Rossi, Elena, Leone, Giuseppe, . (1999) The Risk of Recurrent Deep Venous Thrombosis among Heterozygous Carriers of Both Factor V Leiden and the G20210A Prothrombin Mutation. New England Journal of Medicine 341:11, 801-806
Full Text87
Paolo Prandoni, Pier Mannuccio Mannucci. (1999) Deep-vein thrombosis of the lower limbs: diagnosis and management. Best Practice & Research Clinical Haematology 12:3, 533-554
CrossRef88
Francisco F. Lopez, Joseph D. Sweeney, Abbe J. Blair, William M. Sikov. (1999) Spontaneous venous thrombosis in a young patient with combined factor V Leiden and lupus anticoagulant. American Journal of Hematology 62:1, 58-60
CrossRef89
Fumie Nakazawa, Takatoshi Koyama, Takako Saito, Misako Shibakura, Haruhiko Yoshinaga, Dong Hui Chung, Ryuichi Kamiyama, Shinsaku Hirosawa. (1999) Thrombomodulin with the Asp468Tyr mutation is expressed on the cell surface with normal cofactor activity for protein C activation. British Journal of Haematology 106:2, 416-420
CrossRef90
Paul M. Ridker. (1999) Duration and intensity of anticoagulation among patients with genetic predispositions to venous thrombosis. Current Cardiology Reports 1:2, 88-90
CrossRef91
Carsten Ranke, Hans-Joachim Trappe. (1999) Update Angiologie. Medizinische Klinik 94:5, 251-263
CrossRef92
Schafer, Andrew I., . (1999) Venous Thrombosis as a Chronic Disease. New England Journal of Medicine 340:12, 955-956
Full Text93
A. M. Cumming, C. R. Shiach. (1999) The investigation and management of inherited thrombophilia. Clinical & Laboratory Haematology 21:2, 77-92
CrossRef94
Gavin C. Harewood, Dipin Gupta, Scott C. Litin. (1999) 64-Year-Old Man With Venous Thrombosis and Abnormal Liver Enzymes. Mayo Clinic Proceedings 74:3, 285-288
CrossRef95
Anthonie WA Lensing, Paolo Prandoni, Martin H Prins, HR Büller. (1999) Deep-vein thrombosis. The Lancet 353:9151, 479-485
CrossRef96
Michael D. Freedman, Mark Young. (1999) Venous thrombosis: Diagnosis and treatment; new methods and strategies for management. Comprehensive Therapy 25:1, 13-19
CrossRef97
Norihisa Kumasaka, Masahito Sakuma, Kunio Shirato. (1999) Incidence of Pulmonary Thromboembolism in Japan. Japanese Circulation Journal 63:6, 439-441
CrossRef98
A. Piñar, R. Saenz, J. Rebollo, M. Gomez-Parra, F. Carrasco, J. M. Herrerias, M. Jimenez-Saenz. (1998) Portal and Mesenteric Vein Thrombosis in a Patient Heterozygous for a Mutation (Arg506 → Gln) in the Factor V Gen (Factor V Leiden). Journal of Clinical Gastroenterology 27:4, 361-363
CrossRef99
Michael R. DiSiena, Richard Intres, Daniel J. Carter. (1998) Factor V Leiden and Pulmonary Embolism in a Young Woman Taking an Oral Contraceptive. The American Journal of Forensic Medicine and Pathology 19:4, 362-367
CrossRef100
Wayne Lucas, Paul C. Schroy. (1998) Reversible ischemic colitis in a high endurance athlete. The American Journal of Gastroenterology 93:11, 2231-2234
CrossRef101
Howard A. Liebman, Nader Kashani, Douglas Sutherland, William McGehee, Lori Kam. (1998) The factor V Leiden mutation increases the risk of venous thrombosis in patients with inflammatory bowel disease. Gastroenterology 115:4, 830-834
CrossRef102
Michael Stepak, Jamie E. Siegel. (1998) Factor V Leiden: pathophysiology and clinical implications. Disease Management and Clinical Outcomes 1:5, 181-187
CrossRef103
W. CRAIG HOOPER, BRUCE L. EVATT. (1998) The Role of Activated Protein C Resistance in the Pathogenesis of Venous Thrombosis. The American Journal of the Medical Sciences 316:2, 120-128
CrossRef104
Douglas Grossman, Peter W. Heald, Henry M. Rinder. (1998) Reply. Journal of the American Academy of Dermatology 39:2, 299-300
CrossRef105
Goldhaber, Samuel Z., . (1998) Pulmonary Embolism. New England Journal of Medicine 339:2, 93-104
Full Text106
Caroline Baglin, Karen Brown, Roger Luddington, Trevor Baglin, . (1998) Risk of recurrent venous thromboembolism in patients with the factor V Leiden (FVR506Q) mutation: effect of warfarin and prediction by precipitating factors. British Journal of Haematology 100:4, 764-768
CrossRef107
A. Girolami, P. Simioni, L. Scarano, B. Girolami, A. Marchiori. (1998) Hemorrhagic and thrombotic disorders due to factor V deficiencies and abnormalities: an updated classification. Blood Reviews 12:1, 45-51
CrossRef108
Jane Gilmore, Page B. Pennell, Barney J. Stern. (1998) MEDICATION USE DURING PREGNANCY FOR NEUROLOGIC CONDITIONS. Neurologic Clinics 16:1, 189-206
CrossRef109
M. Odawara, K. Yamashita. (1997) Factor V Leiden mutation and Japanese NIDDM. Diabetologia 40:11, 1363-1364
CrossRef110
José M. García-Gala, Victoria Alvarez, Carmen R. Pinto, Inmaculada Soto, Manuel F. Urgellés, María J. Menéndez, Carmen Carracedo, Carlos López-Larrea, Eliecer Coto. (1997) Factor V Leiden (R506Q) and risk of venous thromboembolism: a case-control study based on the Spanish population. Clinical Genetics 52:4, 206-210
CrossRef111
Laurence C Udoff, Eli Y Adashi. (1997) Combined continuous hormone replacement therapy: an update. Reproductive Medicine Review 6:01, 1
CrossRef112
(1997) REVIEW. Clinical Chemistry and Laboratory Medicine 35:7, 501-516
CrossRef
