Original Article
Propagation of a Human Herpesvirus from AIDS-Associated Kaposi's Sarcoma
N Engl J Med 1997; 336:163-171January 16, 1997
- Abstract
Background
Although unique DNA sequences related to gammaherpesviruses have been found in Kaposi's sarcoma lesions, it is uncertain whether this DNA encodes a virus that is able to reproduce.
Methods
We isolated and propagated a filterable agent whose DNA sequences were found to be identical to those of the Kaposi's sarcoma–associated herpesvirus (KSHV). We obtained early-passage spindle cells from skin lesions of patients with the acquired immunodeficiency syndrome (AIDS) who had Kaposi's sarcoma and cultured them with cells of the human embryonal-kidney epithelial-cell line 293. We characterized the virus according to its effects on cellular morphology and viral replication and its appearance on electron microscopy.
Results
KSHV was cytotoxic to 293 cells and was detected by the polymerase chain reaction (PCR) in infected cells but not uninfected ones. Cytotoxicity and positive PCR signals were consistently maintained with viral titers of 1 million per milliliter or higher for about 20 serial infections of 293 cells. The viral copy number was relatively low (1 to 10 copies per cell). Viral replication was confirmed by Southern blot analysis of DNA isolated from the enriched nuclear fraction of infected cells and by a semiquantitative PCR using dilutions of the lysates of infected cells to detect the 233-bp viral DNA fragment originally described in association with Kaposi's lesions. Electron microscopy revealed herpesvirus-like particles in about 1 percent of cells from infected cultures, as compared with none in cells from uninfected cultures.
Conclusions
A herpesvirus with DNA sequences identical to those of KSHV can be propagated from skin lesions of patients with AIDS-associated Kaposi's sarcoma. (N Engl J Med 1997;336:163 -71.)
Media in This Article
Figure 1
Cytotoxic Effect on 293 Cells of Virus Propagated in Vitro.Figure 2
Detection of KSHV DNA Sequences in 293 Cells after Coculture with Kaposi's Sarcoma Cells.Article Activity
- Article
Kaposi's sarcoma was originally described in the late 1800s as a rare neoplasm predominantly affecting elderly men of Jewish or Mediterranean descent. Currently, Kaposi's sarcoma is the most common cancer in patients with the acquired immunodeficiency syndrome (AIDS), affecting approximately 20 percent of persons with human immunodeficiency virus type 1 (HIV-1) infection.1-3 Epidemiologic data have suggested that an infectious agent could spread the disease through sexual contact,4 but the etiologic agent has not been identified. Several viruses, including cytomegalovirus (CMV), hepatitis B virus, and human papillomavirus, have been found in patients with Kaposi's sarcoma. Recently, Chang et al. found that over 90 percent of the tissue samples they studied from patients with AIDS-associated Kaposi's sarcoma were positive for herpesvirus-like DNA sequences.5 These sequences were homologous to, but distinct from, minor capsid and tegument proteins of Epstein–Barr virus (EBV) and herpesvirus saimiri.5 They defined a putative new member of the gammaherpesvirus family, referred to as Kaposi's sarcoma–associated herpesvirus (KSHV) or human herpesvirus 8 (HHV-8). Since then, investigators in several laboratories have found these DNA sequences in patients with four types of Kaposi's sarcoma — the classic one, the one endemic in Africa, the iatrogenic one, and the one associated with AIDS6-8 — as well as in patients with body-cavity–based lymphomas.9-11
It is uncertain whether these DNA sequences encode a replication-competent virus or represent a replication-defective, adventitious virus present in patients with Kaposi's sarcoma. Although B-cell lines that carry the virus have been identified,10,11 neither viral replication in vitro nor serial propagation of the virus in cell lines has been demonstrated. In this study we demonstrate the propagation of a human herpesvirus from AIDS-associated Kaposi's sarcoma.
Methods
Cell Culture, Isolation of DNA, and Analysis by the Polymerase Chain Reaction
Kaposi's sarcoma cell lines were isolated independently from specimens of Kaposi's sarcoma skin lesions obtained at biopsy from five HIV-infected patients,12 all of whom had multiple lesions, diminished CD4 cell counts, and other signs of AIDS. For some patients, two biopsy specimens were evaluated. The cells were plated in tissue-culture dishes coated with microvascular endothelial-cell attachment factor (Cell Systems, Kirkland, Wash.) and were maintained as previously described,12,13 but without the addition of medium conditioned by cells infected with the human T-cell lymphotropic virus type II (HTLV-II).
The polymerase chain reaction (PCR) was performed with KSHV-specific primers.5 Either genomic DNA or Hirt supernatants — that is, episomal DNA from infected cells — were isolated from tissue-culture cells as previously described.14-16 PCR was performed as previously described to detect human herpesvirus 6 (HHV-6), EBV, and herpes simplex virus types 1 and 2 (HSV-1 and HSV-2).17-19 CMV was detected with the following primers from the intron of an immediate early gene, under standard conditions: 5'CCAAGCTTCCACGCTGTTTTGACCTCCATAGA3' (sense) and 5'CCAAGCTTCTGTCAGCTATTATGTCTGGTGGC3' (antisense); a 908-bp product was generated. Positive controls for these known herpesviruses were obtained from paraffin-embedded tissue samples and from the EBV-transformed B-cell line M16B. The sensitivity of the PCR was 0.1 to 1 fg of DNA.
In a semiquantitative PCR, the 233-bp fragment of viral DNA originally described in association with Kaposi's sarcoma lesions5 (Genbank accession number U18551, base pairs 987 to 1219) was quantitated by electrophoresis with ethidium-stained agarose gel and spectroscopy in serial dilutions. PCR was performed, followed by Southern blot hybridization with a form of the same 233-bp DNA fragment that was radiolabeled with phosphorus-32. Each PCR used DNA from 100,000 cells, purified by phenol–chloroform extraction. The range of the DNA concentration measurable in the assay was 0.001 to 1 fg (4 to 4000 copies).
Propagation of Virus from Cocultures and Serial Passage
Cells from primary Kaposi's sarcoma lesions (200,000 cells, passaged no more than three times after the cells from the biopsy samples were plated) were incubated with 2 million cells of the human embryonal-kidney epithelial-cell line 293 (293 cells) in 35-mm six-well Costar plates, either stimulated before culture with tumor necrosis factor α (200 IU per milliliter) or unstimulated. The 293 cells (provided by Dr. Garry Nolan) were grown in Dulbecco's modified Eagle's medium supplemented with fetal-calf serum (10 percent), antibiotics, and l-glutamine. To release viral particles, cell-free lysates from the 293 cells were prepared by three cycles of freezing and thawing in dry ice and ethanol and a water bath at 37°C three to five days after the initial coculture with the Kaposi's sarcoma cells. After lysis of the cells, the extracts were centrifuged at 10,000 × g for 10 minutes, then filtered through a 0.45-μm membrane.
For the serial propagation of virus, cell-free lysates were prepared from infected 293 cells by this method on day 3 after infection, while a duplicate cell culture was maintained to confirm subsequent cytotoxicity. No viable cells were detected in the lysates by staining with trypan blue, and positivity for KSHV DNA was confirmed in the lysates by PCR. Virus was propagated serially in an equivalent number of 293 cells for approximately 20 passages. Viral titers were estimated by incubating the infected lysates in progressive dilutions (10-2 to 10-10) with 293 cells. Human umbilical-vein endothelial cells were propagated as previously described.20
Treatment of Extracellular Virions with Nuclease
To confirm that viral DNA was protected by components of the viral structure, isolated virions were digested with RNase-free DNase (1 U per milliliter; Promega) and pronase (1 mg per milliliter), which together should degrade free or protein-associated DNA. Some virions were incubated in addition with a nonionic detergent, 1 percent Nonidet P-40 (NP40), which disrupts the lipid bilayer of the viral envelope11,21 and allows DNase and pronase to degrade virion-associated DNA. The supernatants of infected cultures of 293 cells were centrifuged for 10 minutes at 3000 rpm and filtered through a 0.45-μm membrane. To prevent the potential carryover of viral DNA, the supernatants were ultracentrifuged (25,000 × g) at 4°C (SW 28 rotor, Beckman) to pellet the viral particles. Before analysis, the particles were washed once with phosphate-buffered saline (PBS).
Electron Microscopy
Cells from the in vitro cultures described above were rinsed with PBS, and monolayers were fixed in 2.5 percent glutaraldehyde in PBS (pH 7.4) for five minutes at 4°C. The cells were then resuspended, centrifuged into pellets at 300 × g, and incubated for two hours at 4°C. The samples were rinsed, dehydrated, and embedded in epon. The specimens were sectioned, stained with uranyl acetate and lead citrate, and examined with a Zeiss 109 transmission electron microscope. In some instances, the cells were incubated for 12 hours with brefeldin A (0.3 μg per milliliter), an inhibitor of Golgi transport, added 24 hours after infection. This treatment improved the visualization of virions.
Results
Characterization of KSHV DNA in Isolated Kaposi's Sarcoma Cells
To establish Kaposi's sarcoma cell lines in vitro, we developed conditions for cell culture that did not require the presence of medium conditioned with HTLV-II–infected cells, unlike the culture conditions in previous studies.12,13 Kaposi's sarcoma cell lines grew rapidly after the initiation of the cultures. Each was positive for clotting factor XIIIa and vascular-cell adhesion molecule 1 on immunohistochemical staining and negative for factor XIIIs, E-selectin, CD31, factor VIII, and CD34 (data not shown), as is consistent with the phenotype of isolated Kaposi's sarcoma cells studied under different conditions of culture.12,22
PCR was used to determine whether the proliferating Kaposi's sarcoma cells contained recently described herpesvirus-like DNA sequences.5 Early-passage, isolated Kaposi's sarcoma cell lines from six of the seven specimens obtained were positive for these DNA sequences (Table 1Table 1
Presence of KSHV and Other DNA Sequences in Isolated Cell Lines.). The positive signal was present in the cell lines until passage 2 or 3 and could not be detected thereafter. The 233-bp PCR product was also found in DNA isolated from two paraffin-embedded samples of tissue from a different patient who had pulmonary Kaposi's sarcoma, as has been described in other patients.5,6 No evidence of KSHV DNA sequences was detected in human umbilical-vein endothelial cells, 293 cells, or DNA isolated from paraffin-embedded tissue from a patient with psoriasis (Table 1). To determine whether other herpesviruses were present in these samples, PCR was performed to detect viral sequences of HHV-6, HSV-1, HSV-2, CMV, and EBV. DNA from the samples of Kaposi's sarcoma cells was negative for each of these sequences (Table 1). In addition, there was no evidence of mycoplasma, HIV, or adenovirus in freshly derived Kaposi's sarcoma cells or viral isolates (data not shown).Propagation of Lytic Virus
Early-passage Kaposi's sarcoma cells were cocultured for two to seven days with various types of cells, including human epithelial-cell lines (HeLa, 293, and A431 cells), human umbilical-vein endothelial cells, porcine endothelial cells, and human or porcine vascular smooth-muscle primary cells. Genomic DNA was isolated from the cocultures and analyzed for KSHV DNA sequences by PCR. Consistently strong PCR signals were found on day 2 in DNA isolated from cocultures of Kaposi's sarcoma cells with 293 cells, whereas the DNA from the co-cultures with other types of cells was negative. In the 293 cells, the PCR signal was detected as Kaposi's sarcoma cells were lost from the culture (on days 4 and 5) and was accompanied by progressively increasing signs of cytotoxicity in the cell culture (Figure 1AFigure 1
Cytotoxic Effect on 293 Cells of Virus Propagated in Vitro. and Figure 1B). Light-microscopical analysis of uninfected 293 cells showed viable epithelial cells with round nuclei that contained evenly distributed chromatin and prominent nucleoli (Figure 1B). In contrast, after exposure to the infected-cell lysate, the 293 cells showed substantial cytopathic changes, beginning as early as day 2. Groups of infected 293 cells contained multinucleated giant cells (Figure 1B). In addition, certain cells had nuclear molding or dense, chromatin-like material at the margin of the nucleus, and the chromatin was dissolving, with residual chromatin forming a margin along the nuclear membrane (Figure 1B). By day 5, virtually all the cells underwent condensation of chromatin and other morphologic changes consistent with cell death (Figure 1A and Figure 1B). These findings suggested that the positive PCR signals were probably due to transmission of virus rather than to persistent DNA sequences from the primary Kaposi's sarcoma cell line. PCR signals were variably observed in the human umbilical-vein endothelial cells, but there was no consistent cytopathic effect. We therefore focused our efforts on the 293 cells as host cells for viral replication.Propagation of Virus by Serial Infection of 293 Cells
To propagate the virus further, we prepared cell-free lysates from cocultures of Kaposi's sarcoma cells with 293 cells at various times after incubation, and the 293 cells were infected both in the presence and in the absence of tumor necrosis factor α. No PCR signals were detected in the uninfected cells, but signals were readily detected in the infected 293 cells within one day after infection (Figure 2AFigure 2
Detection of KSHV DNA Sequences in 293 Cells after Coculture with Kaposi's Sarcoma Cells.). Signals were detected more readily in the nuclear fraction and were weaker in the cytoplasm (Figure 2B). Hirt supernatants — that is, episomal DNA isolated from infected cells — contained KSHV DNA sequences by PCR. The signals were maximal three days after the viral challenge, diminishing by day 5 (Figure 2A).Although virus could be detected in the cell-culture supernatants and passaged serially, the cell lysates consistently had viral titers two to three orders of magnitude higher than the supernatants (data not shown), and the lysates were therefore used in further studies. With the PCR we could also amplify regions of the thymidine kinase gene, the putative principal capsid protein, and glycoprotein H. These regions were visualized by staining with ethidium bromide after 30 cycles in at least three separate experiments (data not shown). No PCR signals from other known herpesviruses were detected in serially passaged viral isolates, although they were detected readily in positive control tissues and cell lines infected with the relevant viruses. In particular, there was no PCR evidence of EBV in either the primary early-passage Kaposi's sarcoma cell lines or subsequent serially passaged virus (with as many as 20 passages) (data not shown).
Southern blot analysis of DNA prepared from enriched nuclei isolated from 293 cells confirmed that in passage 5 virus, viral DNA was amplified by a factor of 1000 or more after infection (Figure 2C), as was consistent with the results of semiquantitative PCR (Figure 2A and Figure 2B). Moreover, when 293 cells were incubated with infected-cell lysates at increasing dilutions, the development of cytotoxicity correlated with the magnitude of the signal for KSHV that could be detected by Southern blot analysis of the PCR product (Figure 2D). Cytotoxicity and positive PCR signals for KSHV were consistently maintained with viral titers of 1 million per milliliter or more, as determined by the dilution at which no cytotoxicity was seen, for approximately 20 serial infections of 293 cells. The transfer of the cytotoxic effect among the cell cultures and the PCR signals after serial passage were maintained consistently after the infected-cell lysates were filtered through a 0.45-μm membrane, but these characteristics disappeared after inactivation by heat (data not shown). Under identical culture conditions, serial passages of KSHV derived from body-cavity–based lymphomas were unsuccessful, and no cytotoxicity was seen (unpublished data).
Replication of Viral DNA in Infected Cells and Sensitivity of Virus to Treatment with Nuclease
To passage the virus serially, we prepared cell lysates from infected 293 cells on day 3, before the generation of cytotoxicity. Although tumor necrosis factor α enhanced viral replication during the coculture of primary Kaposi's sarcoma cells and 293 cells, it did not increase cytotoxicity or viral titers during serial passage of 293 cells and thus was not used further. Replication of viral DNA was confirmed by semiquantitative PCR. With this technique, as little as about 0.001 fg of viral DNA (or about one copy per 100,000 infected cells) could be detected. After one hour of incubation with infected-cell lysates from passage 15 (a 10-2 dilution, containing 1000 to 10,000 viral-genome equivalents), followed by extensive washing with Dulbecco's modified Eagle's medium, viral DNA was barely detectable in the infected cells four hours after the removal of the viral supernatant. By 24 hours, a definite signal was detected. The peak replication was observed two days after infection, with amplification of viral DNA increased by at least three orders of magnitude.
Exposure to a smaller quantity of lysate in a 10-4 dilution (containing 10 to 100 viral-genome equivalents) revealed sustained but decreased peak replication of viral DNA (Figure 3AFigure 3
Replication of Viral DNA in 293 Cells and Analysis of Extracellular Viral Particles. and Figure 3B), which may have been due to a slower spread in the infected cell culture and to reduced cytotoxicity. No viral DNA was detected in uninfected cells (Figure 2A and Figure 3A). Thus, for the cultures of 293 cells exposed to infected lysates (passage 15), there was a period in which the viral titer was minimal, followed by one in which it increased exponentially, providing evidence that this virus is competent to replicate. Analysis of passage 1 and passage 5 virus showed a similar increase in the synthesis of viral DNA in infected 293 cells (Figure 3C). These results are representative of those obtained with at least six infections in which virus from different passages (from passage 2 to passage 22) was studied by PCR. At least three primary isolates of the virus with similar properties have now been obtained and propagated (data not shown). Quantitation of the Southern blot signal suggested that there was a relatively low copy number of viral genomes in each cell (on average, 1 to 10 copies per cellular genome; data not shown), as is consistent with results of quantitative PCR and electron-microscopical data.To determine whether the virus particles released from infected cells contained KSHV DNA, pelleted virus was subjected to treatment with DNase and pronase,11 with or without prior exposure to NP40, and was then analyzed by PCR and Southern blotting. The KSHV DNA from passage 15 in the preparation treated with pronase and DNase was resistant to nuclease digestion. In contrast, no PCR signal was detected in the preparation exposed to NP40 before treatment with DNase and pronase (Figure 4AFigure 4
Nuclease Sensitivity Assays for Enveloped Virions Derived from Infected 293 Cells.). This finding provides evidence that the DNA is protected from the combined action of a protease and DNase by a virus-associated membrane. Furthermore, transmission of KSHV DNA in 293 cells was demonstrated at passage 22 after treatment with DNase alone (Figure 4B), indicating that filtered and DNase-treated viral particles retained their infectivity. In this experiment, but not routinely, the preparation of virions was also treated with RNase-free DNase (1 U per milliliter, Promega). Similar results were observed with passage 15 virus.Electron Microscopy of Infected 293 Cells
To further document the presence of the virus after serial propagation, we performed additional analyses using electron microscopy. In early-passage Kaposi's sarcoma cells, particles were found in the cytoplasm whose size and structure were consistent with those of herpes virions (Figure 5AFigure 5
Electron-Microscopical Analyses of Cultures of Infected 293 Cells.). Electron-microscopical analysis of 293 cells infected with viral lysate (passage 5) revealed multiple particles that resembled viral nucleocapsids (Figure 5B). These viral nucleocapsids containing electron-dense cores (approximately 100 nm in diameter) were observed in nuclei of infected cells, but not those of uninfected cells, as soon as two days after exposure to lysate (Figure 5C). Furthermore, enveloped virions (approximately 140 nm in diameter) were detected in the perinuclear cisternae and the cytoplasm of infected 293 cells (Figure 5D and Figure 5E). We estimated that about 1 percent of cells in the infected cultures contained herpesvirus-like particles, but none of the cells in the control cultures contained such particles (300 cells were analyzed in each group).Discussion
Since DNA sequences associated with Kaposi's sarcoma were first described, several reports have either supported6-8,23-25 or challenged26,27 the notion that this novel DNA virus is important in Kaposi's sarcoma. We used early-passage cell lines from biopsy specimens of Kaposi's sarcoma skin lesions as a source of the virus and defined conditions that allowed it to be propagated in vitro. KSHV DNA sequences were detected by PCR in early passages of these cell lines (in six of seven primary cultures), and these sequences resembled previously described herpesvirus-like DNA sequences.28,29 It is noteworthy that the PCR signal disappeared from the primary Kaposi's sarcoma cell lines by passage 3 or 4, suggesting that viral replication in these cultures was limited. In coculture experiments, the virus was transmitted to the embryonal-kidney epithelial-cell line 293 in a manner that correlated with the presence of the viral PCR signal. In addition, substantial cytotoxicity was observed, which could be due to the direct toxic effects of viral proteins on infected cells or, indirectly, to the release of cytokines, as noted in the case of EBV infections,30 to the presence of soluble factors, or to the action of virus particles on uninfected cells in the culture. Because a small fraction of cells appear to be infected (0.1 to 1 percent) at the time cytotoxicity is observed, it is likely that this effect is largely indirect.
Independent evidence of the presence of the virus was obtained by analysis of viral DNA, studies of cellular morphology, and electron microscopy. Although replication of viral DNA was repeatedly demonstrated by PCR, the viral copy number was relatively low (1 to 10 copies per cell). For this reason, Southern blotting for the routine detection of virus was not feasible, although the virus was detectable by this technique in larger-scale preparations (Figure 2C). The disappearance of viral DNA (Figure 3B and Figure 3C) was probably due to the cytotoxic effects observed in the culture, with the release of nucleases, proteases, and lipases that may degrade cell-associated viral DNA. Although KSHV appears to replicate with a low copy number, the features we observed are consistent with previous reports based on DNA analysis and in situ hybridization of Kaposi's sarcoma tissue.5,31
Renne et al.11 have described a body-cavity–based lymphoma that contains KSHV. Contrary to Cesarman et al. in an earlier report,10 they showed that a lymphoma that carries KSHV DNA is devoid of EBV sequences. Although the formation of virus was induced in a proportion of cells (5 to 10 percent) by treatment with phorbol 12-myristate 13-acetate,11 serial passage of replication-competent virus was not demonstrated. Another report suggested that transient transmission of KSHV derived from an EBV-containing B-cell lymphoma line was observed, but that virus also could not be propagated serially.32 We studied and propagated KSHV from primary Kaposi's sarcoma lesions. Further research is needed to clarify the relation between the viruses in body-cavity–based lymphomas and those in primary Kaposi's sarcoma lesions.
Despite our ability to propagate this virus in vitro and its close association with the presence of Kaposi's sarcoma in vivo,33,34 whether KSHV has a causal role in the disease remains uncertain. The ability to propagate KSHV should facilitate the development of diagnostic reagents, allow more detailed study of the association of the virus with Kaposi's sarcoma lesions, and improve our understanding of how people respond after exposure to the virus. Finally, it remains uncertain whether the pathogenesis of Kaposi's sarcoma derives from its ability to transform primary cells in vivo or whether the sarcoma represents an immune-mediated inflammatory and angiogenic response to virally infected cells. The fact that cloned viral isolates can be maintained and propagated should facilitate further study of the molecular regulation of the virus and help define its role in the causation and pathogenesis of Kaposi's sarcoma.
Supported in part by grants (AR40488, CA64416, and CA70057 [to Dr. Nickoloff] and AI36207 and CA46592 [to Dr. Nabel]) from the National Institutes of Health.
We are indebted to Drs. Clay Flowers and Oveta Fuller for helpful discussions; to Donna Gschwend and Nancy Barrett for the preparation of the manuscript; to Philip Simonian for DNA-sequence analysis; to Drs. Carol A. Kauffman and Powel H. Kazanjian for the referral of patients; and to Robin Kunkel, Barbara Rogers, Theodore Beals, and Paula Kovarik for the preparation and analysis of the electron-microscopical specimens.
Source Information
From the Department of Pathology, Skin Disease Research Laboratories, Cardinal Bernardin Cancer Center, Loyola University Medical Center, Maywood, Ill. (K.E.F., B.J.N.); and the Departments of Internal Medicine and Biological Chemistry (J.F., W.K., C.W., G.J.N.) and Oral Pathology (P.J.P.), Howard Hughes Medical Institute, University of Michigan Medical Center, Ann Arbor.
Address reprint requests to Dr. Nabel at University of Michigan Medical Center, MSRBI, Rm. 4520, 1150 W. Medical Center Dr., Ann Arbor, MI 48109-0650.
- References
References
1
Beral V ,Peterman TA ,Berkelman RL ,Jaffe HW . Kaposi's sarcoma among persons with AIDS: a sexually transmitted infection? Lancet 1990;335:123-128
CrossRef | Web of Science | Medline2
Safai B ,Johnson KG ,Myskowski PL , et al. The natural history of Kaposi's sarcoma in the acquired immunodeficiency syndrome. Ann Intern Med 1985;103:744-750
Web of Science | Medline3
Beral V ,Jaffe H ,Weiss R . Cancer surveys: cancer, HIV, and AIDS. Eur J Cancer 1991;27:1057-1058
CrossRef | Web of Science | Medline4
Beral V . Epidemiology of Kaposi's sarcoma. Cancer Surv 1991;10:5-22[Erratum, Cancer Surv 1992;12:225a.]
Medline5
Chang Y ,Cesarman E ,Pessin MS , et al. Identification of herpesvirus-like DNA sequences in AIDS-associated Kaposi's sarcoma. Science 1994;266:1865-1869
CrossRef | Web of Science | Medline6
Huang YQ ,Li JJ ,Kaplan MH , et al. Human herpesvirus-like nucleic acid in various forms of Kaposi's sarcoma. Lancet 1995;345:759-761
CrossRef | Web of Science | Medline7
Moore PS ,Chang Y . Detection of herpesvirus-like DNA sequences in Kaposi's sarcoma in patients with and those without HIV infection. N Engl J Med 1995;332:1181-1185
Full Text | Web of Science | Medline8
Ambroziak JA ,Blackburn DJ ,Herndier BG , et al. Herpes-like sequences in HIV-infected and uninfected Kaposi's sarcoma patients. Science 1995;268:582-583
CrossRef | Web of Science | Medline9
Cesarman E ,Chang Y ,Moore PS ,Said JW ,Knowles DM . Kaposi's sarcoma-associated herpesvirus-like DNA sequences in AIDS-related body-cavity-based lymphomas. N Engl J Med 1995;332:1186-1191
Full Text | Web of Science | Medline10
Cesarman E ,Moore PS ,Rao PH ,Inghirami G ,Knowles DM ,Chang Y . In vitro establishment and characterization of two acquired immunodeficiency syndrome-related lymphoma cell lines (BC-1 and BC-2) containing Kaposi's sarcoma-associated herpesvirus-like (KSHV) DNA sequences. Blood 1995;86:2708-2714
Web of Science | Medline11
Renne R ,Zhong W ,Herndier B , et al. Lytic growth of Kaposi's sarcoma-associated herpesvirus (human herpesvirus 8) in culture. Nat Med 1996;2:342-346
CrossRef | Web of Science | Medline12
Huang YQ ,Friedman-Kien AE ,Li JJ ,Nickoloff BJ . Cultured Kaposi's sarcoma cell lines express factor XIIIa, CD14, and VCAM-1, but not factor VIII or ELAM-1. Arch Dermatol 1993;129:1291-1296[Erratum, Arch Dermatol 1993;129:1622.]
CrossRef | Web of Science | Medline13
Yang J ,Xu Y ,Zhu C ,Hagan MK ,Lawley T ,Offermann MK . Regulation of adhesion molecule expression in Kaposi's sarcoma cells. J Immunol 1994;152:361-373
Web of Science | Medline14
Eizuru Y ,Inagawa S ,Minamishima Y . Application of “Hirt supernatant“ DNA to the molecular epidemiology of cytomegalovirus infections. J Clin Microbiol 1984;20:1012-1014
Web of Science | Medline15
Pater MM ,Hyman RW ,Rapp F . Isolation of herpes simplex virus DNA from the “Hirt supernatant.“ Virology 1976;75:481-483
CrossRef | Web of Science | Medline16
Coen DM. Quantitation of rare DNAs by PCR. In: Ausubel FM, Brent R, Kingston RE, et al., eds. Current protocols in molecular biology. Vol. 2. New York: Greene Publishing, 1992:15.3.1-15.3.8.
17
Sa'Adu A ,Thomson BJ ,Bountiff L ,Webster AD . Lymphotropic viruses in “common variable“ immunodeficiency -- PCR analysis of lymphocyte DNA for HIV-1 and HHV-6. Clin Exp Immunol 1993;91:50-53
CrossRef | Web of Science | Medline18
Cao M ,Xiao X ,Egbert B ,Darragh TM ,Yen TS . Rapid detection of cutaneous herpes simplex virus infection with the polymerase chain reaction. J Invest Dermatol 1989;92:391-392
CrossRef | Web of Science | Medline19
Apolloni A ,Sculley TB . Detection of A-type and B-type Epstein-Barr virus in throat washings and lymphocytes. Virology 1994;202:978-981
CrossRef | Web of Science | Medline20
Duckett CS ,Perkins ND ,Kowalik TF , et al. Dimerization of NF-KB2 with RelA(p65) regulates DNA binding, transcriptional activation, and inhibition by an IκB-α (MAD-3). Mol Cell Biol 1993;13:1315-1322
Web of Science | Medline21
Lenhoff RJ ,Summers J . Coordinate regulation of replication and virus assembly by the large envelope protein of an avian hepadnavirus. J Virol 1994;68:4565-4571
Web of Science | Medline22
Naidu YM ,Rosen EM ,Zitnick R , et al. Role of scatter factor in the pathogenesis of AIDS-related Kaposi's sarcoma. Proc Natl Acad Sci U S A 1994;91:5281-5285
CrossRef | Web of Science | Medline23
Lebbe C ,de Cremoux P ,Rybojad M ,Costa da Cunha C ,Morel P ,Calvo F . Kaposi's sarcoma and new herpesvirus. Lancet 1995;345:1180-1180
CrossRef | Web of Science | Medline24
Dupin N ,Grandadam M ,Calvez V , et al. Herpesvirus-like DNA sequences in patients with Mediterranean Kaposi's sarcoma. Lancet 1995;345:761-762
CrossRef | Web of Science | Medline25
Whitby D ,Howard MR ,Tenant-Flowers M , et al. Detection of Kaposi sarcoma associated herpesvirus in peripheral blood of HIV-infected individuals and progression to Kaposi's sarcoma. Lancet 1995;346:799-802
CrossRef | Web of Science | Medline26
Rady PL ,Yen A ,Rollefson JL , et al. Herpesvirus-like DNA sequences in non-Kaposi's sarcoma skin lesions of transplant patients. Lancet 1995;345:1339-1340
CrossRef | Web of Science | Medline27
Lin JC ,Lin SC ,Mar EC , et al. Is Kaposi's-sarcoma-associated herpesvirus detectable in semen of HIV-infected homosexual men? Lancet 1995;346:1601-1602
CrossRef | Web of Science | Medline28
Finesmith TH ,Shrum JP . Kaposi's sarcoma. Int J Dermatol 1994;33:755-762
CrossRef | Medline29
Ioachim HL ,Adsay V ,Giancotti FR ,Dorsett B ,Melamed J . Kaposi's sarcoma of internal organs: a multiparameter study of 86 cases. Cancer 1995;75:1376-1385
CrossRef | Web of Science | Medline30
Jones K ,Rivera C ,Sgadari C , et al. Infection of human endothelial cells with Epstein-Barr virus. J Exp Med 1995;182:1213-1221
CrossRef | Web of Science | Medline31
Boshoff C ,Talbot S ,Kennedy M ,O'Leary J ,Schulz T ,Chang Y . HHV8 and skin cancers in immunosuppressed patients. Lancet 1996;347:338-339[Erratum, Lancet 1996;348:138.]
CrossRef | Web of Science | Medline32
Moore PS ,Gao SJ ,Dominguez G , et al. Primary characterization of a herpesvirus agent associated with Kaposi's sarcoma. J Virol 1996;70:549-558
Web of Science | Medline33
Kedes DH ,Operskalski E ,Busch M ,Kohn R ,Flood J ,Ganem D . The seroepidemiology of human herpesvirus 8 (Kaposi's sarcoma-associated herpesvirus): distribution of infection in KS risk groups and evidence for sexual transmission. Nat Med 1996;2:918-924
CrossRef | Web of Science | Medline34
Gao SJ ,Kingsley L ,Li M , et al. KSHV antibodies among Americans, Italians and Ugandans with and without Kaposi's sarcoma. Nat Med 1996;2:925-928
CrossRef | Web of Science | Medline
- Citing Articles (41)
Citing Articles
1
Francesco DʼAmico, Claudia Fuxman, Fabio Nachman, Lisandro Bitetti, Martin Fauda, Constanza Echevarria, Hector Solar, Pedro Politi, Ana Cabanne, Eduardo Mauriño, Andres Ruf, Gabriel E. Gondolesi. (2010) Visceral Kaposiʼs Sarcoma Remission After Intestinal Transplant. First Case Report and Systematic Literature Review. Transplantation 90:5, 547-554
CrossRef2
Antonino Carbone, Ethel Cesarman, Annunziata Gloghini, Hans G Drexler. (2010) Understanding pathogenetic aspects and clinical presentation of primary effusion lymphoma through its derived cell lines. AIDS 24:4, 479-490
CrossRef3
Vaibhav Tiwari, Nissar A. Darmani, Gerald R. Thrush, Deepak Shukla. (2009) An unusual dependence of human herpesvirus-8 glycoproteins-induced cell-to-cell fusion on heparan sulfate. Biochemical and Biophysical Research Communications 390:3, 382-387
CrossRef4
Di Qin, Yi Zeng, Chao Qian, Zan Huang, Zhigang Lv, Lin Cheng, Shuihong Yao, Qiao Tang, Xiuying Chen, Chun Lu. (2008) Induction of lytic cycle replication of Kaposi's sarcoma-associated herpesvirus by herpes simplex virus type 1: involvement of IL-10 and IL-4. Cellular Microbiology 10:3, 713-728
CrossRef5
C. Lebbé. (2008) Humanes Herpesvirus 8 (HHV-8) und Kaposi-Sarkom. Der Hautarzt 59:1, 18-25
CrossRef6
Bennie H. Jeng, Gary N. Holland, Careen Y. Lowder, William F. Deegan, Michael B. Raizman, David M. Meisler. (2007) Anterior Segment and External Ocular Disorders Associated with Human Immunodeficiency Virus Disease. Survey of Ophthalmology 52:4, 329-368
CrossRef7
Annika Järviluoma, Päivi M. Ojala. (2006) Cell signaling pathways engaged by KSHV. Biochimica et Biophysica Acta (BBA) - Reviews on Cancer 1766:1, 140-158
CrossRef8
Jag Bhawan. (2006) The Evolution of Dermatopathology-The American Experience. The American Journal of Dermatopathology 28:1, 67-71
CrossRef9
Chun Lu, Yi Zeng, Zan Huang, Li Huang, Chao Qian, Guixia Tang, Di Qin. (2005) Human Herpesvirus 6 Activates Lytic Cycle Replication of Kaposi's Sarcoma-Associated Herpesvirus. The American Journal of Pathology 166:1, 173-183
CrossRef10
R. Renne, D. Dittmer, D. Kedes, K. Schmidt, R.C. Desrosiers, P.A. Luciw, D. Ganem. (2004) Experimental transmission of Kaposi's sarcoma-associated herpesvirus (KSHV/HHV-8) to SIV-positive and SIV-negative rhesus macaques. Journal of Medical Primatology 33:1, 1-9
CrossRef11
Giulio Alessandri, Simona Fiorentini, Stefano Licenziati, Monica Bonafede, Paolo Monini, Barbara Ensoli, Arnaldo Caruso. (2003) CD8 + CD28 - T Lymphocytes from HIV-1-Infected Patients Secrete Factors That Induce Endothelial Cell Proliferation and Acquisition of Kaposi's Sarcoma Cell Features. Journal of Interferon & Cytokine Research 23:9, 523-531
CrossRef12
Subhash C. Verma, Erle S. Robertson. (2003) Molecular biology and pathogenesis of Kaposi sarcoma-associated herpesvirus. FEMS Microbiology Letters 222:2, 155-163
CrossRef13
Yoshiyasu Aoki, Giovanna Tosato. (2003) Pathogenesis and manifestations of human herpesvirus-8-associated disorders. Seminars in Hematology 40:2, 143-153
CrossRef14
Grace Hyun, Franklin C Lowe. (2003) AIDS and the urologist. Urologic Clinics of North America 30:1, 101-109
CrossRef15
Lutz G Guertler. (2002) Virus safety of human blood, plasma, and derived products. Thrombosis Research 107, S39-S45
CrossRef16
Upton D. Allen. (2002) Human herpesvirus type 8 infections among solid organ transplant recipients. Pediatric Transplantation 6:3, 187-192
CrossRef17
Lawrence Corey, Scott Brodie, Meei-Li Huang, David M. Koelle, Anna Wald. (2002) HHV-8 infection: a model for reactivation and transmission. Reviews in Medical Virology 12:1, 47-63
CrossRef18
Kimberly E Foreman, Jacques Friborg, Bala Chandran, Harutaka Katano, Tetsutaro Sata, Maria Mercader, Gary J Nabel, Brian J Nickoloff. (2001) Injection of human herpesvirus-8 in human skin engrafted on SCID mice induces Kaposi's sarcoma-like lesions. Journal of Dermatological Science 26:3, 182-193
CrossRef19
Paul J. Bock, David M. Markovitz. (2001) Infection with HIV-2. AIDS 15, S35-S45
CrossRef20
J-P Spano, Y Salhi, D Costagliola, W Rozenbaum, P-M Girard. (2000) Factors predictive of disease progression and death in AIDS-related Kaposi's sarcoma. HIV Medicine 1:4, 232-237
CrossRef21
David J. Blackbourn, Evelyne Lennette, Barbara Klencke, Ashlee Moses, Bala Chandran, Mark Weinstein, Richard G. Glogau, Marlys H. Witte, Dennis L. Way, Tim Kutzkey, Brian Herndier, Jay A. Levy. (2000) The restricted cellular host range of human herpesvirus 8. AIDS 14:9, 1123-1133
CrossRef22
Maria Mercader, Brunella Taddeo, Jeffery R. Panella, Bala Chandran, Brian J. Nickoloff, Kimberly E. Foreman. (2000) Induction of HHV-8 Lytic Cycle Replication by Inflammatory Cytokines Produced by HIV-1-Infected T Cells. The American Journal of Pathology 156:6, 1961-1971
CrossRef23
Kimberly E. Foreman, Tamara Wrone-Smith, Ann E. Krueger, Brian J. Nickoloff. (1999) Expression of Costimulatory Molecules CD80 and/or CD86 by a Kaposi's Sarcoma Tumor Cell Line Induces Differential T-Cell Activation and Proliferation. Clinical Immunology 91:3, 345-353
CrossRef24
Arnold J. Berry. (1999) HIV infection: problems with patientsʼ anaesthetic management and healthcare workersʼ exposure. Current Opinion in Anaesthesiology 12:3, 359-366
CrossRef25
Eva Ries, I. Ruhswurm, K. Krepler, A. Wedrich. (1999) Der HIV-positive Patient. Spektrum der Augenheilkunde 13:S25, 3-11
CrossRef26
Pfrommer, Tebbe, Tidona, WOlfer, Krengel, Zeichardt, Zouboulis, Orfanos. (1998) Progressive HHV-8-positive classic Kaposi's sarcoma: rapid response to interferon alpha-2a but persistence of HHV-8 DNA sequences in lesional skin. British Journal of Dermatology 139:3, 516-519
CrossRef27
Kimberly E. Foreman, Serhan Alkan, Ann E. Krueger, Jeffrey R. Panella, Lode J. Swinnen, Brian J. Nickoloff. (1998) Geographically Distinct HHV-8 DNA Sequences in Saudi Arabian Iatrogenic Kaposi's Sarcoma Lesions. The American Journal of Pathology 153:3, 1001-1004
CrossRef28
Yi-Chun James Wang, Qin Zhang, Eduardo A. Montalvo. (1998) Purification of Kaposi's sarcoma-associated herpesvirus (human herpesvirus 8) and analyses of the structural proteins. Journal of Virological Methods 73:2, 219-228
CrossRef29
Kamal G. Ishak, Karen E. Bijwaard, Hala R. Makhlouf, Jeffery K. Taubenberger, Jack H. Lichy, Zachary D. Goodman. (1998) Absence of human herpesvirus 8 DNA sequences in vascular tumors of the liver*. Liver 18:2, 124-127
CrossRef30
Eric D. Hsi, Kimberly E. Foreman, Joan Duggan, Serhan Alkan, Carol A. Kauffman, Herbert D. Aronow, Brian J. Nickoloff. (1998) Molecular and Pathologic Characterization of an AIDS-Related Body Cavity-Based Lymphoma, Including Ultrastructural Demonstration of Human Herpesvirus-8. The American Journal of Surgical Pathology 22:4, 493-499
CrossRef31
Ruth M. Greenblatt. (1998) KAPOSI'S SARCOMA AND HUMAN HERPESVIRUS-8. Infectious Disease Clinics of North America 12:1, 63-82
CrossRef32
Elena A. Panyutich, Jonathan W. Said, Steven A. Miles. (1998) Infection of primary dermal microvascular endothelial cells by Kaposiʼs sarcoma-associated herpesvirus. AIDS 12:5, 467-472
CrossRef33
S.R Porter, L Di Alberti, N Kumar. (1998) Human herpes virus 8 (Kaposi’s sarcoma herpesvirus). Oral Oncology 34:1, 5-14
CrossRef34
Clay Smith, Scott Lilly, Karen P Mann, Elizabeth Livingston, Sarah Myers, H Kim Lyerly, G Diego Miralles. (1998) AIDS-related malignancies. Annals of Medicine 30:4, 323-344
CrossRef35
JOAN N. BREUER-McHAM, GAILEN D. MARSHALL, DOROTHY E. LEWIS, MADELEINE DUVIC. (1998) Distinct Serum Cytokines in AIDS-Related Skin Diseases. Viral Immunology 11:4, 215-220
CrossRef36
Reinhold Munker, Taizo Tasaka, Dorothy Park, Carl W. Miller, H. Phillip Koeffler. (1997) HHV-8 (KSHV) does not establish latency in prostate cancer cell lines. The Prostate 33:4, 286-288
CrossRef37
Maria M. Medveczky, Elizabeth Horvath, Troy Lund, Peter G. Medveczky. (1997) In vitro antiviral drug sensitivity of the Kaposiʼs sarcoma-associated herpesvirus. AIDS 11:11, 1327-1332
CrossRef38
M DICTOR. (1997) Human herpesvirus 8 and Kaposi's sarcoma1. Seminars in Cutaneous Medicine and Surgery 16:3, 181-187
CrossRef39
(1997) Propagation of a Human Herpesvirus from AIDS-Associated Kaposi's Sarcoma. New England Journal of Medicine 336:25, 1837-1839
Full Text40
Jay A Levy. (1997) Three new human herpesviruses (HHV6, 7, and 8). The Lancet 349:9051, 558-563
CrossRef41
Mocarski, Edward S. Jr.. (1997) Propagating Kaposi's Sarcoma–Associated Herpesvirus. New England Journal of Medicine 336:3, 214-215
Full Text
- Letters
