Original Article
Brief Report
Interferon-γ –Receptor Deficiency in an Infant with Fatal Bacille Calmette–Guérin Infection
N Engl J Med 1996; 335:1956-1962December 26, 1996
- Article
The attenuated strain of Mycobacterium bovis bacille Calmette–Guérin (BCG) is the most widely used vaccine in the world. In most children, inoculation of live BCG vaccine is harmless although it occasionally leads to a benign regional adenitis.1 In rare cases, however, vaccination causes disseminated BCG infection, which may be lethal. Impaired immunity of the host is generally thought to be the pathogenic mechanism. Disseminated BCG infection has been reported in children with inherited immune disorders. Most of these children had severe combined immunodeficiency, which is characterized by an absence of T cells, and some had chronic granulomatous disease, which is marked by an impairment of the phagocyte respiratory burst.2,3 Rare cases of BCG infection have also been reported in association with the acquired immunodeficiency syndrome.2
However, a specific immunodeficiency can be identified in only about half the cases of disseminated BCG infection.2 In the other cases, the pathogenesis remains unclear. Such idiopathic cases have been reported in 24 countries, with a prevalence in France of at least 0.59 case per 1 million children vaccinated with BCG.4 The high rates of consanguinity (30 percent) and familial forms (17 percent) and the equal sex distribution support the hypothesis of a new type of primary immune disorder with an autosomal recessive pattern of inheritance.
The pathological features and clinical outcomes suggest that there are two distinct forms of idiopathic BCG infection and a genetic heterogeneity of the underlying immune disorder.5 Well-circumscribed and well-differentiated tuberculoid granulomas with few visible acid-fast rods are associated with a good prognosis. In contrast, ill-defined and poorly differentiated, leproma-like granulomas with many visible bacilli are associated with a fatal outcome, despite antimycobacterial therapy. We reasoned that the latter form of idiopathic BCG infection most likely results from a genetic defect affecting an obligatory and relatively specific step in the formation of a bactericidal BCG granuloma.
Mice in which the gene for the interferon-γ –receptor high-affinity binding chain (interferon-γR1) has been deleted are highly susceptible to BCG infection, with defects in granuloma structure and a fatal outcome.6 In mice with deletions of the interferon-γ gene or the gene for interferon-γ regulatory factor 1 (IRF1), there is a failure to control BCG growth.7,8 Mice treated with antibodies against tumor necrosis factor α (TNF-α) are susceptible to BCG infection, with defective granuloma structure and a fatal outcome.9 Such a dramatic effect is not observed, however, in mice with deletions of the gene for TNF-α receptor 1 (TNF-αR1).10
We examined the five genes coding for interferon-γ, interferon-γR1, IRF1, TNF-α, and TNF-αR1 in a child with fatal idiopathic disseminated BCG infection. We found a mutation of the gene for interferon-γR1. There was no detectable interferon-γR1 on the cells from the affected child. These findings provide further evidence of the importance of interferon-γ in the response to mycobacterial infection.
Case Report
A girl was born at term to parents of Tunisian origin who were first cousins (Patient 16 in Casanova et al.4). Her size and weight were normal, and she had no overt developmental defects. She was vaccinated with 25 mg of BCG substrain Pasteur at one month of age. Two older brothers, previously vaccinated with BCG, were healthy. She was healthy until 2.5 months of age, when fever and regional adenitis developed. Cachexia, granulomatous dermatitis, hepatosplenomegaly, lymph-node enlargement, diffuse pneumonitis, and multiple osteolytic lesions developed rapidly, with continued fever. The values for blood leukocytes, erythrocyte sedimentation rate, serum C-reactive protein, and serum fibrinogen were elevated. Lymph-node and skin biopsies revealed ill-circumscribed areas of macrophages filled with acid-fast bacilli (Figure 1Figure 1
Leproma-like Granuloma in a Lymph-Node–Biopsy Specimen from an Infant with Bacille Calmette–Guérin Infection.). There were no epithelioid or giant cells or surrounding lymphocytes within these leproma-like granulomas. Treatment with antimycobacterial agents (including rifampin, isoniazid, ethambutol, streptomycin, and clofazimine) was initiated. One month later, a mycobacterium species was cultured from the lungs and bone marrow and identified as M. bovis BCG strain.Despite antimycobacterial treatment and adjuvant treatment with interferon gamma, the child died at the age of 10 months from BCG infection with multiorgan failure, including bone marrow and liver failure. No other opportunistic infectious agents were identified. Neither autoimmune nor allergic processes were noted. A diagnosis of idiopathic disseminated BCG infection was made on the basis of the absence of clinical, radiologic, or biologic signs of any known immunodeficiency.3 In particular, the spleen and lymph nodes were grossly normal. Immunologic studies showed a normal leukocyte count, including normal proportions of polymorphonuclear cells, B cells, CD4 and CD8 T cells, α/β and γ/δ T cells, and natural killer cells. IgM, IgG, IgA, and IgE levels were within the normal ranges or elevated. Complement levels were within the normal ranges. Lymphocyte-function–associated antigen 1 and HLA class I and II molecules were present on the cell surface. The reduction of nitroblue tetrazolium by neutrophilic polymorphonuclear leukocytes was normal. Mitogen-driven and tuberculin-driven T-cell proliferations were normal. A test of delayed hypersensitivity to purified protein derivative (10 IU) was positive (a 16-mm induration). Antimycobacterial serologic studies were also positive. Specific serologic tests for tetanus toxoid and poliovirus were positive after immunization. Repeated serologic tests for infection with the human immunodeficiency virus were negative. All further investigations, reported below, were performed on a B-cell line transformed by Epstein–Barr virus (EBV).
Methods
Microsatellites
The genes coding for human TNF-α, TNF-αR1, interferon-γ (IFN-γ), and IRF1 have been mapped to 6p21.3, 12p13, 12q24, and 5q31.1, respectively. Polymorphic microsatellites within a 2-cM interval around each of these genes, available from human-genome data bases, included TNF1 (for TNF- α), D12S93 and D12S314 (for TNF-αR1), D12S342 (for IFN- γ), and D5S393 (for IRF1). The IFN-γR1 gene was mapped at the Genethon Laboratories (Evry, France) with the use of irradiation hybrids within a larger (10 cM) interval (D6S262 through D6S293) on 6q21–q23.
Sequencing of Complementary DNA
Total RNA was extracted from EBV-transformed B cells in guanidium isothiocyanate, as described elsewhere.11 Complementary DNA (cDNA) was synthesized by incubating 10 μg of total RNA with oligo-dT12-18 and avian myeloblastosis virus reverse transcriptase according to the manufacturer's instructions (Boehringer Mannheim, Mannheim, Germany). Polymerase chain reaction (PCR) with IFN-γR1 sense (5'TTAAGCTTGGAGCCAGCGACCGT3') and antisense (5'CGGATCCAAAGTTGGTGCAACT3') primers12 was carried out with a mixture of Taq polymerase (Promega, Madison, Wis.) and Pfu polymerase (Stratagene, La Jolla, Calif.) under the following conditions: five minutes at 94°C, followed by 35 cycles, each for one minute at 94°C, two minutes at 55°C, and three minutes at 72°C. PCR products were treated with Taq polymerase and deoxyadenosine triphosphate for 60 minutes at 72°C, ligated to pGEM-T vectors (Promega), and transformed into JM109 bacteria. Recombinant phagemids were sequenced with Sequenase or Thermosequenase (U.S. Biochemical, Cleveland) with the use of a series of nested primers. Double-stranded PCR products were directly sequenced on both strands around nucleotide 131 (nucleotides were numbered starting with the ATG sequence initiating the coding region) with Sequenase13 or Thermosequenase.
Genomic PCR
Genomic DNA was extracted from EBV-transformed B cells with proteinase K, sodium dodecyl sulfate, and a series of phenol–chloroform extractions.11 Genomic sense (5'GCCTACACCAACTAATGTTA3') and antisense (5'ATAGTTCTTTACCTCTACGG3') primers within exon 2 of the IFN- γR1 gene (Merlin G, et al.: personal communication) were used for genomic PCR. Genomic PCR was performed with the incorporation of [α32P]deoxycytidine triphosphate and analyzed on a sequencing gel.
Northern Blotting
Total RNA (10 μg) from EBV-transformed B cells was run on a formaldehyde–agarose gel, transferred to a nylon membrane, and hybridized with a 32P-labeled double-stranded DNA probe corresponding to the IFN-γR1 PCR product or to an actin fragment.11
Assay of 125I-Labeled–Interferon-γ Binding
One million EBV-transformed B cells were incubated for two hours at 4°C in RPMI 1640 supplemented with 5 percent fetal-calf serum in the presence of various amounts of 125I-labeled interferon-γ (specific radioactivity, 50×106 cpm per microgram). Parallel samples were incubated under the same conditions with a 100-fold excess of unlabeled interferon-γ. Cell suspensions were washed four times with phosphate-buffered saline containing 1 percent fetal-calf serum, 0.1 mM calcium chloride, and 0.1 mM magnesium chloride, and the radioactivity of the cell pellet was counted. Specific binding was calculated as the bound radioactivity that could be displaced by cold interferon-γ (the mean value of triplicate measurements).
Cell Staining
The available murine monoclonal antibodies specific for human interferon-γR1 were 5362-6545 (IgG1) (Valbiotech, Paris) and 1224-00 (IgG2b) (Genzyme, Cambridge, Mass.). Cells (2×105) were incubated first in RPMI containing 10 percent AB+ serum with 2 μg of ad hoc monoclonal antibodies, then with a biotinylated goat antimouse antibody (Immunotech, Marseille, France), and finally with streptavidin–phycoerythrin (Tebu, Paris). Staining was detected by flow cytometry (Becton Dickinson, Oxford, United Kingdom). Specific staining of interferon-γR1 on EBV-transformed B cells was deduced from that obtained with an isotypic control antibody.
Results
We first analyzed the intrafamilial segregation of polymorphic microsatellites located near each of the five candidate genes coding for TNF-α, TNF-αR1, interferon-γ, interferon-γR1, and IRF1. Since the child had been born to consanguineous parents, she was most likely homozygous for a mutant allele inherited from a common ancestor. Thus, we reasoned that microsatellite heterozygosity would rule out nearby genes, and homozygosity would prompt further investigation. Intrafamilial segregation of microsatellites suggested that only the gene coding for interferon-γR1 warranted further investigation (data not shown).
Interferon-γR1 is ubiquitously expressed, and the cDNA coding region could therefore be amplified and sequenced from an EBV-transformed B-cell line. Two recombinant phagemids from distinct PCR products lacked nucleotide 131 in the coding region (Figure 2AFigure 2
Mutation of the Messenger RNA Coding Region of the Interferon-γR1 Gene.).12 No other mutations were found. The single-base deletion was confirmed by direct sequencing of an independent PCR product (Figure 2B). The single-nucleotide deletion designated 131delC creates a frame shift and leads to a premature stop codon (TAA) at nucleotides 187 through 189 (Figure 2C). Both the deletion and the stop codon are located in a region that codes for the N-terminal portion of the extracellular domain of the receptor.Intrafamilial segregation of the mutant allele of the IFN-γR1 gene was analyzed to confirm its role in the pathogenic process. On the basis of the genomic structure of IFN- γR1 (Merlin G, Dembic Z: personal communication), the mutation was determined to be located in exon 2 (Figure 2C). A genomic PCR product around the single-base deletion within exon 2 showed that the affected child carried the mutant allele at both IFN-γR1 loci (Figure 3Figure 3
Intrafamilial Segregation of the Mutation in the Interferon-γ R1 Gene.). Both her parents and her two healthy brothers were heterozygous carriers.Northern blot analysis revealed a considerable decrease in detectable interferon-γR1 messenger RNA (mRNA) in EBV-transformed B cells from the affected child, presumably due to a rapid degradation of the transcript (Figure 4AFigure 4
Results of Studies of Cell-Surface Interferon-γ Receptor (Interferon-γ R1) in the Patient and a Control.). Hybridization of the same blot with a control probe (actin) revealed no difference in size or intensity between mRNA from a control and mRNA from the patient. The 2.3-kb specific transcript, along with a degradation smear, was visible with longer exposure (data not shown).We analyzed the expression of interferon-γR1 on the EBV-transformed B-cell surface by flow cytometry with two specific monoclonal antibodies (Figure 4B). The specific binding of two monoclonal antibodies, each expressing a distinct isotype, on a control cell line was faint. The expression of cell-surface interferon-γR1 on the cell line from the affected child, however, was not detectable on repeated experiments with either monoclonal antibody.
Specific binding of 125I-labeled interferon-γ was determined on EBV-transformed B cells from a control and the patient to confirm the absence of an interferon-γR1 binding site for interferon-γ on the cell surface (Figure 4C). As expected, there was dose-dependent specific interferon-γ binding in the control cell line. In contrast, there was dramatically reduced specific binding in the patient's cell line. Scatchard analysis revealed high-affinity (association constant, 1.25×10-9 M) specific binding on approximately 6500 binding sites per cell in the control line. The residual specific binding in the patient's cell line did not allow a precise Scatchard analysis. Altogether, our data show a complete deficiency of cell-surface expression of interferon-γR1 in the child.
Discussion
In this child with a fatal BCG infection and in a kindred with atypical mycobacterial infection described by Newport et al. in this issue of the Journal, 14 similar, yet distinct, mutations of the IFN-γR1 gene were found that precluded the expression of interferon-γR1. It thus appears that a complete deficiency of interferon-γR1 may lead to BCG infection in vaccinated children or to atypical mycobacterial infection in unvaccinated persons. The prognosis appears to be worst after BCG vaccination, probably because of the higher virulence of BCG as compared with most atypical mycobacteria, the higher number of infecting BCG organisms, or the direct intradermal inoculation of BCG as opposed to natural routes of infection with atypical mycobacteria. In any event, vaccination with all currently used live BCG substrains is contraindicated in children with interferon-γR deficiency. Whether new generations of live vaccine, such as auxotrophic BCG substrains,15 are safe and even protective in such children is unknown.
Fatal disseminated BCG or atypical mycobacterial infections in other patients may be due to a complete deficiency of interferon-γR1. Milder forms of idiopathic disseminated BCG infections, characterized by well-circumscribed tuberculoid granulomas and few visible acid-fast rods within macrophages, have a favorable outcome5 and may represent either different mutations of the IFN-γR1 gene or mutation of another gene. Furthermore, alternative or heterozygous mutations of the IFN-γR1 gene may contribute to the genetic susceptibility to more virulent mycobacteria in tuberculosis16 or leprosy.17 Mutations of the IFN-γR1 gene may also confer a predisposition to other infections with intracellular microorganisms, such as salmonella, which are frequently associated with idiopathic BCG or atypical mycobacterial infections.4 In any event, a complete deficiency of interferon-γR1 provides molecular evidence of a selective genetic susceptibility to mycobacterial infection.
From recent studies in mice, much has been learned about the characteristics of interferon-γ at the cellular level.6-8,18-20 After macrophage stimulation, such as that produced by mycobacterial infection, the secretion of TNF-α, interleukin-12, and possibly other factors by macrophages promotes interferon-γ secretion by natural killer cells, differentiation of antigen-driven CD4 T cells into interferon-γ –producing TH1 cells, and activation of these TH1 cells to secrete interferon-γ and possibly other macrophage-activating factors.18,19 Secretion of interferon-γ, in turn, results in macrophage secretion of TNF-α9; activation of macrophage mycobactericidal mechanisms, such as nitric oxide production8; and impaired proliferation of interleukin-4–secreting TH2 cells.20
It is likely that the susceptibility to mycobacterial infection in children with a complete deficiency of interferon-γR1 results primarily from an intrinsic impairment of macrophages rather than a defective TH1 response. The strongly positive test for delayed hypersensitivity to tuberculin in the child we studied reflects a normal TH1 response, which is similar to the findings in mice with deletions of the IFN- γR1 gene.21 The normal TH1 response may result from the fact that interferon-γ does not directly promote TH1 responses but instead impairs TH2 responses.20 The uncontrolled growth of mycobacteria within macrophages from interferon-γR1–deficient children is probably due to impaired activation of bactericidal mechanisms rather than impaired induction of major-histocompatibility-complex (MHC) class II molecules. Indeed, disseminated BCG infection after vaccination has not been reported in children with a complete deficiency of MHC class II molecules.2 In vitro experiments in humans provide conflicting evidence, with interferon-γ alternatively enhancing or reducing the growth of mycobacteria within cultured monocyte macrophages.22-28 Moreover, the mycobactericidal mechanisms of human macrophages remain largely unknown.28 Thus, it is likely that the macrophage has a causal role in the pathogenesis of mycobacterial infections associated with interferon-γR1 deficiency, but more direct and definitive evidence of such a role is required.
The selective susceptibility of children with a complete deficiency of interferon-γR1 contrasts with the broad susceptibility of mice with deletions of the IFN-γ or IFN-γR1 gene, which are susceptible not only to mycobacterial infection,6,7,29,30 but also to infection with other intracellular31 or extracellular32 bacteria, as well as a number of viruses31,33-35 and parasites.21,36 Children with interferon-γR1 deficiency do not appear to be susceptible to infection with agents other than mycobacteria. This apparently selective susceptibility may be the result of an underestimation of human interferon-γ –mediated immunity due to early cases of fatal mycobacterial infection that preclude exposure to other potential pathogens; an overestimation of murine interferon-γ –mediated immunity due to experimental, as opposed to natural, modes of infection; or intrinsic differences between human and murine interferon-γ –mediated immunity.
The clinical features and outcome of interferon-γR1 deficiency in children show that interferon-γ is obligatory for both an appropriate granuloma structure and efficient macrophage antimycobacterial activity. This condition thus adds weight to the growing evidence supporting the use of interferon-γ as a therapeutic agent in patients with other mycobacterial diseases.37,38
Supported by grants from the Institut National de la Santé et de la Recherche Medicale, Association Française contre les Myopathies, Institut Smithkline Beecham, Fondation Marcel Mérieux, Centre International des Etudiants et Stagiaires, Glaxo Wellcome, and Fonds d'Etudes et de Recherche des Hôpitaux de Paris.
We are indebted to Dr. J. Wietzerbin for the interferon-γ binding assay; to Drs. G. Merlin and Z. Dembic for the IFN-γR1 genomic structure; to C. Hein for the microsatellite analysis; to Dr. F. Le Deist for immunologic investigations; to Dr. S. Ben Becher for the referral of the patient's family; to Drs. D. Devictor, J.P. Dommergues, and G. Huault for the referral of the patient; to Dr. L. Jacques for the identification of the BCG strain; to Dr. J. Quillard for the biopsy specimen; to Drs. R. Dufourcq, J. Peake, J. Di Santo, F. Godeau, and D. Guy-Grand for helpful comments; and to Drs. P. Kourilsky and J.L. Maryanski for scientific guidance.
Source Information
From INSERM Unité 429 (E.J., F.A., S.L., P.R., A.F., J.-L.C.) and the Department of Pathology (J.-F.E.), Hôpital Necker–Enfants Malades, Paris; the Department of Pediatrics, Imperial College of Science, Technology, and Medicine, St. Mary's Hospital, London (M.N., M.L.); Genethon Laboratories, Evry, France (E.S.); and Unité d'Immunologie et Hématologie Pédiatrique, Hôpital Necker, Paris (S.B., A.F., J.-L.C.).
Address reprint requests to Dr. Casanova at INSERM U429, Pavillon Kirmisson, Hôpital Necker –Enfants Malades, 149 rue de Sèvres, 75015 Paris, France.
- References
References
1
Lotte A ,Wasz-Hockert O ,Poisson N ,Dumitrescu N ,Verron M ,Couvet E . BCG complications: estimates of the risks among vaccinated subjects and statistical analysis of their characteristics. Adv Tuberc Res 1984;21:107-193
Medline2
Casanova J-L ,Jouanguy E ,Lamhamedi S ,Blanche S ,Fischer A . Immunological conditions of children with BCG disseminated infection. Lancet 1995;346:581-581
CrossRef | Web of Science | Medline3
Primary immunodeficiency diseases: report of a WHO scientific groupClin Exp Immunol 1995;99:Suppl 1:1-24
CrossRef | Web of Science | Medline4
Casanova J-L ,Blanche S ,Emile J-F , et al. Idiopathic disseminated bacillus Calmette-Guérin (BCG) infection: a French national retrospective study. Pediatrics 1996;98:774-778
Web of Science | Medline5
Emile J-F, Patey N, Altare F, et al. Correlation of granuloma structure with clinical outcome defines two types of idiopathic disseminated bacillus Calmette-Guérin (BCG) infection. J Pathol (in press).
6
Kamijo R ,Le J ,Shapiro D , et al. Mice that lack the interferon-γ receptor have profoundly altered responses to infection with bacillus Calmette-Guérin and subsequent challenge with lipopolysaccharide. J Exp Med 1993;178:1435-1440
CrossRef | Web of Science | Medline7
Dalton DK ,Pitts-Meek S ,Keshav S ,Figari IS ,Bradley A ,Stewart TA . Multiple defects of immune cell function in mice with disrupted interferon-γ genes. Science 1993;259:1739-1742
CrossRef | Web of Science | Medline8
Kamijo R ,Harada H ,Matsuyama T , et al. Requirement for transcription factor IRF-1 in NO synthase induction in macrophages. Science 1994;263:1612-1615
CrossRef | Web of Science | Medline9
Kindler V ,Sappino AP ,Grau GE ,Piguet PF ,Vassalli P . The inducing role of tumor necrosis factor in the development of bactericidal granulomas during BCG infection. Cell 1989;56:731-740
CrossRef | Web of Science | Medline10
Flynn JL ,Goldstein MM ,Chan J , et al. Tumor necrosis factor-α is required in the protective immune response against Mycobacterium tuberculosis in mice. Immunity 1995;2:561-572
CrossRef | Web of Science | Medline11
Sambrook J, Fritsch EF, Maniatis T. Molecular cloning: a laboratory manual. 2nd ed. Cold Spring Harbor, N.Y.: Cold Spring Harbor Laboratory, 1989.
12
Aguet M ,Dembic Z ,Merlin G . Molecular cloning and expression of the human interferon-γ receptor. Cell 1988;55:273-280
CrossRef | Web of Science | Medline13
Casanova JL ,Pannetier C ,Jaulin C ,Kourilsky P . Optimal conditions for directly sequencing double-stranded PCR products with sequenase. Nucleic Acids Res 1990;18:4028-4028
CrossRef | Web of Science | Medline14
Newport MJ ,Huxley CM ,Huston S , et al. A mutation in the interferon-γ-receptor gene and susceptibility to mycobacterial infection. N Engl J Med 1996;335:1941-1949
Full Text | Web of Science | Medline15
Guleira I ,Teitelbaum R ,McAdam RA ,Kalpana G ,Jacobs WR Jr ,Bloom BR . Auxotrophic vaccines for tuberculosis. Nat Med 1996;2:334-337
CrossRef | Web of Science | Medline16
Stead WW . Genetics and resistance to tuberculosis: could resistance be enhanced by genetic engineering? Ann Intern Med 1992;116:937-941
Web of Science | Medline17
Abel L ,Demenais F . Detection of major genes for susceptibility to leprosy and its subtypes in a Caribbean island: Desirade island. Am J Hum Genet 1988;42:256-266
Web of Science | Medline18
Farrar MA ,Schreiber RD . The molecular cell biology of interferon-γ and its receptor. Annu Rev Immunol 1993;11:571-611
CrossRef | Web of Science | Medline19
Magram J ,Connaughton SE ,Warrier RR , et al. IL-12-deficient mice are defective in IFNγ production and type 1 cytokine production. Immunity 1996;4:471-481
CrossRef | Web of Science | Medline20
Bach EA ,Szabo SJ ,Dighe AS , et al. Ligand-induced autoregulation of IFN-γ receptor β chain expression in T helper cell subsets. Science 1995;270:1215-1218
CrossRef | Web of Science | Medline21
Swihart K ,Fruth U ,Messmer N , et al. Mice from a genetically resistant background lacking the interferon γ receptor are susceptible to infection with Leishmania major but mount a polarized T helper cell 1-type CD4+ T cell response. J Exp Med 1995;181:961-971
CrossRef | Web of Science | Medline22
Douvas GS ,Looker DL ,Vatter AE ,Crowle AJ . Gamma interferon activates human macrophages to become tumoricidal and leishmanicidal but enhances replication of macrophage-associated mycobacteria. Infect Immun 1985;50:1-8
Web of Science | Medline23
Rook GAW ,Steele J ,Fraher L , et al. Vitamin D3, γ interferon, and control of proliferation of Mycobacterium tuberculosis by human monocytes. Immunology 1986;57:159-163
Web of Science | Medline24
Rook GAW ,Steele J ,Ainsworth M ,Champion BR . Activation of macrophages to inhibit proliferation of Mycobacterium tuberculosis: comparison of the effects of recombinant γ-interferon on human monocytes and murine peritoneal macrophages. Immunology 1986;59:333-338
Web of Science | Medline25
Crowle AJ . Intracellular killing of mycobacteria. Res Microbiol 1990;141:231-236
CrossRef | Web of Science | Medline26
Denis M . Killing of Mycobacterium tuberculosis within human monocytes: activation by cytokines and calcitriol. Clin Exp Immunol 1991;84:200-206
CrossRef | Web of Science | Medline27
Denis M . Growth of Mycobacterium avium in human monocytes: identification of cytokines which reduce and enhance intracellular microbial growth. Eur J Immunol 1991;21:391-395
CrossRef | Web of Science | Medline28
Flesch IEA ,Kaufmann SHE . Role of cytokines in tuberculosis. Immunobiology 1993;189:316-339
CrossRef | Web of Science | Medline29
Cooper AM ,Dalton DK ,Stewart TA ,Griffin JP ,Russell DG ,Orme IM . Disseminated tuberculosis in interferon γ gene-disrupted mice. J Exp Med 1993;178:2243-2247
CrossRef | Web of Science | Medline30
Flynn JL ,Chan J ,Triebold KJ ,Dalton DK ,Stewart TA ,Bloom BR . An essential role for interferon γ in resistance to Mycobacterium tuberculosis infection. J Exp Med 1993;178:2249-2254
CrossRef | Web of Science | Medline31
Huang S ,Hendriks W ,Althage A , et al. Immune response in mice that lack the interferon-gamma receptor. Science 1993;259:1742-1745
CrossRef | Web of Science | Medline32
Zhao Y-X ,Tarkowski A . Impact of interferon-γ receptor deficiency on experimental Staphylococcus aureus septicemia and arthritis. J Immunol 1995;155:5736-5742
Web of Science | Medline33
Muller U ,Steinhoff U ,Reis LFL , et al. Functional role of type I and type II interferons in antiviral defense. Science 1994;264:1918-1921
CrossRef | Web of Science | Medline34
Fiette L ,Aubert C ,Muller U . Theiler's virus infection of 129Sv mice that lack the interferon α/β or interferon γ receptors. J Exp Med 1995;181:2069-2076
CrossRef | Web of Science | Medline35
Bouley DM ,Kanangat S ,Wire W ,Rouse BT . Characterization of herpes simplex virus type-1 infection and herpetic stromal keratitis development in IFN-gamma knockout mice. J Immunol 1995;155:3964-3971
Web of Science | Medline36
Tsuji M, Miyahira Y, Nussenzweig RS, Aguet M, Reichel M, Zavala F. Development of antimalarial immunity in mice lacking IFN-γ receptor.J Immunol 1995;154:5338-44.
37
Murray HW . Interferon-γ and host antimicrobial defense: current and future clinical applications. Am J Med 1994;97:459-467
CrossRef | Web of Science | Medline38
Bermudez LE ,Kaplan G . Recombinant cytokines for controlling mycobacterial infections. Trends Microbiol 1995;3:22-27
CrossRef | Medline
- Citing Articles (242)
Citing Articles
1
L. B. Barreiro, L. Tailleux, A. A. Pai, B. Gicquel, J. C. Marioni, Y. Gilad. (2012) Deciphering the genetic architecture of variation in the immune response to Mycobacterium tuberculosis infection. Proceedings of the National Academy of Sciences
CrossRef2
Vidya Sundareshan, Jignesh Modi, Nancy Misri Khardori. (2011) Mycobacteria and Biological Response Modifiers: Two Sides of the Relationship. Infectious Disease Clinics of North America 25:4, 865-893
CrossRef3
Jacinta Bustamante, Capucine Picard, Stéphanie Boisson-Dupuis, Laurent Abel, Jean-Laurent Casanova. (2011) Genetic lessons learned from X-linked Mendelian susceptibility to mycobacterial diseases. Annals of the New York Academy of Sciences 1246:1, 92-101
CrossRef4
Mohamed-Ridha Barbouche, Nermeen Galal, Imen Ben-Mustapha, Leïla Jeddane, Fethi Mellouli, Fatima Ailal, Mohamed Bejaoui, Jeanette Boutros, Aisha Marsafy, Ahmed Aziz Bousfiha. (2011) Primary immunodeficiencies in highly consanguineous North African populations. Annals of the New York Academy of Sciences 1238:1, 42-52
CrossRef5
B. Nandi, S. M. Behar. (2011) Regulation of neutrophils by interferon- limits lung inflammation during tuberculosis infection. Journal of Experimental Medicine 208:11, 2251-2262
CrossRef6
Rabia Hussain, Najeeha Talat, Ambreen Ansari, Firdaus Shahid, Zahra Hasan, Ghaffar Dawood. (2011) Endogenously Activated Interleukin-4 Differentiates Disease Progressors and Non-Progressors in Tuberculosis Susceptible Families: A 2-Year Biomarkers Follow-Up Study. Journal of Clinical Immunology 31:5, 913-923
CrossRef7
Yusuf Akhter, Matthias T. Ehebauer, Sangita Mukhopadhyay, Seyed E. Hasnain. (2011) The PE/PPE multigene family codes for virulence factors and is a possible source of mycobacterial antigenic variation: Perhaps more?. Biochimie
CrossRef8
Mark J. Cayabyab, Suely S. Kashino, Antonio Campos-Neto. (2011) Robust Immune Response Elicited by a Novel and Unique Mycobacterium tuberculosis Protein Using an Optimized DNA / Protein Heterologous Prime / Boost Protocol. Immunologyno-no
CrossRef9
Yuriko Ozeki, Yukio Hirayama, Takemasa Takii, Saburo Yamamoto, Kazuo Kobayashi, Sohkichi Matsumoto. (2011) Loss of anti-mycobacterial efficacy in mice over time following vaccination with Mycobacterium bovis bacillus Calmette-Guérin. Vaccine 29:40, 6881-6887
CrossRef10
Walid Ben Selma, Hedi Harizi, Iheb Bougmiza, Naila Hannachi, Imen Ben Kahla, Radhia Zaieni, Jalel Boukadida. (2011) Interferon Gamma +874T/A Polymorphism Is Associated with Susceptibility to Active Pulmonary Tuberculosis Development in Tunisian Patients. DNA and Cell Biology 30:6, 379-387
CrossRef11
Nazan Dalgic, Deniz Tekin, Zeliha Kayaalti, Tulin Soylemezoglu, Erkan Cakir, Betul Kilic, Busra Kutlubay, Mesut Sancar, Miyase Odabasi. (2011) Arg753Gln polymorphism of the human Toll-like receptor 2 gene from infection to disease in pediatric tuberculosis. Human Immunology 72:5, 440-445
CrossRef12
I. Sologuren, S. Boisson-Dupuis, J. Pestano, Q. B. Vincent, L. Fernandez-Perez, A. Chapgier, M. Cardenes, J. Feinberg, M. I. Garcia-Laorden, C. Picard, E. Santiago, X. Kong, L. Janniere, E. Colino, E. Herrera-Ramos, A. Frances, C. Navarrete, S. Blanche, E. Faria, P. Remiszewski, A. Cordeiro, A. Freeman, S. Holland, K. Abarca, M. Valeron-Lemaur, J. Goncalo-Marques, L. Silveira, J. M. Garcia-Castellano, J. Caminero, J. L. Perez-Arellano, J. Bustamante, L. Abel, J.-L. Casanova, C. Rodriguez-Gallego. (2011) Partial recessive IFN- R1 deficiency: genetic, immunological and clinical features of 14 patients from 11 kindreds. Human Molecular Genetics 20:8, 1509-1523
CrossRef13
D. Qiao, B. Y. Yang, L. Li, J. J. Ma, X. L. Zhang, S. H. Lao, C. Y. Wu. (2011) ESAT-6- and CFP-10-Specific Th1, Th22 and Th17 Cells in Tuberculous Pleurisy May Contribute to the Local Immune Response Against Mycobacterium Tuberculosis Infection. Scandinavian Journal of Immunology 73:4, 330-337
CrossRef14
Nima Rezaei, Asghar Aghamohammadi, Davood Mansouri, Nima Parvaneh, Jean-Laurent Casanova. (2011) Tuberculosis: a new look at an old disease. Expert Review of Clinical Immunology 7:2, 129-131
CrossRef15
Lilia Romdhane, Sonia Abdelhak, , . (2011) Genetic diseases in the Tunisian population. American Journal of Medical Genetics Part A 155:1, 238-267
CrossRef16
Jeffrey R. Starke, Andrea T. Cruz. 2011. Tuberculosis. , 577-600.
CrossRef17
LE Cottle. (2011) Mendelian susceptibility to mycobacterial disease. Clinical Genetics 79:1, 17-22
CrossRef18
Kerry J. Welsh, Shen-An Hwang, Robert L. Hunter, Marian L. Kruzel, Jeffrey K. Actor. (2010) Lactoferrin modulation of mycobacterial cord factor trehalose 6-6'-dimycolate induced granulomatous response. Translational Research 156:4, 207-215
CrossRef19
Madhuri Bhuvanagiri, Anna M. Schlitter, Matthias W. Hentze, Andreas E. Kulozik. (2010) NMD: RNA biology meets human genetic medicine. Biochemical Journal 430:3, 365-377
CrossRef20
V. M. Yates. 2010. Mycobacterial Infections. , 1-41.
CrossRef21
Alain Fischer. 2010. The Immunocompromised Host. .
CrossRef22
Marie-Anne Shaw. 2010. Immunogenetics. .
CrossRef23
Pamela Nicholson, Hasmik Yepiskoposyan, Stefanie Metze, Rodolfo Zamudio Orozco, Nicole Kleinschmidt, Oliver Mühlemann. (2010) Nonsense-mediated mRNA decay in human cells: mechanistic insights, functions beyond quality control and the double-life of NMD factors. Cellular and Molecular Life Sciences 67:5, 677-700
CrossRef24
Carolina Prando, Stéphanie Boisson-Dupuis, Audrey V. Grant, Xiao-Fei Kong, Jacinta Bustamante, Jacqueline Feinberg, Ariane Chapgier, Yoann Rose, Lucile Jannière, Elena Rizzardi, Qiuping Zhang, Catherine M. Shanahan, Louis Viollet, Stanislas Lyonnet, Laurent Abel, Ezia Maria Ruga, Jean-Laurent Casanova. (2010) Paternal uniparental isodisomy of chromosome 6 causing a complex syndrome including complete IFN-γ receptor 1 deficiency. American Journal of Medical Genetics Part A 152A:3, 622-629
CrossRef25
Y. Ozeki, I. Sugawara, T. Udagawa, T. Aoki, M. Osada-Oka, Y. Tateishi, H. Hisaeda, Y. Nishiuchi, N. Harada, K. Kobayashi, S. Matsumoto. (2010) Transient role of CD4+CD25+ regulatory T cells in mycobacterial infection in mice. International Immunology 22:3, 179-189
CrossRef26
Diederik van de Wetering, Roelof A. de Paus, Jaap T. van Dissel, Esther van de Vosse. (2010) Functional analysis of naturally occurring amino acid substitutions in human IFN-γR1. Molecular Immunology 47:5, 1023-1030
CrossRef27
Madhan Kumar, Jagadish C. Sundaramurthi, Narinder K. Mehra, Gurvinder Kaur, Alamelu Raja. (2010) Cellular immune response to Mycobacterium tuberculosis-specific antigen culture filtrate protein-10 in south India. Medical Microbiology and Immunology 199:1, 11-25
CrossRef28
X.-F. Kong, G. Vogt, A. Chapgier, C. Lamaze, J. Bustamante, C. Prando, A. Fortin, A. Puel, J. Feinberg, X.-X. Zhang, P. Gonnord, U. M. Pihkala-Saarinen, M. Arola, P. Moilanen, L. Abel, M. Korppi, S. Boisson-Dupuis, J.-L. Casanova. (2010) A novel form of cell type-specific partial IFN- R1 deficiency caused by a germ line mutation of the IFNGR1 initiation codon. Human Molecular Genetics 19:3, 434-444
CrossRef29
Tadele G Kiros, Carl A Power, Guojian Wei, Peter A Bretscher. (2010) Immunization of newborn and adult mice with low numbers of BCG leads to Th1 responses, Th1 imprints and enhanced protection upon BCG challenge. Immunotherapy 2:1, 25-35
CrossRef30
Madhan Kumar, N. Meenakshi, Jagadish C. Sundaramurthi, Gurvinder Kaur, Narinder K. Mehra, Alamelu Raja. (2010) Immune response to Mycobacterium tuberculosis specific antigen ESAT-6 among south Indians. Tuberculosis 90:1, 60-69
CrossRef31
Y. Y. Wan, R. A. Flavell. (2009) How Diverse--CD4 Effector T Cells and their Functions. Journal of Molecular Cell Biology 1:1, 20-36
CrossRef32
Alexandre Alcaïs, Laurent Abel, Jean-Laurent Casanova. (2009) Human genetics of infectious diseases: between proof of principle and paradigm. Journal of Clinical Investigation 119:9, 2506-2514
CrossRef33
V. Schuster, H. Bernuth. (2009) Immundefekte mit selektiver Vulnerabilität für einzelne Erreger. Monatsschrift Kinderheilkunde 157:9, 886-895
CrossRef34
Ronggai Sun, Yasir A.W. Skeiky, Angelo Izzo, Veerabadran Dheenadhayalan, Zakaria Imam, Erica Penn, Katherine Stagliano, Scott Haddock, Stefanie Mueller, John Fulkerson, Charles Scanga, Ajay Grover, Steven C. Derrick, Sheldon Morris, David M. Hone, Marcus A. Horwitz, Stefan H.E. Kaufmann, Jerald C. Sadoff. (2009) Novel recombinant BCG expressing perfringolysin O and the over-expression of key immunodominant antigens; pre-clinical characterization, safety and protection against challenge with Mycobacterium tuberculosis. Vaccine 27:33, 4412-4423
CrossRef35
N. Talat, F. Shahid, G. Dawood, R. Hussain. (2009) Dynamic Changes in Biomarker Profiles Associated with Clinical and Subclinical Tuberculosis in a High Transmission Setting: A Four-Year Follow-Up Study. Scandinavian Journal of Immunology 69:6, 537-546
CrossRef36
Claus Aagaard, Jes Dietrich, Mark Doherty, Peter Andersen. (2009) TB vaccines: current status and future perspectives. Immunology and Cell Biology 87:4, 279-286
CrossRef37
ITAI PESSACH, JOLAN WALTER, LUIGI D. NOTARANGELO. (2009) Recent Advances in Primary Immunodeficiencies: Identification of Novel Genetic Defects and Unanticipated Phenotypes. Pediatric Research 65:Supplement, 3R-12R
CrossRef38
Toshiyuki Koya, Chikako Tsubata, Hiroshi Kagamu, Ken-ichi Koyama, Masachika Hayashi, Katsuhiro Kuwabara, Takui Itoh, Yoshinari Tanabe, Toshinori Takada, Fumitake Gejyo. (2009) Anti-interferon-γ autoantibody in a patient with disseminated Mycobacterium avium complex. Journal of Infection and Chemotherapy 15:2, 118-122
CrossRef39
James Harris, Sharon S. Master, Sergio A. De Haro, Monica Delgado, Esteban A. Roberts, Jayne C. Hope, Joseph Keane, Vojo Deretic. (2009) Th1–Th2 polarisation and autophagy in the control of intracellular mycobacteria by macrophages. Veterinary Immunology and Immunopathology 128:1-3, 37-43
CrossRef40
David M. Higgins, Joaquin Sanchez-Campillo, Adrian G. Rosas-Taraco, Eric J. Lee, Ian M. Orme, Mercedes Gonzalez-Juarrero. (2009) Lack of IL-10 alters inflammatory and immune responses during pulmonary Mycobacterium tuberculosis infection. Tuberculosis 89:2, 149-157
CrossRef41
Pin-Yu Perera, Steven C. Derrick, Kristopher Kolibab, Fumiki Momoi, Masafumi Yamamoto, Sheldon L. Morris, Thomas A. Waldmann, Liyanage P. Perera. (2009) A multi-valent vaccinia virus-based tuberculosis vaccine molecularly adjuvanted with interleukin-15 induces robust immune responses in mice. Vaccine 27:15, 2121-2127
CrossRef42
Rhea N. Coler, Davin C. Dillon, Yasir A.W. Skeiky, Maria Kahn, Ian M. Orme, Yves Lobet, Steven G. Reed, Mark R. Alderson. (2009) Identification of Mycobacterium tuberculosis vaccine candidates using human CD4+ T-cells expression cloning. Vaccine 27:2, 223-233
CrossRef43
Alicia Demirjian, Ofer Levy. (2009) Safety and efficacy of neonatal vaccination. European Journal of Immunology 39:1, 36-46
CrossRef44
Saleh Al-Muhsen, Jean-Laurent Casanova. (2008) The genetic heterogeneity of mendelian susceptibility to mycobacterial diseases. Journal of Allergy and Clinical Immunology 122:6, 1043-1051
CrossRef45
Angela M Minassian, Helen McShane. (2008) Tuberculosis vaccines: present and future. Expert Review of Respiratory Medicine 2:6, 721-738
CrossRef46
Daniel J. Gough, David E. Levy, Ricky W. Johnstone, Christopher J. Clarke. (2008) IFNγ signaling—Does it mean JAK–STAT?. Cytokine & Growth Factor Reviews 19:5-6, 383-394
CrossRef47
J. Zhu, W. E. Paul. (2008) CD4 T cells: fates, functions, and faults. Blood 112:5, 1557-1569
CrossRef48
Jean-Laurent Casanova, Claire Fieschi, Shen-Ying Zhang, Laurent Abel. (2008) Revisiting human primary immunodeficiencies. Journal of Internal Medicine 264:2, 115-127
CrossRef49
Cory M. Robinson, Gerard J. Nau. (2008) Interleukin‐12 and Interleukin‐27 Regulate Macrophage Control of Mycobacterium tuberculosis. The Journal of Infectious Diseases 198:3, 359-366
CrossRef50
D. Murphy, L.A.L. Corner, E. Gormley. (2008) Adverse reactions to Mycobacterium bovis bacille Calmette–Guérin (BCG) vaccination against tuberculosis in humans, veterinary animals and wildlife species. Tuberculosis 88:4, 344-357
CrossRef51
Else Marie Agger, Joseph P. Cassidy, Joseph Brady, Karen S. Korsholm, Carina Vingsbo-Lundberg, Peter Andersen. (2008) Adjuvant modulation of the cytokine balance in Mycobacterium tuberculosis subunit vaccines; immunity, pathology and protection. Immunology 124:2, 175-185
CrossRef52
Kohsaku Uetani, Miki Hiroi, Tadamichi Meguro, Hiroshi Ogawa, Toshinori Kamisako, Yoshihiro Ohmori, Serpil C. Erzurum. (2008) Influenza A virus abrogates IFN-γ response in respiratory epithelial cells by disruption of the Jak/Stat pathway. European Journal of Immunology 38:6, 1559-1573
CrossRef53
D. C. Dale, L. Boxer, W. C. Liles. (2008) The phagocytes: neutrophils and monocytes. Blood 112:4, 935-945
CrossRef54
Jacinta Bustamante, Shen-Ying Zhang, Horst von Bernuth, Laurent Abel, Jean-Laurent Casanova. (2008) From Infectious Diseases to Primary Immunodeficiencies. Immunology and Allergy Clinics of North America 28:2, 235-258
CrossRef55
Bandaru Anuradha, Shilpa S. Rakh, Mohd Ishaq, K J. R. Murthy, Vijaya Lakshmi Valluri. (2008) Interferon-?? Low Producer Genotype +874 Overrepresented in Bacillus Calmette-Guerin Nonresponding Children. The Pediatric Infectious Disease Journal 27:4, 325-329
CrossRef56
Cheryl L. Day, Nompumelelo Mkhwanazi, Sharon Reddy, Zenele Mncube, Mary van der Stok, Paul Klenerman, Bruce D. Walker. (2008) Detection of Polyfunctional Mycobacterium tuberculosis –Specific T Cells and Association with Viral Load in HIV‐1–Infected Persons. The Journal of Infectious Diseases 197:7, 990-999
CrossRef57
Michael L. Dustin. (2008) Synaptic Asymmetry to Go. Cell 132:5, 733-734
CrossRef58
Jacinta Bustamante, Stéphanie Boisson-Dupuis, Emmanuelle Jouanguy, Capucine Picard, Anne Puel, Laurent Abel, Jean-Laurent Casanova. (2008) Novel primary immunodeficiencies revealed by the investigation of paediatric infectious diseases. Current Opinion in Immunology 20:1, 39-48
CrossRef59
H. Glosli, A. Stray-Pedersen, A. C. Brun, L. W. Holtmon, T. Tonjum, A. Chapgier, J. L. Casanova, T. G. Abrahamsen. (2008) Infections Due to Various Atypical Mycobacteria in a Norwegian Multiplex Family with Dominant Interferon- Receptor Deficiency. Clinical Infectious Diseases 46:3, e23-e27
CrossRef60
Gülbû Uzel, Steven M. Holland. 2008. Phagocyte deficiencies. , 327-344.
CrossRef61
Fen Wu, Yabin Qu, Yunxia Tang, Duozhi Cao, Pin Sun, Zhaolin Xia. (2008) Lack of Association between Cytokine Gene Polymorphisms and Silicosis and Pulmonary Tuberculosis in Chinese Iron Miners. Journal of Occupational Health 50:6, 445-454
CrossRef62
Capucine Picard, Jean-Laurent Casanova. 2008. Inherited disorders of IFN-γ-, IFN-α/β-, and NF-κB-mediated immunity. , 553-560.
CrossRef63
Vanessa Sancho-Shimizu, Shen-Ying Zhang, Laurent Abel, Marc Tardieu, Flore Rozenberg, Emmanuelle Jouanguy, Jean-Laurent Casanova. (2007) Genetic susceptibility to herpes simplex virus 1 encephalitis in mice and humans. Current Opinion in Allergy and Clinical Immunology 7:6, 495-505
CrossRef64
Massoud HOUSHMAND, Mohammad Mehdi BANOEI, Payam TABARSI, Mehdi Shafa Shariat PANAHI, Baharak Hooshiar KASHANI, Golnaz EBRAHIMI, Laleh ZARGAR, Parissa FARNIA, Matthew W. MORRIS, Davood MANSOURI, Ali Akbar VELAYATI, Mehdi S. MIRSAEIDI. (2007) Do mitochondrial DNA haplogroups play a role in susceptibility to tuberculosis?. Respirology 12:6, 823-827
CrossRef65
Lisa Goldsack, Joanna R. Kirman. (2007) Half-truths and selective memory: Interferon gamma, CD4+ T cells and protective memory against tuberculosis. Tuberculosis 87:6, 465-473
CrossRef66
A. Fortin, L. Abel, J.L. Casanova, P. Gros. (2007) Host Genetics of Mycobacterial Diseases in Mice and Men: Forward Genetic Studies of BCG-osis and Tuberculosis. Annual Review of Genomics and Human Genetics 8:1, 163-192
CrossRef67
Jeroen G. Noordzij, Nico G. Hartwig, Frank A. W. Verreck, Sandra De Bruin-Versteeg, Tjitske De Boer, Jaap T. Van Dissel, Ronald De Groot, Tom H. M. Ottenhoff, Jacques J. M. Van Dongen. (2007) Two Patients with Complete Defects in Interferon Gamma Receptor-Dependent Signaling. Journal of Clinical Immunology 27:5, 490-496
CrossRef68
Carla M. Ward, Harumi Jyonouchi, Sergei V. Kotenko, Sergey V. Smirnov, Rakesh Patel, Helen Aguila, George McSherry, Barry Dashefsky, Steven M. Holland. (2007) Adjunctive treatment of disseminated Mycobacterium avium complex infection with interferon alpha-2b in a patient with complete interferon-gamma receptor R1 deficiency. European Journal of Pediatrics 166:9, 981-985
CrossRef69
Francis Serour, Avraham Mizrahi, Eli Somekh, Jacqueline Feinberg, Capucine Picard, Jean-Laurent Casanova, Ilan Dalal. (2007) Analysis of the interleukin-12/interferon-γ pathway in children with non-tuberculous mycobacterial cervical lymphadenitis. European Journal of Pediatrics 166:8, 835-841
CrossRef70
Mounira K. Chelbi-Alix, Juana Wietzerbin. (2007) Interferon, a growing cytokine family: 50 years of interferon research. Biochimie 89:6-7, 713-718
CrossRef71
Emmanuelle Jouanguy, Shen-Ying Zhang, Ariane Chapgier, Vanessa Sancho-Shimizu, Anne Puel, Capucine Picard, Stéphanie Boisson-Dupuis, Laurent Abel, Jean-Laurent Casanova. (2007) Human primary immunodeficiencies of type I interferons. Biochimie 89:6-7, 878-883
CrossRef72
Nilgün Sallakcı, Mesut Coskun, Zafer Berber, Fuat Gürkan, Halil Kocamaz, Gülnar Uysal, Sabin Bhuju, Ugur Yavuzer, Mahavir Singh, Olcay Yeğin. (2007) Interferon-γ gene+874T–A polymorphism is associated with tuberculosis and gamma interferon response. Tuberculosis 87:3, 225-230
CrossRef73
Robert S Wallis. (2007) Reactivation of Latent Tuberculosis by TNF Blockade: The Role of Interferon γ. Journal of Investigative Dermatology Symposium Proceedings 12:1, 16-21
CrossRef74
Hubert Schäfer, Katrin Klippert, Petra Meuer, Bettina Borsdorf, Albrecht F. Kiderlen, Reinhard Burger. (2007) Biologic Activity of Guinea Pig IFN- γ In Vitro. Journal of Interferon & Cytokine Research 27:4, 305-316
CrossRef75
D. Furthner, J. Mühleder, F. Eitelberger, E. Richter, C. Engelhorn, B. H. Belohradsky, J. L. Casanova. (2007) Neu beschriebener homozygoter Interferon-γ-Rezeptor-2-Defekt. Monatsschrift Kinderheilkunde 155:S01, S58-S61
CrossRef76
Mary Ellen Conley. (2007) Immunodeficiency: UNC-93B gets a toll call. Trends in Immunology 28:3, 99-101
CrossRef77
Jean-Laurent Casanova, Laurent Abel. (2007) Human genetics of infectious diseases: a unified theory. The EMBO Journal 26:4, 915-922
CrossRef78
Monika Sharma, Sadhna Sharma, Sugata Roy, Saurabh Varma, Mridula Bose. (2007) Pulmonary epithelial cells are a source of interferon-γ in response to Mycobacterium tuberculosis infection. Immunology and Cell Biology
CrossRef79
M A Salih, M E Ibrahim, J M Blackwell, E N Miller, E A G Khalil, A M ElHassan, A M Musa, H S Mohamed. (2007) IFNG and IFNGR1 gene polymorphisms and susceptibility to post-kala-azar dermal leishmaniasis in Sudan. Genes and Immunity 8:1, 75-78
CrossRef80
Orchidée Filipe-Santos, Jacinta Bustamante, Ariane Chapgier, Guillaume Vogt, Ludovic de Beaucoudrey, Jacqueline Feinberg, Emmanuelle Jouanguy, Stéphanie Boisson-Dupuis, Claire Fieschi, Capucine Picard, Jean-Laurent Casanova. (2006) Inborn errors of IL-12/23- and IFN-γ-mediated immunity: molecular, cellular, and clinical features. Seminars in Immunology 18:6, 347-361
CrossRef81
Daniel E. Furst, Robert Wallis, Michael Broder, David O. Beenhouwer. (2006) Tumor Necrosis Factor Antagonists: Different Kinetics and/or Mechanisms of Action May Explain Differences in the Risk for Developing Granulomatous Infection. Seminars in Arthritis and Rheumatism 36:3, 159-167
CrossRef82
L. N. Nesterenko, D. V. Balunets, A. S. Tomova, J. M. Romanova, J. S. Alyapkina, N. A. Zigangirova, M. A. Kapina, E. V. Kondratieva, A. V. Pichugin, K. B. Majorov, A. S. Apt. (2006) Mycobacterium tuberculosis-susceptible I/St mice develop severe disease following infection with taxonomically distant bacteria, Salmonella enterica and Chlamydia pneumoniae. Clinical and Experimental Immunology 146:1, 93-100
CrossRef83
David Burgner, Sarra E Jamieson, Jenefer M Blackwell. (2006) Genetic susceptibility to infectious diseases: big is beautiful, but will bigger be even better?. The Lancet Infectious Diseases 6:10, 653-663
CrossRef84
Jung Hye Hwang, Won-Jung Koh, Eun Joo Kim, Eun Hae Kang, Gee Young Suh, Man Pyo Chung, Hojoong Kim, O Jung Kwon. (2006) Partial interferon-γ receptor deficiency and non-tuberculous mycobacterial lung disease. Tuberculosis 86:5, 382-385
CrossRef85
C F Chantrain, A Bruwier, B Brichard, V Largent, A Chapgier, J Feinberg, J-L Casanova, J-P Stalens, C Vermylen. (2006) Successful hematopoietic stem cell transplantation in a child with active disseminated Mycobacterium fortuitum infection and interferon-γ receptor 1 deficiency. Bone Marrow Transplantation 38:1, 75-76
CrossRef86
Maria N. Tsolia, Ariane Chapgier, Polyxeni Taprantzi, Marina Servitzoglou, Ioannis Tassios, Nikolaos Spyridis, Fotini Papageorgiou, Orchidée Filipe Santos, Jean-Laurent Casanova, Panayotis Spyridis. (2006) Disseminated nontuberculous mycobacterial infection in a child with interferon-γ receptor 1 deficiency. European Journal of Pediatrics 165:7, 458-461
CrossRef87
Yasir A. W. Skeiky, Jerald C. Sadoff. (2006) Advances in tuberculosis vaccine strategies. Nature Reviews Microbiology 4:6, 469-476
CrossRef88
Helen Fletcher, Helen McShane. (2006) Tuberculosis vaccines: current status and future prospects. Expert Opinion on Emerging Drugs 11:2, 207-215
CrossRef89
Anna Liberek, Maria Korzon, Ewa Bernatowska, Magdalena Kurenko-Deptuch, Marlena Rytlewska. (2006) Vaccination-related Mycobacterium bovis BCG Infection. Emerging Infectious Diseases 12:5, 860-861
CrossRef90
Rainer Doffinger, Smita Y. Patel, Dinakantha S. Kumararatne. (2006) Host genetic factors and mycobacterial infections: lessons from single gene disorders affecting innate and adaptive immunity. Microbes and Infection 8:4, 1141-1150
CrossRef91
Paweł Remiszewski, Barbara Roszkowska-Śliz, Jolanta Winek, Ariane Chapgier, Jacquelin Feinberg, Renata Langfort, Iwona Bestry, Ewa Augustynowicz-Kopeć, Jakub Ptak, Jean-Laurent Casanova, Ewa Rowińska-Zakrzewska. (2006) Disseminated <i>Mycobacterium avium</i> Infection in a 20-Year-Old Female with Partial Recessive IFNγR1 Deficiency. Respiration 73:3, 375-378
CrossRef92
Anita E. Smyth, Paul Jackson, David Lammas, M. Suhail Asghar, Alistair D. Crockard, Jean-Laurent Casanova, Dinakantha S. Kumararatne, J. David M. Edgar. (2006) Differential response to interferon-γ therapy in a family with dominant negative partial interferon-γ receptor1 deficiency. European Journal of Pediatrics 165:1, 71-72
CrossRef93
Jeffrey R. Starke. 2006. Tuberculosis. , 581-601.
CrossRef94
Philip M. D. Wood, Claire Fieschi, Capucine Picard, Tom H. M. Ottenhoff, Jean-Laurent Casanova, Dinakantha S. Kumararatne. (2005) Inherited defects in the interferon-gamma receptor or interleukin-12 signalling pathways are not sufficient to cause allergic disease in children. European Journal of Pediatrics 164:12, 741-747
CrossRef95
E. Catherinot, C. Fieschi, J. Feinberg, J.-L. Casanova, L.-J. Couderc. (2005) Syndrome de susceptibilite mendélienne aux infections mycobacteriennes : défauts de l’axe Interleukine-12 - Interféron. Revue des Maladies Respiratoires 22:5, 767-776
CrossRef96
Caterina Romano Carratelli, Antonietta Rizzo, Rossella Paolillo, Maria Rosaria Catania, Piergiorgio Catalanotti, Fabio Rossano. (2005) Effect of nitric oxide on the growth of Chlamydophila pneumoniae. Canadian Journal of Microbiology 51:11, 941-947
CrossRef97
Beate Kampmann, Cheryl Hemingway, Alick Stephens, Robert Davidson, Anna Goodsall, Suzanne Anderson, Mark Nicol, Elisabeth Schölvinck, David Relman, Simon Waddell, Paul Langford, Brian Sheehan, Lynn Semple, Katalin A. Wilkinson, Robert J. Wilkinson, Stanley Ress, Martin Hibberd, Michael Levin. (2005) Acquired predisposition to mycobacterial disease due to autoantibodies to IFN-γ. Journal of Clinical Investigation 115:9, 2480-2488
CrossRef98
D. de Moraes-Vasconcelos, A. S. Grumach, A. Yamaguti, M. E. B. Andrade, C. Fieschi, L. de Beaucoudrey, J.-L. Casanova, A. J. S. Duarte. (2005) Paracoccidioides brasiliensis Disseminated Disease in a Patient with Inherited Deficiency in the 1 Subunit of the Interleukin (IL)-12/IL-23 Receptor. Clinical Infectious Diseases 41:4, 31-37
CrossRef99
H. Handan Akbulut, S. Sirri Kilic, Vedat Bulut, Mehmet Ozden. (2005) Determination of intracellular cytokines produced by Th1 and Th2 cells using flow cytometry in patients with brucellosis. FEMS Immunology & Medical Microbiology 45:2, 253-258
CrossRef100
Robert S. Wallis. (2005) Reconsidering Adjuvant Immunotherapy for Tuberculosis. Clinical Infectious Diseases 41:2, 201-208
CrossRef101
Guillaume Vogt, Ariane Chapgier, Kun Yang, Nadia Chuzhanova, Jacqueline Feinberg, Claire Fieschi, Stéphanie Boisson-Dupuis, Alexandre Alcais, Orchidée Filipe-Santos, Jacinta Bustamante, Ludovic de Beaucoudrey, Ibrahim Al-Mohsen, Sami Al-Hajjar, Abdulaziz Al-Ghonaium, Parisa Adimi, Mehdi Mirsaeidi, Soheila Khalilzadeh, Sergio Rosenzweig, Oscar de la Calle Martin, Thomas R Bauer, Jennifer M Puck, Hans D Ochs, Dieter Furthner, Carolin Engelhorn, Bernd Belohradsky, Davood Mansouri, Steven M Holland, Robert D Schreiber, Laurent Abel, David N Cooper, Claire Soudais, Jean-Laurent Casanova. (2005) Gains of glycosylation comprise an unexpectedly large group of pathogenic mutations. Nature Genetics 37:7, 692-700
CrossRef102
J.F. Emile. (2005) Granulomatoses systémiques. La Revue de Médecine Interne 26, S4-S5
CrossRef103
Andre Bafica, Charles A. Scanga, Charles Serhan, Fabiana Machado, Sandy White, Alan Sher, Julio Aliberti. (2005) Host control of Mycobacterium tuberculosis is regulated by 5-lipoxygenase–dependent lipoxin production. Journal of Clinical Investigation 115:6, 1601-1606
CrossRef104
Richard Bellamy. (2005) Genetic Susceptibility to Tuberculosis. Clinics in Chest Medicine 26:2, 233-246
CrossRef105
Francisco A. Bonilla, I. Leonard Bernstein, David A. Khan, Zuhair K. Ballas, Javier Chinen, Michael M. Frank, Lisa J. Kobrynski, Arnold I. Levinson, Bruce Mazer, Robert P. Nelson, Jordan S. Orange, John M. Routes, William T. Shearer, Ricardo U. Sorensen. (2005) Practice parameter for the diagnosis and management of primary immunodeficiency. Annals of Allergy, Asthma & Immunology 94:5, S1-S63
CrossRef106
Denise Kirschner, Simeone Marino. (2005) Mycobacterium tuberculosis as viewed through a computer. Trends in Microbiology 13:5, 206-211
CrossRef107
E RICHARD STIEHM, RICHARD B. JOHNSTON. (2005) A History of Pediatric Immunology. Pediatric Research 57:3, 458-467
CrossRef108
Michel Denis, D Neil Wedlock, Bryce M Buddle. (2005) Vaccination of brushtail possums, Trichosurus vulpecula, with Bacille Calmette-Guerin induces T lymphocytes that reduce Mycobacterium bovis replication in alveolar macrophages via a contact-dependent/nitric oxide-independent mechanism. Immunology and Cell Biology 83:1, 57-66
CrossRef109
Sergio D. Rosenzweig, Steven M. Holland. (2005) Defects in the interferon-gamma and interleukin-12 pathways. Immunological Reviews 203:1, 38-47
CrossRef110
Tom H.M. Ottenhoff, Frank A.W. Verreck, Marieke A. Hoeve, Esther van de Vosse. (2005) Control of human host immunity to mycobacteria. Tuberculosis 85:1-2, 53-64
CrossRef111
Esther van de Vosse, Marieke A Hoeve, Tom HM Ottenhoff. (2004) Human genetics of intracellular infectious diseases: molecular and cellular immunity against mycobacteria and salmonellae. The Lancet Infectious Diseases 4:12, 739-749
CrossRef112
Capucine Picard, Jean-Laurent Casanova. (2004) Inherited disorders of cytokines. Current Opinion in Pediatrics 16:6, 648-658
CrossRef113
Panu E. Kovanen, Warren J. Leonard. (2004) Cytokines and immunodeficiency diseases: critical roles of the gammac-dependent cytokines interleukins 2, 4, 7, 9, 15, and 21, and their signaling pathways. Immunological Reviews 202:1, 67-83
CrossRef114
Ana Paula Vieira, Julia Vasconcelos, Jose Carlos Fernandes, Henedina Antunes, A. Sousa Basto, Cristiana Macedo, Afsana Zaman, Eugenia Santos, J. Castro Melo, Dirk Roos. (2004) Lymphadenopathy After BCG Vaccination in a Child with Chronic Granulomatous Disease. Pediatric Dermatology 21:6, 646-651
CrossRef115
Francesco Dieli, Nadia Caccamo, Serena Meraviglia, Juraj Ivanyi, Guido Sireci, Cesira?T. Bonanno, Viviana Ferlazzo, Carmela La Mendola, Alfredo Salerno. (2004) Reciprocal stimulation of ?? T cells and dendritic cells during the anti-mycobacterial immune response. European Journal of Immunology 34:11, 3227-3235
CrossRef116
Dominic O. Co, Laura H. Hogan, Shin-Il Kim, Matyas Sandor. (2004) Mycobacterial granulomas: keys to a long-lasting host–pathogen relationship. Clinical Immunology 113:2, 130-136
CrossRef117
Alison M. Elliott, Wendy S. Hodsdon, Jacqueline Kyosiimire, Maria A. Quigley, Jessica S. Nakiyingi, Proscovia B. Namujju, Christine Watera, Neil French, Charles F. Gilks, Hazel M. Dockrell, James A.G. Whitworth. (2004) Cytokine responses and progression to active tuberculosis in HIV-1-infected Ugandans: a prospective study. Transactions of the Royal Society of Tropical Medicine and Hygiene 98:11, 660-670
CrossRef118
Francesco Novelli, Jean-Laurent Casanova. (2004) The role of IL-12, IL-23 and IFN-γ in immunity to viruses. Cytokine & Growth Factor Reviews 15:5, 367-377
CrossRef119
A. W. Olsen, L. Brandt, E. M. Agger, L. A. H. van Pinxteren, P. Andersen. (2004) The Influence of Remaining Live BCG Organisms in Vaccinated Mice on the Maintenance of Immunity to Tuberculosis. Scandinavian Journal of Immunology 60:3, 273-277
CrossRef120
Denise M. Monack, Anne Mueller, Stanley Falkow. (2004) Persistent bacterial infections: the interface of the pathogen and the host immune system. Nature Reviews Microbiology 2:9, 747-765
CrossRef121
Alan P. Knutsen, Elaine C. Siegfried, Cirilo Sotelo-Avila. (2004) Acneiform Granulomatous Folliculitis in a Patient with Interferon-γ Deficiency: Clearing with Empiric Antimycobacterial Therapy. Pediatric Asthma, Allergy & Immunology 17:3, 169-176
CrossRef122
Jill A Holbrook, Gabriele Neu-Yilik, Matthias W Hentze, Andreas E Kulozik. (2004) Nonsense-mediated decay approaches the clinic. Nature Genetics 36:8, 801-808
CrossRef123
Megan S. Lim, Kojo S.J. Elenitoba-Johnson. (2004) The Molecular Pathology of Primary Immunodeficiencies. The Journal of Molecular Diagnostics 6:2, 59-83
CrossRef124
C. Cordonnier, R. Martino, P. Trabasso, T. K. Held, H. Akan, M. S. Ward, K. Fabian, A. J. Ullmann, N. Wulffraat, P. Ljungman, E. P. Alessandrino, J. Pretnar, J. Gmur, R. Varela, A. Vitek, S. Sica, M. Rovira, . (2004) Mycobacterial Infection: A Difficult and Late Diagnosis in Stem Cell Transplant Recipients. Clinical Infectious Diseases 38:9, 1229-1236
CrossRef125
Jae-Hyun Lim, Hwa-Jung Kim, Kil-Soo Lee, Eun-Kyeong Jo, Chang-Hwa Song, Saet-Byel Jung, Su-Young Kim, Ji-Sook Lee, Tae-Hyun Paik, Jeong-Kyu Park. (2004) Identification of the new T-cell-stimulating antigens from Mycobacterium tuberculosis culture filtrate. FEMS Microbiology Letters 232:1, 51-59
CrossRef126
Sergio D. Rosenzweig, Steven M. Holland. (2004) Congenital defects in the interferon-??/interleukin-12 pathway. Current Opinion in Pediatrics 16:1, 3-8
CrossRef127
AySe Metin, Gulnar Uysal, Akif Guven, Agahan Unlu, M Halil Ozturk. (2004) Tuberculous brain abscess in a patient with hyper IgE syndrome. Pediatrics International 46:1, 97-100
CrossRef128
Kazue Higuchi, Yukie Sekiya, Nobuyuki Harada. (2004) Characterization of M. Tuberculosis-derived IL-12-inducing material by alveolar macrophages. Vaccine 22:5-6, 725-735
CrossRef129
G. S. COOKE, M. R. SIDDIQUI. (2004) Host genetics and the dissection of mycobacterial immunity. Clinical and Experimental Immunology 135:1, 9-11
CrossRef130
Anthony Jaworowski, Clare L.V. Maslin, Steven L. Wesselingh. (2004) The use of growth factors and cytokines to treat opportunistic infections in HIV-1 disease. Sexual Health 1:3, 161
CrossRef131
Anne E Goldfeld. (2004) Genetic susceptibility to pulmonary tuberculosis in Cambodia. Tuberculosis 84:1-2, 76-81
CrossRef132
Alissa A. Chackerian, Samuel M. Behar. (2003) Susceptibility to Mycobacterium tuberculosis: lessons from inbred strains of mice. Tuberculosis 83:5, 279-285
CrossRef133
M. J. Newport, A. A. Awomoyi, J. M. Blackwell. (2003) Polymorphism in the Interferon-gamma Receptor-1 Gene and Susceptibility to Pulmonary Tuberculosis in The Gambia. Scandinavian Journal of Immunology 58:4, 383-385
CrossRef134
Dhananjaya V. Kalvakolanu. (2003) Alternate interferon signaling pathways. Pharmacology & Therapeutics 100:1, 1-29
CrossRef135
M. H. Shaw, V. Boyartchuk, S. Wong, M. Karaghiosoff, J. Ragimbeau, S. Pellegrini, M. Muller, W. F. Dietrich, G. S. Yap. (2003) A natural mutation in the Tyk2 pseudokinase domain underlies altered susceptibility of B10.Q/J mice to infection and autoimmunity. Proceedings of the National Academy of Sciences 100:20, 11594-11599
CrossRef136
John Kelly, Warren J. Leonard. (2003) Immune deficiencies due to defects in cytokine signaling. Current Allergy and Asthma Reports 3:5, 396-401
CrossRef137
Carol Dukes Hamilton. (2003) Tuberculosis in the cytokine era: What rheumatologists need to know. Arthritis & Rheumatism 48:8, 2085-2091
CrossRef138
Weyand, Cornelia M., Goronzy, Jörg J., . (2003) Medium- and Large-Vessel Vasculitis. New England Journal of Medicine 349:2, 160-169
Full Text139
Alison M. Elliott, Jacqueline Kyosiimire, Maria A. Quigley, Jessica Nakiyingi, Christine Watera, Michael Brown, Sarah Joseph, Neil French, Charles F. Gilks, James A.G. Whitworth. (2003) Eosinophilia and progression to active tuberculosis in HIV-1-infected Ugandans. Transactions of the Royal Society of Tropical Medicine and Hygiene 97:4, 477-480
CrossRef140
P.V. Giannoudis. (2003) Current concepts of the inflammatory response after major trauma: an update. Injury 34:6, 397-404
CrossRef141
Charles A. Dinarello. (2003) Anti-cytokine therapeutics and infections. Vaccine 21, S24-S34
CrossRef142
D. A. Fraser, L. Bulat-Kardum, J. Knezevic, P. Babarovic, N. Matakovic-Mileusnic, J. Dellacasagrande, D. Matanic, J. Pavelic, Z. Beg-Zec, Z. Dembic. (2003) Interferon-gamma Receptor-1 Gene Polymorphism in Tuberculosis Patients from Croatia. Scandinavian Journal of Immunology 57:5, 480-484
CrossRef143
Xinfang Li, Anthony W. O'Regan, Jeffrey S. Berman. (2003) IFN- γ Induction of Osteopontin Expression in Human Monocytoid Cells. Journal of Interferon & Cytokine Research 23:5, 259-265
CrossRef144
Susanne J. Szabo, Brandon M. Sullivan, Stanford L. Peng, Laurie H. Glimcher. (2003) M
OLECULAR MECHANISMS REGULATING TH 1 IMMUNE RESPONSES . Annual Review of Immunology 21:1, 713-758
CrossRef145
W.H Boom, David H Canaday, Scott A Fulton, Adam J Gehring, Roxana E Rojas, Marta Torres. (2003) Human immunity to M. tuberculosis: T cell subsets and antigen processing. Tuberculosis 83:1-3, 98-106
CrossRef146
S Pasic. (2002) Local bacillus Calmette-Guérin infection in hyperimmunoglobulin-E syndrome. Acta Paediatrica 91:11, 1271-1272
CrossRef147
Kirk H. Waibel, David P. Regis, Gulbu Uzel, Sergio D. Rosenzweig, Steven M. Holland. (2002) Fever and leg pain in a 42-month-old. Annals of Allergy, Asthma & Immunology 89:3, 239-243
CrossRef148
Gulbu Uzel, Steven M. Holland. (2002) White blood cell defects: Molecular discoveries and clinical management. Current Allergy and Asthma Reports 2:5, 385-391
CrossRef149
Charles L Daley, David E Griffith. (2002) Pulmonary disease caused by rapidly growing mycobacteria. Clinics in Chest Medicine 23:3, 623-632
CrossRef150
Joseph O Falkinham. (2002) Nontuberculous mycobacteria in the environment. Clinics in Chest Medicine 23:3, 529-551
CrossRef151
Deborah L Ebert, Kenneth N Olivier. (2002) Nontuberculous mycobacteria in the setting of cystic fibrosis. Clinics in Chest Medicine 23:3, 655-663
CrossRef152
Suneil Malik, Erwin Schurr. (2002) Genetic Susceptibility to Tuberculosis. Clinical Chemistry and Laboratory Medicine 40:9, 863-868
CrossRef153
Jean-Daniel Chiche, Juliette Pingat, Alain Cariou, Jean-Paul Mira. (2002) Genetic Predisposition to Severe Sepsis. Clinical Pulmonary Medicine 9:4, 229-237
CrossRef154
Rebecca H. Buckley. (2002) Primary immunodeficiency diseases: dissectors of the immune system. Immunological Reviews 185:1, 206-219
CrossRef155
Martin Rottenberg, Krister Kristensson. (2002) Effects of Interferon-γ on Neuronal Infections. Viral Immunology 15:2, 247-260
CrossRef156
Takeo Shibata, Tadaatsu Imaizumi, Wakako Tamo, Tomoh Matsumiya, Mika Kumagai, Xue-Fan Cui, Hidemi Yoshida, Shun-Ichi Takaya, Ikuo Fukuda, Kei Satoh. (2002) Proteasome inhibitor MG-132 enhances the expression of interleukin-6 in human umbilical vein endothelial cells: Involvement of MAP/ERK kinase. Immunology and Cell Biology 80:3, 226-230
CrossRef157
Douglas S Robinson, Anne O'Garra. (2002) Further Checkpoints in Th1 Development. Immunity 16:6, 755-758
CrossRef158
Sarah Young, Michael O'Donnell, Euan Lockhart, Bryce Buddle, Lynn Slobbe, Yi Luo, Geoff De Lisle, Glenn Buchan. (2002) Manipulation of immune responses to Mycobacterium bovis by vaccination with IL-2- and IL-18-secreting recombinant bacillus Calmette Guerin. Immunology and Cell Biology 80:3, 209-215
CrossRef159
R. Döffinger, S. Dupuis, C. Picard, C. Fieschi, J. Feinberg, G. Barcenas-Morales, J.-L. Casanova. (2002) Inherited disorders of IL-12- and IFNγ-mediated immunity: a molecular genetics update. Molecular Immunology 38:12-13, 903-909
CrossRef160
Jean-Laurent Casanova, Laurent Abel. (2002) G
ENETIC DISSECTION OF IMMUNITY TO MYCOBACTERIA : The Human Model. Annual Review of Immunology 20:1, 581-620
CrossRef161
Ion Gresser, Filippo Belardelli. (2002) Endogenous type I interferons as a defense against tumors. Cytokine & Growth Factor Reviews 13:2, 111-118
CrossRef162
R. Abu-Nader, C. L. Terrell. (2002) Mycobacterium bovis Vertebral Osteomyelitis as a Complication of Intravesical BCG Use. Mayo Clinic Proceedings 77:4, 393-397
CrossRef163
Deborah L Ebert, Kenneth N Olivier. (2002) Nontuberculous mycobacteria in cystic fibrosis. Infectious Disease Clinics of North America 16:1, 221-233
CrossRef164
Capucine Picard, Claire Fieschi, Frédéric Altare, Suliman Al-Jumaah, Sami Al-Hajjar, Jacqueline Feinberg, Stéphanie Dupuis, Claire Soudais, Ibrahim Zaid Al-Mohsen, Emmanuelle Génin, David Lammas, Dinakantha S. Kumararatne, Tony Leclerc, Arash Rafii, Husn Frayha, Belinda Murugasu, Lee Bee Wah, Raja Sinniah, Michael Loubser, Emi Okamoto, Abdulaziz Al-Ghonaium, Haysam Tufenkeji, Laurent Abel, Jean-Laurent Casanova. (2002) Inherited Interleukin-12 Deficiency: IL12B Genotype and Clinical Phenotype of 13 Patients from Six Kindreds. The American Journal of Human Genetics 70:2, 336-348
CrossRef165
D. A. LAMMAS, E. DE HEER, J. D. EDGAR, V. NOVELLI, A. BEN-SMITH, R. BARETTO, P. DRYSDALE, J. BINCH, C. MACLENNAN, D. S. KUMARARATNE, S. PANCHALINGAM, T. H. M. OTTENHOFF, J.-L. CASANOVA, J.F. EMILE. (2002) Heterogeneity in the granulomatous response to mycobacterial infection in patients with defined genetic mutations in the interleukin 12-dependent interferon-gamma production pathway. International Journal of Experimental Pathology 83:1, 1-20
CrossRef166
Michinori Yamashita, Kenichi Kidera, Hirofumi Inoue, Naoko Shibata, Noriaki Miyata, Kenji Yamada, Toshiro Inoue, Shiori Ban. (2002) A Case of Mycobacterium Bovis Osteomyelitis as a Complication of BCG Vaccination.. Orthopedics & Traumatology 51:3, 653-658
CrossRef167
S. Rosenzweig, S.E. Dorman, J. Roesler, J. Palacios, M. Zelazko, S.M. Holland. (2002) 561del4 Defines a Novel Small Deletion Hotspot in the Interferon-γ Receptor 1 Chain. Clinical Immunology 102:1, 25-27
CrossRef168
Janine Reichenbach, Sergio Rosenzweig, Rainer D??ffinger, St??phanie Dupuis, Steven M. Holland, Jean-Laurent Casanova. (2001) Mycobacterial diseases in primary immunodeficiencies. Current Opinion in Allergy and Clinical Immunology 1:6, 503-511
CrossRef169
Jenefer M Blackwell. (2001) Genetics and genomics in infectious disease susceptibility. Trends in Molecular Medicine 7:11, 521-526
CrossRef170
C.M. Mason, E. Dobard, J. Shellito, S. Nelson. (2001) CD4+ lymphocyte responses to pulmonary infection with Mycobacterium tuberculosis in naı̈e and vaccinated BALB/c mice. Tuberculosis 81:5-6, 327-334
CrossRef171
Adrian V.S. Hill. (2001) T
HE GENOMICS AND GENETICS OF HUMAN INFECTIOUS DISEASE SUSCEPTIBILITY . Annual Review of Genomics and Human Genetics 2:1, 373-400
CrossRef172
Marta Cohen, Ricardo Drut. (2001) Cytologic features of disseminated bacillus Calmette-Gu
rin (BCG) infection. Diagnostic Cytopathology 25:2, 134-137
CrossRef173
Regina A. Silva, Manuela Florido, Rui Appelberg. (2001) Interleukin-12 primes CD4+ T cells for interferon-gamma production and protective immunity during Mycobacterium avium infection. Immunology 103:3, 368-374
CrossRef174
NATASCHA REMUS, JANINE REICHENBACH, CAPUCINE PICARD, CHRISTOPH RIETSCHEL, PHILIP WOOD, DAVID LAMMAS, DINAKANTHA S. KUMARARATNE, JEAN-LAURENT CASANOVA. (2001) Impaired Interferon Gamma-Mediated Immunity and Susceptibility to Mycobacterial Infection in Childhood. Pediatric Research 50:1, 8-13
CrossRef175
Lynn A. Riddell, Anthony J. Pinching, Susan Hill, Tony T. Ng, Emilio Arbe, Gary P. Lapham, Stephen Ash, Richard Hillman, Stephen Tchamouroff, David W. Denning, Jacqueline M. Parkin. (2001) A Phase III Study of Recombinant Human Interferon Gamma to Prevent Opportunistic Infections in Advanced HIV Disease. AIDS Research and Human Retroviruses 17:9, 789-797
CrossRef176
Güzide Aksu, Cengiz Trpan, Cengiz Çavuşoğlu, Saliha Soydan, Frédéric Altare, Jean-Laurent Casanova, Necil Kutukculer. (2001) MYCOBACTERIUM FORTUITUM-CHELONAE COMPLEX INFECTION IN A CHILD WITH COMPLETE INTERLEUKIN-12 RECEPTOR BETA 1 DEFICIENCY. The Pediatric Infectious Disease Journal 20:5, 551-553
CrossRef177
Beate Kampmann, Douglas Young. (2001) Childhood Tuberculosis: Advances in Immunopathogenesis, Treatment and Prevention *. Infectious Diseases in Clinical Practice 10:4, 205-210
CrossRef178
Peter Andersen. (2001) TB vaccines: progress and problems. Trends in Immunology 22:3, 160-168
CrossRef179
Wendy S. Hodsdon, Henry Luzze, Tamara J. Hurst, Maria A. Quigley, Jacqueline Kyosiimire, Proscovia B. Namujju, John L. Johnson, Pontiano Kaleebu, Alphonse Okwera, Alison M. Elliott. (2001) HIV-1-related pleural tuberculosis: elevated production of IFN-??, but failure of immunity to Mycobacterium tuberculosis. AIDS 15:4, 467-475
CrossRef180
D. E. Griffith. (2001) The Challenge and Opportunity of New Clinical Infectious Entities. Clinical Infectious Diseases 32:3, 432-435
CrossRef181
Steven M. Holland. (2001) Nontuberculous Mycobacteria. The American Journal of the Medical Sciences 321:1, 49-55
CrossRef182
Philip F. Halloran, Marjan Afrouzian, Vido Ramassar, Joan Urmson, Lin-Fu Zhu, Lisa M.H. Helms, Kim Solez, Norman M. Kneteman. (2001) Interferon-γ Acts Directly on Rejecting Renal Allografts to Prevent Graft Necrosis. The American Journal of Pathology 158:1, 215-226
CrossRef183
Mackay, Ian R., Rosen, Fred S., , Lekstrom-Himes, Julie A., Gallin, John I., . (2000) Immunodeficiency Diseases Caused by Defects in Phagocytes. New England Journal of Medicine 343:23, 1703-1714
Full Text184
Susan E Dorman, Steven M Holland. (2000) Interferon-γ and interleukin-12 pathway defects and human disease. Cytokine & Growth Factor Reviews 11:4, 321-333
CrossRef185
David A. Lammas, Pamela Drysdale, Anne Ben-Smith, John Girdlestone, David Edgar, Dinakantha S. Kumararatne. (2000) Diagnosis of defects in the type 1 cytokine pathway. Microbes and Infection 2:13, 1567-1578
CrossRef186
Michael Levin, Melanie Newport. (2000) Inherited predisposition to mycobacterial infection: historical considerations. Microbes and Infection 2:13, 1549-1552
CrossRef187
Rainer Döffinger, Frédéric Altare, Jean-Laurent Casanova. (2000) Genetic heterogeneity of Mendelian susceptibility to mycobacterial infection. Microbes and Infection 2:13, 1553-1557
CrossRef188
Tom H.M Ottenhoff, Tjitske de Boer, Claudia E Verhagen, Frank A.W Verreck, Jaap T van Dissel. (2000) Human deficiencies in type 1 cytokine receptors reveal the essential role of type 1 cytokines in immunity to intracellular bacteria. Microbes and Infection 2:13, 1559-1566
CrossRef189
D. A. Lammas, J.-L. Casanova, D. S. Kumararatne. (2000) Clinical consequences of defects in the IL-12-dependent interferon-gamma (IFN-gamma) pathway . IMMUNODEFICIENCY REVIEW. Clinical and Experimental Immunology 121:3, 417-425
CrossRef190
Irene Garcia, Reto Guler, Dominique Vesin, Maria L Olleros, Pierre Vassalli, Yolande Chvatchko, Muazzam Jacobs, Bernhard Ryffel. (2000) Lethal Mycobacterium Bovis Bacillus Calmette Guérin Infection in Nitric Oxide Synthase 2-Deficient Mice: Cell-Mediated Immunity Requires Nitric Oxide Synthase 2. Laboratory Investigation 80:9, 1385-1397
CrossRef191
Eric G. Davis, M.Robert Eichenberger, Brooke S. Grant, Hiram C. Polk. (2000) Microsatellite marker of interferon-gamma receptor 1 gene correlates with infection following major trauma. Surgery 128:2, 301-305
CrossRef192
Gerard J. Nau, Geoffrey L. Chupp, Jean-François Emile, Emmanuelle Jouanguy, Jeffrey S. Berman, Jean-Laurent Casanova, Richard A. Young. (2000) Osteopontin Expression Correlates with Clinical Outcome in Patients with Mycobacterial Infection. The American Journal of Pathology 157:1, 37-42
CrossRef193
J. J. Ellner, C. S. Hirsch, C. C. Whalen. (2000) Correlates of Protective Immunity to Mycobacterium tuberculosis in Humans. Clinical Infectious Diseases 30:Supplement 3, S279-S282
CrossRef194
D. F. Hoft, R. M. Brown, R. B. Belshe. (2000) Mucosal Bacille Calmette-Guerin Vaccination of Humans Inhibits Delayed-Type Hypersensitivity to Purified Protein Derivative but Induces Mycobacteria-Specific Interferon- Responses. Clinical Infectious Diseases 30:Supplement 3, S217-S222
CrossRef195
Emmanuelle Jouanguy, Stéphanie Dupuis, Annaïck Pallier, Rainer Döffinger, Marie-Claude Fondanèche, Claire Fieschi, Salma Lamhamedi-Cherradi, Frédéric Altare, Jean-François Emile, Patrick Lutz, Pierre Bordigoni, Haluk Cokugras, Necla Akcakaya, Judith Landman-Parker, Jean Donnadieu, Yildiz Camcioglu, Jean-Laurent Casanova. (2000) In a novel form of IFN-γ receptor 1 deficiency, cell surface receptors fail to bind IFN-γ. Journal of Clinical Investigation 105:10, 1429-1436
CrossRef196
Vassiliki A. Boussiotis, Eunice Y. Tsai, Edmond J. Yunis, Sok Thim, Julio C. Delgado, Christopher C. Dascher, Alla Berezovskaya, Dominique Rousset, Jean-Marc Reynes, Anne E. Goldfeld. (2000) IL-10–producing T cells suppress immune responses in anergic tuberculosis patients. Journal of Clinical Investigation 105:9, 1317-1325
CrossRef197
Aaby, Shaheen, Heyes, Goudiaby, Hall, Shiell, Jensen, Marchant. (2000) Early BCG vaccination and reduction in atopy in Guinea-Bissau. Clinical <html_ent glyph="@amp;" ascii="&"/> Experimental Allergy 30:5, 644-650
CrossRef198
Peggy Matsiota-Bernard, Françoise Vildé, Charles Nauciel. (2000) Mycobacterium genavense infection in normal and immunodeficient mice. Microbes and Infection 2:6, 575-580
CrossRef199
Brahm H Segal, Thomas L Leto, John I Gallin, Harry L Malech, Steven M Holland. (2000) Genetic, Biochemical, and Clinical Features of Chronic Granulomatous Disease. Medicine 79:3, 170-200
CrossRef200
Isabel Weber, Christian Fritz, Silvia Ruttkowski, Andreas Kreft, Franz-Christoph Bange. (2000) Anaerobic nitrate reductase (narGHJI) activity of Mycobacterium bovis BCG in vitro and its contribution to virulence in immunodeficient mice. Molecular Microbiology 35:5, 1017-1025
CrossRef201
Muazzam Jacobs, Najmeeyah Brown, Nasiema Allie, Bernhard Ryffel. (2000) Fatal Mycobacterium bovis BCG Infection in TNF-LT-α-Deficient Mice. Clinical Immunology 94:3, 192-199
CrossRef202
M Shiloh. (2000) Reactive nitrogen intermediates and the pathogenesis of Salmonella and mycobacteria. Current Opinion in Microbiology 3:1, 35-42
CrossRef203
S.B. LeBlanc, E.G. Naik, L. Jacobson, R.A. Kaslow. (2000) Association of DRB1*1501 with disseminated Mycobacterium avium complex infection in North American AIDS patients. Tissue Antigens 55:1, 17-23
CrossRef204
Anna Dubaniewicz, Barbara Lewko, Grazyna Moszkowska, Barbara Zamorska, Jan Stepinski. (2000) Molecular subtypes of the HLA-DR antigens in pulmonary tuberculosis. International Journal of Infectious Diseases 4:3, 129-133
CrossRef205
Carmen Infante-Duarte, Thomas Kamradt. (1999) Th1/Th2 balance in infection. Springer Seminars in Immunopathology 21:3, 317-338
CrossRef206
G. Tau, P. Rothman. (1999) Biologic functions of the IFN-gamma receptors. Allergy 54:12, 1233-1251
CrossRef207
A DESSEIN, D HILLAIRE, N ELWALI, S MARQUET, Q MOHAMEDALI, A MIRGHANI, S HENRI, A ABDELHAMEED, O SAEED, M MAGZOUB. (1999) Severe Hepatic Fibrosis in Schistosoma mansoni Infection Is Controlled by a Major Locus That Is Closely Linked to the Interferon-γ Receptor Gene. The American Journal of Human Genetics 65:3, 709-721
CrossRef208
Pei-Song Gao, Xiao-Quan Mao, Emmanuelle Jouanguy, Annaick Pallier, Rainer Döffinger, Yosuke Tanaka, Hitoshi Nakashima, Takeshi Otsuka, Mark H. Roberts, Tadao Enomoto, Yasuhiro Dake, Mitsuru Kawai, Sei Sasaki, Sarah R. Shaldon, Phillip Coull, Chaker N. Adra, Yoshiyuki Niho, Jean-Laurent Casanova, Taro Shirakawa, Julian M. Hopkin. (1999) Nonpathogenic Common Variants of IFNGR1 and IFNGR2 in Association with Total Serum IgE Levels. Biochemical and Biophysical Research Communications 263:2, 425-429
CrossRef209
Melanie Newport, Michael Levin. (1999) Genetic susceptibility to tuberculosis. Journal of Infection 39:2, 117-121
CrossRef210
Katalin A. Wilkinson, Ferenc Hudecz, H. Martin Vordermeier, Juraj Ivanyi, Robert J. Wilkinson. (1999) Enhancement of the T cell response to a mycobacterial peptide by conjugation to synthetic branched polypeptide. European Journal of Immunology 29:9, 2788-2796
CrossRef211
Mary Ellen Conley. (1999) Genetic effects on immunity New genes — how do they fit?. Current Opinion in Immunology 11:4, 427-430
CrossRef212
Michael Levin, Melanie Newport. (1999) Understanding the Genetic Basis of Susceptibility to Mycobacterial Infection. Proceedings of the Association of American Physicians 111:4, 308-312
CrossRef213
Carole Elbim, Préma Rajagopalan-Levasseur, Sylvie Chollet-Martin, Jean-Louis Gaillard, Michèle Fay, Jacques Hakim, Alain Fischer, Jean-Laurent Casanova, Marie-Anne Gougerot-Pocidalo. (1999) Defective priming of the phagocyte oxidative burst in a child with recurrent intracellular infections. Microbes and Infection 1:8, 581-587
CrossRef214
JFA Adams, EH Schölvinck, RP Gie, PC Potter, N Beyers, AD Beyers. (1999) Decline in total serum IgE after treatment for tuberculosis. The Lancet 353:9169, 2030-2033
CrossRef215
Javed N. Agrewala, Robert J. Wilkinson. (1999) Influence of HLA-DR on the phenotype of CD4+ T lymphocytes specific for an epitope of the 16-kDa α-crystallin antigen ofMycobacterium tuberculosis. European Journal of Immunology 29:6, 1753-1761
CrossRef216
Emmanuelle Jouanguy, Rainer Döffinger, Stéphanie Dupuis, Annaïck Pallier, Frédéric Altare, Jean-Laurent Casanova. (1999) IL-12 and IFN-γ in host defense against mycobacteria and salmonella in mice and men. Current Opinion in Immunology 11:3, 346-351
CrossRef217
R Döffinger, E Jouanguy, F Altare, J-L Casanova, P Wood, D Lammas, D Kumararatne, T Shirakawa, F Novelli. (1999) Inheritable defects in interleukin-12- and interferon-gamma-mediated immunity and the TH1/TH2 paradigm in man. Allergy 54:5, 409-412
CrossRef218
Katsuhiko Tsukaguchi, Barbara de Lange, W.Henry Boom. (1999) Differential Regulation of IFN-γ, TNF-α, and IL-10 Production by CD4+ αβTCR+ T Cells and Vδ2+ γδ T Cells in Response to Monocytes Infected with Mycobacterium tuberculosis-H37Ra. Cellular Immunology 194:1, 12-20
CrossRef219
Salma Lamhamedi-Cherradi, Chantal de Chastellier, Jean-Laurent Casanova. (1999) Growth of Mycobacterium bovis, Bacille Calmette-Guérin, within human monocytes-macrophages cultured in serum-free medium. Journal of Immunological Methods 225:1-2, 75-86
CrossRef220
Jun Wang, Julia Wakeham, Robin Harkness, Zhou Xing. (1999) Macrophages are a significant source of type 1 cytokines during mycobacterial infection. Journal of Clinical Investigation 103:7, 1023-1029
CrossRef221
Simon L Newman. (1999) Macrophages in host defense against Histoplasma capsulatum. Trends in Microbiology 7:2, 67-71
CrossRef222
Steffen Stenger, Robert L Modlin. (1999) T cell mediated immunity to Mycobacterium tuberculosis. Current Opinion in Microbiology 2:1, 89-93
CrossRef223
Fabio Facchetti, William Vermi, Simona Fiorentini, Marco Chilosi, Arnaldo Caruso, Marzia Duse, Luigi Daniele Notarangelo, Raffaele Badolato. (1999) Expression of Inducible Nitric Oxide Synthase in Human Granulomas and Histiocytic Reactions. The American Journal of Pathology 154:1, 145-152
CrossRef224
N. D. Dore, P. N. LeSouëf, B. Masters, P. W. Francis, D. M. Cooper, J. H. Wildhaber, A. J. Fall, P. D. Sly. (1998) Atypical mycobacterial pulmonary disease and bronchial obstruction in HIV-negative children. Pediatric Pulmonology 26:6, 380-388
CrossRef225
MUSTAFA, AMOUDY, WIKER, ABAL, RAVN, OFTUNG, ANDERSEN. (1998) Comparison of Antigen-Specific T-Cell Responses of Tuberculosis Patients using Complex or Single Antigens of Mycobacterium tuberculosis. Scandinavian Journal of Immunology 48:5, 535-543
CrossRef226
R M Ten. (1998) Primary immunodeficiencies.. Mayo Clinic Proceedings 73:9, 865-872
CrossRef227
Frédéric Altare, Emmanuelle Jouanguy, Salma Lamhamedi, Rainer Döffinger, Alain Fischer, Jean-Laurent Casanova. (1998) Mendelian susceptibility to mycobacterial infection in man. Current Opinion in Immunology 10:4, 413-417
CrossRef228
Richard Bellamy, Adrian VS Hill. (1998) Genetic susceptibility to mycobacteria and other infectious pathogens in humans. Current Opinion in Immunology 10:4, 483-487
CrossRef229
George R. Stark, Ian M. Kerr, Bryan R. G. Williams, Robert H. Silverman, Robert D. Schreiber. (1998) HOW CELLS RESPOND TO INTERFERONS. Annual Review of Biochemistry 67:1, 227-264
CrossRef230
S Pasic, D Lilic, N Pejnovic, D Vojvodic, R Simic, M Abinun. (1998) Disseminated Bacillus Calmette-Guérin infection in a girl with hyperimmunoglobulin E syndrome. Acta Paediatrica 87:6, 702-704
CrossRef231
Adrian V. S. Hill. (1998) THE IMMUNOGENETICS OF HUMAN INFECTIOUS DISEASES. Annual Review of Immunology 16:1, 593-617
CrossRef232
Sing Leung Lui, Vido Ramassar, Joan Urmson, Philip F Halloran. (1998) Mycophenolate mofetil reduces production of interferon-dependent major histocompatibility complex induction during allograft rejection, probably by limiting clonal expansion. Transplant Immunology 6:1, 23-32
CrossRef233
Frédéric Altare, Emmanuelle Jouanguy, Salma Lamhamedi-Cherradi, Marie-Claude Fondanèche, Cécile Fizame, Florence Ribiérre, Gilles Merlin, Zlatko Dembic, Robert Schreiber, Barbara Lisowska-Grospierre, Alain Fischer, Eric Seboun, Jean-Laurent Casanova. (1998) A Causative Relationship between Mutant IFNgR1 Alleles and Impaired Cellular Response to IFNγ in a Compound Heterozygous Child. The American Journal of Human Genetics 62:3, 723-727
CrossRef234
Emil Skamene, MD, PhD, Erwin Schurr, PhD, Philippe Gros, PhD. (1998) INFECTION GENOMICS: Nramp1 as a Major Determinant of Natural Resistance to Intracellular Infections. Annual Review of Medicine 49:1, 275-287
CrossRef235
Steven M. Holland, MD, John I. Gallin, MD. (1998) EVALUATION OF THE PATIENT WITH RECURRENT BACTERIAL INFECTIONS 1 1. Annual Review of Medicine 49:1, 185-199
CrossRef236
James P. Di Santo. (1998) Inherited Cytokine and Cytokine Receptor Deficiencies in Man. International Reviews of Immunology 17:1-4, 103-120
CrossRef237
EMMANUELLE JOUANGUY, FRÉDÉERIC ALTARE, SALMA LAMHAMEDI-CHERRADI, JEAN-LAURENT CASANOVA. (1997) Infections in IFNGR-1-Deficient Children. Journal of Interferon & Cytokine Research 17:10, 583-587
CrossRef238
Sidney Pestka, Serguei V. Kotenko, Geetha Muthukumaran, Lara S. Izotova, Jeffry R. Cook, Gianni Garotta. (1997) The interferon gamma (IFN-γ) receptor: a paradigm for the multichain cytokine receptor. Cytokine & Growth Factor Reviews 8:3, 189-206
CrossRef239
Stefan H. E. Kaufman, Masashi Emoto, Gudrun Szalay, Johannes Barsig, Inge E. A. Flesch. (1997) Interleukin-4 and listeriosis. Immunological Reviews 158:1, 95-105
CrossRef240
Laurent Abel, Alain J Dessein. (1997) The impact of host genetics on susceptibility to human infectious diseases. Current Opinion in Immunology 9:4, 509-516
CrossRef241
G. Vanham, Z. Toossi, C.S. Hirsch, R.S. Wallis, S.K. Schwander, E.A. Rich, J.J. Ellner. (1997) Examining a paradox in the pathogenesis of human pulmonary tuberculosis: Immune activation and suppression/anergy. Tubercle and Lung Disease 78:3-4, 145-158
CrossRef242
Vibeke Rosenfeldt, Anders Pærregaard, Niels Henrik Valerius. (1997) Disseminated Infection with Bacillus Calmette-Guerin in a Child with Advanced HIV Disease. Scandinavian Journal of Infectious Diseases 29:5, 526-527
CrossRef
