Original Article
A Mutation in the Interferon-γ –Receptor Gene and Susceptibility to Mycobacterial Infection
N Engl J Med 1996; 335:1941-1949December 26, 1996
- Abstract
Background
Genetic differences in immune responses may affect susceptibility to mycobacterial infection, but no specific genes have been implicated in humans. We studied four children who had an unexplained genetic susceptibility to mycobacterial infection and who appeared to have inherited the same recessive mutation from a common ancestor.
Methods
We used microsatellite analysis, immunofluorescence studies, and sequence analysis to study the affected patients, unaffected family members, and normal controls.
Results
A genome search using microsatellite markers identified a region on chromosome 6q in which the affected children were all homozygous for eight markers. The gene for interferon-γ receptor 1 maps to this region. Immunofluorescence studies showed that the receptor was absent on leukocytes from the affected children. Sequence analysis of complementary DNA for the gene for interferon- γ receptor 1 revealed a point mutation at nucleotide 395 that introduces a stop codon and results in a truncated protein that lacks the transmembrane and cytoplasmic domains.
Conclusions
Four children with severe mycobacterial infections had a mutation in the gene for interferon-γ receptor 1 that leads to the absence of receptors on cell surfaces and a functional defect in the up-regulation of tumor necrosis factor α by macrophages in response to interferon-γ. The interferon-γ pathway is important in the response to intracellular pathogens such as mycobacteria.
Media in This Article
Figure 4
TNF-α Production in Response to Stimulation of Whole Blood with Phosphate-Buffered Saline (PBS), Lipopolysaccharide (LPS) Alone, or Lipopolysaccharide and Interferon-γ (IFN-γ) in the Surviving Affected Child, His Parents, and Control Subjects.Figure 1
Haplotypes of Affected Children, Their Parents, and Unaffected Siblings in the Region of Chromosome 6q22–q23.Article Activity
- Article
The World Health Organization has estimated that more than 1.7 billion persons are infected with Mycobacterium tuberculosis worldwide.1,2 A puzzling feature of mycobacterial infection is that clinically evident disease occurs in only a small proportion of those who are infected. However, the mechanisms that distinguish a successful immune response, which contains the infection, from an ineffective response, which enables progressive disease to occur, remain poorly understood. Familial clustering, racial differences in incidence, and twin studies suggest that genetic factors have a role in susceptibility.3-5 However, in contrast to the situation in mice, in which a number of single gene defects have been associated with susceptibility to intracellular pathogens, including mycobacteria,6-10 no such genes have been identified in humans.
We have previously described a group of related children from a village in Malta who appear to have a familial immunologic defect predisposing them to infection with a range of mycobacteria.11 Despite intensive treatment three of the four affected patients have died, and the survivor has persistent infection. Immunologic studies have shown that the affected children have defective production of tumor necrosis factor α (TNF-α) in response to endotoxin and a failure to up-regulate this cytokine in response to interferon-γ.11
It is likely that all four affected Maltese children have the same autosomal recessive disorder owing to a single mutation introduced by a common ancestor.12 The mutation originally occurred on a single chromosome and is therefore associated with a particular haplotype inherited with the mutant allele. It is possible to identify the chromosomal location of a recessive gene in such families by searching for regions of the genome for which all the affected family members are homozygous by descent.13,14 Candidate genes identified within the region of homology can then be analyzed for causative mutations. We have used this approach to identify the genetic defect underlying the increased susceptibility to mycobacterial infection in our patients.
Methods
Patients
The characteristics of the patients have been described elsewhere.11 Briefly, four children from the same small town in Malta presented with disseminated atypical mycobacterial infection in the absence of a recognized immunodeficiency. They all had fever, weight loss, hepatosplenomegaly, bone lesions, and an intense acute-phase response. Two of the affected children are brothers whose parents are second cousins, and the third is related to them as a fourth cousin through both sets of parents. The family pedigree has been described elsewhere,11,12 and the numbering of patients and family members follows that of Newport et al.12 The genetic link between these three children and the fourth child has not been determined, but they all come from the same town, where intermarriage between families is common. Each child was infected with a different species or strain of mycobacterium (M. fortuitum, M. chelonei, and two strains of M. avium), suggesting a defect in host immunity, and one child also had a prolonged episode of salmonellosis. It is therefore likely that the children all had the same recessively inherited defect. Three of the children have died as a result of their infections.
All family members agreed to participate in this study, which was approved by the hospitals' ethics committees.
Microsatellite Analysis
DNA was prepared from peripheral-blood lymphocytes according to standard methods.15 A set of polymorphic microsatellites derived from both the Genethon catalogue and the Cooperative Human Linkage Center were typed in the parents and three of the affected children. Amplification was performed with the polymerase chain reaction (PCR) according to standard Genethon conditions.16 Amplified products were resolved on 6 percent polyacrylamide sequencing gels. The subjects were subsequently typed for additional markers in the region of homozygosity.
Immunofluorescence Studies of Peripheral-Blood Leukocytes
Peripheral-blood mononuclear cells were prepared by Ficoll–Hypaque (Nycomed, Oslo, Norway) gradient centrifugation. Granulocytes were isolated from the erythrocyte pellet by lysis of red cells with 155 mM ammonium chloride. The cells were incubated for 30 to 60 minutes on ice with 2 to 5 μg of an isotype control per milliliter (Becton Dickinson, Oxford, United Kingdom) or 2 to 5 μg of antibodies against interferon-γ receptor 1 per milliliter (mouse IgG2b [1224-00] or mouse IgG1 [1223-01]; Genzyme, Cambridge, Mass.). Both antibodies are directed against the extracellular domain. Bound antibody was detected with goat antimouse IgG antibody labeled with fluorescein isothiocyanate (Dako, Teddington, United Kingdom). A minimum of 3000 cells was analyzed for each test with an Epics Profile II cell analyzer (Coulter Electronics, Luton, United Kingdom). For the analysis of up-regulation of the receptor, lymphocytes were cultured for 24 hours in the presence or absence of 400 nM dexamethasone (Sigma Chemical, St. Louis).17
Sequence Analysis of Complementary DNA for the Gene for Interferon-γ Receptor 1
In three of the affected patients and an unrelated control, messenger RNA (mRNA) was extracted with the Microfast Track kit (Invitrogen, San Diego, Calif.) from 1 million lymphocytes after transformation with the Epstein–Barr virus (EBV). Reverse transcription was accomplished with a complementary DNA (cDNA) cycle kit (Invitrogen), and the open reading frame of the gene for interferon-γ receptor 1 was amplified by PCR with the primers 5'CCAGCGACCGTCGGTAGCAGC3' and 5'ATCCTCTTTACGCTTTCAT3', designed from published sequence data.18 The PCR products were cloned with the TA (Invitrogen) cloning kit. One to five clones from separate PCR reactions from each subject were sequenced with the Sequenase kit (Amersham, Amersham, United Kingdom) according to the manufacturer's instructions.
For the PCR assay of genomic DNA from members of the affected families, primers were designed (5'GTTAAAGCCAGGGTTGGACA3' and 5'CATCTCGGCATACAGCAAATTCTTGT3') to amplify a 70-bp fragment across the mutation site from genomic DNA. A single-base mismatch was introduced at the penultimate 3' nucleotide of the reverse primer sequence (a substitution of G for C, shown underlined in the primer) in order to create a Tsp45I restriction site in normal DNA. This enzyme recognizes the sequence GTCAC (or GTGAC). The normal genomic sequence is GTCAG for nucleotides 393 to 397; the mismatch in the reverse primer introduces a C at position 397, thus creating a Tsp45I site. However, in the mutant sequence, there is an A at position 395 and the restriction site is lost. PCR amplification was performed in a total volume of 30 μl containing 100 ng of DNA; 10 pM of each primer; 3.5 mM magnesium chloride; 75 mM potassium chloride; 10 mM TRIS (pH 9.2); 200 μM each of deoxyadenosine triphosphate, deoxycytosine triphosphate, deoxyguanosine triphosphate, and deoxythymidine triphosphate; and 1 U of Taq polymerase at an annealing temperature of 55°C. Amplified products were digested with Tsp45I, resolved on 15 percent polyacrylamide gels, stained with ethidium bromide, and visualized under ultraviolet light.
Interferon-γ Responses
The ability of interferon-γ to up-regulate the production of TNF-α by monocytes was studied with an in vitro whole-blood assay, as described elsewhere.11 The production of TNF-α in response to Escherichia coli lipopolysaccharide (1 μg per milliliter) was compared with TNF-α production induced by the same concentration of lipopolysaccharide after pretreatment with interferon-γ (2 μg per milliliter) for two hours. Plasma TNF-α levels were measured with an enzyme-linked immunosorbent assay.19
Results
In an initial screening, 360 polymorphic microsatellite markers spaced at intervals of approximately 11 cM across the genome were typed in three of the affected children and their parents. Haplotype sharing on three or more of the six affected chromosomes was observed on a total of 42 chromosomal regions. These regions were further analyzed with additional microsatellite markers to determine whether they were identical by state or by descent. A single 5-cM region was identified on chromosome 6q in which all three affected children were homozygous for the same alleles for eight microsatellites, whereas their parents and unaffected siblings were not (Figure 1Figure 1
Haplotypes of Affected Children, Their Parents, and Unaffected Siblings in the Region of Chromosome 6q22–q23.). The gene for interferon-γ receptor 1 is located in this region21 and seemed a likely candidate gene, since mice lacking this gene are susceptible to infections with mycobacteria.7 To establish whether the expression of interferon-γ receptor 1 was defective on the cells of the affected children, we investigated the binding of two monoclonal antibodies with specificities for different epitopes of the extracellular domain of the receptor. The antibodies did not bind to freshly isolated monocytes, neutrophils, or lymphocytes from the only surviving child, Subject III-4 (Figure 2AFigure 2
Level of Expression of Interferon-γ Receptor 1 on the Surface of Peripheral-Blood Cells from the Patients, Their Parents, and Healthy Controls., Figure 2B, and Figure 2C). The extent of binding to the cells from his mother (Subject II-4) was intermediate. Similarly, there was no binding to stored lymphocytes from Subject III-1 (Figure 2D), whereas the extent of binding to his parents' cells (Subjects II-1 and II-2) was intermediate between that of the patients and that of the healthy controls (Figure 2A, Figure 2B, Figure 2C, and Figure 2D). The expression of other cell-surface proteins, including CD14, CD16, CD3, and the receptor for granulocyte–macrophage colony-stimulating factor, was normal (data not shown). Preincubation of fresh peripheral-blood mononuclear cells with dexamethasone resulted in the up-regulation of the receptor on lymphocytes from the control and an unaffected parent (Subject II-4), but not from the affected child (Subject III-4) (Figure 2C).Northern analysis of mRNA from EBV-transformed B lymphocytes showed no difference in the expression of the gene for interferon-γ receptor 1 between affected children and an unrelated control (data not shown). The cDNA was prepared from the EBV-transformed lymphocytes by reverse-transcription PCR and sequenced. A substitution of A for C, which results in a stop codon, was identified at position 395 of the coding sequence in all affected children (Figure 3AFigure 3
Characterization of the Mutation in the Gene for Interferon-γ Receptor 1 in Patients with Disseminated Mycobacterial Infection and Their Families.).In order to validate this finding in genomic DNA, a PCR assay was designed that incorporates the site of the mutation into a Tsp45I restriction site (as described in the Methods section). The affected children are homozygous for the mutation, whereas their parents are heterozygous carriers (Figure 3B). Siblings III-2 and III-5 are heterozygous, whereas sibling III-7 is homozygous for the normal sequence (Figure 3B), as they are for the microsatellites around the mutation (Figure 1).
Consistent with the mutation in the gene for interferon-γ receptor 1 and the absence of interferon-γ –receptor 1 protein on cell surfaces as detected by the monoclonal antibodies, TNF-α production in response to interferon-γ was markedly lower in the surviving affected child than in healthy controls; his parents had intermediate responses (Figure 4Figure 4
TNF-α Production in Response to Stimulation of Whole Blood with Phosphate-Buffered Saline (PBS), Lipopolysaccharide (LPS) Alone, or Lipopolysaccharide and Interferon-γ (IFN-γ) in the Surviving Affected Child, His Parents, and Control Subjects.).Discussion
We have shown that a novel immunodeficiency predisposing affected persons to mycobacterial infection is caused by a mutation in the gene for interferon-γ receptor 1. We have mapped the defect to the same chromosomal region as the receptor gene and identified a point mutation in the coding region. The substitution of A for C at position 395 results in a new stop codon and in the production of a truncated protein that would be predicted to lack the membrane-binding region and the intracellular domain and would be unlikely to be expressed on the cell surface (Figure 5AFigure 5
Structure of the Interferon-γ –Receptor 1 Protein and a Model of the Interferon-γ Receptor Complex.).The major defects in immunologic function observed in the affected patients are the failure of interferon-γ to up-regulate the production of TNF-α by macrophages and defective antigen processing and presentation.11,24 Unlike the situation in cells from healthy controls, in monocytes from the patients exogenous interferon-γ induces only a small increase in TNF-α production in vitro (Figure 4). These findings are explained by our molecular studies showing a mutation in the gene for interferon-γ receptor 1 and by our cellular studies confirming the absence of the expression of interferon-γ receptor 1 on cell surfaces as detected by the binding of monoclonal antibodies to the extracellular domain of the receptor. However, given the absence of interferon-γ receptor 1 on cell surfaces, it is surprising that we observed any up-regulation of monocytes by interferon-γ. It is also surprising that there appeared to have been clinical improvement associated with the administration of interferon-γ to three of the patients.11 This paradox may be explained by considering the function of the various components of the interferon-γ receptor (Figure 5B).
Interferon-γ induces cellular activation by binding to a receptor complex consisting of at least two subunits: the interferon-γ –binding subunit (interferon-γ receptor 1) and a chromosome 21–encoded transmembrane accessory factor (interferon-γ receptor 2) (Figure 5B).25 Both components of the receptor are thought to be required for normal signal transduction. Binding of interferon-γ induces dimerization of the interferon-γ receptor 1, which associates with interferon-γ receptor 2 (Figure 5B). There is evidence that interferon-γ interacts with both interferon-γ receptor 1 and interferon-γ receptor 2 during the process of association of the two receptor proteins.23 The Janus protein kinases Jak 1 and Jak 2 are associated with the intracellular domains of interferon-γ receptor 1 and interferon-γ receptor 2, respectively, and are brought together and activated by phosphorylation by the binding of interferon-γ to the receptor complex. This results in the phosphorylation of tyrosine at position 457 of the interferon-γ receptor 1 chain and produces a binding site for Stat 1α (signal transduction and activation of transcription protein), leading to the phosphorylation, homodimerization, and subsequent dissociation of Stat 1α from the interferon-γ –receptor complex.26 The Stat 1α dimer translocates to the nucleus and interacts with γ-activation sequences in the promoter regions of interferon-γ –inducible genes, resulting in their transcription (Figure 5B).
The mutation present in our patients severely disrupts the function of the interferon-receptor complex, since interferon-γ receptor 1 is required both for binding of interferon-γ and for signal transduction. The small residual response to interferon-γ observed in our patients and the apparent clinical response to exogenous interferon-γ have a number of possible explanations. The truncated extracellular domain of interferon-γ receptor 1 may be transported to the cell surface and shed into the plasma, since the membrane anchor is absent. Interferon-γ may associate with the truncated receptor in the plasma, and the complex may interact with interferon-γ receptor 2, allowing some signal transduction through this receptor (Figure 5B). Alternatively, interferon-γ may bind directly to interferon-γ receptor 2 and induce a minor degree of cellular activation. In the absence of the transmembrane region of interferon-γ receptor 1, signaling through the Janus kinases is likely to be markedly reduced. Finally, interferon-γ may induce a milder degree of cellular activation through an as yet unidentified additional receptor. Most of what is known about the functions of the human interferon-γ –receptor complex has been learned by studying human–rodent chimeras in which individual components of the receptor complex can be knocked out.23 Our patients provide an opportunity to study the receptor in what might be considered a knockout in humans, and further studies are required to explain their residual response to interferon-γ fully.
A large literature documents the importance of interferon-γ in the up-regulation of murine macrophage function to control intracellular organisms, including mycobacteria, salmonella, and leishmania.27 Interferon-γ produced by T cells and natural killer cells induces macrophage activation, resulting in increased production of interleukin-1 and TNF-α,28 enhanced antigen presentation,29 and increased production of nitric oxide30 and reactive-oxygen intermediates.31 Murine macrophages activated by interferon-γ are able to limit the growth of mycobacteria in vitro, and there appears to be synergy between interferon-γ and TNF-α.32 Mice in which the gene for interferon-γ has been disrupted have defective production of macrophage antimicrobial products and reduced expression of major-histocompatibility-complex class II antigens and die of disseminated mycobacterial infection.10 Moreover, mice lacking interferon-γ receptor 1 have a similar phenotype to those with disruption of the interferon-γ gene and are susceptible to infection with intracellular pathogens.7 Despite these data in mice, there is no clear evidence that interferon-γ enhances the killing of mycobacteria in vitro by human macrophages.33-35 However, treatment with interferon-γ resulted in clinical improvement in a group of patients with refractory disseminated nontuberculous mycobacterial infection.11,36
A striking feature of the immune defect in these children is that it is highly specific for mycobacteria and possibly other intracellular pathogens such as salmonella. They have not had infections with conventional bacteria or fungi and have coped with viral infections normally. The interferon-γ pathway has been implicated in the immune response to virtually all infectious agents, including fungi, parasites, and bacteria.37 The specificity of the defect in these children suggests that there must be a redundancy of immunologic mechanisms against most of these pathogens but not against mycobacteria. Perhaps the success of mycobacteria as human pathogens is due to the absence of overlapping immunologic responses able to control their growth in humans.
Elucidation of the basis of this rare immunodeficiency not only provides important information on the role of the interferon-γ pathway in human immunity, but also identifies a gene with a potentially crucial role in determining susceptibility to mycobacterial disease. Clearly, the complete absence of interferon-γ receptor 1 on cell surfaces induces so profound an immune defect that such mutations are unlikely to explain mycobacterial susceptibility in the general population. However, the existence of heterozygous carriers of the defect or more subtle variations in this gene might explain differences in mycobacterial susceptibility within the population. The interferon-γ pathway may be an important potential target for immunotherapy of mycobacterial infections.
Supported in part by St. Mary's Hospital Special Trustees.
We are indebted to Lodewijk Sandkuijl for helpful discussions regarding the feasibility of a genome search to map the gene in these families; to Gideon Lack and Laura Guida for assistance with immunofluorescence studies; to Sushila d'Souza for establishing the EBV-transformed lymphocyte lines; to Jean Weissenbach for disclosure of microsatellite primer sequences before the data were published; to members of the Department of Clinical Genetics, Erasmus University, Rotterdam, in particular Leon Testers, Guido Breedveld, and Peter Heutink, for their hospitality and assistance while genotype studies were conducted; and to Graham Davies, the Maltese pediatricians Herbert Lenicker and Paul Vassallo Agius, and the families for their help with this study.
Source Information
From the Departments of Pediatrics (M.J.N., M.L.), Biochemistry and Molecular Genetics (M.J.N., C.M. Huxley, S.H., R.W.), and Immunology (C.M. Hawrylowicz), Imperial College School of Medicine at St. Mary's, London; and the Department of Clinical Genetics, Erasmus University, Rotterdam, the Netherlands (B.A.O.).
Address reprint requests to Dr. Levin at the Department of Pediatrics, Queen Elizabeth the Queen Mother Wing, St. Mary's Hospital, South Wharf Rd., London W2 1NY, United Kingdom.
- References
References
1
Kochi A . The global tuberculosis situation and the new control strategy of the World Health Organization. Tubercle 1991;72:1-6
CrossRef | Medline2
Horsburgh CR Jr ,Selik RM . The epidemiology of disseminated nontuberculous mycobacterial infection in the acquired immunodeficiency syndrome (AIDS). Am Rev Respir Dis 1989;139:4-7
CrossRef | Web of Science | Medline3
Fine PEM . Immunogenetics of susceptibility to leprosy, tuberculosis, and leishmaniasis: an epidemiological perspective. Int J Lepr Other Mycobact Dis 1981;49:437-454
Medline4
Comstock GW . Tuberculosis in twins: a re-analysis of the Prophit survey. Am Rev Respir Dis 1978;117:621-624
Web of Science | Medline5
Kallmann FJ ,Reisner D . Twin studies on the significance of genetic factors in tuberculosis. Am Rev Tuberc 1943;47:549-5746
Blackwell JM . The macrophage resistance gene, Lsh/Ity/Bcg. Res Immunol 1989;140:767-769
CrossRef | Medline7
Kamijo R ,Le J ,Shapiro D , et al. Mice that lack the interferon-gamma receptor have profoundly altered responses to infection with Bacillus Calmette-Guerin and subsequent challenge with lipopolysaccharide. J Exp Med 1993;178:1435-1440
CrossRef | Web of Science | Medline8
Pfeffer K ,Matsuyama T ,Kundig TM , et al. Mice deficient for the 55 kd tumor necrosis factor receptor are resistant to endotoxic shock, yet succumb to L. monocytogenes infection. Cell 1994;73:457-467
CrossRef | Web of Science9
Flynn JL ,Chan J ,Triebold KJ ,Dalton DK ,Stewart TA ,Bloom BR . An essential role for interferon γ in resistance to Mycobacterium tuberculosis infection. J Exp Med 1993;178:2249-2254
CrossRef | Web of Science | Medline10
Cooper AM ,Dalton DK ,Stewart TA ,Griffin JP ,Russell DG ,Orme IM . Disseminated tuberculosis in interferon γ gene-disrupted mice. J Exp Med 1993;178:2243-2247
CrossRef | Web of Science | Medline11
Levin M ,Newport MJ ,D'Souza S , et al. Familial disseminated atypical mycobacterial infection in childhood: a human mycobacterial susceptibility gene? Lancet 1995;345:79-83
CrossRef | Web of Science | Medline12
Newport M ,Levin M ,Blackwell JM ,Shaw MA ,Williamson R ,Huxley C . Evidence for exclusion of a mutation in NRAMP as the cause of familial disseminated atypical mycobacterial infection in a Maltese kindred. J Med Genet 1995;32:904-906
CrossRef | Web of Science | Medline13
Lander ES ,Botstein D . Homozygosity mapping: a way to map human recessive traits with the DNA of inbred children. Science 1987;236:1567-1570
CrossRef | Web of Science | Medline14
Houwen RHJ ,Baharloo S ,Blankenship K , et al. Genome screening by searching for shared segments: mapping a gene for benign recurrent intrahepatic cholestasis. Nat Genet 1994;8:380-386
CrossRef | Web of Science | Medline15
Sambrook J, Fritsch EF, Maniatis T. Molecular cloning: a laboratory manual. 2nd ed. Vol. 2. Cold Spring Harbor, N.Y.: Cold Spring Harbor Laboratory, 1989.
16
Gyapay G ,Morissette J ,Vignal A , et al. The 1993-94 Genethon human genetic linkage map. Nat Genet 1994;7:246-339
CrossRef | Web of Science | Medline17
Strickland RW ,Wahl LM ,Finbloom DS . Corticosteroids enhance the binding of recombinant interferon-γ to cultured human monocytes. J Immunol 1986;137:1577-1580
Web of Science | Medline18
Aguet M ,Dembic Z ,Merlin G . Molecular cloning and expression of the human interferon-γ receptor. Cell 1988;55:273-280
CrossRef | Web of Science | Medline19
Klein NJ ,Kalabalikis P ,Curtis N , et al. Ex-vivo assessment of candidate anti-inflammatory agents in the treatment of gram negative sepsis. Immunol Infect Dis 1994;4:33-3520
Dib C ,Faure S ,Fizames C , et al. A comprehensive genetic map of the human genome based on 5,264 microsatellites. Nature 1996;380:152-154
CrossRef | Web of Science | Medline21
Pfizenmaier K ,Wiegmann K ,Scheurich P , et al. High affinity human IFN-γ-binding capacity is encoded by a single receptor gene located in proximity to c-ros on human chromosome region 6q16 to 6q22. J Immunol 1988;141:856-860
Web of Science | Medline22
Farrar MA ,Schreiber RD . The molecular cell biology of interferon-gamma and its receptor. Annu Rev Immunol 1993;11:571-611
CrossRef | Web of Science | Medline23
Kotenko SV ,Izotova LS ,Pollack BP , et al. Interaction between the components of the interferon γ receptor complex. J Biol Chem 1995;270:20915-20921
CrossRef | Web of Science | Medline24
D'Souza S ,Levin M ,Faith A , et al. Defective antigen processing associated with familial disseminated mycobacteriosis. Clin Exp Immunol 1996;103:35-39
CrossRef | Web of Science | Medline25
Soh J ,Donnelly RJ ,Kotenko S , et al. Identification and sequence of an accessory factor required for activation of the human interferon γ receptor. Cell 1994;76:793-802
CrossRef | Web of Science | Medline26
Greenlund AC ,Farrar MA ,Viviano BL ,Schreiber RD . Ligand-induced IFN gamma receptor tyrosine phosphorylation couples the receptor to its signal transduction system (p91). EMBO J 1994;13:1591-1600
Web of Science | Medline27
Chan J, Kaufmann SHE. Immune mechanisms of protection. In: Bloom BR, ed. Tuberculosis: pathogenesis, protection, and control. Washington, D.C.: American Society for Microbiology Press, 1994:389-415.
28
Orme IM ,Roberts AD ,Griffin JP ,Abrams JS . Cytokine secretion by CD4 T lymphocytes acquired in response to Mycobacterium tuberculosis infection. J Immunol 1993;151:518-525
Web of Science | Medline29
Wong GH ,Clark-Lewis I ,McKimm-Breschkin L ,Harris AW ,Schrader JW . Interferon-γ induces enhanced expression of Ia and H-2 antigens on B lymphoid, macrophage, and myeloid cell lines. J Immunol 1983;131:788-793
Web of Science | Medline30
Nathan C . Nitric oxide as a secretory product of mammalian cells. FASEB J 1992;6:3051-3064
Web of Science | Medline31
Walker L ,Lowrie DB . Killing of Mycobacterium microti by immunologically activated macrophages. Nature 1981;293:69-71
CrossRef | Web of Science | Medline32
Flesch IEA ,Kaufmann SHE . Activation of tuberculostatic macrophage functions by gamma interferon, interleukin-4, and tumor necrosis factor. Infect Immun 1990;58:2675-2677
Web of Science | Medline33
Denis M . Killing of Mycobacterium tuberculosis within human monocytes: activation by cytokines and calcitriol. Clin Exp Immunol 1991;84:200-206
CrossRef | Web of Science | Medline34
Nathan CF ,Murray HW ,Wiebe ME ,Rubin BY . Identification of interferon-γ as the lymphokine that activates human macrophage oxidative metabolism and antimicrobial activity. J Exp Med 1983;158:670-689
CrossRef | Web of Science | Medline35
Rook GAW ,Steele J ,Fraher L , et al. Vitamin D3, gamma interferon, and control of proliferation of Mycobacterium tuberculosis by human monocytes. Immunology 1986;57:159-163
Web of Science | Medline36
Holland SM ,Eisenstein EM ,Kuhns DB , et al. Treatment of refractory disseminated nontuberculous mycobacterial infection with interferon gamma: a preliminary report. N Engl J Med 1994;330:1348-1355
Full Text | Web of Science | Medline37
Lewis DB ,Wilson CB . Gamma-interferon: an immunoregulatory lymphokine with immunotherapeutic potential. Pediatr Infect Dis 1990;9:642-651
- Citing Articles (336)
Citing Articles
1
L. B. Barreiro, L. Tailleux, A. A. Pai, B. Gicquel, J. C. Marioni, Y. Gilad. (2012) Deciphering the genetic architecture of variation in the immune response to Mycobacterium tuberculosis infection. Proceedings of the National Academy of Sciences
CrossRef2
R. J. Wilkinson. (2012) Human Genetic Susceptibility to Tuberculosis: Time for a Bottom-Up Approach?. Journal of Infectious Diseases
CrossRef3
Brigitte Walther, David JC Miles, Pauline Waight, Melba S Palmero, Olubukola Ojuola, Ebrima S Touray, Hilton Whittle, Marianne van der Sande, Sarah Crozier, Katie L Flanagan. (2012) Placental malaria is associated with attenuated CD4 T-cell responses to tuberculin PPD 12 months after BCG vaccination. BMC Infectious Diseases 12:1, 6
CrossRef4
Daniel F. Hoft, Azra Blazevic, Jaime Stanley, Bernard Landry, Donata Sizemore, Eloi Kpamegan, Jacqueline Gearhart, Alison Scott, Sandra Kik, Maria G. Pau, Jaap Goudsmit, J. Bruce McClain, Jerald Sadoff. (2012) A recombinant adenovirus expressing immunodominant TB antigens can significantly enhance BCG-induced human immunity. Vaccine
CrossRef5
Jacinta Bustamante, Capucine Picard, Stéphanie Boisson-Dupuis, Laurent Abel, Jean-Laurent Casanova. (2011) Genetic lessons learned from X-linked Mendelian susceptibility to mycobacterial diseases. Annals of the New York Academy of Sciences 1246:1, 92-101
CrossRef6
Manjunatha M. Venkataswamy, Michael F. Goldberg, Andres Baena, John Chan, William R. Jacobs, Steven A. Porcelli. (2011) In vitro culture medium influences the vaccine efficacy of Mycobacterium bovis BCG. Vaccine
CrossRef7
T. C. Hall, D. K. Bilku, D. Al-Leswas, C. Horst, A. R. Dennison. (2011) The difficulties of clinical trials evaluating therapeutic agents in patients with severe sepsis. Irish Journal of Medical Science
CrossRef8
Cailin Moira Wilke, Shuang Wei, Lin Wang, Ilona Kryczek, John Kao, Weiping Zou. (2011) Dual biological effects of the cytokines interleukin-10 and interferon-γ. Cancer Immunology, Immunotherapy 60:11, 1529-1541
CrossRef9
H. McShane. (2011) Tuberculosis vaccines: beyond bacille Calmette-Guerin. Philosophical Transactions of the Royal Society B: Biological Sciences 366:1579, 2782-2789
CrossRef10
M. Fabri, S. Stenger, D.-M. Shin, J.-M. Yuk, P. T. Liu, S. Realegeno, H.-M. Lee, S. R. Krutzik, M. Schenk, P. A. Sieling, R. Teles, D. Montoya, S. S. Iyer, H. Bruns, D. M. Lewinsohn, B. W. Hollis, M. Hewison, J. S. Adams, A. Steinmeyer, U. Zugel, G. Cheng, E.-K. Jo, B. R. Bloom, R. L. Modlin. (2011) Vitamin D Is Required for IFN- -Mediated Antimicrobial Activity of Human Macrophages. Science Translational Medicine 3:104, 104ra102-104ra102
CrossRef11
Yusuf Akhter, Matthias T. Ehebauer, Sangita Mukhopadhyay, Seyed E. Hasnain. (2011) The PE/PPE multigene family codes for virulence factors and is a possible source of mycobacterial antigenic variation: Perhaps more?. Biochimie
CrossRef12
Mark J. Cayabyab, Suely S. Kashino, Antonio Campos-Neto. (2011) Robust Immune Response Elicited by a Novel and Unique Mycobacterium tuberculosis Protein Using an Optimized DNA / Protein Heterologous Prime / Boost Protocol. Immunologyno-no
CrossRef13
Yuriko Ozeki, Yukio Hirayama, Takemasa Takii, Saburo Yamamoto, Kazuo Kobayashi, Sohkichi Matsumoto. (2011) Loss of anti-mycobacterial efficacy in mice over time following vaccination with Mycobacterium bovis bacillus Calmette-Guérin. Vaccine 29:40, 6881-6887
CrossRef14
Qin Li, Li Li, Yun Liu, Xiaoying Fu, Hui Wang, Suihua Lao, Binyan yang, Changyou Wu. (2011) Biological functions of Mycobacterium tuberculosis-specific CD4+T cells were impaired by tuberculosis pleural fluid. Immunology Letters 138:2, 113-121
CrossRef15
Hannah P. Gideon, JoAnne L. Flynn. (2011) Latent tuberculosis: what the host “sees”?. Immunologic Research 50:2-3, 202-212
CrossRef16
Simon Nadel. (2011) Genetic Susceptibility in Sepsis. Pediatric Drugs 13:4, 205-208
CrossRef17
Antima Gupta, Akshay Kaul, Anthony G. Tsolaki, Uday Kishore, Sanjib Bhakta. (2011) Mycobacterium tuberculosis: Immune evasion, latency and reactivation. Immunobiology
CrossRef18
M. O. C. Ota, A. A. Odutola, P. K. Owiafe, S. Donkor, O. A. Owolabi, N. J. Brittain, N. Williams, S. Rowland-Jones, A. V. S. Hill, R. A. Adegbola, H. McShane. (2011) Immunogenicity of the Tuberculosis Vaccine MVA85A Is Reduced by Coadministration with EPI Vaccines in a Randomized Controlled Trial in Gambian Infants. Science Translational Medicine 3:88, 88ra56-88ra56
CrossRef19
Walid Ben Selma, Hedi Harizi, Iheb Bougmiza, Naila Hannachi, Imen Ben Kahla, Radhia Zaieni, Jalel Boukadida. (2011) Interferon Gamma +874T/A Polymorphism Is Associated with Susceptibility to Active Pulmonary Tuberculosis Development in Tunisian Patients. DNA and Cell Biology 30:6, 379-387
CrossRef20
Hui-Qi Qu, Susan P. Fisher-Hoch, Joseph B. McCormick. (2011) Molecular immunity to mycobacteria: knowledge from the mutation and phenotype spectrum analysis of Mendelian susceptibility to mycobacterial diseases. International Journal of Infectious Diseases 15:5, e305-e313
CrossRef21
Nazan Dalgic, Deniz Tekin, Zeliha Kayaalti, Tulin Soylemezoglu, Erkan Cakir, Betul Kilic, Busra Kutlubay, Mesut Sancar, Miyase Odabasi. (2011) Arg753Gln polymorphism of the human Toll-like receptor 2 gene from infection to disease in pediatric tuberculosis. Human Immunology 72:5, 440-445
CrossRef22
Rosalind Rowland, Helen McShane. (2011) Tuberculosis vaccines in clinical trials. Expert Review of Vaccines 10:5, 645-658
CrossRef23
I. Sologuren, S. Boisson-Dupuis, J. Pestano, Q. B. Vincent, L. Fernandez-Perez, A. Chapgier, M. Cardenes, J. Feinberg, M. I. Garcia-Laorden, C. Picard, E. Santiago, X. Kong, L. Janniere, E. Colino, E. Herrera-Ramos, A. Frances, C. Navarrete, S. Blanche, E. Faria, P. Remiszewski, A. Cordeiro, A. Freeman, S. Holland, K. Abarca, M. Valeron-Lemaur, J. Goncalo-Marques, L. Silveira, J. M. Garcia-Castellano, J. Caminero, J. L. Perez-Arellano, J. Bustamante, L. Abel, J.-L. Casanova, C. Rodriguez-Gallego. (2011) Partial recessive IFN- R1 deficiency: genetic, immunological and clinical features of 14 patients from 11 kindreds. Human Molecular Genetics 20:8, 1509-1523
CrossRef24
D. Qiao, B. Y. Yang, L. Li, J. J. Ma, X. L. Zhang, S. H. Lao, C. Y. Wu. (2011) ESAT-6- and CFP-10-Specific Th1, Th22 and Th17 Cells in Tuberculous Pleurisy May Contribute to the Local Immune Response Against Mycobacterium Tuberculosis Infection. Scandinavian Journal of Immunology 73:4, 330-337
CrossRef25
Nima Rezaei, Asghar Aghamohammadi, Davood Mansouri, Nima Parvaneh, Jean-Laurent Casanova. (2011) Tuberculosis: a new look at an old disease. Expert Review of Clinical Immunology 7:2, 129-131
CrossRef26
M. J. Newport, C. Finan. (2011) Genome-wide association studies and susceptibility to infectious diseases. Briefings in Functional Genomics and Proteomics 10:2, 98-107
CrossRef27
Chiea-Chuen Khor, Martin L Hibberd. (2011) Revealing the molecular signatures of host-pathogen interactions. Genome Biology 12:10, 229
CrossRef28
LE Cottle. (2011) Mendelian susceptibility to mycobacterial disease. Clinical Genetics 79:1, 17-22
CrossRef29
AI Al-Aska, AR Al-Anazi, SS Al-Subaei, MA Al-Hedaithy, MA Barry, AM Somily, F Buba, U Yusuf, NA Al Anazi. (2011) CD4+ T-Lymphopenia in HIV negative tuberculous patients at king khalid university hospital in riyadh, saudi arabia. European Journal of Medical Research 16:6, 285
CrossRef30
Nitya Krishnan, Brian D. Robertson, Guy Thwaites. (2010) The mechanisms and consequences of the extra-pulmonary dissemination of Mycobacterium tuberculosis. Tuberculosis 90:6, 361-366
CrossRef31
Sonia Davila, Victoria J Wright, Chiea Chuen Khor, Kar Seng Sim, Alexander Binder, Willemijn B Breunis, David Inwald, Simon Nadel, Helen Betts, Enitan D Carrol, Ronald de Groot, Peter W M Hermans, Jan Hazelzet, Marieke Emonts, Chui Chin Lim, Taco W Kuijpers, Federico Martinon-Torres, Antonio Salas, Werner Zenz, Michael Levin, Martin L Hibberd. (2010) Genome-wide association study identifies variants in the CFH region associated with host susceptibility to meningococcal disease. Nature Genetics 42:9, 772-776
CrossRef32
Nadia Caccamo, Giuliana Guggino, Simone A. Joosten, Giuseppe Gelsomino, Paola Di Carlo, Lucina Titone, Domenico Galati, Marialuisa Bocchino, Alessandro Matarese, Alfredo Salerno, Alessandro Sanduzzi, Willeke P. J. Franken, Tom H. M. Ottenhoff, Francesco Dieli. (2010) Multifunctional CD4+ T cells correlate with active Mycobacterium tuberculosis infection. European Journal of Immunology 40:8, 2211-2220
CrossRef33
John Altin, Chong Shen, Adrian Liston. (2010) Understanding the genetic regulation of IgE production. Blood Reviews 24:4-5, 163-169
CrossRef34
J. He, J. Wang, D. Lei, S. Ding. (2010) Analysis of Functional SNP in Ifng/Ifngr1 in Chinese Han Population with Tuberculosis. Scandinavian Journal of Immunology 71:6, 452-458
CrossRef35
Nasreena Bashir, Fozia Kounsar, Sangita Mukhopadhyay, Seyed E. Hasnain. (2010) Mycobacterium tuberculosis conserved hypothetical protein rRv2626c modulates macrophage effector functions. Immunology 130:1, 34-45
CrossRef36
Susanna Brighenti, Jan Andersson. (2010) Induction and regulation of CD8+ cytolytic T cells in human tuberculosis and HIV infection. Biochemical and Biophysical Research Communications 396:1, 50-57
CrossRef37
Keertan DHEDA, Stephan K. SCHWANDER, Bingdong ZHU, Richard N. van ZYL-SMIT, Ying ZHANG. (2010) The immunology of tuberculosis: From bench to bedside. Respirology 15:3, 433-450
CrossRef38
V. M. Yates. 2010. Mycobacterial Infections. , 1-41.
CrossRef39
Alain Fischer. 2010. The Immunocompromised Host. .
CrossRef40
Marie-Anne Shaw. 2010. Immunogenetics. .
CrossRef41
Carolina Prando, Stéphanie Boisson-Dupuis, Audrey V. Grant, Xiao-Fei Kong, Jacinta Bustamante, Jacqueline Feinberg, Ariane Chapgier, Yoann Rose, Lucile Jannière, Elena Rizzardi, Qiuping Zhang, Catherine M. Shanahan, Louis Viollet, Stanislas Lyonnet, Laurent Abel, Ezia Maria Ruga, Jean-Laurent Casanova. (2010) Paternal uniparental isodisomy of chromosome 6 causing a complex syndrome including complete IFN-γ receptor 1 deficiency. American Journal of Medical Genetics Part A 152A:3, 622-629
CrossRef42
Y. Ozeki, I. Sugawara, T. Udagawa, T. Aoki, M. Osada-Oka, Y. Tateishi, H. Hisaeda, Y. Nishiuchi, N. Harada, K. Kobayashi, S. Matsumoto. (2010) Transient role of CD4+CD25+ regulatory T cells in mycobacterial infection in mice. International Immunology 22:3, 179-189
CrossRef43
Maeve K. Lalor, Steven G. Smith, Sian Floyd, Patricia Gorak-Stolinska, Rosemary E. Weir, Rose Blitz, Keith Branson, Paul E. Fine, Hazel M. Dockrell. (2010) Complex cytokine profiles induced by BCG vaccination in UK infants. Vaccine 28:6, 1635-1641
CrossRef44
Diederik van de Wetering, Roelof A. de Paus, Jaap T. van Dissel, Esther van de Vosse. (2010) Functional analysis of naturally occurring amino acid substitutions in human IFN-γR1. Molecular Immunology 47:5, 1023-1030
CrossRef45
Jae-Joon YIM, Paramasivam SELVARAJ. (2010) Genetic susceptibility in tuberculosis. Respirology 15:2, 241-256
CrossRef46
Celia Guerrero-Velázquez, Rocio I. Lopez-Roa, Vidal Delgado-Rizo, Cecilia M. Guillen-Vargas, Margarita Montoya-Buelna, Mary Fafutis-Morris. (2010) Abnormalities in Intracellular Processing and Expression of Interferon-γ Receptor in Adherent Cells From Lepromatous Leprosy Patients. Journal of Interferon & Cytokine Research 30:2, 99-106
CrossRef47
Maria Grazia Marazzi, Ariane Chapgier, Anna-Carla Defilippi, Vito Pistoia, Sara Mangini, Cesarina Savioli, Anna Dell’Acqua, Jacqueline Feinberg, Enrico Tortoli, Jean-Laurent Casanova. (2010) Disseminated Mycobacterium scrofulaceum infection in a child with interferon-γ receptor 1 deficiency. International Journal of Infectious Diseases 14:2, e167-e170
CrossRef48
X.-F. Kong, G. Vogt, A. Chapgier, C. Lamaze, J. Bustamante, C. Prando, A. Fortin, A. Puel, J. Feinberg, X.-X. Zhang, P. Gonnord, U. M. Pihkala-Saarinen, M. Arola, P. Moilanen, L. Abel, M. Korppi, S. Boisson-Dupuis, J.-L. Casanova. (2010) A novel form of cell type-specific partial IFN- R1 deficiency caused by a germ line mutation of the IFNGR1 initiation codon. Human Molecular Genetics 19:3, 434-444
CrossRef49
Pooja KHOSLA, Neha AROAA, Sunil JAIN. (2010) Tubercular pyomyositis in a case of rheumatoid arthritis being treated with infliximab. International Journal of Rheumatic Diseases 13:1, 82-85
CrossRef50
H. Northen, G.K. Paterson, F. Constantino-Casas, C.E. Bryant, S. Clare, P. Mastroeni, S.E. Peters, D.J. Maskell. (2010) Salmonella enterica serovar Typhimurium mutants completely lacking the F0F1 ATPase are novel live attenuated vaccine strains. Vaccine 28:4, 940-949
CrossRef51
Y. Y. Wan, R. A. Flavell. (2009) How Diverse--CD4 Effector T Cells and their Functions. Journal of Molecular Cell Biology 1:1, 20-36
CrossRef52
Luciana Breda, Giuseppina Michele, Manuela Nozzi, Sara Sanctis, Daniele Marzio, Francesco Chiarelli. (2009) Non-tuberculous mycobacterial osteomyelitis: an unusual cause of hip pain in immunocompetent children. Rheumatology International 29:12, 1487-1489
CrossRef53
Alexandre Alcaïs, Laurent Abel, Jean-Laurent Casanova. (2009) Human genetics of infectious diseases: between proof of principle and paradigm. Journal of Clinical Investigation 119:9, 2506-2514
CrossRef54
Victoria Wright, Martin Hibberd, Michael Levin. (2009) Genetic polymorphisms in host response to meningococcal infection: The role of susceptibility and severity genes. Vaccine 27, B90-B102
CrossRef55
Sayma Rahman, Berhanu Gudetta, Joshua Fink, Anna Granath, Senait Ashenafi, Abraham Aseffa, Milliard Derbew, Mattias Svensson, Jan Andersson, Susanna Grundström Brighenti. (2009) Compartmentalization of Immune Responses in Human Tuberculosis. The American Journal of Pathology 174:6, 2211-2224
CrossRef56
N. Talat, F. Shahid, G. Dawood, R. Hussain. (2009) Dynamic Changes in Biomarker Profiles Associated with Clinical and Subclinical Tuberculosis in a High Transmission Setting: A Four-Year Follow-Up Study. Scandinavian Journal of Immunology 69:6, 537-546
CrossRef57
Lei Zhang, Fang Sun, Qilong Wang, Jing Zhou, Li-He Zhang, Xiao-Lian Zhang, Xin-Shan Ye. (2009) Discovery of Iminosugar Derivatives with Strong IFN-γ Inducing Activity. ChemMedChem 4:5, 756-760
CrossRef58
Claus Aagaard, Jes Dietrich, Mark Doherty, Peter Andersen. (2009) TB vaccines: current status and future perspectives. Immunology and Cell Biology 87:4, 279-286
CrossRef59
ITAI PESSACH, JOLAN WALTER, LUIGI D. NOTARANGELO. (2009) Recent Advances in Primary Immunodeficiencies: Identification of Novel Genetic Defects and Unanticipated Phenotypes. Pediatric Research 65:Supplement, 3R-12R
CrossRef60
Kah Wee Koh, Norbert Lehming, Geok Teng Seah. (2009) Degradation-resistant protein domains limit host cell processing and immune detection of mycobacteria. Molecular Immunology 46:7, 1312-1318
CrossRef61
Jennifer Lighter, Mona Rigaud. (2009) Diagnosing Childhood Tuberculosis: Traditional and Innovative Modalities. Current Problems in Pediatric and Adolescent Health Care 39:3, 61-88
CrossRef62
Jayne S. Sutherland, Ifedayo M. Adetifa, Philip C. Hill, Richard A. Adegbola, Martin O. C. Ota. (2009) Pattern and diversity of cytokine production differentiates between Mycobacterium tuberculosis infection and disease. European Journal of Immunology 39:3, 723-729
CrossRef63
Yoshitaka Tateishi, Yukio Hirayama, Yuriko Ozeki, Yukiko Nishiuchi, Mamiko Yoshimura, Jing Kang, Atsushi Shibata, Kazuto Hirata, Seigo Kitada, Ryoji Maekura, Hisashi Ogura, Kazuo Kobayashi, Sohkichi Matsumoto. (2009) Virulence of Mycobacterium avium complex strains isolated from immunocompetent patients. Microbial Pathogenesis 46:1, 6-12
CrossRef64
R. J. Boyton. (2009) Regulation of immunity in bronchiectasis. Medical Mycology 47:s1, S175-S182
CrossRef65
Simon Barry, Ronan Breen, Marc Lipman, Margaret Johnson, George Janossy. (2009) Impaired antigen-specific CD4+ T lymphocyte responses in cavitary tuberculosis. Tuberculosis 89:1, 48-53
CrossRef66
Rhea N. Coler, Davin C. Dillon, Yasir A.W. Skeiky, Maria Kahn, Ian M. Orme, Yves Lobet, Steven G. Reed, Mark R. Alderson. (2009) Identification of Mycobacterium tuberculosis vaccine candidates using human CD4+ T-cells expression cloning. Vaccine 27:2, 223-233
CrossRef67
Saleh Al-Muhsen, Jean-Laurent Casanova. (2008) The genetic heterogeneity of mendelian susceptibility to mycobacterial diseases. Journal of Allergy and Clinical Immunology 122:6, 1043-1051
CrossRef68
Angela M Minassian, Helen McShane. (2008) Tuberculosis vaccines: present and future. Expert Review of Respiratory Medicine 2:6, 721-738
CrossRef69
Daniel F. Hoft, Azra Blazevic, Getahun Abate, Willem A. Hanekom, Gilla Kaplan, Jorge H. Soler, Frank Weichold, Larry Geiter, Jerald C. Sadoff, Marcus A. Horwitz. (2008) A New Recombinant Bacille Calmette‐Guérin Vaccine Safely Induces Significantly Enhanced Tuberculosis‐Specific Immunity in Human Volunteers. The Journal of Infectious Diseases 198:10, 1491-1501
CrossRef70
W. T. Watford, B. D. Hissong, L. R. Durant, H. Yamane, L. M. Muul, Y. Kanno, C. M. Tato, H. L. Ramos, A. E. Berger, L. Mielke, M. Pesu, B. Solomon, D. M. Frucht, W. E. Paul, A. Sher, D. Jankovic, P. N. Tsichlis, J. J. O'Shea. (2008) Tpl2 kinase regulates T cell interferon- production and host resistance to Toxoplasma gondii. Journal of Experimental Medicine 205:12, 2803-2812
CrossRef71
Natalie E.R. Beveridge, Helen A. Fletcher, Jane Hughes, Ansar A. Pathan, Thomas J. Scriba, Angela Minassian, Clare R. Sander, Kathryn T. Whelan, Hazel M. Dockrell, Adrian V.S. Hill, Willem A. Hanekom, Helen McShane. (2008) A comparison of IFNγ detection methods used in tuberculosis vaccine trials. Tuberculosis 88:6, 631-640
CrossRef72
Mark P. Nicol, Robert J. Wilkinson. (2008) The clinical consequences of strain diversity in Mycobacterium tuberculosis. Transactions of the Royal Society of Tropical Medicine and Hygiene 102:10, 955-965
CrossRef73
J. Zhu, W. E. Paul. (2008) CD4 T cells: fates, functions, and faults. Blood 112:5, 1557-1569
CrossRef74
Jean-Laurent Casanova, Claire Fieschi, Shen-Ying Zhang, Laurent Abel. (2008) Revisiting human primary immunodeficiencies. Journal of Internal Medicine 264:2, 115-127
CrossRef75
Sandra M Newton, Andrew J Brent, Suzanne Anderson, Elizabeth Whittaker, Beate Kampmann. (2008) Paediatric tuberculosis. The Lancet Infectious Diseases 8:8, 498-510
CrossRef76
Cory M. Robinson, Gerard J. Nau. (2008) Interleukin‐12 and Interleukin‐27 Regulate Macrophage Control of Mycobacterium tuberculosis. The Journal of Infectious Diseases 198:3, 359-366
CrossRef77
S. Ding, F. Li, J. Wang, K. Xu, L. Li. (2008) Interferon Gamma Receptor 1 Gene Polymorphism in Patients with Tuberculosis in China. Scandinavian Journal of Immunology 68:2, 140-144
CrossRef78
Daniel F Hoft. (2008) Tuberculosis vaccine development: goals, immunological design, and evaluation. The Lancet 372:9633, 164-175
CrossRef79
Jacinta Bustamante, Shen-Ying Zhang, Horst von Bernuth, Laurent Abel, Jean-Laurent Casanova. (2008) From Infectious Diseases to Primary Immunodeficiencies. Immunology and Allergy Clinics of North America 28:2, 235-258
CrossRef80
A. Marinho, G. Fernandes, T. Carvalho, D. Pinheiro, I. Gomes. (2008) Micobactérias atípicas em doentes sem síndroma de imunodeficiência adquirida. Revista Portuguesa de Pneumologia (English Edition) 14:3, 323-337
CrossRef81
Paul L.A.M. Corstjens, Michel Zuiderwijk, Hans J. Tanke, Jolien J. van der Ploeg-van Schip, Tom H.M. Ottenhoff, Annemiek Geluk. (2008) A user-friendly, highly sensitive assay to detect the IFN-γ secretion by T cells. Clinical Biochemistry 41:6, 440-444
CrossRef82
A. S. Pulickal, S. Hambleton, M. J. Callaghan, C. E. Moore, J. Goulding, A. Goodsall, R. Baretto, D. A. Lammas, S. T. Anderson, M. Levin, A. J. Pollard. (2008) Biliary Cirrhosis in a Child with Inherited Interleukin-12 Deficiency. Journal of Tropical Pediatrics 54:4, 269-271
CrossRef83
A. N. Gaikwad, Sudhir Sinha. (2008) Determinants of natural immunity against tuberculosis in an endemic setting: factors operating at the level of macrophage-Mycobacterium tuberculosis interaction. Clinical & Experimental Immunology 151:3, 414-422
CrossRef84
Jacinta Bustamante, Stéphanie Boisson-Dupuis, Emmanuelle Jouanguy, Capucine Picard, Anne Puel, Laurent Abel, Jean-Laurent Casanova. (2008) Novel primary immunodeficiencies revealed by the investigation of paediatric infectious diseases. Current Opinion in Immunology 20:1, 39-48
CrossRef85
H. Glosli, A. Stray-Pedersen, A. C. Brun, L. W. Holtmon, T. Tonjum, A. Chapgier, J. L. Casanova, T. G. Abrahamsen. (2008) Infections Due to Various Atypical Mycobacteria in a Norwegian Multiplex Family with Dominant Interferon- Receptor Deficiency. Clinical Infectious Diseases 46:3, e23-e27
CrossRef86
Gülbû Uzel, Steven M. Holland. 2008. Phagocyte deficiencies. , 327-344.
CrossRef87
Capucine Picard, Jean-Laurent Casanova. 2008. Inherited disorders of IFN-γ-, IFN-α/β-, and NF-κB-mediated immunity. , 553-560.
CrossRef88
Delane Shingadia, David Burgner. 2008. Mycobacterial Infections. , 597-614.
CrossRef89
Vanessa Sancho-Shimizu, Shen-Ying Zhang, Laurent Abel, Marc Tardieu, Flore Rozenberg, Emmanuelle Jouanguy, Jean-Laurent Casanova. (2007) Genetic susceptibility to herpes simplex virus 1 encephalitis in mice and humans. Current Opinion in Allergy and Clinical Immunology 7:6, 495-505
CrossRef90
Gary Maartens, Robert J Wilkinson. (2007) Tuberculosis. The Lancet 370:9604, 2030-2043
CrossRef91
Julian Knight. (2007) Polymorphisms in tumor necrosis factor and other cytokines as risks for infectious diseases and the septic syndrome. Current Infectious Disease Reports 3:5, 427-439
CrossRef92
A. Fortin, L. Abel, J.L. Casanova, P. Gros. (2007) Host Genetics of Mycobacterial Diseases in Mice and Men: Forward Genetic Studies of BCG-osis and Tuberculosis. Annual Review of Genomics and Human Genetics 8:1, 163-192
CrossRef93
Theodoros Eleftheriadis, Georgia Antoniadi, Vassilios Liakopoulos, Charalambos Kartsios, Ioannis Stefanidis. (2007) Basic Science and Dialysis: Disturbances of Acquired Immunity in Hemodialysis Patients. Seminars in Dialysis 20:5, 440-451
CrossRef94
Jeroen G. Noordzij, Nico G. Hartwig, Frank A. W. Verreck, Sandra De Bruin-Versteeg, Tjitske De Boer, Jaap T. Van Dissel, Ronald De Groot, Tom H. M. Ottenhoff, Jacques J. M. Van Dongen. (2007) Two Patients with Complete Defects in Interferon Gamma Receptor-Dependent Signaling. Journal of Clinical Immunology 27:5, 490-496
CrossRef95
BÜLENT KARAPINAR, DENIZ YILMAZ, GÜLGÜN ASAR, FADIL VARDAR. (2007) Disseminated invasive vertebral aspergillosis in an immunocompetent girl with a 7 year latent period. Pediatrics International 49:4, 516-518
CrossRef96
Carla M. Ward, Harumi Jyonouchi, Sergei V. Kotenko, Sergey V. Smirnov, Rakesh Patel, Helen Aguila, George McSherry, Barry Dashefsky, Steven M. Holland. (2007) Adjunctive treatment of disseminated Mycobacterium avium complex infection with interferon alpha-2b in a patient with complete interferon-gamma receptor R1 deficiency. European Journal of Pediatrics 166:9, 981-985
CrossRef97
Claire Andréjak, François-Xavier Lescure, Youcef Douadi, Geneviève Laurans, Amar Smail, Pierre Duhaut, Vincent Jounieaux, Jean-Luc Schmit. (2007) Non-tuberculous mycobacteria pulmonary infection: Management and follow-up of 31 infected patients. Journal of Infection 55:1, 34-40
CrossRef98
Francis Serour, Avraham Mizrahi, Eli Somekh, Jacqueline Feinberg, Capucine Picard, Jean-Laurent Casanova, Ilan Dalal. (2007) Analysis of the interleukin-12/interferon-γ pathway in children with non-tuberculous mycobacterial cervical lymphadenitis. European Journal of Pediatrics 166:8, 835-841
CrossRef99
Catherine M. Stein, Sarah Zalwango, Allan B. Chiunda, Christopher Millard, Dmitry V. Leontiev, Amanda L. Horvath, Kevin C. Cartier, Keith Chervenak, W. Henry Boom, Robert C. Elston, Roy D. Mugerwa, Christopher C. Whalen, Sudha K. Iyengar. (2007) Linkage and association analysis of candidate genes for TB and TNFα cytokine expression: evidence for association with IFNGR1, IL-10, and TNF receptor 1 genes. Human Genetics 121:6, 663-673
CrossRef100
Daniel Elias, Sven Britton, Afework Kassu, Hannah Akuffo. (2007) Chronic helminth infections may negatively influence immunity against tuberculosis and other diseases of public health importance. Expert Review of Anti-infective Therapy 5:3, 475-484
CrossRef101
Mounira K. Chelbi-Alix, Juana Wietzerbin. (2007) Interferon, a growing cytokine family: 50 years of interferon research. Biochimie 89:6-7, 713-718
CrossRef102
Emmanuelle Jouanguy, Shen-Ying Zhang, Ariane Chapgier, Vanessa Sancho-Shimizu, Anne Puel, Capucine Picard, Stéphanie Boisson-Dupuis, Laurent Abel, Jean-Laurent Casanova. (2007) Human primary immunodeficiencies of type I interferons. Biochimie 89:6-7, 878-883
CrossRef103
Nilgün Sallakcı, Mesut Coskun, Zafer Berber, Fuat Gürkan, Halil Kocamaz, Gülnar Uysal, Sabin Bhuju, Ugur Yavuzer, Mahavir Singh, Olcay Yeğin. (2007) Interferon-γ gene+874T–A polymorphism is associated with tuberculosis and gamma interferon response. Tuberculosis 87:3, 225-230
CrossRef104
Robert H. Yolken, E Fuller Torrey. 2007. Hypothesis of an Infectious Etiology in Bipolar Disorder. , 209-220.
CrossRef105
D. Furthner, J. Mühleder, F. Eitelberger, E. Richter, C. Engelhorn, B. H. Belohradsky, J. L. Casanova. (2007) Neu beschriebener homozygoter Interferon-γ-Rezeptor-2-Defekt. Monatsschrift Kinderheilkunde 155:S01, S58-S61
CrossRef106
Jung Hye Hwang, Eun Joo Kim, Won-Jung Koh, Su Yeon Kim, Shin-Hye Lee, Gee Young Suh, O Jung Kwon, Chang Seok Ki, Yongick Ji, Miyeon Kang, Duk-Hwan Kim. (2007) Polymorphisms of interferon-γ and interferon-γ receptor 1 genes and non-tuberculous mycobacterial lung diseases. Tuberculosis 87:2, 166-171
CrossRef107
C. Sander, H. McShane. (2007) Translational Mini-Review Series on Vaccines:
Development and evaluation of improved vaccines against tuberculosis. Clinical & Experimental Immunology 147:3, 401-411
CrossRef108
Jean-Laurent Casanova, Laurent Abel. (2007) Human genetics of infectious diseases: a unified theory. The EMBO Journal 26:4, 915-922
CrossRef109
M A Salih, M E Ibrahim, J M Blackwell, E N Miller, E A G Khalil, A M ElHassan, A M Musa, H S Mohamed. (2007) IFNG and IFNGR1 gene polymorphisms and susceptibility to post-kala-azar dermal leishmaniasis in Sudan. Genes and Immunity 8:1, 75-78
CrossRef110
Orchidée Filipe-Santos, Jacinta Bustamante, Ariane Chapgier, Guillaume Vogt, Ludovic de Beaucoudrey, Jacqueline Feinberg, Emmanuelle Jouanguy, Stéphanie Boisson-Dupuis, Claire Fieschi, Capucine Picard, Jean-Laurent Casanova. (2006) Inborn errors of IL-12/23- and IFN-γ-mediated immunity: molecular, cellular, and clinical features. Seminars in Immunology 18:6, 347-361
CrossRef111
Christina Warrender, Stephanie Forrest, Frederick Koster. (2006) Modeling Intercellular Interactions in Early Mycobacterium Infection. Bulletin of Mathematical Biology 68:8, 2233-2261
CrossRef112
S. Brahmbhatt, G. F. Black, N. M. Carroll, N. Beyers, F. Salker, M. Kidd, P. T. Lukey, K. Duncan, P. van Helden, G. Walzl. (2006) Immune markers measured before treatment predict outcome of intensive phase tuberculosis therapy. Clinical and Experimental Immunology 146:2, 243-252
CrossRef113
D. ELIAS, H. AKUFFO, S. BRITTON. (2006) Helminthes could influence the outcome of vaccines against TB in the tropics. Parasite Immunology 28:10, 507-513
CrossRef114
L. N. Nesterenko, D. V. Balunets, A. S. Tomova, J. M. Romanova, J. S. Alyapkina, N. A. Zigangirova, M. A. Kapina, E. V. Kondratieva, A. V. Pichugin, K. B. Majorov, A. S. Apt. (2006) Mycobacterium tuberculosis-susceptible I/St mice develop severe disease following infection with taxonomically distant bacteria, Salmonella enterica and Chlamydia pneumoniae. Clinical and Experimental Immunology 146:1, 93-100
CrossRef115
R. J. Boyton, C. Reynolds, F. N. Wahid, M. G. Jones, L. Ozerovitch, T. Ahmad, A. Chaudhry, D. P. Jewell, O. M. Kon, J. Smith, M. Rose, A. J. Newman-Taylor, P. Cole, R. Wilson, D. M. Altmann. (2006) IFN? and CXCR-1 gene polymorphisms in idiopathic bronchiectasis. Tissue Antigens 68:4, 325-330
CrossRef116
David Burgner, Sarra E Jamieson, Jenefer M Blackwell. (2006) Genetic susceptibility to infectious diseases: big is beautiful, but will bigger be even better?. The Lancet Infectious Diseases 6:10, 653-663
CrossRef117
Jung Hye Hwang, Won-Jung Koh, Eun Joo Kim, Eun Hae Kang, Gee Young Suh, Man Pyo Chung, Hojoong Kim, O Jung Kwon. (2006) Partial interferon-γ receptor deficiency and non-tuberculous mycobacterial lung disease. Tuberculosis 86:5, 382-385
CrossRef118
M. Storgaard, K. Varming, T. Herlin, N. Obel. (2006) Novel Mutation in the Interferon- γ -Receptor Gene and Susceptibility to Mycobacterial Infections. Scandinavian Journal of Immunology 64:2, 137-139
CrossRef119
William P. Lafuse, Gail R. Alvarez, Heather M. Curry, Bruce S. Zwilling. (2006) Mycobacterium tuberculosis and Mycobacterium avium Inhibit IFN- γ -Induced Gene Expression by TLR2-Dependent and Independent Pathways. Journal of Interferon & Cytokine Research 26:8, 548-561
CrossRef120
C F Chantrain, A Bruwier, B Brichard, V Largent, A Chapgier, J Feinberg, J-L Casanova, J-P Stalens, C Vermylen. (2006) Successful hematopoietic stem cell transplantation in a child with active disseminated Mycobacterium fortuitum infection and interferon-γ receptor 1 deficiency. Bone Marrow Transplantation 38:1, 75-76
CrossRef121
A Kassu, T Yabutani, Z H Mahmud, A Mohammad, N Nguyen, B T M Huong, G Hailemariam, E Diro, B Ayele, Y Wondmikun, J Motonaka, F Ota. (2006) Alterations in serum levels of trace elements in tuberculosis and HIV infections. European Journal of Clinical Nutrition 60:5, 580-586
CrossRef122
Anna Liberek, Maria Korzon, Ewa Bernatowska, Magdalena Kurenko-Deptuch, Marlena Rytlewska. (2006) Vaccination-related Mycobacterium bovis BCG Infection. Emerging Infectious Diseases 12:5, 860-861
CrossRef123
Rainer Doffinger, Smita Y. Patel, Dinakantha S. Kumararatne. (2006) Host genetic factors and mycobacterial infections: lessons from single gene disorders affecting innate and adaptive immunity. Microbes and Infection 8:4, 1141-1150
CrossRef124
M.H. Haverkamp, J.T. van Dissel, S.M. Holland. (2006) Human host genetic factors in nontuberculous mycobacterial infection: lessons from single gene disorders affecting innate and adaptive immunity and lessons from molecular defects in interferon-γ-dependent signaling. Microbes and Infection 8:4, 1157-1166
CrossRef125
SURAN L FERNANDO, WARWICK J BRITTON. (2006) Genetic susceptibility to mycobacterial disease in humans. Immunology and Cell Biology 84:2, 125-137
CrossRef126
David Burgner, Michael Levin. 2006. Infectious Diseases: Predisposition. .
CrossRef127
Paweł Remiszewski, Barbara Roszkowska-Śliz, Jolanta Winek, Ariane Chapgier, Jacquelin Feinberg, Renata Langfort, Iwona Bestry, Ewa Augustynowicz-Kopeć, Jakub Ptak, Jean-Laurent Casanova, Ewa Rowińska-Zakrzewska. (2006) Disseminated <i>Mycobacterium avium</i> Infection in a 20-Year-Old Female with Partial Recessive IFNγR1 Deficiency. Respiration 73:3, 375-378
CrossRef128
Anita E. Smyth, Paul Jackson, David Lammas, M. Suhail Asghar, Alistair D. Crockard, Jean-Laurent Casanova, Dinakantha S. Kumararatne, J. David M. Edgar. (2006) Differential response to interferon-γ therapy in a family with dominant negative partial interferon-γ receptor1 deficiency. European Journal of Pediatrics 165:1, 71-72
CrossRef129
Michael Levin. (2006) Anti-Interferon Auto-Antibodies in Autoimmune Polyendocrinopathy Syndrome Type 1. PLoS Medicine 3:7, e292
CrossRef130
Jung Yeon Lee, Tae Sun Shim. (2006) Diagnosis of Mycobacterium tuberculosis Infection using Ex-vivo interferon-gamma Assay. Tuberculosis and Respiratory Diseases 60:5, 497
CrossRef131
Davood Mansouri, Parisa Adimi, Mehdi Mirsaeidi, Nahal Mansouri, Soheila Khalilzadeh, Mohammad R. Masjedi, Parvaneh Adimi, Payam Tabarsi, Mohammad Naderi, Orchidée Filipe-Santos, Guillaume Vogt, Ludovic Beaucoudrey, Jacinta Bustamante, Ariane Chapgier, Jacqueline Feinberg, Ali A. Velayati, Jean-Laurent Casanova. (2005) Inherited disorders of the IL-12-IFN-γ axis in patients with disseminated BCG infection. European Journal of Pediatrics 164:12, 753-757
CrossRef132
Philip M. D. Wood, Claire Fieschi, Capucine Picard, Tom H. M. Ottenhoff, Jean-Laurent Casanova, Dinakantha S. Kumararatne. (2005) Inherited defects in the interferon-gamma receptor or interleukin-12 signalling pathways are not sufficient to cause allergic disease in children. European Journal of Pediatrics 164:12, 741-747
CrossRef133
Steven M Opal, Alan S Cross. (2005) THE USE OF IMMUNOCOMPROMISED ANIMALS AS MODELS FOR HUMAN SEPTIC SHOCK. Shock 24:Supplement 1, 64-70
CrossRef134
E. Catherinot, C. Fieschi, J. Feinberg, J.-L. Casanova, L.-J. Couderc. (2005) Syndrome de susceptibilite mendélienne aux infections mycobacteriennes : défauts de l’axe Interleukine-12 - Interféron. Revue des Maladies Respiratoires 22:5, 767-776
CrossRef135
Caterina Romano Carratelli, Antonietta Rizzo, Rossella Paolillo, Maria Rosaria Catania, Piergiorgio Catalanotti, Fabio Rossano. (2005) Effect of nitric oxide on the growth of Chlamydophila pneumoniae. Canadian Journal of Microbiology 51:11, 941-947
CrossRef136
A. Fortes, K. Pereira, P. R. Z. Antas, C. L. M. C. Franken, M. Dalcolmo, M. M. Ribeiro-Carvalho, K. S. Cunha, A. Geluk, A. Kritski, A. Kolk, P. Klatser, E. N. Sarno, T. H. M. Ottenhoff, E. P. Sampaio. (2005) Detection of in vitro interferon-gamma and serum tumour necrosis factor-alpha in multidrug-resistant tuberculosis patients. Clinical and Experimental Immunology 141:3, 541-548
CrossRef137
Beate Kampmann, Cheryl Hemingway, Alick Stephens, Robert Davidson, Anna Goodsall, Suzanne Anderson, Mark Nicol, Elisabeth Schölvinck, David Relman, Simon Waddell, Paul Langford, Brian Sheehan, Lynn Semple, Katalin A. Wilkinson, Robert J. Wilkinson, Stanley Ress, Martin Hibberd, Michael Levin. (2005) Acquired predisposition to mycobacterial disease due to autoantibodies to IFN-γ. Journal of Clinical Investigation 115:9, 2480-2488
CrossRef138
D. de Moraes-Vasconcelos, A. S. Grumach, A. Yamaguti, M. E. B. Andrade, C. Fieschi, L. de Beaucoudrey, J.-L. Casanova, A. J. S. Duarte. (2005) Paracoccidioides brasiliensis Disseminated Disease in a Patient with Inherited Deficiency in the 1 Subunit of the Interleukin (IL)-12/IL-23 Receptor. Clinical Infectious Diseases 41:4, 31-37
CrossRef139
Stefan Winkler, Magdalena Necek, Heidi Winkler, Ayola A. Adegnika, Thomas Perkmann, Michael Ramharter, Peter G. Kremsner. (2005) Increased specific T cell cytokine responses in patients with active pulmonary tuberculosis from Central Africa. Microbes and Infection 7:9-10, 1161-1169
CrossRef140
Guillaume Vogt, Ariane Chapgier, Kun Yang, Nadia Chuzhanova, Jacqueline Feinberg, Claire Fieschi, Stéphanie Boisson-Dupuis, Alexandre Alcais, Orchidée Filipe-Santos, Jacinta Bustamante, Ludovic de Beaucoudrey, Ibrahim Al-Mohsen, Sami Al-Hajjar, Abdulaziz Al-Ghonaium, Parisa Adimi, Mehdi Mirsaeidi, Soheila Khalilzadeh, Sergio Rosenzweig, Oscar de la Calle Martin, Thomas R Bauer, Jennifer M Puck, Hans D Ochs, Dieter Furthner, Carolin Engelhorn, Bernd Belohradsky, Davood Mansouri, Steven M Holland, Robert D Schreiber, Laurent Abel, David N Cooper, Claire Soudais, Jean-Laurent Casanova. (2005) Gains of glycosylation comprise an unexpectedly large group of pathogenic mutations. Nature Genetics 37:7, 692-700
CrossRef141
A Natividad, J Wilson, O Koch, M J Holland, K Rockett, N Faal, O Jallow, H M Joof, M J Burton, N D E Alexander, D P Kwiatkowski, D C W Mabey, R L Bailey. (2005) Risk of trachomatous scarring and trichiasis in Gambians varies with SNP haplotypes at the interferon-gamma and interleukin-10 loci. Genes and Immunity 6:4, 332-340
CrossRef142
Bridget Vesosky, Joanne Turner. (2005) The influence of age on immunity to infection with Mycobacterium tuberculosis. Immunological Reviews 205:1, 229-243
CrossRef143
Yasmina Laouar, Fayyaz S Sutterwala, Leonid Gorelik, Richard A Flavell. (2005) Transforming growth factor-β controls T helper type 1 cell development through regulation of natural killer cell interferon-γ. Nature Immunology 6:6, 600-607
CrossRef144
R. Chacon-Salinas, J. Serafin-Lopez, R. Ramos-Payan, P. Mendez-Aragon, R. Hernandez-Pando, D. Van Soolingen, L. Flores-Romo, S. Estrada-Parra, I. Estrada-Garcia. (2005) Differential pattern of cytokine expression by macrophages infected in vitro with different Mycobacterium tuberculosis genotypes. Clinical and Experimental Immunology 140:3, 443-449
CrossRef145
Richard Bellamy. (2005) Genetic Susceptibility to Tuberculosis. Clinics in Chest Medicine 26:2, 233-246
CrossRef146
D. Elias, H. Akuffo, S. Britton. (2005) PPD induced in vitro interferon gamma production is not a reliable correlate of protection against Mycobacterium tuberculosis. Transactions of the Royal Society of Tropical Medicine and Hygiene 99:5, 363-368
CrossRef147
Denise Kirschner, Simeone Marino. (2005) Mycobacterium tuberculosis as viewed through a computer. Trends in Microbiology 13:5, 206-211
CrossRef148
Thomas John, Emily Velotta. (2005) Nontuberculous (Atypical) Mycobacterial Keratitis After LASIK. Cornea 24:3, 245-255
CrossRef149
Calin Popa, Mihai G. Netea, Pilar Barrera, Timothy R.D.S. Radstake, Piet L. van Riel, Bart-Jan Kullberg, Jos W.M. Van der Meer. (2005) Cytokine production of stimulated whole blood cultures in rheumatoid arthritis patients receiving short-term infliximab therapy. Cytokine 30:2, 72-77
CrossRef150
Sergio D. Rosenzweig, Steven M. Holland. (2005) Defects in the interferon-gamma and interleukin-12 pathways. Immunological Reviews 203:1, 38-47
CrossRef151
Masahiko Makino, Yumi Maeda, Norihisa Ishii. (2005) Immunostimulatory activity of major membrane protein-II from Mycobacterium leprae. Cellular Immunology 233:1, 53-60
CrossRef152
F. Rodríguez de Castro, J. Solé-Violán, J.C. Rodríguez-Gallego. (2005) Variabilidad genética en la susceptibilidad y en la gravedad de la neumonía. Archivos de Bronconeumología 41, 21-29
CrossRef153
Tom H.M. Ottenhoff, Frank A.W. Verreck, Marieke A. Hoeve, Esther van de Vosse. (2005) Control of human host immunity to mycobacteria. Tuberculosis 85:1-2, 53-64
CrossRef154
Helen McShane, Ansar A. Pathan, Clare R. Sander, Nilu P. Goonetilleke, Helen A. Fletcher, Adrian V.S. Hill. (2005) Boosting BCG with MVA85A: the first candidate subunit vaccine for tuberculosis in clinical trials. Tuberculosis 85:1-2, 47-52
CrossRef155
Samuel I. Miller, Robert K. Ernst, Martin W. Bader. (2005) LPS, TLR4 and infectious disease diversity. Nature Reviews Microbiology 3:1, 36-46
CrossRef156
Mark J. Smyth, Erika Cretney, Michael H. Kershaw, Yoshihiro Hayakawa. (2004) Cytokines in cancer immunity and immunotherapy. Immunological Reviews 202:1, 275-293
CrossRef157
Heather Curry, Gail R. Alvarez, Bruces S. Zwilling, William P. Lafuse. (2004) Toll-like Receptor 2 Stimulation Decreases IFN-γ Receptor Expression in Mouse RAW264.7 Macrophages. Journal of Interferon & Cytokine Research 24:12, 699-710
CrossRef158
Esther van de Vosse, Marieke A Hoeve, Tom HM Ottenhoff. (2004) Human genetics of intracellular infectious diseases: molecular and cellular immunity against mycobacteria and salmonellae. The Lancet Infectious Diseases 4:12, 739-749
CrossRef159
Panu E. Kovanen, Warren J. Leonard. (2004) Cytokines and immunodeficiency diseases: critical roles of the gammac-dependent cytokines interleukins 2, 4, 7, 9, 15, and 21, and their signaling pathways. Immunological Reviews 202:1, 67-83
CrossRef160
William E.R. Ollier. (2004) Cytokine genes and disease susceptibility. Cytokine 28:4-5, 174-178
CrossRef161
Jacqueline Feinberg, Claire Fieschi, Rainer Doffinger, Max Feinberg, Tony Leclerc, St
phanie Boisson-Dupuis, Capucine Picard, Jacinta Bustamante, Ariane Chapgier, Orchid
CrossRef162
Naoko Aoki, Zhou Xing. (2004) Use of cytokines in infection. Expert Opinion on Emerging Drugs 9:2, 223-236
CrossRef163
Dominic O. Co, Laura H. Hogan, Shin-Il Kim, Matyas Sandor. (2004) Mycobacterial granulomas: keys to a long-lasting host–pathogen relationship. Clinical Immunology 113:2, 130-136
CrossRef164
Alison M. Elliott, Wendy S. Hodsdon, Jacqueline Kyosiimire, Maria A. Quigley, Jessica S. Nakiyingi, Proscovia B. Namujju, Christine Watera, Neil French, Charles F. Gilks, Hazel M. Dockrell, James A.G. Whitworth. (2004) Cytokine responses and progression to active tuberculosis in HIV-1-infected Ugandans: a prospective study. Transactions of the Royal Society of Tropical Medicine and Hygiene 98:11, 660-670
CrossRef165
Francesco Novelli, Jean-Laurent Casanova. (2004) The role of IL-12, IL-23 and IFN-γ in immunity to viruses. Cytokine & Growth Factor Reviews 15:5, 367-377
CrossRef166
Denise M. Monack, Anne Mueller, Stanley Falkow. (2004) Persistent bacterial infections: the interface of the pathogen and the host immune system. Nature Reviews Microbiology 2:9, 747-765
CrossRef167
Graham A.W. Rook, Rogelio Hernandez-Pando, Keertan Dheda, Geok Teng Seah. (2004) IL-4 in tuberculosis: implications for vaccine design. Trends in Immunology 25:9, 483-488
CrossRef168
Z. Toossi, H. Mayanja-Kizza, A. Kanost, K. Edmonds, M. McHugh, C. Hirsch. (2004) Protective Responses in Tuberculosis: Induction of Genes for Interferon-gamma and Cytotoxicity by Mycobacterium tuberculosis and During Human Tuberculosis. Scandinavian Journal of Immunology 60:3, 299-306
CrossRef169
Alan P. Knutsen, Elaine C. Siegfried, Cirilo Sotelo-Avila. (2004) Acneiform Granulomatous Folliculitis in a Patient with Interferon-γ Deficiency: Clearing with Empiric Antimycobacterial Therapy. Pediatric Asthma, Allergy & Immunology 17:3, 169-176
CrossRef170
H. Kimura, Y. Maeda, F. Takeshita, L. E. Takaoka, M. Matsuoka, M. Makino. (2004) Upregulation of T-Cell-Stimulating Activity of Mycobacteria-Infected Macrophages. Scandinavian Journal of Immunology 60:3, 278-286
CrossRef171
Simeone Marino, Denise E. Kirschner. (2004) The human immune response to Mycobacterium tuberculosis in lung and lymph node. Journal of Theoretical Biology 227:4, 463-486
CrossRef172
Jae-Hyun Lim, Hwa-Jung Kim, Kil-Soo Lee, Eun-Kyeong Jo, Chang-Hwa Song, Saet-Byel Jung, Su-Young Kim, Ji-Sook Lee, Tae-Hyun Paik, Jeong-Kyu Park. (2004) Identification of the new T-cell-stimulating antigens from Mycobacterium tuberculosis culture filtrate. FEMS Microbiology Letters 232:1, 51-59
CrossRef173
Sergio D. Rosenzweig, Steven M. Holland. (2004) Congenital defects in the interferon-??/interleukin-12 pathway. Current Opinion in Pediatrics 16:1, 3-8
CrossRef174
Kazue Higuchi, Yukie Sekiya, Nobuyuki Harada. (2004) Characterization of M. Tuberculosis-derived IL-12-inducing material by alveolar macrophages. Vaccine 22:5-6, 725-735
CrossRef175
G. S. COOKE, M. R. SIDDIQUI. (2004) Host genetics and the dissection of mycobacterial immunity. Clinical and Experimental Immunology 135:1, 9-11
CrossRef176
Yumi MIZUNO. (2004) Host defense mechanisms against Salmonella infection. Japanese Journal of Clinical Immunology 27:6, 367-372
CrossRef177
Anthony Jaworowski, Clare L.V. Maslin, Steven L. Wesselingh. (2004) The use of growth factors and cytokines to treat opportunistic infections in HIV-1 disease. Sexual Health 1:3, 161
CrossRef178
Anne E Goldfeld. (2004) Genetic susceptibility to pulmonary tuberculosis in Cambodia. Tuberculosis 84:1-2, 76-81
CrossRef179
Hiroe Shiratsuch, Marc D Basson. (2003) Caspase activation may be associated with Mycobacterium avium pathogenicity. The American Journal of Surgery 186:5, 547-551
CrossRef180
Alissa A. Chackerian, Samuel M. Behar. (2003) Susceptibility to Mycobacterium tuberculosis: lessons from inbred strains of mice. Tuberculosis 83:5, 279-285
CrossRef181
M. J. Newport, A. A. Awomoyi, J. M. Blackwell. (2003) Polymorphism in the Interferon-gamma Receptor-1 Gene and Susceptibility to Pulmonary Tuberculosis in The Gambia. Scandinavian Journal of Immunology 58:4, 383-385
CrossRef182
Muktar H. Aliyu, Hamisu M. Salihu. (2003) Tuberculosis and HIV disease: Two decades of a dual epidemic. Wiener Klinische Wochenschrift 115:19-20, 685-697
CrossRef183
Dhananjaya V. Kalvakolanu. (2003) Alternate interferon signaling pathways. Pharmacology & Therapeutics 100:1, 1-29
CrossRef184
M. H. Shaw, V. Boyartchuk, S. Wong, M. Karaghiosoff, J. Ragimbeau, S. Pellegrini, M. Muller, W. F. Dietrich, G. S. Yap. (2003) A natural mutation in the Tyk2 pseudokinase domain underlies altered susceptibility of B10.Q/J mice to infection and autoimmunity. Proceedings of the National Academy of Sciences 100:20, 11594-11599
CrossRef185
John Kelly, Warren J. Leonard. (2003) Immune deficiencies due to defects in cytokine signaling. Current Allergy and Asthma Reports 3:5, 396-401
CrossRef186
Alison M. Elliott, Jacqueline Kyosiimire, Maria A. Quigley, Jessica Nakiyingi, Christine Watera, Michael Brown, Sarah Joseph, Neil French, Charles F. Gilks, James A.G. Whitworth. (2003) Eosinophilia and progression to active tuberculosis in HIV-1-infected Ugandans. Transactions of the Royal Society of Tropical Medicine and Hygiene 97:4, 477-480
CrossRef187
Alain Delcayre, John S. Peake, Damian J. White, Shining Yuan, Megan K. McDonald, Andrew Liang, Paul L. Tan, James D. Watson. (2003) A genome-based functional screening approach to vaccine development that combines in vitro assays and DNA immunization. Vaccine 21:23, 3259-3264
CrossRef188
May-Lill Garly, Cesário Lourenco Martins, Carlitos Balé, Mamadu Aliu Baldé, Kathryn Louise Hedegaard, Per Gustafson, Ida M Lisse, Hilton C Whittle, Peter Aaby. (2003) BCG scar and positive tuberculin reaction associated with reduced child mortality in West Africa. Vaccine 21:21-22, 2782-2790
CrossRef189
P.V. Giannoudis. (2003) Current concepts of the inflammatory response after major trauma: an update. Injury 34:6, 397-404
CrossRef190
Eun-Kyeong Jo, Jeong-Kyu Park, Hazel M. Dockrell. (2003) Dynamics of cytokine generation in patients with active pulmonary tuberculosis. Current Opinion in Infectious Diseases 16:3, 205-210
CrossRef191
Xinfang Li, Anthony W. O'Regan, Jeffrey S. Berman. (2003) IFN- γ Induction of Osteopontin Expression in Human Monocytoid Cells. Journal of Interferon & Cytokine Research 23:5, 259-265
CrossRef192
Ewa Koscielniak, Tjitske de Boer, Stephanie Dupuis, Ludmila Naumann, Jean Laurent Casanova, Tom H. M. Ottenhoff. (2003) DISSEMINATED MYCOBACTERIUM PEREGRINUM INFECTION IN A CHILD WITH COMPLETE INTERFERON-GAMMA RECEPTOR-1 DEFICIENCY. The Pediatric Infectious Disease Journal 22:4, 378-380
CrossRef193
R. Ito, M. Mori, S. Katakura, N. Kobayashi, T. Naruto, Y. Osamura, Y. Aihara, S. Yokota. (2003) Selective insufficiency of IFN-gamma secretion in patients with hyper-IgE syndrome. Allergy 58:4, 329-336
CrossRef194
M. P. Reynard, D. Turner, A. P. Junqueira-Kipnis, M. Ramos de Souza, C. Moreno, C. V. Navarrete. (2003) Allele frequencies for an interferon-gamma microsatellite in a population of Brazilian leprosy patients. European Journal of Immunogenetics 30:2, 149-151
CrossRef195
Susanne J. Szabo, Brandon M. Sullivan, Stanford L. Peng, Laurie H. Glimcher. (2003) M
OLECULAR MECHANISMS REGULATING TH 1 IMMUNE RESPONSES . Annual Review of Immunology 21:1, 713-758
CrossRef196
Katherine Kedzierska, Rula Azzam, Philip Ellery, Johnson Mak, Anthony Jaworowski, Suzanne M Crowe. (2003) Defective phagocytosis by human monocyte/macrophages following HIV-1 infection: underlying mechanisms and modulation by adjunctive cytokine therapy. Journal of Clinical Virology 26:2, 247-263
CrossRef197
Shruti Malu, Shrividhya Srinivasan, Prasanta Kumar Maiti, Deepa Rajagopal, Beena John, Dipankar Nandi. (2003) IFN-γ bioassay: development of a sensitive method by measuring nitric oxide production by peritoneal exudate cells from C57BL/6 mice. Journal of Immunological Methods 272:1-2, 55-65
CrossRef198
Rogier J.L Stuyt, Soo-Hyun Kim, Leonid L Reznikov, Giamila Fantuzzi, Daniela Novick, Menachem Rubinstein, Bart Jan Kullberg, Jos W.M van der Meer, Charles A Dinarello, Mihai G Netea. (2003) Regulation of Staphylococcus epidermidis-induced IFN-γ in whole human blood: the role of endogenous IL-18, IL-12, IL-1, and TNF. Cytokine 21:2, 65-73
CrossRef199
DAVID BURGNER, MICHAEL LEVIN. (2003) Genetic susceptibility to infectious diseases. The Pediatric Infectious Disease Journal 22:1, 1-6
CrossRef200
H.J Hasvold, M Valheim, G Berntsen, A.K Storset. (2002) In vitro responses to purified protein derivate of caprine T lymphocytes following vaccination with live strains of Mycobacterium avium subsp. paratuberculosis. Veterinary Immunology and Immunopathology 90:1-2, 79-89
CrossRef201
Yvonne R. Freund, Linda Dousman, Nahid Mohagheghpour. (2002) Prophylactic clarithromycin to treat Mycobacterium avium in HIV patients receiving zidovudine may significantly increase mortality by suppressing lymphopoiesis and hematopoiesis. International Immunopharmacology 2:10, 1465-1475
CrossRef202
Kirk H. Waibel, David P. Regis, Gulbu Uzel, Sergio D. Rosenzweig, Steven M. Holland. (2002) Fever and leg pain in a 42-month-old. Annals of Allergy, Asthma & Immunology 89:3, 239-243
CrossRef203
Gulbu Uzel, Steven M. Holland. (2002) White blood cell defects: Molecular discoveries and clinical management. Current Allergy and Asthma Reports 2:5, 385-391
CrossRef204
Charles L Daley, David E Griffith. (2002) Pulmonary disease caused by rapidly growing mycobacteria. Clinics in Chest Medicine 23:3, 623-632
CrossRef205
Timothy R Aksamit. (2002) Mycobacterium avium complex pulmonary disease in patients with pre-existing lung disease. Clinics in Chest Medicine 23:3, 643-653
CrossRef206
Joseph O Falkinham. (2002) Nontuberculous mycobacteria in the environment. Clinics in Chest Medicine 23:3, 529-551
CrossRef207
Deborah L Ebert, Kenneth N Olivier. (2002) Nontuberculous mycobacteria in the setting of cystic fibrosis. Clinics in Chest Medicine 23:3, 655-663
CrossRef208
Worakij Chalermskulrat, Jack G Gilbey, James F Donohue. (2002) Nontuberculous mycobacteria in women, young and old. Clinics in Chest Medicine 23:3, 675-686
CrossRef209
Suneil Malik, Erwin Schurr. (2002) Genetic Susceptibility to Tuberculosis. Clinical Chemistry and Laboratory Medicine 40:9, 863-868
CrossRef210
Rebecca H. Buckley. (2002) Primary immunodeficiency diseases: dissectors of the immune system. Immunological Reviews 185:1, 206-219
CrossRef211
Barker, Alan F., . (2002) Bronchiectasis. New England Journal of Medicine 346:18, 1383-1393
Full Text212
R. Döffinger, S. Dupuis, C. Picard, C. Fieschi, J. Feinberg, G. Barcenas-Morales, J.-L. Casanova. (2002) Inherited disorders of IL-12- and IFNγ-mediated immunity: a molecular genetics update. Molecular Immunology 38:12-13, 903-909
CrossRef213
Mauricio Rojas, Martin Olivier, Luis F Garcı́a. (2002) Activation of JAK2/STAT1-α-dependent signaling events during Mycobacterium tuberculosis-induced macrophage apoptosis. Cellular Immunology 217:1-2, 58-66
CrossRef214
Hiroaki Ikeda, Lloyd J Old, Robert D Schreiber. (2002) The roles of IFNγ in protection against tumor development and cancer immunoediting. Cytokine & Growth Factor Reviews 13:2, 95-109
CrossRef215
Jean-Laurent Casanova, Laurent Abel. (2002) G
ENETIC DISSECTION OF IMMUNITY TO MYCOBACTERIA : The Human Model. Annual Review of Immunology 20:1, 581-620
CrossRef216
Ion Gresser, Filippo Belardelli. (2002) Endogenous type I interferons as a defense against tumors. Cytokine & Growth Factor Reviews 13:2, 111-118
CrossRef217
Gillian F Black, Rosemary E Weir, Sian Floyd, Lyn Bliss, David K Warndorff, Amelia C Crampin, Bagrey Ngwira, Lifted Sichali, Bernadette Nazareth, Jenefer M Blackwell, Keith Branson, Steven D Chaguluka, Linda Donovan, Elizabeth Jarman, Elizabeth King, Paul EM Fine, Hazel M Dockrell. (2002) BCG-induced increase in interferon-gamma response to mycobacterial antigens and efficacy of BCG vaccination in Malawi and the UK: two randomised controlled studies. The Lancet 359:9315, 1393-1401
CrossRef218
R. Abu-Nader, C. L. Terrell. (2002) Mycobacterium bovis Vertebral Osteomyelitis as a Complication of Intravesical BCG Use. Mayo Clinic Proceedings 77:4, 393-397
CrossRef219
Francis A. Drobniewski, Yanina M. Balabanova. (2002) The diagnosis and management of multiple-drug-resistant tuberculosis at the beginning of the new millenium. International Journal of Infectious Diseases 6, S21-S31
CrossRef220
J.M. Pollock, S.D. Neill. (2002) Mycobacterium boviss Infection and Tuberculosis in Cattle. The Veterinary Journal 163:2, 115-127
CrossRef221
Deborah L Ebert, Kenneth N Olivier. (2002) Nontuberculous mycobacteria in cystic fibrosis. Infectious Disease Clinics of North America 16:1, 221-233
CrossRef222
Capucine Picard, Claire Fieschi, Frédéric Altare, Suliman Al-Jumaah, Sami Al-Hajjar, Jacqueline Feinberg, Stéphanie Dupuis, Claire Soudais, Ibrahim Zaid Al-Mohsen, Emmanuelle Génin, David Lammas, Dinakantha S. Kumararatne, Tony Leclerc, Arash Rafii, Husn Frayha, Belinda Murugasu, Lee Bee Wah, Raja Sinniah, Michael Loubser, Emi Okamoto, Abdulaziz Al-Ghonaium, Haysam Tufenkeji, Laurent Abel, Jean-Laurent Casanova. (2002) Inherited Interleukin-12 Deficiency: IL12B Genotype and Clinical Phenotype of 13 Patients from Six Kindreds. The American Journal of Human Genetics 70:2, 336-348
CrossRef223
D. A. LAMMAS, E. DE HEER, J. D. EDGAR, V. NOVELLI, A. BEN-SMITH, R. BARETTO, P. DRYSDALE, J. BINCH, C. MACLENNAN, D. S. KUMARARATNE, S. PANCHALINGAM, T. H. M. OTTENHOFF, J.-L. CASANOVA, J.F. EMILE. (2002) Heterogeneity in the granulomatous response to mycobacterial infection in patients with defined genetic mutations in the interleukin 12-dependent interferon-gamma production pathway. International Journal of Experimental Pathology 83:1, 1-20
CrossRef224
Andrew J. Mungall, Ian Dunham. 2002. Chromosome 6. .
CrossRef225
S. Rosenzweig, S.E. Dorman, J. Roesler, J. Palacios, M. Zelazko, S.M. Holland. (2002) 561del4 Defines a Novel Small Deletion Hotspot in the Interferon-γ Receptor 1 Chain. Clinical Immunology 102:1, 25-27
CrossRef226
Janine Reichenbach, Sergio Rosenzweig, Rainer D??ffinger, St??phanie Dupuis, Steven M. Holland, Jean-Laurent Casanova. (2001) Mycobacterial diseases in primary immunodeficiencies. Current Opinion in Allergy and Clinical Immunology 1:6, 503-511
CrossRef227
Jenefer M Blackwell. (2001) Genetics and genomics in infectious disease susceptibility. Trends in Molecular Medicine 7:11, 521-526
CrossRef228
Keane, Joseph, Gershon, Sharon, Wise, Robert P., Mirabile-Levens, Elizabeth, Kasznica, John, Schwieterman, William D., Siegel, Jeffrey N., Braun, M. Miles, . (2001) Tuberculosis Associated with Infliximab, a Tumor Necrosis Factor α–Neutralizing Agent. New England Journal of Medicine 345:15, 1098-1104
Full Text229
C.M. Mason, E. Dobard, J. Shellito, S. Nelson. (2001) CD4+ lymphocyte responses to pulmonary infection with Mycobacterium tuberculosis in naı̈e and vaccinated BALB/c mice. Tuberculosis 81:5-6, 327-334
CrossRef230
David M Frucht, Taro Fukao, Christian Bogdan, Heike Schindler, John J O'Shea, Shigeo Koyasu. (2001) IFN-γ production by antigen-presenting cells: mechanisms emerge. Trends in Immunology 22:10, 556-560
CrossRef231
Julian Knight. (2001) Polymorphisms in tumor necrosis factor and other cytokines as risks for infectious diseases and the septic syndrome. Current Infectious Disease Reports 3:5, 427-439
CrossRef232
Kent D. Taylor, Huiying Yang, Jerome I. Rotter. (2001) Inflammatory Bowel Disease. Molecular Genetics and Metabolism 74:1-2, 22-44
CrossRef233
W. W. Yew. (2001) Management of Multidrug-Resistant Tuberculosis: Chemotherapy and Beyond. Clinical Pulmonary Medicine 8:5, 265-272
CrossRef234
Adrian V.S. Hill. (2001) T
HE GENOMICS AND GENETICS OF HUMAN INFECTIOUS DISEASE SUSCEPTIBILITY . Annual Review of Genomics and Human Genetics 2:1, 373-400
CrossRef235
Marta Cohen, Ricardo Drut. (2001) Cytologic features of disseminated bacillus Calmette-Gu
CrossRef236
Regina A. Silva, Manuela Florido, Rui Appelberg. (2001) Interleukin-12 primes CD4+ T cells for interferon-gamma production and protective immunity during Mycobacterium avium infection. Immunology 103:3, 368-374
CrossRef237
NATASCHA REMUS, JANINE REICHENBACH, CAPUCINE PICARD, CHRISTOPH RIETSCHEL, PHILIP WOOD, DAVID LAMMAS, DINAKANTHA S. KUMARARATNE, JEAN-LAURENT CASANOVA. (2001) Impaired Interferon Gamma-Mediated Immunity and Susceptibility to Mycobacterial Infection in Childhood. Pediatric Research 50:1, 8-13
CrossRef238
Lynn A. Riddell, Anthony J. Pinching, Susan Hill, Tony T. Ng, Emilio Arbe, Gary P. Lapham, Stephen Ash, Richard Hillman, Stephen Tchamouroff, David W. Denning, Jacqueline M. Parkin. (2001) A Phase III Study of Recombinant Human Interferon Gamma to Prevent Opportunistic Infections in Advanced HIV Disease. AIDS Research and Human Retroviruses 17:9, 789-797
CrossRef239
Jacqueline Parkin, Bryony Cohen. (2001) An overview of the immune system. The Lancet 357:9270, 1777-1789
CrossRef240
Güzide Aksu, Cengiz Trpan, Cengiz Çavuşoğlu, Saliha Soydan, Frédéric Altare, Jean-Laurent Casanova, Necil Kutukculer. (2001) MYCOBACTERIUM FORTUITUM-CHELONAE COMPLEX INFECTION IN A CHILD WITH COMPLETE INTERLEUKIN-12 RECEPTOR BETA 1 DEFICIENCY. The Pediatric Infectious Disease Journal 20:5, 551-553
CrossRef241
Heather J. Milburn. (2001) Primary tuberculosis. Current Opinion in Pulmonary Medicine 7:3, 133-141
CrossRef242
S. Ehlers, E. Richter. (2001) Differential requirement for interferon-gamma to restrict the growth of or eliminate some recently identified species of nontuberculous mycobacteria in vivo. Clinical and Experimental Immunology 124:2, 229-238
CrossRef243
Beate Kampmann, Douglas Young. (2001) Childhood Tuberculosis: Advances in Immunopathogenesis, Treatment and Prevention *. Infectious Diseases in Clinical Practice 10:4, 205-210
CrossRef244
Wendy S. Hodsdon, Henry Luzze, Tamara J. Hurst, Maria A. Quigley, Jacqueline Kyosiimire, Proscovia B. Namujju, John L. Johnson, Pontiano Kaleebu, Alphonse Okwera, Alison M. Elliott. (2001) HIV-1-related pleural tuberculosis: elevated production of IFN-??, but failure of immunity to Mycobacterium tuberculosis. AIDS 15:4, 467-475
CrossRef245
D. E. Griffith. (2001) The Challenge and Opportunity of New Clinical Infectious Entities. Clinical Infectious Diseases 32:3, 432-435
CrossRef246
J.M. Pollock, J. McNair, M.D. Welsh, R.M. Girvin, H.E. Kennedy, D.P. Mackie, S.D. Neill. (2001) Immune responses in bovine tuberculosis. Tuberculosis 81:1-2, 103-107
CrossRef247
M.Salomé Gomes, Johan R. Boelaert, Rui Appelberg. (2001) Role of iron in experimental Mycobacterium avium infection. Journal of Clinical Virology 20:3, 117-122
CrossRef248
H. Shiratsuchi, J. J. Ellner. (2001) Expression of IL-18 by Mycobacterium avium-infected human monocytes; association with M. avium virulence. Clinical and Experimental Immunology 123:2, 203-209
CrossRef249
Steven M. Holland. (2001) Nontuberculous Mycobacteria. The American Journal of the Medical Sciences 321:1, 49-55
CrossRef250
Philip F. Halloran, Marjan Afrouzian, Vido Ramassar, Joan Urmson, Lin-Fu Zhu, Lisa M.H. Helms, Kim Solez, Norman M. Kneteman. (2001) Interferon-γ Acts Directly on Rejecting Renal Allografts to Prevent Graft Necrosis. The American Journal of Pathology 158:1, 215-226
CrossRef251
Satoshi Yoshijima, Yoshiaki Harada, Urara Kohdera, Hirohiko Higashino, Minoru Kino, Noriko Sakaida, Akiharu Okamura, Yohnosuke Kobayashi. (2000) Possible splenic tuberculosis presenting as unexplained fever. Pediatrics International 42:6, 705-707
CrossRef252
Mackay, Ian R., Rosen, Fred S., , Lekstrom-Himes, Julie A., Gallin, John I., . (2000) Immunodeficiency Diseases Caused by Defects in Phagocytes. New England Journal of Medicine 343:23, 1703-1714
Full Text253
E.M. Aubert-Pivert, F.M. Chedevergne, G.M. Lopez-Ramirez, J.H. Colle, P.L. Scheinmann, B.M. Gicquel, J.M. de Blic. (2000) Cytokine transcripts in pediatric tuberculosis: a study with bronchoalveolar cells. Tubercle and Lung Disease 80:6, 249-258
CrossRef254
&NA;. (2000) COUGH, FATIGUE AND BRONCHOPULMONARY DISEASE IN TWO IMMUNOCOMPETENT CHILDREN: DENOUEMENT???Continued from p. 1209. The Pediatric Infectious Disease Journal 19:12, 1220-1221
CrossRef255
Susan E Dorman, Steven M Holland. (2000) Interferon-γ and interleukin-12 pathway defects and human disease. Cytokine & Growth Factor Reviews 11:4, 321-333
CrossRef256
David A. Lammas, Pamela Drysdale, Anne Ben-Smith, John Girdlestone, David Edgar, Dinakantha S. Kumararatne. (2000) Diagnosis of defects in the type 1 cytokine pathway. Microbes and Infection 2:13, 1567-1578
CrossRef257
J.F.T. GRIFFIN, C.G. MACKINTOSH. (2000) Tuberculosis in Deer: Perceptions, Problems and Progress. The Veterinary Journal 160:3, 202-219
CrossRef258
Michael Levin, Melanie Newport. (2000) Inherited predisposition to mycobacterial infection: historical considerations. Microbes and Infection 2:13, 1549-1552
CrossRef259
Rainer Döffinger, Frédéric Altare, Jean-Laurent Casanova. (2000) Genetic heterogeneity of Mendelian susceptibility to mycobacterial infection. Microbes and Infection 2:13, 1553-1557
CrossRef260
Tom H.M Ottenhoff, Tjitske de Boer, Claudia E Verhagen, Frank A.W Verreck, Jaap T van Dissel. (2000) Human deficiencies in type 1 cytokine receptors reveal the essential role of type 1 cytokines in immunity to intracellular bacteria. Microbes and Infection 2:13, 1559-1566
CrossRef261
Pierre Ambroise-Thomas. (2000) Emerging parasite zoonoses: the role of host–parasite relationship. International Journal for Parasitology 30:12-13, 1361-1367
CrossRef262
D. A. Lammas, J.-L. Casanova, D. S. Kumararatne. (2000) Clinical consequences of defects in the IL-12-dependent interferon-gamma (IFN-gamma) pathway . IMMUNODEFICIENCY REVIEW. Clinical and Experimental Immunology 121:3, 417-425
CrossRef263
C. E. Verhagen, T. de Boer, H. H. Smits, F. A.W. Verreck, E. A. Wierenga, M. Kurimoto, D. A. Lammas, D. S. Kumararatne, O. Sanal, F. P. Kroon, J. T. van Dissel, F. Sinigaglia, T. H.M. Ottenhoff. (2000) Residual Type 1 Immunity in Patients Genetically Deficient for Interleukin 12 Receptor 1 (IL-12R 1): Evidence for an IL-12R 1-Independent Pathway of IL-12 Responsiveness in Human T Cells. Journal of Experimental Medicine 192:4, 517-528
CrossRef264
Eric G. Davis, M.Robert Eichenberger, Brooke S. Grant, Hiram C. Polk. (2000) Microsatellite marker of interferon-gamma receptor 1 gene correlates with infection following major trauma. Surgery 128:2, 301-305
CrossRef265
Gerard J. Nau, Geoffrey L. Chupp, Jean-François Emile, Emmanuelle Jouanguy, Jeffrey S. Berman, Jean-Laurent Casanova, Richard A. Young. (2000) Osteopontin Expression Correlates with Clinical Outcome in Patients with Mycobacterial Infection. The American Journal of Pathology 157:1, 37-42
CrossRef266
L. Abu Jawdeh, R. Haidar, F. Bitar, S. Mroueh, S. Akel, N. Nuwayri-Salti, G.S. Dbaibo. (2000) Aspergillus Vertebral Osteomyelitis in a Child with a Primary Monocyte Killing Defect: Response to GM-CSF Therapy. Journal of Infection 41:1, 97-100
CrossRef267
Sangeeta Bhaskar, S.P Khanna, Rama Mukherjee. (2000) Isolation, purification and immunological characterization of novel low molecular weight protein antigen CFP 6 from culture filtrate of M. tuberculosis. Vaccine 18:25, 2856-2866
CrossRef268
Robert W. Wilmott, Gurjit Khurana-Hershey, James M. Stark. (2000) Current concepts on pulmonary host defense mechanisms in children. Current Opinion in Pediatrics 12:3, 187-193
CrossRef269
D. F. Hoft, R. M. Brown, R. B. Belshe. (2000) Mucosal Bacille Calmette-Guerin Vaccination of Humans Inhibits Delayed-Type Hypersensitivity to Purified Protein Derivative but Induces Mycobacteria-Specific Interferon- Responses. Clinical Infectious Diseases 30:Supplement 3, S217-S222
CrossRef270
Emmanuelle Jouanguy, Stéphanie Dupuis, Annaïck Pallier, Rainer Döffinger, Marie-Claude Fondanèche, Claire Fieschi, Salma Lamhamedi-Cherradi, Frédéric Altare, Jean-François Emile, Patrick Lutz, Pierre Bordigoni, Haluk Cokugras, Necla Akcakaya, Judith Landman-Parker, Jean Donnadieu, Yildiz Camcioglu, Jean-Laurent Casanova. (2000) In a novel form of IFN-γ receptor 1 deficiency, cell surface receptors fail to bind IFN-γ. Journal of Clinical Investigation 105:10, 1429-1436
CrossRef271
Vassiliki A. Boussiotis, Eunice Y. Tsai, Edmond J. Yunis, Sok Thim, Julio C. Delgado, Christopher C. Dascher, Alla Berezovskaya, Dominique Rousset, Jean-Marc Reynes, Anne E. Goldfeld. (2000) IL-10–producing T cells suppress immune responses in anergic tuberculosis patients. Journal of Clinical Investigation 105:9, 1317-1325
CrossRef272
Janet M. McNicholl, Marie V. Downer, Venkatachalam Udhayakumar, Chester A. Alper, David L. Swerdlow. (2000) Host-Pathogen Interactions in Emerging and Re-emerging Infectious Diseases: A Genomic Perspective of Tuberculosis, Malaria, Human Immunodeficiency Virus Infection, Hepatitis B, and Cholera 1. Annual Review of Public Health 21:1, 15-46
CrossRef273
H. Shiratsuchi, I. Krukovets, J.J. Ellner. (2000) Role of T Cell Subsets in the Modulation of Mycobacterium avium Growth within Human Monocytes. Cellular Immunology 202:1, 6-12
CrossRef274
Peggy Matsiota-Bernard, Françoise Vildé, Charles Nauciel. (2000) Mycobacterium genavense infection in normal and immunodeficient mice. Microbes and Infection 2:6, 575-580
CrossRef275
Brahm H Segal, Thomas L Leto, John I Gallin, Harry L Malech, Steven M Holland. (2000) Genetic, Biochemical, and Clinical Features of Chronic Granulomatous Disease. Medicine 79:3, 170-200
CrossRef276
M. C. B. S. Lima, G. M. B. Pereira, F. D. Rumjanek, H. M. Gomes, N. Duppre, E. P. Sampaio, I. M. P. Alvim, J. A. C. Nery, E. N. Sarno, M. C. V. Pessolani. (2000) Immunological Cytokine Correlates of Protective Immunity and Pathogenesis in Leprosy. Scandinavian Journal of Immunology 51:4, 419-428
CrossRef277
Isabel Weber, Christian Fritz, Silvia Ruttkowski, Andreas Kreft, Franz-Christoph Bange. (2000) Anaerobic nitrate reductase (narGHJI) activity of Mycobacterium bovis BCG in vitro and its contribution to virulence in immunodeficient mice. Molecular Microbiology 35:5, 1017-1025
CrossRef278
M Shiloh. (2000) Reactive nitrogen intermediates and the pathogenesis of Salmonella and mycobacteria. Current Opinion in Microbiology 3:1, 35-42
CrossRef279
Naoya Ohara, Masanori Matsuoka, Hiroko Nomaguchi, Mariko Naito, Takeshi Yamada. (2000) Inhibition of multiplication of Mycobacterium leprae in mouse foot pads by recombinant Bacillus Catmette-Guérin (BCG). Vaccine 18:14, 1294-1297
CrossRef280
Robert J Wilkinson, Martin Llewelyn, Zahra Toossi, Punita Patel, Geoffrey Pasvol, Ajit Lalvani, Dennis Wright, Mohammed Latif, Robert N Davidson. (2000) Influence of vitamin D deficiency and vitamin D receptor polymorphisms on tuberculosis among Gujarati Asians in west London: a case-control study. The Lancet 355:9204, 618-621
CrossRef281
Katalin A Wilkinson, John T Belisle, Maria Mincek, Robert J Wilkinson, Zahra Toossi. (2000) Enhancement of the human T cell response to culture filtrate fractions of Mycobacterium tuberculosis by microspheres. Journal of Immunological Methods 235:1-2, 1-9
CrossRef282
A. Wangoo, I. N. Brown, B. G. Marshall, H. T. Cook, D. B. Young, R. J. Shaw. (2000) Bacille Calmette-Guerin (BCG)-associated inflammation and fibrosis: modulation by recombinant BCG expressing interferon-gamma (IFN-gamma). Clinical and Experimental Immunology 119:1, 92-98
CrossRef283
Y.-W. Tang, P. J. Cleavinger, H. Li, P. S. Mitchell, T. F. Smith, D. H. Persing. (2000) Analysis of Candidate-Host Immunogenetic Determinants in Herpes Simplex Virus-Associated Mollaret's Meningitis. Clinical Infectious Diseases 30:1, 176-178
CrossRef284
Carmen Infante-Duarte, Thomas Kamradt. (1999) Th1/Th2 balance in infection. Springer Seminars in Immunopathology 21:3, 317-338
CrossRef285
G. Tau, P. Rothman. (1999) Biologic functions of the IFN-gamma receptors. Allergy 54:12, 1233-1251
CrossRef286
Mariko Naito, Masanori Matsuoka, Naoya Ohara, Hiroko Nomaguchi, Takeshi Yamada. (1999) The antigen 85 complex vaccine against experimental Mycobacterium leprae infection in mice. Vaccine 18:9-10, 795-798
CrossRef287
A DESSEIN, D HILLAIRE, N ELWALI, S MARQUET, Q MOHAMEDALI, A MIRGHANI, S HENRI, A ABDELHAMEED, O SAEED, M MAGZOUB. (1999) Severe Hepatic Fibrosis in Schistosoma mansoni Infection Is Controlled by a Major Locus That Is Closely Linked to the Interferon-γ Receptor Gene. The American Journal of Human Genetics 65:3, 709-721
CrossRef288
Pei-Song Gao, Xiao-Quan Mao, Emmanuelle Jouanguy, Annaick Pallier, Rainer Döffinger, Yosuke Tanaka, Hitoshi Nakashima, Takeshi Otsuka, Mark H. Roberts, Tadao Enomoto, Yasuhiro Dake, Mitsuru Kawai, Sei Sasaki, Sarah R. Shaldon, Phillip Coull, Chaker N. Adra, Yoshiyuki Niho, Jean-Laurent Casanova, Taro Shirakawa, Julian M. Hopkin. (1999) Nonpathogenic Common Variants of IFNGR1 and IFNGR2 in Association with Total Serum IgE Levels. Biochemical and Biophysical Research Communications 263:2, 425-429
CrossRef289
Warren S Alexander, Robyn Starr, Jennifer E Fenner, Clare L Scott, Emanuela Handman, Naomi S Sprigg, Jason E Corbin, Ann L Cornish, Rima Darwiche, Catherine M Owczarek, Thomas W.H Kay, Nicos A Nicola, Paul J Hertzog, Donald Metcalf, Douglas J Hilton. (1999) SOCS1 Is a Critical Inhibitor of Interferon γ Signaling and Prevents the Potentially Fatal Neonatal Actions of this Cytokine. Cell 98:5, 597-608
CrossRef290
Melanie Newport, Michael Levin. (1999) Genetic susceptibility to tuberculosis. Journal of Infection 39:2, 117-121
CrossRef291
Katalin A. Wilkinson, Ferenc Hudecz, H. Martin Vordermeier, Juraj Ivanyi, Robert J. Wilkinson. (1999) Enhancement of the T cell response to a mycobacterial peptide by conjugation to synthetic branched polypeptide. European Journal of Immunology 29:9, 2788-2796
CrossRef292
Mary Ellen Conley. (1999) Genetic effects on immunity New genes — how do they fit?. Current Opinion in Immunology 11:4, 427-430
CrossRef293
Steven M. Opal, Jonathan Cohen. (1999) Clinical Gram-positive sepsis. Critical Care Medicine 27:8, 1608-1616
CrossRef294
Michael Levin, Melanie Newport. (1999) Understanding the Genetic Basis of Susceptibility to Mycobacterial Infection. Proceedings of the Association of American Physicians 111:4, 308-312
CrossRef295
JFA Adams, EH Schölvinck, RP Gie, PC Potter, N Beyers, AD Beyers. (1999) Decline in total serum IgE after treatment for tuberculosis. The Lancet 353:9169, 2030-2033
CrossRef296
Javed N. Agrewala, Robert J. Wilkinson. (1999) Influence of HLA-DR on the phenotype of CD4+ T lymphocytes specific for an epitope of the 16-kDa α-crystallin antigen ofMycobacterium tuberculosis. European Journal of Immunology 29:6, 1753-1761
CrossRef297
M ESCAMILLA, L MCINNES, M SPESNY, V REUS, S SERVICE, N SHIMAYOSHI, D TYLER, S SILVA, J MOLINA, A GALLEGOS. (1999) Assessing the Feasibility of Linkage Disequilibrium Methods for Mapping Complex Traits: An Initial Screen for Bipolar Disorder Loci on Chromosome 18. The American Journal of Human Genetics 64:6, 1670-1678
CrossRef298
Emmanuelle Jouanguy, Rainer Döffinger, Stéphanie Dupuis, Annaïck Pallier, Frédéric Altare, Jean-Laurent Casanova. (1999) IL-12 and IFN-γ in host defense against mycobacteria and salmonella in mice and men. Current Opinion in Immunology 11:3, 346-351
CrossRef299
S SERVICE, D LANG, N FREIMER, L SANDKUIJL. (1999) Linkage-Disequilibrium Mapping of Disease Genes by Reconstruction of Ancestral Haplotypes in Founder Populations. The American Journal of Human Genetics 64:6, 1728-1738
CrossRef300
R Döffinger, E Jouanguy, F Altare, J-L Casanova, P Wood, D Lammas, D Kumararatne, T Shirakawa, F Novelli. (1999) Inheritable defects in interleukin-12- and interferon-gamma-mediated immunity and the TH1/TH2 paradigm in man. Allergy 54:5, 409-412
CrossRef301
Katsuhiko Tsukaguchi, Barbara de Lange, W.Henry Boom. (1999) Differential Regulation of IFN-γ, TNF-α, and IL-10 Production by CD4+ αβTCR+ T Cells and Vδ2+ γδ T Cells in Response to Monocytes Infected with Mycobacterium tuberculosis-H37Ra. Cellular Immunology 194:1, 12-20
CrossRef302
Salma Lamhamedi-Cherradi, Chantal de Chastellier, Jean-Laurent Casanova. (1999) Growth of Mycobacterium bovis, Bacille Calmette-Guérin, within human monocytes-macrophages cultured in serum-free medium. Journal of Immunological Methods 225:1-2, 75-86
CrossRef303
GAW Rook, JL Stanford. (1999) Skin-test responses to mycobacteria in atopy and asthma. Allergy 54:3, 285-286
CrossRef304
Alimuddin Zumla, S.Beitel Squire, Chifumbe Chintu, John M. Grange. (1999) The tuberculosis pandemic: implications for health in the tropics. Transactions of the Royal Society of Tropical Medicine and Hygiene 93:2, 113-117
CrossRef305
Havlir, Diane V., Barnes, Peter F., . (1999) Tuberculosis in Patients with Human Immunodeficiency Virus Infection. New England Journal of Medicine 340:5, 367-373
Full Text306
Simon L Newman. (1999) Macrophages in host defense against Histoplasma capsulatum. Trends in Microbiology 7:2, 67-71
CrossRef307
Steffen Stenger, Robert L Modlin. (1999) T cell mediated immunity to Mycobacterium tuberculosis. Current Opinion in Microbiology 2:1, 89-93
CrossRef308
Fabio Facchetti, William Vermi, Simona Fiorentini, Marco Chilosi, Arnaldo Caruso, Marzia Duse, Luigi Daniele Notarangelo, Raffaele Badolato. (1999) Expression of Inducible Nitric Oxide Synthase in Human Granulomas and Histiocytic Reactions. The American Journal of Pathology 154:1, 145-152
CrossRef309
WILKINSON, ZHU, WILKINSON, LALVANI, IVANYI, PASVOL, VORDERMEIER. (1998) 38 000 MW antigen-specific major histocompatibility complex class I restricted interferon-gamma-secreting CD8+ T cells in healthy contacts of tuberculosis. Immunology 95:4, 585-590
CrossRef310
Agrewala, Wilkinson. (1998) Differential regulation of Th1 and Th2 cells by p91-110 and p21-40 peptides of the 16-kD alpha-crystallin antigen of Mycobacterium tuberculosis. Clinical and Experimental Immunology 114:3, 392-397
CrossRef311
N. D. Dore, P. N. LeSouëf, B. Masters, P. W. Francis, D. M. Cooper, J. H. Wildhaber, A. J. Fall, P. D. Sly. (1998) Atypical mycobacterial pulmonary disease and bronchial obstruction in HIV-negative children. Pediatric Pulmonology 26:6, 380-388
CrossRef312
MUSTAFA, AMOUDY, WIKER, ABAL, RAVN, OFTUNG, ANDERSEN. (1998) Comparison of Antigen-Specific T-Cell Responses of Tuberculosis Patients using Complex or Single Antigens of Mycobacterium tuberculosis. Scandinavian Journal of Immunology 48:5, 535-543
CrossRef313
Wilkinson, Wilkinson, De Smet, Haslov, Pasvol, Singh, Svarcova, Ivanyi. (1998) Human T- and B-Cell Reactivity to the 16 kDa alpha-Crystallin Protein of Mycobacterium tuberculosis. Scandinavian Journal of Immunology 48:4, 403-409
CrossRef314
Richard Bellamy, Adrian VS Hill. (1998) Genetic susceptibility to mycobacteria and other infectious pathogens in humans. Current Opinion in Immunology 10:4, 483-487
CrossRef315
Frédéric Altare, Emmanuelle Jouanguy, Salma Lamhamedi, Rainer Döffinger, Alain Fischer, Jean-Laurent Casanova. (1998) Mendelian susceptibility to mycobacterial infection in man. Current Opinion in Immunology 10:4, 413-417
CrossRef316
Timothy R. Sterling, Richard D. Moore, Neil M.H. Graham, Jacquie Astemborski, David Vlahov, Richard E. Chaisson. (1998) Mycobacterium tuberculosis infection and disease are not associated with protection against subsequent disseminated M. avium complex disease. AIDS 12:12, 1451-1457
CrossRef317
George R. Stark, Ian M. Kerr, Bryan R. G. Williams, Robert H. Silverman, Robert D. Schreiber. (1998) HOW CELLS RESPOND TO INTERFERONS. Annual Review of Biochemistry 67:1, 227-264
CrossRef318
J. C. Graham, D. A. Tweddle, D. R. Jenkins, C. Pollitt, S. J. Pedler. (1998) Non-tuberculous mycobacterial infection in children with cancer. European Journal of Clinical Microbiology & Infectious Diseases 17:6, 394-397
CrossRef319
Adrian V. S. Hill. (1998) THE IMMUNOGENETICS OF HUMAN INFECTIOUS DISEASES. Annual Review of Immunology 16:1, 593-617
CrossRef320
Sing Leung Lui, Vido Ramassar, Joan Urmson, Philip F Halloran. (1998) Mycophenolate mofetil reduces production of interferon-dependent major histocompatibility complex induction during allograft rejection, probably by limiting clonal expansion. Transplant Immunology 6:1, 23-32
CrossRef321
Frédéric Altare, Emmanuelle Jouanguy, Salma Lamhamedi-Cherradi, Marie-Claude Fondanèche, Cécile Fizame, Florence Ribiérre, Gilles Merlin, Zlatko Dembic, Robert Schreiber, Barbara Lisowska-Grospierre, Alain Fischer, Eric Seboun, Jean-Laurent Casanova. (1998) A Causative Relationship between Mutant IFNgR1 Alleles and Impaired Cellular Response to IFNγ in a Compound Heterozygous Child. The American Journal of Human Genetics 62:3, 723-727
CrossRef322
Bradford D. Gessner, Noel S. Weiss, Charles M. Nolan. (1998) Risk factors for pediatric tuberculosis infection and disease after household exposure to adult index cases in Alaska. The Journal of Pediatrics 132:3, 509-513
CrossRef323
Emil Skamene, MD, PhD, Erwin Schurr, PhD, Philippe Gros, PhD. (1998) INFECTION GENOMICS: Nramp1 as a Major Determinant of Natural Resistance to Intracellular Infections. Annual Review of Medicine 49:1, 275-287
CrossRef324
Steven M. Holland, MD, John I. Gallin, MD. (1998) EVALUATION OF THE PATIENT WITH RECURRENT BACTERIAL INFECTIONS 1 1. Annual Review of Medicine 49:1, 185-199
CrossRef325
Ken Duncan. (1998) Tuberculosis 1998. Expert Opinion on Therapeutic Patents 8:2, 137-142
CrossRef326
James P. Di Santo. (1998) Inherited Cytokine and Cytokine Receptor Deficiencies in Man. International Reviews of Immunology 17:1-4, 103-120
CrossRef327
Benjamin A. Rybicki, Mary J. Maliarik, Marcie Major, John Popovich, Michael C. Iannuzzi. (1997) GENETICS OF SARCOIDOSIS. Clinics in Chest Medicine 18:4, 707-717
CrossRef328
EMMANUELLE JOUANGUY, FRÉDÉERIC ALTARE, SALMA LAMHAMEDI-CHERRADI, JEAN-LAURENT CASANOVA. (1997) Infections in IFNGR-1-Deficient Children. Journal of Interferon & Cytokine Research 17:10, 583-587
CrossRef329
Sidney Pestka, Serguei V. Kotenko, Geetha Muthukumaran, Lara S. Izotova, Jeffry R. Cook, Gianni Garotta. (1997) The interferon gamma (IFN-γ) receptor: a paradigm for the multichain cytokine receptor. Cytokine & Growth Factor Reviews 8:3, 189-206
CrossRef330
Stefan H. E. Kaufman, Masashi Emoto, Gudrun Szalay, Johannes Barsig, Inge E. A. Flesch. (1997) Interleukin-4 and listeriosis. Immunological Reviews 158:1, 95-105
CrossRef331
JANE L. BURNS, UMA MALHOTRA, JAIRAM LINGAPPA, SHERILYN SMITH. (1997) Unusual presentations of nontuberculous mycobacterial infections in children. The Pediatric Infectious Disease Journal 16:8, 802-806
CrossRef332
Laurent Abel, Alain J Dessein. (1997) The impact of host genetics on susceptibility to human infectious diseases. Current Opinion in Immunology 9:4, 509-516
CrossRef333
Adrian V.S. Hill. (1997) Genetic susceptibility to multifactorial diseases. Transactions of the Royal Society of Tropical Medicine and Hygiene 91:4, 369-371
CrossRef334
Stephen T. Holgate. (1997) Asthma genetics: waiting to exhale. Nature Genetics 15:3, 227-229
CrossRef335
G. Vanham, Z. Toossi, C.S. Hirsch, R.S. Wallis, S.K. Schwander, E.A. Rich, J.J. Ellner. (1997) Examining a paradox in the pathogenesis of human pulmonary tuberculosis: Immune activation and suppression/anergy. Tubercle and Lung Disease 78:3-4, 145-158
CrossRef336
Jouanguy, Emmanuelle, Altare, Frédéric, Lamhamedi, Salma, Revy, Patrick, Emile, Jean-François, Newport, Melanie, Levin, Michael, Blanche, Stéphane, Seboun, Eric, Fischer, Alain, Casanova, Jean-Laurent, . (1996) Interferon-γ –Receptor Deficiency in an Infant with Fatal Bacille Calmette–Guérin Infection. New England Journal of Medicine 335:26, 1956-1962
Full Text
