Correspondence

Disseminated Encephalitozoon (Septata) intestinalis Infection in a Patient with AIDS

N Engl J Med 1996; 335:1610-1611November 21, 1996

Article

To the Editor:

Disseminated microsporidian infections have been reported in several patients with human immunodeficiency virus (HIV) infection, and hematologic dissemination is thought to be most likely.1 We describe an HIV-infected patient with disseminated infection due to Encephalitozoon (Septata) intestinalis. DNA from the parasites could be amplified from various samples, including blood, by the polymerase chain reaction (PCR).

The patient was a 24-year-old homosexual man who had received a diagnosis of HIV infection in January 1995. In March 1996 he was admitted to our hospital because of diarrhea, a weight loss of 7 kg, abdominal pain, cough, and a temperature of up to 39.0°C. These symptoms did not respond to empirical antimicrobial therapy. He had severe immunodeficiency (20 CD4+ cells per cubic millimeter). No bacterial or fungal pathogens were detected in multiple blood cultures, but light microscopy and PCR with the use of previously described techniques2-4 showed the presence of microsporidia in stool samples, specimens of duodenal or bile juice, duodenal-biopsy specimens, and samples of urine, sputum, and bronchoalveolar-lavage fluid.

A primer pair specific for E. intestinalis (V1 5'CACCAGGTTGATTCTGCCTGAC3' and SI500 5'CTCGCTCCTTTACACTCG3')3,4 showed amplification of the correct DNA fragments, indicating infection with this species, whereas primer pairs specific for E. bieneusi, E. cuniculi, and E. hellem did not lead to amplification of DNA fragments (Figure 1Figure 1Ethidium Bromide–Stained Gel of DNA from Various Tissue and Fluid Samples Amplified with the V1 and SI500 Primer Pair.). The results of PCR amplification with target DNA from blood samples were also positive (Figure 1). Analysis of the amplified DNA fragments by Southern blot hybridization with a probe specific for E. intestinalis (SI60 5'TGTTGATGAACCTTGTGG3') confirmed the identification of the species as E. intestinalis.

The patient was treated with albendazole (400 mg twice daily), and 48 hours after the start of therapy, the diarrhea, cough, and fever had disappeared. No parasites were detected in control samples, including blood, by light microscopy or PCR.

Hematologic dissemination of microsporidia has been suspected since the first description of disseminated infection with E. intestinalis. 1 In the patient we describe, hematologic dissemination was shown by the detection of the parasite's DNA in blood samples. We did not know whether the fever in our patient was caused by the microsporidia, but the symptoms and fever resolved after the initiation of treatment, and the parasites disappeared from all sites, including the blood. Hence, we have genetic and clinical evidence of hematologic dissemination of the parasites in this HIV-infected patient.

Caspar Franzen, M.D.
Andreas Müller
Pia Hartmann, M.D.
Matthias Kochanek, M.D.
Volker Diehl, M.D.
Gerd Fätkenheuer, M.D.
University of Cologne, 50924 Cologne, Germany

4 References

1. 1

   Orenstein JM, Dieterich DT, Kotler DP. Systemic dissemination by a newly recognized intestinal microsporidia species in AIDS. AIDS 1992;6:1143-1150
   CrossRef | Web of Science | Medline

2. 2

   van Gool T, Snijders F, Reiss P, et al. Diagnosis of intestinal and disseminated microsporidial infections in patients with HIV by a new rapid fluorescence technique. J Clin Pathol 1993;46:694-699
   CrossRef | Web of Science | Medline

3. 3

   Franzen C, Muller A, Hegener P, et al. Polymerase chain reaction for microsporidian DNA in gastrointestinal biopsy specimens of HIV-infected patients. AIDS 1996;10:F23-F27
   CrossRef | Web of Science | Medline

4. 4

   Franzen C, Kuppers R, Muller A, et al. Genetic evidence for latent Septata intestinalis infection in human immunodeficiency virus-infected patients with intestinal microsporidiosis. J Infect Dis 1996;173:1038-1040
   CrossRef | Web of Science | Medline

Citing Articles (1)

Citing Articles

1. 1

   &NA; F. Wagner, Willy A. Flegel, Bernhard Kubanek. (1998) Blood transfusion: influence of transfusion therapy on outcome. Current Opinion in Anaesthesiology 11:2, 167-175
   CrossRef