Original Article
Constitutively Activated Receptors for Parathyroid Hormone and Parathyroid Hormone–Related Peptide in Jansen's Metaphyseal Chondrodysplasia
N Engl J Med 1996; 335:708-714September 5, 1996
- Abstract
Background
An activating mutation of the receptor for parathyroid hormone (PTH) and parathyroid hormone–related peptide (PTHrP) was recently found in a patient with Jansen's metaphyseal chondrodysplasia, a rare form of short-limbed dwarfism associated with hypercalcemia and normal or low serum concentrations of the two hormones. To investigate this and other activating mutations and to refine the classification of this unusual disorder, we analyzed genomic DNA from six additional patients with Jansen's disease.
Methods
Exons encoding the PTH–PTHrP receptor were amplified by the polymerase chain reaction (PCR), and the products were analyzed by gel electrophoresis or direct nucleotide-sequence analysis. Nucleotide changes were confirmed by restriction-enzyme digestion of genomic DNA or the PCR products.
Results
The previously reported mutation, which changes a histidine at position 223 to arginine (H223R), was found in genomic DNA from three of the six patients but not in DNA from their healthy relatives or 45 unrelated normal subjects. A novel missense mutation that changes a threonine in the receptor's sixth membrane-spanning region to proline (T410P) was identified in another patient but not in 62 normal subjects. In two patients with radiologic evidence of Jansen's metaphyseal chondrodysplasia but less severe hypercalcemia, no receptor mutations were detected. In COS-7 cells expressing PTH–PTHrP receptors with the T410P or H223R mutation, basal cyclic AMP accumulation was four to six times higher than in cells expressing wild-type receptors.
Conclusions
The expression of constitutively active PTH–PTHrP receptors in kidney, bone, and growth-plate chondrocytes provides a plausible genetic explanation for mineral-ion abnormalities and metaphyseal changes in patients with Jansen's disease.
Media in This Article
Figure 2
Analysis of Genomic DNA from Patients with Jansen's Metaphyseal Chondrodysplasia and the H223R Mutation in the PTH–PTHrP Receptor.Figure 1
Diagram of the Human PTH–PTHrP Receptor.Article Activity
- Article
Jansen's metaphyseal chondrodysplasia1 is a rare form of short-limbed dwarfism caused by severe abnormalities of the growth plates. The condition is typically associated with asymptomatic hypercalcemia and hypercalciuria due to increased bone resorption, which develops during the first months of life, despite normal or low serum concentrations of parathyroid hormone (PTH) and parathyroid hormone–related peptide (PTHrP).2-10 Both peptides mediate their biologic actions through the PTH–PTHrP receptor, which belongs to a distinct family of G protein–coupled receptors,11 has dual signaling properties, and is expressed in many fetal and adult tissues, although most abundantly in kidney, bone, and growth-plate cartilage.12-15 We recently identified a heterozygous mutation of the gene encoding the PTH–PTHrP receptor in a patient with Jansen's metaphyseal chondrodysplasia.16 The mutation changes a histidine residue to an arginine residue (H223R) (Figure 1Figure 1
Diagram of the Human PTH–PTHrP Receptor.), causing constitutive, ligand-independent activation of the receptor. We have now analyzed the genomic DNA from six additional patients with this disease to determine the frequency of the H223R mutation and to search for other activating mutations.Methods
Laboratory Studies
Serum PTH and PTHrP were measured by immunoradiometric assay and radioimmunoassay, respectively (Incstar, Stillwater, Minn.). Serum osteocalcin, bone-specific alkaline phosphatase activity, 25-hydroxyvitamin D, and 1,25-dihydroxyvitamin D were measured as described elsewhere,17 and serum calcium and phosphorus were measured by standard techniques with an automated analyzer.
Patients
All seven patients with Jansen's metaphyseal chondrodysplasia have been described previously.3,6-8,10,16,18-20 Selected clinical and laboratory findings are shown in Table 1Table 1
Clinical and Laboratory Findings in Seven Patients with Jansen's Metaphyseal Chondrodysplasia.. Because of the rarity of the disease, the two patients in Family 3 are described here in some detail.The index patient in Family 3 (Patient 3A) received a diagnosis of achondroplasia in childhood.20 Her parents were of average height and phenotypically normal; both died from causes unrelated to changes in calcium homeostasis. In 1995, at the age of 49 years, the patient's height was 130 cm; the ratio of the upper segment to the lower segment was 1.58 (mean value for normal women, 1.01). She was dysmorphic, with a small degree of micrognathia, and her skin was very dry and scaly. The laboratory findings were as follows: serum calcium concentration, 11.7 mg per deciliter (2.93 mmol per liter); phosphorus concentration, 2.9 mg per deciliter (0.9 mmol per liter); PTH concentration, <0.4 pg per milliliter (normal range, 15 to 50); PTHrP concentration, <5 pmol per liter (normal value, <5); osteocalcin concentration, 18 ng per milliliter (normal range, 8 to 12); bone-specific alkaline phosphatase activity, 235 U per liter (normal range, 10 to 22); 25-hydroxyvitamin D concentration, 9 ng per milliliter (22 nmol per liter) (normal range, 10 to 40 ng per milliliter [25 to 100 nmol per liter]); and 1,25-dihydroxyvitamin D concentration, 39 pg per milliliter (94 pmol per liter) (normal range, 15 to 40 pg per milliliter [36 to 96 pmol per liter]).
Her daughter (Patient 3B) was delivered at term by cesarean section because of cephalopelvic disproportion. The weight at birth was 3480 g, the length was 49 cm, the ratio of the upper segment to the lower segment was 1.54 (normal value at birth, 1.70), and the head circumference was 34.5 cm. The infant had tachypnea and cyanosis due to micrognathia, which were relieved by oral intubation. Except for marked bowing of both femurs, no other abnormalities were noted on physical examination. At birth and on day 3, the infant's serum calcium and phosphorus concentrations were normal for her age, but the serum alkaline phosphatase activity was 385 U per liter (normal range for this age, 73 to 264). Radiographic studies showed cupping and irregularity of all long bones, marked cortical lucencies with poor definition of the bony cortex, and marked subperiosteal resorption. Bilateral tibial fractures were present, the skull was undermineralized, and the mandible was hypoplastic.
At the age of six months, the patient's serum calcium concentration ranged from 11.8 to 12.4 mg per deciliter (2.95 to 3.10 mmol per liter), the phosphorus concentration ranged from 2.8 to 3.6 mg per deciliter (0.9 to 1.2 mmol per liter), and the PTH concentration was 0.2 μl-eq per milliliter (normal range, 2.4 to 5.9). No other laboratory studies were performed until 1995. At 1 1/2 years of age, the patient underwent frontal orbital advancement for bicoronal synostosis.
In 1995, at the age of 12 years, the patient's height was 104 cm (36 cm below the fifth percentile), and her weight was 27 kg (4 kg below the fifth percentile). Her pubic hair and breast development were Tanner stage 2 and 3, respectively. She had abnormalities characteristic of Jansen's metaphyseal chondrodysplasia, including fronto-orbital asymmetry, hypertelorism, and mandibular hypoplasia. Her skin was dry and scaly, and her hair was thin. She was a B student in an age-appropriate grade.
The laboratory values were as follows: serum calcium concentration, 11.2 to 11.5 mg per deciliter (2.80 to 2.87 mmol per liter); phosphorus concentration, 2.0 to 3.1 mg per deciliter (0.6 to 1.0 mmol per liter); PTH concentration, <0.4 pg per milliliter; PTHrP concentration, <5 pmol per liter; osteocalcin concentration, 97 ng per milliliter (age-adjusted normal range, 8 to 18); bone-specific alkaline phosphatase activity, 319 U per liter (age-adjusted normal range, 10 to 50); 25-hydroxyvitamin D concentration, 14 ng per milliliter (35 nmol per liter); and 1,25-dihydroxyvitamin D concentration, 42 pg per milliliter (101 pmol per liter).
Identification of Mutations
All coding exons of the gene encoding the PTH–PTHrP receptor were amplified from blood leukocyte genomic DNA with the use of the polymerase chain reaction (PCR). The products were analyzed by temperature-gradient gel electrophoresis or direct nucleotide-sequence analysis.21
The nucleotide changes that cause the H223R mutation in exon M2 and a threonine-to-proline mutation in exon M6/7 (residue 410 of the PTH–PTHrP receptor) were confirmed by restriction-enzyme digestion. For this purpose, smaller portions of either exon were amplified by PCR with the use of different reverse primers from those described previously.21 The reverse primer for exon M2, 5'CTCCTCCTCGGTGAGGCGCTCA3', which was synthesized with a GC clamp,21 generated a 206-bp PCR product; if adenine at position 696 was mutated to guanosine, restriction-enzyme digestion with Sph I resulted in two DNA fragments of 58 and 148 bp. The reverse primer for exon M6/7, 5'GTCCCTGAGACCTCGGTGTAT3', generated a 135-bp PCR product. Restriction-enzyme digestion with Aci I resulted in two DNA fragments of 30 and 105 bp; if adenine at position 1256 was mutated to cytosine, Aci I further digested the 105-bp fragment into 28- and 77-bp fragments. The H223R mutation was also confirmed by Southern blot analysis of genomic DNA.16
In Vitro Evaluation of Wild-Type and Mutant PTH–PTHrP Receptors
Mutations were introduced into the complementary DNA encoding the wild-type human PTH–PTHrP receptor (HKrk) and the version of the receptor containing a human influenza virus hemagglutinin-epitope tag.16 Plasmid DNA from at least two independent bacterial colonies, each encoding the respective mutant PTH–PTHrP receptor, was expressed in COS-7 cells.
Syntheses of [Nle8, Nle18, Tyr34] bovine PTH (1–34) amide and [Tyr36] human PTHrP (1–36) amide, radioreceptor assays, studies of the accumulation of PTH- and PTHrP-induced cyclic AMP and inositol phosphate, and studies of antihemagglutinin binding were performed as described elsewhere.16,21
Results
We recently reported the identification of a heterozygous H223R mutation of the gene for the PTH–PTHrP receptor in a patient with Jansen's metaphyseal chondrodysplasia (Patient 1, Table 1 and Figure 2Figure 2
Analysis of Genomic DNA from Patients with Jansen's Metaphyseal Chondrodysplasia and the H223R Mutation in the PTH–PTHrP Receptor.) that results in constitutive, ligand-independent accumulation of cyclic AMP in vitro.16 This mutation is caused by an adenine-to-guanine transition that introduces a novel Sph I restriction site in exon M2 of the gene for the PTH–PTHrP receptor. PCR-amplified genomic DNA from six additional patients with biochemical or radiologic evidence of Jansen's disease was therefore first screened by Sph I digestion. The PCR products from the affected patients in Families 1, 2, and 3 yielded, in addition to the undigested PCR product, 58- and 148-bp DNA fragments (Figure 2). The heterozygous adenine-to-guanine transition was confirmed by direct nucleotide-sequence analysis and Southern blot analysis of Sph I-digested genomic DNA (data not shown). This mutation was not detected in unaffected first-degree relatives of the patients in Families 1 and 2 (Figure 2), in three other previously described patients with Jansen's metaphyseal chondrodysplasia (Patients 4, 5, and 6), or in 45 normal subjects (data not shown). In Family 3, the H223R mutation was identified in the affected mother (Patient 3A) and her affected daughter (Patient 3B) but not in the healthy father.To search for mutations of the PTH–PTHrP receptor in Patients 4, 5, and 6, all 14 coding exons were amplified by PCR of genomic DNA, and the products were analyzed by direct nucleotide-sequence analysis and temperature-gradient gel electrophoresis (in Patients 5 and 6) or by nucleotide-sequence analysis alone (in Patient 4).21 In Patient 4, a heterozygous adenine-to-cytosine transversion was identified in exon M6/7 (Figure 3AFigure 3
Identification of the T410P Mutation in the PTH–PTHrP Receptor.), which corresponds to position 1256 of the complementary DNA encoding the human PTH–PTHrP receptor. This mutation, which was confirmed by temperature-gradient gel electrophoresis, introduces a novel restriction site for Aci I (Figure 3B) and changes a conserved threonine at position 410 to proline (Figure 1).For Patients 5 and 6, missense mutations were ruled out by temperature-gradient gel electrophoresis and direct nucleotide-sequence analysis in all coding exons of the gene for the PTH–PTHrP receptor.18,19 Patient 6 was heterozygous for a frequent exon M7 polymorphism.22
COS-7 cells expressing the mutant PTH–PTHrP receptor, HKrk-T410P, accumulated about four times more cyclic AMP than cells expressing the wild-type receptor (mean ±SE, 45.3±1.5 vs. 12.1±0.3 pmol per well per 15 minutes) (Figure 4AFigure 4
Expression of Wild-Type PTH–PTHrP Receptor (HKrk) and Mutant PTH–PTHrP Receptors (HKrk-H223R and HKrk-T410P) in COS-7 Cells., Figure 4B, Figure 4C, and Figure 4D). This degree of ligand-independent, constitutive activation was lower (P<0.001) than that caused by the H223R mutation (67.2±3.5 pmol per well per 15 minutes).16 The maximal accumulation of cyclic AMP in response to either PTH or PTHrP was higher in cells expressing receptors with the T410P mutation than in those with receptors containing the H223R mutation. Basal inositol phosphate accumulation was similar in cells expressing wild-type and mutant PTH–PTHrP receptors. Unlike the cells expressing the H223R mutant receptor, however, those expressing the T410P mutant receptor had increased inositol phosphate accumulation when stimulated by either PTH or PTHrP.The epitope-tagged version of the T410P mutant receptor showed only 31±4 percent of maximal cell-surface expression, which is slightly lower than that previously reported for cells expressing the H223R mutant receptor.16 Scatchard analysis of the results from cells expressing either wild-type or mutant PTH–PTHrP receptors without the hemagglutinin-epitope tag confirmed that the number of mutant receptors per cell was one third to one fifth the number of wild-type receptors (data not shown). Despite these reduced levels of mutant receptors on the cell surface, the maximal specific binding of radiolabeled PTH to wild-type and mutant PTH–PTHrP receptors was similar (HKrk, 14.3±4.5 percent; HKrk-H223R, 17.4±0.7 percent; and HKrk-T410P, 13.0±3.6 percent). The mutant receptors had an apparent binding affinity for PTH and PTHrP that was about two times higher than that of the wild-type receptors (HKrk, 10.3±4.8 nM; HKrk-H223R, 4.1±1.0 nM; and HKrk-T410P, 4.0±0.5 nM).
Discussion
A heterozygous mutation of the PTH–PTHrP receptor, previously reported in one patient with Jansen's metaphyseal chondrodysplasia, was identified in genomic DNA from three additional, unrelated patients but not in their healthy first-degree relatives or 45 normal subjects. In Family 3, the mutation was found in the affected mother and her affected daughter but not in the healthy father. Taken together, these findings suggest that Jansen's disease is usually caused by germ-line mutations in the gene for the PTH–PTHrP receptor and that the disease is inherited in an autosomal dominant fashion, as proposed previously.5,20,23
A second activating mutation in the PTH–PTHrP receptor, previously ruled out in 62 normal subjects,22 was identified in one patient with Jansen's metaphyseal chondrodysplasia (Patient 4). The mutated residue, T410, is conserved in all members of the family of calcitonin and PTH receptors in mammals.11 This residue has also been found at a similar position in the α2-adrenergic receptor, and its replacement by other residues resulted in constitutive activation of the receptor.24
The T410P mutation also led to receptor activation that was independent of PTH and PTHrP. Furthermore, in comparison with PTH–PTHrP receptors containing the H223R mutation, those containing the T410P mutation had significantly higher ligand-stimulated accumulation of cyclic AMP and inositol phosphate. Despite these differences in receptor function, the manifestations of the disease were similar in the affected patients.
In two other patients with Jansen's metaphyseal chondrodysplasia (Patients 5 and 6), mutations of the PTH–PTHrP receptor were ruled out by temperature-gradient gel electrophoresis and direct nucleotide-sequence analysis in all coding exons.18,19 The course of the disease in these patients differed from that in the patients with activating receptor mutations. The patients without these mutations had less severe hypercalcemia (Table 1), normal serum phosphorus and alkaline phosphatase activity,18,19 and normal serum PTH concentrations and urinary cyclic AMP excretion (in Patient 5; data not shown). Furthermore, whereas the adult height of Patient 6 was similar to that of other adults with Jansen's disease, Patient 5 reached an adult height that was almost normal, and unlike the findings in other patients,4,7 his radiologic growth-plate abnormalities did not improve after puberty.19 It thus appears possible that Jansen's metaphyseal chondrodysplasia comprises two distinct genetic disorders or that milder forms of the disease represent somatic mosaicism affecting primarily the growth-plate cartilage, with normal genes for PTH–PTHrP receptors in blood cells.
In patients with Jansen's metaphyseal chondrodysplasia, asymptomatic, ligand-independent hypercalcemia is most likely caused by constitutive activation of PTH–PTHrP receptors. These G protein–coupled receptors with dual signaling properties are activated by PTH and PTHrP11 and are normally expressed at high levels in the kidneys and bone.12-15 Even if the receptors are expressed at reduced levels, the presence of activated mutant receptors in these two tissues provides the most plausible explanation for the ligand-independent abnormalities of mineral-ion homeostasis and bone turnover in patients with this disorder.2-4,6-10 The abnormalities appear to subside later in life without treatment.
PTH–PTHrP receptors are also abundantly expressed in growth-plate chondrocytes at the transition between proliferation and hypertrophy and are thought to mediate, possibly through cyclic AMP, the paracrine or autocrine actions of PTHrP produced by adjacent perichondrial cells.14,25-27 Mice that lack PTHrP or PTH–PTHrP receptors have severe growth-plate abnormalities,28,29 and transgenic mice with an overproduction of PTHrP targeted to proliferating chondrocytes have dwarfism as a result of impaired terminal chondrocyte differentiation and delayed mineralization.30 On the basis of these in vitro and in vivo findings, it appears likely that constitutive activation of PTH–PTHrP receptors in chondrocytes causes growth-plate abnormalities that lead to the typical radiologic2,7-10,20 and histologic2,3,31 findings in Jansen's metaphyseal chondrodysplasia and result in short-limbed dwarfism.
Because of the widespread expression of PTHrP and its receptor, our findings may have implications for other biologic functions mediated by the PTH–PTHrP receptor. Patient 3A was unable to breast-feed, and her skin, as well as that of her affected daughter, was dry and scaly. PTHrP is found in the epidermis,26 and its expression under the control of the keratin-14 promoter results in abnormal development of the mammary-duct system.32 These clinical findings may be related to constitutively activated PTH–PTHrP receptors in dermis and mammary epithelial cells, respectively. Patients with Jansen's disease have no obvious abnormalities in other systems, indicating that PTH–PTHrP receptors in these systems serve less crucial biologic functions or that these functions are not all mediated by cyclic AMP.
In summary, the expression of activated PTH–PTHrP receptors in the kidneys, bone, and growth-plate chondrocytes most likely causes ligand-independent hypercalcemia and short-limbed dwarfism, which are the two most prominent features of Jansen's metaphyseal chondrodysplasia. These findings may have implications for understanding the broader biologic role of PTHrP and the PTH–PTHrP receptor, as well as their roles in other disorders.
Supported by a grant (R01 46718) from the National Institute of Diabetes and Digestive and Kidney Diseases.
We are indebted to Drs. D.S. Rao and W. Kupin, Detroit, and to Dr. J.C. Leyhane, Delmar, New York, for providing blood samples and clinical information; and to Dr. A.K. Poznanski, Chicago, for helpful discussions about the radiologic findings in Jansen's metaphyseal chondrodysplasia.
Source Information
From the Endocrine Unit, Department of Medicine (E.S., G.S.J., H.J.), and the Children's Service (H.J.), Massachusetts General Hospital and Harvard Medical School, Boston; the Pediatric Nephrology and Mineral Metabolism Unit, Northwestern University Medical School and Children's Memorial Hospital, Chicago (C.B.L.); the Bone and Mineral Research Laboratory, Henry Ford Hospital, Detroit (A.M.P.); Fukushima Medical College, Fukushima, Japan (S.K.); and the Department of Orthopaedic Surgery and Endocrinology, Hospital for Sick Children and University of Toronto, Toronto (S.W.K., W.G.C.).
Address reprint requests to Dr. Jüppner at the Endocrine Unit, Wellman 5, Massachusetts General Hospital, Boston, MA 02114.
- References
References
1
Jansen M . Über atypische Chondrodystrophie (Achondroplasie) und über eine noch nicht beschriebene angeborene Wachstumsstörung des Knochensystems: Metaphysäre Dysostosis. Orthop Chir 1934;61:253-2862
Cameron JAP ,Young WB ,Sissons HA . Metaphysial dysostosis: report of a case. J Bone Joint Surg Br 1954;36:622-629
Web of Science | Medline3
Gram PB ,Fleming JL ,Frame B ,Fine G . Metaphyseal chondrodysplasia of Jansen. J Bone Joint Surg Am 1959;41:951-959
Web of Science | Medline4
de Haas WHD ,de Boer W ,Griffioen F . Metaphysial dysostosis: a late follow-up of the first reported case. J Bone Joint Surg Br 1969;51:290-299
Medline5
Holthusen W ,Holt JF ,Stoeckenius M . The skull in metaphyseal chondrodysplasia type Jansen. Pediatr Radiol 1975;3:137-144
CrossRef | Medline6
Rao DS, Frame B, Reynolds WA, Parfitt AM. Hypercalcemia in metaphyseal chondrodysplasia of Jansen (MCD): an enigma. In: Norman AW, Schaefer K, von Herrath D, et al., eds. Vitamin D, basic research and its clinical application. Berlin, Germany: Walter de Gruyter, 1979:1173-6.
7
Frame B, Poznanski AK. Conditions that may be confused with rickets. In: DeLuca HF, Anast CS, eds. Pediatric diseases related to calcium. New York: Elsevier, 1980:269-89.
8
Silverthorn KG ,Houston CS ,Duncan BP . Murk Jansen's metaphyseal chondrodysplasia with long-term followup. Pediatr Radiol 1987;17:119-123
CrossRef | Web of Science | Medline9
Kessel D ,Hall CM ,Shaw DG . Two unusual cases of nephrocalcinosis in infancy. Pediatr Radiol 1992;22:470-471
CrossRef | Web of Science | Medline10
Kruse K ,Schutz C . Calcium metabolism in the Jansen type of metaphyseal dysplasia. Eur J Pediatr 1993;152:912-915
CrossRef | Web of Science | Medline11
Juppner H . Molecular cloning and characterization of a parathyroid hormone/parathyroid hormone-related peptide receptor: a member of an ancient family of G protein-coupled receptors. Curr Opin Nephrol Hypertens 1994;3:371-378
CrossRef | Medline12
Urena P ,Kong XF ,Abou-Samra AB , et al. Parathyroid hormone (PTH)/PTH-related peptide receptor messenger ribonucleic acids are widely distributed in rat tissues. Endocrinology 1993;133:617-623
CrossRef | Web of Science | Medline13
Tian J ,Smogorzewski M ,Kedes L ,Massry SG . Parathyroid hormone/parathyroid hormone related protein receptor messenger RNA is present in many tissues besides the kidney. Am J Nephrol 1993;13:210-213
CrossRef | Web of Science | Medline14
Lee K ,Deeds JD ,Chiba S ,Un-No M ,Bond AT ,Segre GV . Parathyroid hormone induces sequential c-fos expression in bone cells in vivo: in situ localization of its receptor and c-fos messenger ribonucleic acids. Endocrinology 1994;134:441-450
CrossRef | Web of Science | Medline15
Lee K ,Brown D ,Urena P , et al. Localization of parathyroid hormone-parathyroid hormone-related peptide receptor mRNA in kidney. Am J Physiol 1996;270:F186-F191
Web of Science | Medline16
Schipani E ,Kruse K ,Juppner H . A constitutively active mutant PTH-PTHrP receptor in Jansen-type metaphyseal chondrodysplasia. Science 1995;268:98-100
CrossRef | Web of Science | Medline17
Reed A ,Haugen M ,Pachman LM ,Langman CB . Abnormalities in serum osteocalcin values in children with chronic rheumatic diseases. J Pediatr 1990;116:574-580
CrossRef | Web of Science | Medline18
Gordon SL ,Varano LA ,Alandete A ,Maisels MJ . Jansen's metaphyseal dysostosis. Pediatrics 1976;58:556-560
Web of Science | Medline19
Kikuchi S ,Hasue M ,Watanabe M ,Hasebe K . Metaphysial dysostosis (Jansen type): report of a case with long follow-up. J Bone Joint Surg Br 1976;58:102-106
Web of Science | Medline20
Charrow J ,Poznanski AK . The Jansen type of metaphyseal chondrodysplasia: confirmation of dominant inheritance and review of radiographic manifestations in the newborn and adult. Am J Med Genet 1984;18:321-327
CrossRef | Web of Science | Medline21
Schipani E ,Weinstein LS ,Bergwitz C , et al. Pseudohypoparathyroidism type lb is not caused by mutations in the coding exons of the human parathyroid hormone (PTH)/PTH-related peptide receptor gene. J Clin Endocrinol Metab 1995;80:1611-1621
CrossRef | Web of Science | Medline22
Schipani E ,Hustmyer FG ,Bergwitz C ,Juppner H . Polymorphism in exon M7 of the PTHR gene. Hum Mol Genet 1994;3:1210-1210
CrossRef | Web of Science | Medline23
Lenz WD. Discussion. In: Bergsma D, ed. The First Conference on the Clinical Delineation of Birth Defects. Part 4. Skeletal dysplasias. Vol. 5. No. 4 of Birth defects: original article series. New York: National Foundation, 1969:71-2.
24
Ren Q ,Kurose H ,Lefkowitz RJ ,Cotecchia S . Constitutively active mutants of the α 2-adrenergic receptor. J Biol Chem 1993;268:16483-16487[Erratum, J Biol Chem 1994;269:1566.]
Web of Science | Medline25
Iwamoto M ,Jikko A ,Murakami H , et al. Changes in parathyroid hormone receptors during chondrocyte cytodifferentiation. J Biol Chem 1994;269:17245-17251
Web of Science | Medline26
Lee K ,Deeds JD ,Segre GV . Expression of parathyroid hormone-related peptide and its receptor messenger ribonucleic acid during fetal development of rats. Endocrinology 1995;136:453-463
CrossRef | Web of Science | Medline27
Jikko A ,Murahami H ,Yan W , et al. Effects of cyclic adenosine 3',5'-monophosphate on chondrocyte terminal differentiation and cartilage-matrix calcification. Endocrinology 1996;137:122-128
CrossRef | Web of Science | Medline28
Karaplis AC ,Luz A ,Glowacki J , et al. Lethal skeletal dysplasia from targeted disruption of the parathyroid hormone-related peptide gene. Genes Dev 1994;8:277-289
CrossRef | Web of Science | Medline29
Lanske B ,Karaplis AC ,Lee K , et al. PTH/PTHrP receptor in early development and Indian hedgehog-regulated bone growth. Science 1996;273:663-666
CrossRef | Web of Science | Medline30
Weir E ,Philbrick W ,Neff L ,Amling M ,Baron R ,Broadus A . Targeted overexpression of parathyroid hormone-related peptide in chondrocytes causes skeletal dysplasia and delayed osteogenesis. J Bone Miner Res 1995;10:Suppl 1:S157-S157 abstract.
CrossRef | Web of Science31
Jaffe HL. Metabolic, degenerative, and inflammatory diseases of bones and joints. Philadelphia: Lea & Febiger, 1972:222-6.
32
Wysolmerski JJ ,McCaughern-Carucci JF ,Daifotis AG ,Broadus AE ,Philbrick WM . Overexpression of parathyroid hormone-related protein or parathyroid hormone in transgenic mice impairs branching morphogenesis during mammary gland development. Development 1995;121:3539-3547
Web of Science | Medline
- Citing Articles (54)
Citing Articles
1
Noriaki Ono, Kazuhisa Nakashima, Ernestina Schipani, Tadayoshi Hayata, Yoichi Ezura, Kunimichi Soma, Henry M. Kronenberg, Masaki Noda. (2012) Constitutively active PTH/PTHrP receptor specifically expressed in osteoblasts enhances bone formation induced by bone marrow ablation. Journal of Cellular Physiology 227:2, 408-415
CrossRef2
Fanxin Long. 2012. Prenatal Bone Development. , 39-53.
CrossRef3
Murat Bastepe, Harald Jüppner, Rajesh V. Thakker. 2012. Parathyroid Disorders. , 557-588.
CrossRef4
Antonio Morales Piga, Verónica Alonso Ferreira, Ana Villaverde-Hueso. (2011) Implicaciones del nuevo enfoque etiopatogénico en la clasificación de las enfermedades constitucionales y genéticas del hueso. Reumatología Clínica 7:4, 248-254
CrossRef5
Paul Arundel, Amaka Offiah, Nicholas J Bishop. (2011) Evolution of the radiographic appearance of the metaphyses over the first year of life in type V osteogenesis imperfecta: Clues to pathogenesis. Journal of Bone and Mineral Research 26:4, 894-898
CrossRef6
T. Hirai, A. S. Chagin, T. Kobayashi, S. Mackem, H. M. Kronenberg. (2011) Parathyroid hormone/parathyroid hormone-related protein receptor signaling is required for maintenance of the growth plate in postnatal life. Proceedings of the National Academy of Sciences 108:1, 191-196
CrossRef7
Harald Jüppner, John T. Jr. Potts. 2011. Roles of Parathyroid Hormone and Parathyroid Hormone-Related Peptide in Calcium Metabolism and Bone Biology: Biological Actions and Receptors. .
CrossRef8
Antonio Morales Piga, Verónica Alonso Ferreira, Ana Villaverde-Hueso. (2011) Implications of the new etiophatogenic approach in the classification of constitutional and genetic bone diseases. Reumatolog ía Cl ínica (English Edition) 7:4, 248-254
CrossRef9
Franciszek Burdan, Justyna Szumiło, Agnieszka Korobowicz, Rabia Farooquee, Sagar Patel, Ankit Patel, Anjalee Dave, Michał Szumiło, Michał Solecki, Robert Klepacz, Jarosław Dudka. (2009) Morphology and physiology of the epiphyseal growth plate. Folia Histochemica et Cytobiologica 47:1, 5-16
CrossRef10
Junko SHIMOMURA-KUROKI, Sobhan UBAIDUS, Paulo HL FREITAS, Minqi LI, Yoko ISHIDA, Naoaki SAITO, Kimimitsu ODA, Shohachi SHIMOOKA, Norio AMIZUKA. (2008) Rat wild-type parathyroid hormone receptor (PTH-R) and mutant PTH-RP132L show the different intracellular localization in vitro. Biomedical Research 29:2, 61-69
CrossRef11
ALAN M. RICE, SCOTT A. RIVKEES. 2008. Receptor Transduction of Hormone Action. , 26-73.
CrossRef12
ALLEN W. ROOT, FRANK B. DIAMOND. 2008. Disorders of Mineral Homeostasis in the Newborn, Infant, Child, and Adolescent. , 686-769.
CrossRef13
Carles Vilariño-Güell, Lisa J. Miles, Emma L. Duncan, Stuart H. Ralston, Juliet E. Compston, Cyrus Cooper, Bente L. Langdahl, Alasdair MacLelland, Huibert A. Pols, David M. Reid, Andre G. Uitterlinden, Colin D. Steer, Jon H. Tobias, John A. Wass, Matthew A. Brown. (2007) PTHR1 Polymorphisms Influence BMD Variation through Effects on the Growing Skeleton. Calcified Tissue International 81:4, 270-278
CrossRef14
Shinichi Kikuchi. (2007) International Collaboration Beyond the Culture Gap. Spine 32:13, 1369-1374
CrossRef15
Andrea G Lania, Giovanna Mantovani, Anna Spada. (2006) Mechanisms of Disease: mutations of G proteins and G-protein-coupled receptors in endocrine diseases. Nature Clinical Practice Endocrinology & Metabolism 2:12, 681-693
CrossRef16
Jonathan M. Weber, Shaula R. Forsythe, Christina A. Christianson, Benjamin J. Frisch, Benjamin J. Gigliotti, Craig T. Jordan, Laurie A. Milner, Monica L. Guzman, Laura M. Calvi. (2006) Parathyroid hormone stimulates expression of the Notch ligand Jagged1 in osteoblastic cells. Bone 39:3, 485-493
CrossRef17
Min Chen, Ahmet Celik, Keith E. Georgeson, Carroll M. Harmon, Yingkui Yang. (2006) Molecular basis of melanocortin-4 receptor for AGRP inverse agonism. Regulatory Peptides 136:1-3, 40-49
CrossRef18
L. M. Calvi. (2006) Hematopoietic-Osteoblastic Interactions in the Hematopoietic Stem Cell Niche. International Bone and Mineral Society Knowledge Environment 3:5, 10-18
CrossRef19
Outi Mäkitie, Miki Susic, Leanne Ward, Catherine Barclay, Francis H. Glorieux, William G. Cole. (2005) Schmid type of metaphyseal chondrodysplasia and COL10A1 mutations-findings in 10 patients. American Journal of Medical Genetics Part A 137A:3, 241-248
CrossRef20
Robert C. Gensure, Thomas J. Gardella, Harald Jüppner. (2005) Parathyroid hormone and parathyroid hormone-related peptide, and their receptors. Biochemical and Biophysical Research Communications 328:3, 666-678
CrossRef21
Sylvain Provot, Ernestina Schipani. (2005) Molecular mechanisms of endochondral bone development. Biochemical and Biophysical Research Communications 328:3, 658-665
CrossRef22
Lewis P. Rubin. 2005. Disorders of Calcium and Phosphorus Metabolism. , 1346-1365.
CrossRef23
O Mäkitie, L Ellis, PR Durie, JA Morrison, EB Sochett, JM Rommens, WG Cole. (2004) Skeletal phenotype in patients with Shwachman-Diamond syndrome and mutations in SBDS. Clinical Genetics 65:2, 101-112
CrossRef24
Norio Amizuka, Janet E. Henderson, John H. White, Kimimitsu Oda, Minqi Li, Kayoko Nozawa-Inoue, Yoshiro Kawano, Akiko Suzuki, Andrew C. Karaplis, David Goltzman, Takeyasu Maeda. (2004) Morphological Approach to Biological Action of PTHrP and Vitamin D3 on Endochondral Ossification. Journal of Oral Biosciences 46:2, 79-96
CrossRef25
Eva-Maria Weiss-Guillet, Jukka Takala, Stephan M Jakob. (2003) Diagnosis and management of electrolyte emergencies. Best Practice & Research Clinical Endocrinology & Metabolism 17:4, 623-651
CrossRef26
Ernestina Schipani, Sylvain Provot. (2003) PTHrP, PTH, and the PTH/PTHrP receptor in endochondral bone development. Birth Defects Research Part C: Embryo Today: Reviews 69:4, 352-362
CrossRef27
Chunying Yu, Anh-Thy Le, Herman Yeger, Bernard Perbal, Benjamin A Alman. (2003) NOV (CCN3) regulation in the growth plate and CCN family member expression in cartilage neoplasia. The Journal of Pathology 201:4, 609-615
CrossRef28
R. Tracy Ballock, Regis J. O'Keefe. (2003) Physiology and pathophysiology of the growth plate. Birth Defects Research Part C: Embryo Today: Reviews 69:2, 123-143
CrossRef29
Andrea Superti-Furga, Luisa Bonaf
, David L. Rimoin. (2002) Molecular-pathogenetic classification of genetic disorders of the skeleton. American Journal of Medical Genetics 106:4, 282-293
CrossRef30
Armen H. Tashjian, Bruce A. Chabner. (2002) Commentary on Clinical Safety of Recombinant Human Parathyroid Hormone 1-34 in the Treatment of Osteoporosis in Men and Postmenopausal Women. Journal of Bone and Mineral Research 17:7, 1151-1161
CrossRef31
Akiko Iida-Klein, Hua Zhou, Shi Shou Lu, Lance R. Levine, Mercedes Ducayen-Knowles, David W. Dempster, Jeri Nieves, Robert Lindsay. (2002) Anabolic Action of Parathyroid Hormone Is Skeletal Site Specific at the Tissue and Cellular Levels in Mice. Journal of Bone and Mineral Research 17:5, 808-816
CrossRef32
William McLean, Bjorn R Olsen. (2001) Mouse models of abnormal skeletal development and homeostasis. Trends in Genetics 17:10, S38-S43
CrossRef33
Wolfgang Sadee, Elen Hoeg, Julie Lucas, Danxin Wang. (2001) Genetic variations in human G protein-coupled receptors: Implications for drug therapy. AAPS PharmSci 3:3, 54-80
CrossRef34
Dhruv B. Pateder, Cristin M. Ferguson, Andreia M. Ionescu, Edward M. Schwarz, Randy N. Rosier, J. Edward Puzas, Regis J. O'Keefe. (2001) PTHrP expression in chick sternal chondrocytes is regulated by TGF-? through Smad-mediated signaling. Journal of Cellular Physiology 188:3, 343-351
CrossRef35
Benoît Escande, Véronique Lindner, Thierry Massfelder, Jean-Jacques Helwig, Umberto Simeoni. (2001) Developmental aspects of parathyroid hormone-related protein biology. Seminars in Perinatology 25:2, 76-84
CrossRef36
M.R John, J Bösel, S Breit, H Wickert, R Ziegler, E Blind. (2001) Changing serine-485 to alanine in the opossum parathyroid hormone (PTH)/PTH-related peptide receptor enhances PTH stimulation of phospholipase C in a stably transfected human kidney cell line: a useful model for PTH-analog screening?. Bone 28:2, 182-186
CrossRef37
Christian Rölz, Dale F. Mierke. (2001) Characterization of the molecular motions of constitutively active G protein-coupled receptors for parathyroid hormone. Biophysical Chemistry 89:2-3, 119-128
CrossRef38
Gordon J. Strewler. (2001) Local and systemic control of the osteoblast. Journal of Clinical Investigation 107:3, 271-272
CrossRef39
Marx, Stephen J., . (2000) Hyperparathyroid and Hypoparathyroid Disorders. New England Journal of Medicine 343:25, 1863-1875
Full Text40
Gordon J. Strewler. (2000) THE PARATHYROID HORMONE–RELATED PROTEIN. Endocrinology & Metabolism Clinics of North America 29:3, 629-645
CrossRef41
Ung-il Chung, Henry M. Kronenberg. (2000) Parathyroid hormone-related peptide and Indian hedgehog. Current Opinion in Nephrology and Hypertension 9:4, 357-362
CrossRef42
D. Inoue, T. Matsumoto. (2000) Parathyroid hormone-related peptide and bone: pathological and physiological aspects. Biomedicine & Pharmacotherapy 54, 32s-41s
CrossRef43
Rianne A F de Ligt, Angeliki P Kourounakis, Ad P IJzerman. (2000) Inverse agonism at G protein-coupled receptors: (patho)physiological relevance and implications for drug discovery. British Journal of Pharmacology 130:1, 1-12
CrossRef44
Epstein, Franklin H., , Strewler, Gordon J., . (2000) The Physiology of Parathyroid Hormone–Related Protein. New England Journal of Medicine 342:3, 177-185
Full Text45
Emma L. Duncan, Matthew A. Brown, Janet Sinsheimer, John Bell, Andrew J. Carr, B. Paul Wordsworth, John A. H. Wass. (1999) Suggestive Linkage of the Parathyroid Receptor Type 1 to Osteoporosis. Journal of Bone and Mineral Research 14:12, 1993-1999
CrossRef46
Beatriz D. Kuizon, Isidro B. Salusky. (1999) Growth Retardation in Children with Chronic Renal Failure. Journal of Bone and Mineral Research 14:10, 1680-1690
CrossRef47
H Jüppner. (1999) Receptors for parathyroid hormone and parathyroid hormone-related peptide: exploration of their biological importance. Bone 25:1, 87-90
CrossRef48
D. Goltzman. (1999) Interactions of PTH and PTHrP with the PTH/PTHrP Receptor and with Downstream Signaling Pathways: Exceptions That Provide the Rules. Journal of Bone and Mineral Research 14:2, 173-177
CrossRef49
Pascale Gaudin, Alain Couvineau, Christiane Rouyer-Fessard, Jean-José Maoret, Marc Laburthe. (1999) The Human Vasoactive Intestinal Peptide/Pituitary Adenylate Cyclase Activating Peptide Receptor 1 (VPAC1): Constitutive Activation by Mutations at Threonine 343. Biochemical and Biophysical Research Communications 254:1, 15-20
CrossRef50
Robert Terkeltaub, Martin Lotz, Kristen Johnson, Dalun Deng, Sanshiro Hashimoto, Mary B. Goldring, Doug Burton, Leonard J. Deftos. (1998) Parathyroid hormone-related protein is abundant in osteoarthritic cartilage, and the parathyroid hormone-related protein 1-173 isoform is selectively induced by transforming growth factor ? in articular chondrocytes and suppresses generation of extracellular inorganic pyrophosphate. Arthritis & Rheumatism 41:12, 2152-2164
CrossRef51
J. J. Wysolmerski, A. F. Stewart. (1998) THE PHYSIOLOGY OF PARATHYROID HORMONE-RELATED PROTEIN: An Emerging Role as a Developmental Factor. Annual Review of Physiology 60:1, 431-460
CrossRef52
Epstein, Franklin H., , Paschke, Ralf, Ludgate, Marian, . (1997) The Thyrotropin Receptor in Thyroid Diseases. New England Journal of Medicine 337:23, 1675-1681
Full Text53
Chi-Chuan Tseng, Li Lin. (1997) A Point Mutation in the Glucose-Dependent Insulinotropic Peptide Receptor Confers Constitutive Activity. Biochemical and Biophysical Research Communications 232:1, 96-100
CrossRef54
Martin, T. John, . (1996) Actions of Parathyroid Hormone–Related Peptide and Its Receptors. New England Journal of Medicine 335:10, 736-738
Full Text
