Original Article
Brief Report
Hepatitis C Virus–Associated Fulminant Hepatic Failure
N Engl J Med 1996; 335:631-634August 29, 1996
- Article
Fulminant hepatic failure is a dramatic clinical syndrome characterized by massive necrosis of liver cells.1 It is most often caused by hepatitis A virus and hepatitis B virus (HBV)2; whether hepatitis C virus (HCV) can cause it is still controversial.3,4 Among patients with non-A, non-B fulminant hepatitis, antibodies against HCV (anti-HCV) or serum HCV RNA were found in 40 to 60 percent in Japan5,6 and Taiwan,7 but in only 2 percent (range, 0 to 12 percent) in Western countries,8-13 with one exception: a recent study conducted in California reported a prevalence of 60 percent associated with low socioeconomic status and Hispanic ethnicity.14 Whether these discrepancies reflect geographic differences in the epidemiology of HCV infection or the pathogenicity of the prevalent viral strains is not known. Furthermore, because of the dramatic course of fulminant hepatic failure, in most patients only a single serum sample, often obtained late in the course of the disease, was studied.
In this report, we describe a patient with HCV-associated fulminant hepatitis in whom serial studies were done that provided a unique opportunity to establish a temporal association between the acquisition of HCV infection and the development of fulminant hepatitis and to define the clinical, virologic, and histologic profile of fulminant hepatitis C.
Case Report
A 68-year-old white man, who has been described previously,15 was admitted to Georgetown University Hospital in Washington, D.C., to undergo coronary-artery bypass grafting and aortic-valve replacement on March 21, 1990, about two months before the introduction of anti-HCV screening for blood donors. He was enrolled in a prospective study of post-transfusion non-A, non-B hepatitis being conducted at the National Institutes of Health at that time.16 He had no evidence of liver disease and had not received any transfusions in the previous six months (these were exclusion criteria for entry into the study).16 During surgery, the patient received a total of 39 units of red-cell concentrate, 15 units of platelets, 21 units of fresh-frozen plasma, and 2 units of plasma cryoprecipitate; no halothane was administered. He recovered quickly and was discharged seven days after surgery. He was readmitted four weeks later because of increasing malaise and nausea, at which time his serum alanine aminotransferase concentration was 4493 U per liter (it was 27 U per liter at the time of discharge). After readmission, icterus and progressive encephalopathy and coagulopathy developed, and the patient died in hepatic coma on the 11th hospital day, almost 7 weeks after surgery. His peak serum bilirubin concentration was 15 mg per deciliter (256 μmol per liter), and the longest prothrombin time was 70 seconds.
The diagnosis of fulminant hepatitis C was based on the assessment of clinical,17 virologic, and histologic measures. None of the medications that were administered to the patient were known to be hepatotoxic. Serial serum samples were tested for the presence and amount of HCV RNA, the HCV genotype, the degree of genetic heterogeneity within individual isolates, and the immune response to HCV. None of the serum samples had detectable levels of hepatitis B surface antigen, IgM antibodies against hepatitis A or hepatitis B core antigens, or antibodies against cytomegalovirus, Epstein–Barr virus, or the human immunodeficiency virus. To exclude the possibility of coinfection with HBV and hepatitis G virus (HGV), all serum samples were tested for the presence of HBV DNA and HGV RNA by the polymerase chain reaction (PCR), and all were negative.
Methods
Anti-HCV Testing
First- and second-generation enzyme immunoassays (Ortho Diagnostic Systems, Raritan, N.J.) were used to test for anti-HCV.
Detection, Titration, Genotyping, and Sequencing of HCV RNA
Total RNA extracted from 100 μl of serum by the guanidinium isothiocyanate–phenol–chloroform method18 was amplified by PCR with two sets of nested primers. The first set, derived from the 5' noncoding region,19 was used to investigate the course of HCV viremia, and the second set, from the E1 and E2 genes,19 including the hypervariable region 1,20 was used to determine the HCV genotype21 and the degree of variation within individual viral isolates. The sensitivity and specificity of this nested-PCR assay have been reported previously.18 The concentration of HCV RNA in serum was measured by the branched-chain DNA test with the Amplex Chiron assay (Chiron, Emeryville, Calif.).22
The PCR products derived from the E1 and E2 regions were analyzed both by direct sequencing, as previously described,19 and by sequencing of molecular clones. The amplified PCR products were also cloned into pGEM-T vector systems (Promega Biotech, Madison, Wis.), and 8 to 10 clones from each sample were sequenced with an automated DNA sequencer (model 373, Applied Biosystems, Foster City, Calif.) by a modified Sanger method.
Detection of Serum HGV RNA
Total RNA extracted from 100 μl of serum was amplified by PCR with primers derived from the putative fifth nonstructural region of the HGV genome, as previously reported.23 The PCR products were analyzed by dot blot hybridization with a 32P-labeled oligonucleotide probe.23
Detection of Serum HBV DNA
Serum HBV DNA was extracted,24 and PCR was performed with nested primers derived from the preS1 gene and the major S gene of the HBV genome. The outer primer pair consisted of F1 (5'GGGTGGAGCCCTCAGGCTCAGGGCA3'), starting at map position 1679, and F2 (5'GAAGATGAGGCATAGCAGCAGGAT3'), starting at map position 2254. The inner primer pair consisted of F3 (5'CCTCCTGCCTCCACCAAT3'), starting at map position 1730, and F4 (5'GAGGTTGGTGGTGAGTGATTG3'), starting at map position 2166.
Liver-Biopsy Studies and Immunohistochemical Staining for the Detection of HCV Antigen in the Liver
Liver tissue obtained at autopsy was stained for an HCV antigen encoded by the fourth nonstructural (ns4) gene; the percentage of cells that were antigen-positive was determined. Deparaffinized tissue sections were pretreated with protease XXIV solution and rinsed in TRIS–hydrochloric acid buffer. The sections were incubated for 30 minutes with a mouse monoclonal antibody against protein expressed from the NS4 region of the HCV genome (MA 292, Biogenex, San Ramon, Calif.). The sections were washed and then incubated with biotinylated antimouse antibody (HK 335-5K, Biogenex) for 30 minutes. The samples were rinsed, and a streptavidin–phosphatase label (HK 331-5K, Biogenex) was applied, followed by a rinse and application of 6-bromo-2-hydroxy-3-naphtholic blue substrate solution. Fifteen minutes later, the sections were rinsed again and coverslips were applied with mounting medium.
Results
Serial serum samples were tested for the presence and concentration of HCV RNA and for anti-HCV. HCV viremia was not detected before or 1 week after transfusion, but it was detected in the next available sample, obtained 5 weeks after transfusion, when the patient was readmitted to the hospital, and remained detectable until the patient's death, 11 days later (Figure 1Figure 1
Biochemical, Serologic, and Molecular Profiles of Fulminant Hepatitis C in a Patient Who Acquired HCV Infection after Blood Transfusion for Heart Surgery.). Before surgery, anti-HCV antibodies were not detected in serum, but these antibodies were detected by a second-generation enzyme immunoassay one day before the patient's death. The level of HCV viremia, as measured by the branched-chain DNA test, increased in parallel with serum alanine aminotransferase concentrations to a peak value of more than 108 genome equivalents per milliliter, and then rapidly decreased below the level of sensitivity of this test, despite the fact that serum HCV RNA was continuously detected by PCR until the patient's death (Figure 1). No HBV or HGV sequences were detected in any of the serial samples tested. Postmortem examination revealed areas of submassive and massive necrosis of the liver (Figure 2AFigure 2
Photomicrographs of a Liver-Biopsy Specimen from a Patient with Fulminant Hepatitis C.), and immunohistochemical staining for intrahepatic HCV NS4 antigen was positive in 20 percent of the residual liver cells (Figure 2B).The genotype of the HCV strain recovered from this patient was 1b. Direct sequencing of 525 nucleotides derived from the E1 and E2 genes showed that the two viral isolates recovered during the course of the disease, at week 5 and just before death 11 days later, were identical. Sequencing of molecular clones confirmed that the viral strain was the same but revealed the presence of genetic heterogeneity within each of the two isolates. Comparative sequence analysis of 18 clones showed the presence of 11 closely related viral variants, each differing from the consensus sequence by only one or two amino acids (data not shown).
Discussion
The availability of serial serum samples from a patient in whom fulminant hepatic failure developed provided us with the opportunity to demonstrate a temporal association between HCV infection and the development of fulminant hepatitis. The appearance of viremia, followed by seroconversion, unequivocally indicated the acquisition of primary HCV infection. The longitudinal analysis and molecular studies allowed us to rule out the etiologic role of other hepatitis viruses, including HGV, a recently described hepatitis agent.23 In this patient, fulminant hepatitis C was associated with continuous replication of HCV. As previously documented in acute hepatitis C,18 the detection of serum HCV RNA was the earliest marker for the diagnosis of fulminant hepatitis C. In contrast, anti-HCV was detected only one day before the patient's death. This suggests that in fulminant hepatitis, because of the extremely rapid course of the disease, there may not always be sufficient time for the development of antibodies. The patient's persistent HCV viremia was a critical marker in the differential diagnosis of non-A, non-B fulminant hepatitis. On the basis of this finding, a negative test for HCV RNA in a patient with fulminant hepatitis makes it extremely unlikely that the patient has HCV infection, even in cases in which only a single serum sample is available for testing. By extension, we infer that the previously described cases of fulminant non-A, non-B hepatitis that tested negative for HCV by PCR were probably unrelated to HCV infection. Whether these cases were due to unidentified infectious agents or, as recently proposed,4 to noninfectious hepatotoxic agents is not known.
In our patient, fulminant hepatitis C was characterized by high levels of viremia. Although the pathogenetic mechanism of virally induced fulminant hepatic failure is not known, the extent of liver damage correlated with the magnitude of viral replication in the absence of detectable antibodies. In contrast, in patients with fulminant hepatitis B, HBV replication is barely detectable or is undetectable, and antibody titers are high.25 This suggests that the mechanisms of fulminant liver injury differ in the two types of hepatitis. In viral isolates from our patient, we found a remarkably low degree of diversity, whereas in chronic hepatitis C there is considerable diversity.26 This finding may reflect a lack of selective pressure on the viral population because there is insufficient time for the development of a specific immune response in this rapidly evolving syndrome.
Although the temporal association between the acquisition of HCV infection and the development of fulminant hepatitis in this patient suggests that HCV was the causative agent, we cannot exclude the role of nonviral factors. Nevertheless, the incidence of post-transfusion fulminant hepatitis associated with major surgical operations is exceedingly low.27 Among more than 100 prospectively followed transfusion recipients in whom non-A, non-B hepatitis developed after major surgery, this patient was the only one in whom fulminant hepatitis developed.27 Thus, it is very unlikely that intraoperative factors were responsible for the fulminant hepatic failure.
In summary, HCV can cause fulminant hepatic failure. The disease is characterized by continuous viral replication. The detection of serum HCV RNA by PCR is the earliest and most valuable marker for the diagnosis of fulminant hepatitis C.
Presented in part at the Annual Meeting of the American Association for the Study of Liver Diseases, Chicago, November 11–15, 1994.
Source Information
From the Hepatitis Viruses Section, Laboratory of Infectious Diseases, National Institute of Allergy and Infectious Diseases (P.F., A.S., R.H.P.), and the Department of Transfusion Medicine, Warren G. Magnuson Clinical Center (H.J.A., L.C.C., J.C.M., J.W.S.), National Institutes of Health, Bethesda, Md.; the Department of Pathology, Rancho Los Amigos Medical Center, Downey, Calif. (S.G.); and the Division of Clinical and Laboratory Service, Georgetown Medical Center, Washington, D.C. (R.A.S.).
Address reprint requests to Dr. Farci at the Istituto di Medicina Interna, University of Cagliari, Via San Giorgio 12, 09124 Cagliari, Italy.
- References
References
1
Bernuau J ,Rueff B ,Benhamou JP . Fulminant and subfulminant liver failure: definitions and causes. Semin Liver Dis 1986;6:97-106
CrossRef | Web of Science | Medline2
Sherlock S . Fulminant hepatic failure. Adv Intern Med 1993;38:245-267
Medline3
Lee WM . Acute liver failure. N Engl J Med 1993;329:1862-1872[Erratum, N Engl J Med 1994;330:584.]
Full Text | Web of Science | Medline4
Wright TL . Etiology of fulminant hepatic failure: is another virus involved? Gastroenterology 1993;104:640-643
Web of Science | Medline5
Muto Y ,Sugihara J ,Ohnishi H ,Moriwaki H ,Nishioka K . Anti-hepatitis C virus antibody prevails in fulminant hepatic failure. Gastroenterol Jpn 1990;25:32-35
Medline6
Yanagi M ,Kaneko S ,Unoura M , et al. Hepatitis C virus in fulminant hepatic failure. N Engl J Med 1991;324:1895-1896
Full Text | Web of Science | Medline7
Chu CM ,Sheen IS ,Liaw YF . The role of hepatitis C virus in fulminant viral hepatitis in an area with endemic hepatitis A and B. Gastroenterology 1994;107:189-195
Web of Science | Medline8
Wright TL ,Hsu H ,Donegan E , et al. Hepatitis C virus not found in fulminant non-A, non-B hepatitis. Ann Intern Med 1991;115:111-112
Web of Science | Medline9
Theilmann L ,Solbach C ,Toex U , et al. Role of hepatitis C virus infection in German patients with fulminant and subacute hepatic failure. Eur J Clin Invest 1992;22:569-571
CrossRef | Web of Science | Medline10
Feray C ,Gigou M ,Samuel D , et al. Hepatitis C virus RNA and hepatitis B virus DNA in serum and liver of patients with fulminant hepatitis. Gastroenterology 1993;104:549-555
Web of Science | Medline11
Liang TJ ,Jeffers L ,Reddy RK , et al. Fulminant or subfulminant non-A, non-B viral hepatitis: the role of hepatitis C and E viruses. Gastroenterology 1993;104:556-562
Web of Science | Medline12
Kuwada SK ,Patel VM ,Hollinger FB , et al. Non-A, non-B fulminant hepatitis is also non-E and non-C. Am J Gastroenterol 1994;89:57-61
Web of Science | Medline13
Sallie R ,Silva AE ,Purdy M , et al. Hepatitis C and E in non-A non-B fulminant hepatic failure: a polymerase chain reaction and serological study. J Hepatol 1994;20:580-588
CrossRef | Web of Science | Medline14
Villamil FG ,Hu KQ ,Yu CH , et al. Detection of hepatitis C virus with RNA polymerase chain reaction in fulminant hepatic failure. Hepatology 1995;22:1379-1386
CrossRef | Web of Science | Medline15
Sacher RA ,Melpolder JJ . Hepatitis C virus and fulminant hepatitis. Ann Intern Med 1991;115:984-985
Web of Science16
Koziol DE ,Holland PV ,Alling DW , et al. Antibody to hepatitis B core antigen as a paradoxical marker for non-A, non-B hepatitis agents in donated blood. Ann Intern Med 1986;104:488-495
Web of Science | Medline17
Trey C ,Davidson CS . The management of fulminant hepatic failure. Prog Liver Dis 1970;3:282-298
Medline18
Farci P ,Alter HJ ,Wong D , et al. A long-term study of hepatitis C virus replication in non-A, non-B hepatitis. N Engl J Med 1991;325:98-104
Full Text | Web of Science | Medline19
Farci P ,Alter HJ ,Govindarajan S , et al. Lack of protective immunity against reinfection with hepatitis C virus. Science 1992;258:135-140
CrossRef | Web of Science | Medline20
Weiner AJ ,Brauer MJ ,Rosenblatt J , et al. Variable and hypervariable domains are found in the regions of HCV corresponding to the flavivirus envelope and NS1 proteins and the pestivirus envelope glycoproteins. Virology 1991;180:842-848
CrossRef | Web of Science | Medline21
Bukh J ,Purcell RH ,Miller RH . At least 12 genotypes of hepatitis C virus predicted by sequence analysis of the putative E1 gene of isolates collected worldwide. Proc Natl Acad Sci U S A 1993;90:8234-8238
CrossRef | Web of Science | Medline22
Alter HJ ,Sanchez-Pescador R ,Urdea MS , et al. Evaluation of branched DNA signal amplification for the detection of hepatitis C virus RNA. J Viral Hepat 1995;2:121-132
CrossRef | Web of Science | Medline23
Linnen J ,Wages J Jr ,Zhang-Keck Z-Y , et al. Molecular cloning and disease association of hepatitis G virus: a transfusion-transmissible agent. Science 1996;271:505-508
CrossRef | Web of Science | Medline24
Shih JW ,Cheung LC ,Alter HJ ,Lee LM ,Gu JR . Strain analysis of hepatitis B virus on the basis of restriction endonuclease analysis of polymerase chain reaction products. J Clin Microbiol 1991;29:1640-1644
Web of Science | Medline25
Brechot C ,Bernuau J ,Thiers V , et al. Multiplication of hepatitis B virus in fulminant hepatitis B. BMJ 1984;288:270-271
CrossRef | Web of Science | Medline26
Martell M ,Esteban JI ,Quer J , et al. Hepatitis C virus (HCV) circulates as a population of different but closely related genomes: quasispecies nature of HCV genome distribution. J Virol 1992;66:3225-3229
Web of Science | Medline27
Alter HJ . To C or not to C: these are the questions. Blood 1995;85:1681-1695
Web of Science | Medline
- Citing Articles (45)
Citing Articles
1
Maria Paola Simula, Valli De Re. (2010) Hepatitis C virus-induced oxidative stress and mitochondrial dysfunction: A focus on recent advances in proteomics. PROTEOMICS - Clinical Applications 4:10-11, 782-793
CrossRef2
Bloom Jonathan, Zapf Christoph, Levin Jeremy, Flint Michael. 2010. Recent Advances in Hepatitis C Therapies. .
CrossRef3
Giuseppe Castello, Stefania Scala, Giuseppe Palmieri, Steven A. Curley, Francesco Izzo. (2010) HCV-related hepatocellular carcinoma: From chronic inflammation to cancer. Clinical Immunology 134:3, 237-250
CrossRef4
Gary L. Davis, Miriam J. Alter, Hashem El–Serag, Thierry Poynard, Linda W. Jennings. (2010) Aging of Hepatitis C Virus (HCV)-Infected Persons in the United States: A Multiple Cohort Model of HCV Prevalence and Disease Progression. Gastroenterology 138:2, 513-521.e6
CrossRef5
Sarah L. Walker, Fionnuala Kennedy, Nolan Niamh, P. Aiden McCormick. (2008) Nimesulide associated fulminant hepatic failure. Pharmacoepidemiology and Drug Safety 17:11, 1108-1112
CrossRef6
Takanobu Kato, Youkyung Choi, Gamal Elmowalid, Ronda K. Sapp, Heidi Barth, Akihiro Furusaka, Shunji Mishiro, Takaji Wakita, Krzysztof Krawczynski, T. Jake Liang. (2008) Hepatitis C virus JFH-1 strain infection in chimpanzees is associated with low pathogenicity and emergence of an adaptive mutation. Hepatology 48:3, 732-740
CrossRef7
Anurag Maheshwari, Stuart Ray, Paul J Thuluvath. (2008) Acute hepatitis C. The Lancet 372:9635, 321-332
CrossRef8
David M. Novick, Mary Jeanne Kreek. (2008) Critical issues in the treatment of hepatitis C virus infection in methadone maintenance patients. Addiction 103:6, 905-918
CrossRef9
L. Martín Ramos, M.J. López Arias, J.L. Fernández Forcelledo, R. Ortiz de Diego. (2008) Manejo general y extrahospitalario de los pacientes con hepatitis aguda. Medicine - Programa de Formación Médica Continuada Acreditado 10:9, 577-584
CrossRef10
Adnan Said, Nasia Safdar, Jennifer Wells, Michael R. Lucey. 2008. Liver Disease in Renal Transplant Recipients. , 508-533.
CrossRef11
Mirta Ciocca, Sandra Fagundes Moreira-Silva, Sylvia Alegr??a, Maria Cristina Galoppo, Ricardo Ruttiman, Gilda Porta, Themis Reverbel Da Silvera, Pilar Rubio, Mercedes Macias, Yolanda Cervantes, Maria Luisa Avila-Aguero, Sue Anne Costa Clemens, Ralf Clemens, John Weil. (2007) Hepatitis A as an Etiologic Agent of Acute Liver Failure in Latin America. The Pediatric Infectious Disease Journal 26:8, 711-715
CrossRef12
(2007) Asian Pacific Association for the Study of the Liver consensus statements on the diagnosis, management and treatment of hepatitis C virus infection. Journal of Gastroenterology and Hepatology 22:5, 615-633
CrossRef13
Gorana Stamenkovic, Milena Bozic, Snezana Jovanovic-Cupic, Ksenija Bojovic, Jasmina Simonovic. (2007) Hepatitis C virus as cause of fulminant hepatitis-sequence analysis of the 5’ nontranslated region. Archives of Biological Sciences 59:3, 37P-38P
CrossRef14
R SOLALAMOGLIA. (2006) Tratamiento de la hepatitis aguda C. Gastroenterología y Hepatología 29, 163-167
CrossRef15
Takanobu Kato, Tomoko Date, Michiko Miyamoto, Takaji Wakita. (2006) A novel virus culture system for hepatitis C virus. Future Virology 1:4, 519-525
CrossRef16
Liisa K. Selin, Michael A. Brehm, Yuri N. Naumov, Markus Cornberg, Sung-Kwon Kim, Shalyn C. Clute, Raymond M. Welsh. (2006) Memory of mice and men: CD8+ T-cell cross-reactivity and heterologous immunity. Immunological Reviews 211:1, 164-181
CrossRef17
Raymond M Welsh. (2006) Private specificities of heterologous immunity. Current Opinion in Immunology 18:3, 331-337
CrossRef18
Evangelista Sagnelli, Nicola Coppola, Cecilia Marrocco, Mirella Onofrio, Caterina Sagnelli, Giancarlo Coviello, Carlo Scolastico, Pietro Filippini. (2006) Hepatitis C virus superinfection in hepatitis B virus chronic carriers: A reciprocal viral interaction and a variable clinical course. Journal of Clinical Virology 35:3, 317-320
CrossRef19
Takaji WAKITA. (2005) Kanzo 46:12, 691-702
CrossRef20
(2005) Hepatitis C Virus (HCV). Transfusion Medicine and Hemotherapy 32:3-4, 184-195
CrossRef21
Brian L. Pearlman. (2004) Hepatitis C Infection: A Clinical Review. Southern Medical Journal 97:4, 365-373
CrossRef22
Paul Krogstad, Mart??n G. Mart??n. (2003) Evaluation of acute liver failure. The Pediatric Infectious Disease Journal 22:9, 831-832
CrossRef23
M. S. Khuroo, S. Kamili. (2003) Aetiology and prognostic factors in acute liver failure in India. Journal of Viral Hepatitis 10:3, 224-231
CrossRef24
Takanobu Kato, Michiko Miyamoto, Akihiro Furusaka, Tomoko Date, Kotaro Yasui, Junko Kato, Shozo Matsushima, Tatsuji Komatsu, Takaji Wakita. (2003) Processing of hepatitis C virus core protein is regulated by its C-terminal sequence. Journal of Medical Virology 69:3, 357-366
CrossRef25
Frank Vinholt Schiodt, Timothy J. Davern, A. Obaid Shakil, Brendan McGuire, Grace Samuel, William M. Lee, . (2003) Viral hepatitis-related acute liver failure. The American Journal of Gastroenterology 98:2, 448-453
CrossRef26
Jay H. Hoofnagle. (2002) Course and outcome of hepatitis C. Hepatology 36:S1, S21-S29
CrossRef27
Anthony J Freeman, George Marinos, Rosemary A Ffrench, Andrew R Lloyd. (2001) Immunopathogenesis of hepatitis C virus infection. Immunology and Cell Biology 79:6, 515-536
CrossRef28
P. F. Whitington, E. M. Alonso. (2001) Fulminant Hepatitis in Children: Evidence for an Unidentified Hepatitis Virus. Journal of Pediatric Gastroenterology and Nutrition 33:5, 529-536
CrossRef29
Lauer, Georg M., Walker, Bruce D., . (2001) Hepatitis C Virus Infection. New England Journal of Medicine 345:1, 41-52
Full Text30
Takanobu Kato, Akihiro Furusaka, Michiko Miyamoto, Tomoko Date, Kotaro Yasui, Jun Hiramoto, Kazuo Nagayama, Teruji Tanaka, Takaji Wakita. (2001) Sequence analysis of hepatitis C virus isolated from a fulminant hepatitis patient. Journal of Medical Virology 64:3, 334-339
CrossRef31
G.W. McCaughan, A. Zekry. (2000) Effects of immunosuppression and organ transplantation on the natural history and immunopathogenesis of hepatitis C virus infection. Transplant Infectious Disease 2:4, 166-185
CrossRef32
Luppi, Mario, Barozzi, Patrizia, Schulz, Thomas F., Setti, Gisella, Staskus, Katherine, Trovato, Raffaella, Narni, Franco, Donelli, Amedea, Maiorana, Antonio, Marasca, Roberto, Sandrini, Silvio, Torelli, Giuseppe, Sheldon, Julie, . (2000) Bone Marrow Failure Associated with Human Herpesvirus 8 Infection after Transplantation. New England Journal of Medicine 343:19, 1378-1385
Full Text33
Catherine Petruff Cheney, Sanjiv Chopra, Camilla Graham. (2000) HEPATITIS C. Infectious Disease Clinics of North America 14:3, 633-667
CrossRef34
A. Obaid Shakil, David Kramer, George V. Mazariegos, John J. Fung, Jorge Rakela. (2000) Acute liver failure: Clinical features, outcome analysis, and applicability of prognostic criteria. Liver Transplantation 6:2, 163-169
CrossRef35
Motoji Sawabe, Tomio Arai, Yukiyoshi Esaki, Toshio Fukazawa, Kaiyo Takubo, Katsuiku Hirokawa. (2000) Fulminant hepatic failure in the elderly: A clinicopathological study of autopsy cases aged over 65 years. Pathology International 50:2, 98-105
CrossRef36
Mark P. Epstein, Tamsin Knox. (2000) Current views on hepatitis C virus infection. Current Infectious Disease Reports 2:1, 55-60
CrossRef37
Andreas Cerny, Francis V. Chisari. (1999) Pathogenesis of chronic hepatitis C: Immunological features of hepatic injury and viral persistence. Hepatology 30:3, 595-601
CrossRef38
Chun-Jen Liu, Jia-Horng Kao, Ming-Yang Lai, Pei-Jer Chen, Jan-Show Chu, Wendy Chen, Ding-Shinn Chen. (1999) Minimal role of GB virus-C/hepatitis G virus in fulminant and subfulminant hepatitis in Taiwan. Journal of Gastroenterology and Hepatology 14:4, 352-357
CrossRef39
A. Obaid Shakil, George V. Mazariegos, David J. Kramer. (1999) FULMINANT HEPATIC FAILURE. Surgical Clinics of North America 79:1, 77-108
CrossRef40
Alison L. Doughty, Dorothy M. Painter, Geoffrey W. McCaughan. (1999) Nonspecificity of monoclonal antibody tordji-22 for the detection of hepatitis C virus in liver transplant recipients with cholestatic hepatitis. Liver Transplantation and Surgery 5:1, 40-45
CrossRef41
Makoto Yoshiba. (1998) Recent progress in the treatment of fulminant hepatic failure in Japan. Journal of Infection and Chemotherapy 4:2, 41-49
CrossRef42
Plevris, Schina, Hayes. (1998) The management of acute liver failure. Alimentary Pharmacology and Therapeutics 12:5, 405-418
CrossRef43
D BERNSTEIN, J TRIPODI. (1998) FULMINANT HEPATIC FAILURE. Critical Care Clinics 14:2, 181-197
CrossRef44
Ryukichi Kumashiro, Michio Sata, Yuriko Koga, Hiroshi Suzuki, Kazunori Noguchi, Kunihide Ishii, Nobuhide Kusaba, Kyuichi Tanikawa. (1997) SELECTION OF PROGNOSTIC FACTORS OF ACUTE HEPATITIS TYPE NON-A, NON-B FOR PATIENT LISTING FOR LIVER TRANSPLANTATION1. Transplantation 64:3, 418-421
CrossRef45
Patrizia Farci, Jens Bukh, Robert H. Purcell. (1997) The quasispecies of hepatitis C virus and the host immune response. Springer Seminars in Immunopathology 19:1, 5-26
CrossRef
