Correction
Direct Cultivation of the Causative Agent of Human Granulocytic Ehrlichiosis
N Engl J Med 1996; 335:361August 1, 1996
- Article
Direct Cultivation of the Causative Agent of Human Granulocytic Ehrlichiosis (Original Article, N Engl J Med 1996:334;209 - 215) . On page 210, 18 lines from the bottom of the right-hand column, the sequence for the primer GER 3 should have read, “5'TAGATCCTTCTTAACGGAAGGGCG3',” not “5'TAGATCCTTAACGGAAGGGCG3',” as printed. Also, on page 214, in the legend to Figure 3, the primers used for amplification should have read “GER 3 and 4,” not “PER 3 and 4,” as printed.
- Citing Articles (1)
Citing Articles
1
Charles A. Kallick. (2011) Ehrlichia and bone marrow cells: Could Ehrlichial infection explain the unsuspected etiology of some diseases of the immune system?. Medical Hypotheses 77:3, 374-379
CrossRef
