Correspondence
Hepatitis GB Virus C in Patients on Hemodialysis
N Engl J Med 1996; 334:1549June 6, 1996
- Article
To the Editor:
A new group of Flaviviridae viruses — hepatitis GB virus C (HGBV-C)1 and hepatitis G virus (HGV)2 — has recently been described. Patients infected with these viruses have persistent viremia, and they may have chronic hepatitis.
We tested the serum of 61 patients on hemodialysis for HGBV-C, using a reverse-transcriptase–nested polymerase-chain-reaction (PCR) method with primers located in the NS3 region of the viral genome. The outer primers1 were GB-C-a1 and GB-C-sl, and the inner primers were GBCSMAR (sense, 5'ATCCCCTTTTATGGGCATGG) and GBCAMAR (antisense, 5'GARCTGTCYTTiCCCCTRTAATA, in which R denotes A or G and Y denotes C or T). There were 29 women and 32 men with a mean age of 61 years (range, 21 to 86). The mean duration of hemodialysis was 106 months (range, 9 to 321). Ten percent of the patients had diabetes mellitus, 86 percent had received transfusions, and 5 percent had received renal transplants. Twenty-three percent had antibodies to hepatitis C virus (HCV), and 15 percent had positive PCR tests for hepatitis C. Five percent were positive for hepatitis B surface antigen.
Of those 61 patients, 57.5 percent were positive for HGBV-C on PCR. The presence of the viral genome correlated significantly with the duration of hemodialysis (mean duration, 72 months in the HGBV-C–negative patients and 130 months in the HGBV-C–positive patients; P = 0.009) and with the receipt of blood transfusions (73 percent of HGBV-C–positive patients had previously been transfused, as compared with 27 percent of HGBV-C–negative patients; P = 0.001), as previously described for HCV seropositivity among patients at our dialysis center.3 Only 4 of the 61 patients had elevated serum alanine aminotransferase concentrations. All four were positive for HGBV-C on PCR; one patient was seropositive for HCV and HCV-negative on PCR, and the other three patients were seronegative for HCV and HCV-negative on PCR. There was no correlation between the HGBV-C PCR results and sex, age, history of transplantation, or presence of diabetes, or between the presence of HGBV-C and HCV infection.
HGBV-C viremia is highly prevalent in patients on hemodialysis and is correlated with blood transfusion and the duration of hemodialysis. However, no specific clinical feature has thus far been associated with positivity for HGBV-C on PCR in patients on hemodialysis.
3 ReferencesX. de Lamballerie, M.D.
R.N. Charrel, M.D.
Université de la Méditerranée, 13007 Marseille, FranceB. Dussol, M.D.
Hôpital Sainte Marguerite, 13009 Marseille, France1
Simons JN ,Leary TP ,Dawson GJ , et al. Isolation of novel virus-like sequences associated with human hepatitis. Nat Med 1995;1:564-569
CrossRef | Web of Science | Medline2
Linnen J ,Wages J Jr ,Zhang-Keck Z-Y , et al. Molecular cloning and disease association of hepatitis G virus: a transfusion-transmissible agent. Science 1996;271:505-508
CrossRef | Web of Science | Medline3
Dussol B ,Berthezene P ,Brunet P ,Roubicek C ,Berland Y . Hepatitis C virus infection among chronic dialysis patients in the south of France: a collaborative study. Am J Kidney Dis 1995;25:399-404
CrossRef | Web of Science | Medline
- Citing Articles (44)
Citing Articles
1
Ravinder K. Wali, Jay R. Kaluvapalle, Alfred K. Cheung. 2008. Complications Associated with Hemodialysis. , 894-912.
CrossRef2
Ali Eslamifar, Rasool Hamkar, Amitis Ramezani, Farrokhlagha Ahmadi, Latif Gachkar, Somayeh Jalilvand, Ladan Adibi, Shahnaz Atabak, Ali Khameneh, Ramin Ghadimi, Arezoo Aghakhani. (2007) Hepatitis G virus exposure in dialysis patients. International Urology and Nephrology 39:4, 1257-1263
CrossRef3
Ali Eslamifar, Rasool Hamkar, Amitis Ramezani, Farrokhlagha Ahmadi, Latif Gachkar, Somayeh Jalilvand, Ladan Adibi, Ali Khameneh, Shahnaz Atabak, Ramin Ghadimi, Arezoo Aghakhani. (2007) Hepatitis G Virus Exposure in Dialysis Staff. Therapeutic Apheresis and Dialysis 11:5, 370-374
CrossRef4
Deepak Kumar, Bhudev C. Das, Ashu Arora, Narendera Pal Singh, Rajiv Kohli, Premashish Kar. (2005) Hepatitis G Virus Infection in Hemodialysis Patients from Urban Delhi. Renal Failure 27:1, 87-93
CrossRef5
Aykut Ozdarendeli, Zulal A. Toroman, Ahmet Kalkan, Süleyman S. Kilic, Mehmet Ozden, Mehmet Z. Doymaz. (2005) Prevalence and Genotypes of Hepatitis G Virus among Hemodialysis Patients in Eastern Anatolia, Turkey. Medical Principles and Practice 14:2, 102-106
CrossRef6
Priya Abraham, Rachel Hallett, Sujatha Radhakrishnan, Sukanya Raghuraman, Gopalan Sridharan, Chong Gee Teo. (2002) Hepatitis G virus genotypes in a tertiary care centre in southern India. Journal of Clinical Virology 25:2, 187-192
CrossRef7
Marcello Grassi, Antonio Mammarella, Giovanni Sagliaschi, Lucia Granati, Antonio Musca, Fiore Traditi, Mario Pezzella. (2001) Persistent Hepatitis G Virus (HGV) Infection in Chronic Hemodialysis Patients and Non-B, Non-C Chronic Hepatitis. Clinical Chemistry and Laboratory Medicine 39:10, 956-960
CrossRef8
M. A. Sathar, P. N. Soni, D. York. (2000) GB Virus C/Hepatitis G Virus (GBV-C/HGV): still looking for a disease. International Journal of Experimental Pathology 81:5, 305-322
CrossRef9
Michiari Okuda, Keisuke Hino, Masaaki Korenaga, Yuhki Yamaguchi, Yoshiharu Katoh, Motokazu Mukaide, Yoshitaka Kaneda, Takashi Minaminozono, Kiwamu Okita. (2000) GB Virus C/Hepatitis G Viremia and Antibody Response to the E2 Protein of Hepatitis G Virus in Hemodialysis Patients. Journal of Clinical Gastroenterology 30:4, 425-428
CrossRef10
Dámaso Infante, Margarita Pich, Ramon Tormo, Silvia Sauleda, Carlos Montané, Juan Ignacio Esteban, Rafael Esteban. (2000) Prevalence of Hepatitis G Virus in Healthy Children in Liver Disease, and Human Immunodeficiency Virus-1 Infection: Response to Interferon. Journal of Pediatric Gastroenterology and Nutrition 30:4, 385-390
CrossRef11
Hatim Hassan, Bahar Bastani. (2000) Hepatitis G Virus Infection Among Hemodialysis Patients: True Infection or Innocent Bystander?. Seminars in Dialysis 13:2, 108-111
CrossRef12
Barbara Tribl, Maximilian Schoniger-Hekele, Dagmar Petermann, Silvia Bakos, Edward Penner, Christian Muller. (1999) Prevalence of GBV-C/HGV-RNA, virus genotypes, and anti-E2 antibodies in autoimmune hepatitis. The American Journal of Gastroenterology 94:11, 3336-3340
CrossRef13
Maria Cabrerizo, Javier Bartolome, Patricia De Sequera, Carlos Caramelo, M. Luisa Manzano, Vicente Carreno. (1999) GBV-C/HGV-RNA in serum and peripheral blood mononuclear cells in hemodialysis patients. Kidney International 56:3, 1120-1128
CrossRef14
Mahomed A. Sathar, Paresh N. Soni, Sarala Naicker, Jan Conradie, Fathima Lockhat, Eleanor Gouws. (1999) GB virus C/hepatitis G virus infection in KwaZulu Natal, South Africa. Journal of Medical Virology 59:1, 38-44
CrossRef15
Magdalena Robaczewska, Lucyna Cova, Anna J. Podhajska, Bogdan Falkiewicz. (1999) Hepatitis G virus: Molecular organization, methods of detection, prevalence, and disease association. International Journal of Infectious Diseases 3:4, 220-233
CrossRef16
Abdel Rahman El-Zayadi, Kenji Abe, Osaima Selim, Hideo Naito, Georg Hess, Adham Ahdy. (1999) Prevalence of GBV-C/hepatitis G virus viraemia among blood donors, health care personnel, chronic non-B non-C hepatitis, chronic hepatitis C and hemodialysis patients in Egypt. Journal of Virological Methods 80:1, 53-58
CrossRef17
Guilherme Macedo, Odete Pereira, Berta Carvalho, Alfredo Loureiro. (1999) Hepatitis G Virus Infection in Hemodialysis Patients: Fact or Fancy?. The American Journal of Gastroenterology 94:5, 1423-1424
CrossRef18
Maria Luisa Mateos, Cristina Camarero, Elena Lasa, Jose Luis Teruel, Nuria Mir, Fernando Baquero. (1999) Hepatitis E Virus: Relevance in Blood Donors and Risk Groups. Vox Sanguinis 76:2, 78-80
CrossRef19
Lionel Rostaing, Jacques Izopet, Catherine Arnaud, Jean-Marc Cisterne, Laurent Alric, Jean-Louis Rumeau, Michel Duffaut, Dominique Durand. (1999) LONG-TERM IMPACT OF SUPERINFECTION BY HEPATITIS G VIRUS IN HEPATITIS C VIRUS-POSITIVE RENAL TRANSPLANT PATIENTS. Transplantation 67:4, 556-560
CrossRef20
Maria Luisa Mateos, Cristina Camarero, Elena Lasa, Jose Luis Teruel, Nuria Mir, Fernando Baquero. (1998) Hepatitis E Virus: Relevance in Blood Donors and Other Risk Groups. Vox Sanguinis 75:4, 267-269
CrossRef21
P. Gallian, V. Rodrigues, J. F. Cantaloube, H. Dessein, P. de Micco, A. J. Dessein, X. de Lamballerie. (1998) High prevalence of GB-C/hepatitis G virus in a Brazilian population with helminth infection. Journal of Medical Virology 56:4, 310-315
CrossRef22
E. Schulte-Frohlinde, S. Schmolke, W. Reindl, G. Schatzle, J. Scherf, K. F. Kopp, M. Classen, V. Schluter. (1998) Significance of antibodies to the recombinant E2 protein of hepatitis G virus in haemodialysis patients. Journal of Viral Hepatitis 5:5, 341-344
CrossRef23
P Karayiannis. (1998) Natural history and molecular biology of hepatitis G virus/GB virus C. Clinical and Diagnostic Virology 10:2-3, 103-111
CrossRef24
Alison Casteling, Ernie Song, John Sim, Duane Blaauw, Anthon Heyns, Rose Schweizer, Larry Margolius, Eben Kuun, Steve Field, Barry Schoub, Eftyhia Vardas. (1998) GB virus C prevalence in blood donors and high risk groups for parenterally transmitted agents from Gauteng, South Africa†. Journal of Medical Virology 55:2, 103-108
CrossRef25
Murthy, A. Scott Muerhoff, Suresh M. Desai, Svetlozar N. Natov, Beth A. Bouthot, Robin Ruthazer, Christopher H. Schmid, Andrew S. Levey, Isa K. Mushahwar, Brian J.G. Pereira. (1998) Predictors of GBV-C infection among patients referred for renal transplantation. Kidney International 53:6, 1769-1774
CrossRef26
M. Jeffrey Mphahlele, George K. K. Lau, William F. Carman. (1998) HGV: the identification, biology and prevalence of an orphan virus. Liver 18:3, 143-155
CrossRef27
J
r
CrossRef28
B. Cacopardo, A. Berger, S. Cosentino, S. Lombardo, M.L. Morrone, V. Boscia, G. Vinci, R. Restivo, G. Brancati, H.W. Doerr, A. Nunnari. (1998) Serum hepatitis G virus (HGV) RNA in multitransfused thalassemics from Eastern Sicily. Journal of Infection 36:2, 179-183
CrossRef29
YONG POOVORAWAN, APIRADEE THEAMBOONLERS, VORANAUSH CHONGSRISAWAT, PANYA SEKSARN, LISA JARVIS† AND PETER SIMMONDS. (1998) High prevalence of hepatitis G virus infection in multiply transfused children with thalassaemia. Journal of Gastroenterology and Hepatology 13:3, 253-256
CrossRef30
Jean-Michel Pawlotsky, Françoise Roudot-Thoraval, A. Scott Muerhoff, Muriel Pellerin, Georgios Germanidis, Suresh M. Desai, Anne Bastie, Françoise Darthuy, Jocelyne Rémiré, Elie-Serge Zafrani, Claude-James Soussy, Isa K. Mushahwar, Daniel Dhumeaux. (1998) GB virus C (GBV-C) infection in patients with chronic hepatitis C. Influence on liver disease and on hepatitis virus behaviour: Effect of interferon alfa therapy. Journal of Medical Virology 54:1, 26-37
CrossRef31
CHIU-CHING HUANG. (1997) Hepatitis in patients with end-stage renal disease. Journal of Gastroenterology and Hepatology 12:9-10, S236-S241
CrossRef32
R. S. Ross, S. Viazov, J. P. Kruppenbacher, S. Elsner, S. Sarr, R. Lange, F.-W. Eigler, M. Roggendorf. (1997) GB virus C infection in patients who underwent liver transplantation. Liver 17:5, 238-243
CrossRef33
Sheng Lou, Xiaoxing Qiu, Gary Tegtmeier, Sandra Leitza, John Brackett, Kristen Cousineau, Amit Varma, Heidi Seballos, Samar Kundu, Steve Kuemmerlea, J.C. Hunt. (1997) Immunoassays to study prevalence of antibody against GB virus C in blood donors. Journal of Virological Methods 68:1, 45-55
CrossRef34
M. Günaydin, A. Bedir, T. Akpolat, I. Kuku, A. Pekbay, S. Esen, E. Özyilkan, N. Arik, K. Cengiz. (1997) Prevalence of serum HGV-RNA among hemodialysis patients in Turkey. Infection 25:5, 307-309
CrossRef35
XH. Zhang, H. Shinzawa, L. Shao, M. Ishibashi, K. Saito, S. Ohno, N. Yamada, H. Misawa, H. Togashi, T. Takahashi. (1997) Detection of hepatitis G virus RNA in patients with hepatitis B, hepatitis C, and non-A-E hepatitis by RT-PCR using multiple primer sets. Journal of Medical Virology 52:4, 385-390
CrossRef36
P. Karayiannis, H.C. Thomas. (1997) Current Status of Hepatitis G Virus (GBV-C) in Transfusion: Is It Relevant?. Vox Sanguinis 73:2, 63-69
CrossRef37
Klaus Stark, Christian G. Meyer, Michael Tacke, Anke Schwarz, Claudia Braun, Daniela Huzly, Alfred M. Engel, J??rgen May, Ulrich Bienzle. (1997) HEPATITIS G VIRUS RNA AND HEPATITIS G VIRUS ANTIBODIES IN RENAL TRANSPLANT RECIPIENTS. Transplantation 64:4, 608-612
CrossRef38
Bertrand Dussol, R??mi Charrel, Xavier De Lamballerie, Patrice Berthezene, Philippe Brunet, Philippe De Micco, Didier Raoult, Yvon Berland. (1997) PREVALENCE OF HEPATITIS G VIRUS INFECTION IN KIDNEY TRANSPLANT RECIPIENTS. Transplantation 64:3, 537-539
CrossRef39
Ryozo Nagayama, Kazuhiko Miyake, Hiroaki Okamoto. (1997) Effect of interferon on GB virus C and hepatitis C virus in hepatitis patients with the co-infection. Journal of Medical Virology 52:2, 156-160
CrossRef40
Elisabeth Lampe, Felipe L. Saback, Clara F. T. Yoshida, Christian Niel. (1997) Infection with GB virus C/hepatitis G virus in Brazilian hemodialysis and hepatitis patients and asymptomatic individuals. Journal of Medical Virology 52:1, 61-67
CrossRef41
Yu Wang, Hong-Song Chen, Min-Hua Fan, Hui-Lan Liu, Ping An, Naoto Sawada, Takeshi Tanaka, Fumio Tsuda, Hiroaki Okamoto. (1997) Infection with GB virus C and hepatitis C virus in hemodialysis patients and blood donors in Beijing. Journal of Medical Virology 52:1, 26-30
CrossRef42
Jean-François Cantaloube, Rémi N. Charrel, Houssam Attoui, Philippe Biagini, Philippe De Miccoa, Xavier De Lamballarie. (1997) Evaluation of four PCR systems amplifying different genomic regions for molecular diagnosis of GB virus C infections. Journal of Virological Methods 64:2, 131-135
CrossRef43
Min Ding, Hao Yuwen, Freddie Mitchell, Robin Biswas, Oliver K. Ndimbie, Mahmood Farshid. (1997) Sequence Characterization of the 5′ Noncoding Region of GB Virus C/Hepatitis G Virus. Biochemical and Biophysical Research Communications 231:3, 606-609
CrossRef44
(1996) Hepatitis GB Virus C. New England Journal of Medicine 335:18, 1392-1394
Full Text
