Original Article
Brief Report
Hepatic Dysfunction as a Complication of Adenosine Deaminase Deficiency
N Engl J Med 1996; 334:1367-1372May 23, 1996
- Article
Complete deficiency of adenosine deaminase causes severe combined immunodeficiency that is inherited as an autosomal recessive trait. The patients present in infancy with recurrent infections, lymphopenia, defective proliferative responses to mitogens, hypogammaglobulinemia, and an inability to mount specific antibody responses. Patients with a low level of residual adenosine deaminase activity have a later onset of clinical disease owing to a slower and sometimes less complete loss of immune function.1-3
Unlike other primary immunodeficiencies caused by defects in lymphocyte signaling pathways,4 adenosine deaminase deficiency is a systemic metabolic disorder. The enzymatic defect is expressed in all cells, and therefore the substrates for the enzyme, adenosine and 2'-deoxyadenosine, accumulate in cells of all types.3 Immunodeficiency is thought to occur because immature lymphoid cells are particularly sensitive to the toxic effects of adenosine and 2'-deoxyadenosine. In addition, some patients have neurologic abnormalities that are thought to be due to adenosine deaminase deficiency.5 Unlike humans, mice that express no adenosine deaminase die perinatally of severe hepatocellular degeneration.6,7 Hepatotoxicity in humans has not previously been attributed to adenosine deaminase deficiency. We report a neonate with this deficiency and prolonged hyperbilirubinemia with hepatitis that resolved after the institution of adenosine deaminase–replacement therapy.
Case Report
The patient was born to a healthy mother who was seronegative for the human immunodeficiency virus (HIV) and hepatitis B virus. He was normal at birth, but by the age of three weeks he had thrush, hepatomegaly, and jaundice. The patient's serum total bilirubin concentration was 5 mg per deciliter (86 μmol per liter), and his direct bilirubin concentration was 2.9 mg per deciliter (50 μmol per liter). The serum enzyme activities were as follows: aspartate aminotransferase, 561 IU per liter; alanine aminotransferase, 109 IU per liter; alkaline phosphatase, 528 IU per liter; and lactate dehydrogenase, 1997 IU per liter. The white-cell count was 5100 per cubic millimeter, with an abnormal differential count (61 percent neutrophils, 18 percent monocytes, 16 percent eosinophils, and 5 percent lymphocytes). Diagnostic studies revealed no anatomical explanation for the jaundice; viral and bacterial cultures were negative; and no antibodies to cytomegalovirus, Epstein–Barr virus, or hepatitis viruses A, B, and C were detectable. The sweat chloride concentration was normal. Hepatic radionuclide imaging with megrofenin isotope (Squibb Pharmaceutical, Princeton, N.J.) revealed rapid uptake with delayed excretion.
At the age of seven weeks, the patient weighed 3100 g (less than at birth), and his length and head circumference were below the fifth percentile. He was icteric and had a diffuse, truncal erythematous macular rash, oral and perineal candidiasis, and erythema of the palms and soles. He had tachypnea with scattered rales. The liver was palpable 4 cm below the costal margin; the tip of the spleen was just palpable. No tonsillar tissue was visible, and no lymph nodes were palpable at any site.
The lymphocyte count was 126 cells per cubic millimeter, with low percentages of T cells, B cells, and natural killer cells. The serum immunoglobulin concentrations were low (IgG, 240 mg per deciliter; IgA, 19 mg per deciliter; and IgM, 15 mg per deciliter). There was no in vitro proliferation of peripheral-blood mononuclear cells in response to a panel of mitogens. A skin biopsy revealed no evidence of graft-versus-host disease or infection. In erythrocytes, adenosine deaminase activity was undetectable (normal mean [±SD] activity, 52.3±38.8 nmol per hour per milligram of protein), adenosylhomocysteinase activity was reduced (0.17 nmol per hour per milligram of protein; normal, 4.2±1.9), and the concentration of total deoxyadenosine nucleotides was elevated (709 nmol per milliliter of packed cells; normal, <2). These findings established the diagnosis of adenosine deaminase deficiency.
A percutaneous liver-biopsy specimen showed early giant-cell transformation, with enlarged foamy hepatocytes and portal and lobular eosinophilic infiltrates (Figure 1Figure 1
Liver-Biopsy Specimen from the Patient with Adenosine Deaminase Deficiency, Showing Eosinophilic Infiltrates (Large Arrow), Enlarged Foamy Hepatocytes (Small Arrow), and Bile Stasis (Hematoxylin and Eosin, ×160).). There was no evidence of graft-versus-host disease, and no viral inclusions were seen. Immunostaining for herpes simplex virus and cytomegalovirus was negative. Viral cultures of liver, cerebrospinal fluid, nasopharyngeal secretions, stool, urine, and blood were negative, as were serum tests for cytomegalovirus and hepatitis B antigens and a polymerase-chain-reaction (PCR) test for hepatitis C.Methods
Adenosine deaminase complementary DNA (cDNA) and genomic sequences were identified,8,9 and methods of amplifying the cDNA and genomic segments and of cloning and sequencing PCR products were performed as described previously.10-13 The DNA fragments and PCR primer pairs used were as follows: adenosine deaminase cDNA coding region (base pairs [bp] 96 to 1188), 5'CGCGCGAATTCATGGCCCAGACGCCCGCCTTCGAC and 5'GCGCAAGCTTCAGAGGTTCTGCCCTGCAGAGGC; genomic exon 4 (bp 24,787 to 25,481), 5'GTATGCAGTTCCAAAGTAGAGCTG and 5'CAGTTATGAAGTTAGAGCAGGACC; and genomic exons 10 and 11 (bp 30,319 to 31,340), 5'AGGCTGCTGTGAGGATCAAAGGCGGGTGAA and 5'TGCTAGAAGTCCCACAGAAAGCCACACTGG.
The effect of mutations on adenosine deaminase activity was assessed as described elsewhere.10,12,13 Messenger RNA (mRNA) transcribed in vitro from cDNA subclones was used to prime a rabbit reticulocyte lysate translation system in the presence of methionine labeled with sulfur-35. Aliquots of these reactions containing equal amounts of wild-type translation products and translation products from cDNA samples from the patient (as determined by 10 percent sodium dodecyl sulfate–mercaptoethanol polyacrylamide-gel electrophoresis and fluorography) were subjected to electrophoresis on cellulose acetate and stained for adenosine deaminase activity in situ.14
Results
The patient had no HLA-matched sibling and was considered a poor candidate for bone marrow transplantation because of hepatitis. Enzyme-replacement therapy was begun with pegademase bovine (polyethylene glycol–modified adenosine deaminase [PEG-ADA], Adagen, Enzon, Piscataway, N.J.; 30 U per kilogram of ideal body weight twice weekly).3,15-19 Plasma adenosine deaminase activity rose rapidly to therapeutic levels. Within days after the start of the replacement therapy, the patient's serum aminotransferase and bilirubin concentrations began to fall, paralleling a decrease in the concentration of deoxyadenosine nucleotides in erythrocytes as a percentage of all adenine nucleotides (Figure 2AFigure 2
Responses to Treatment with Pegademase (PEG-ADA).). The serum bilirubin concentration became normal by day 55 of therapy and remained so subsequently. The improvement in the serum aminotransferase and bilirubin concentrations was followed by improvement in the lymphocyte count and the distribution of subgroups (Figure 2B). The patient is 23 months old at this writing, and his height, weight, and development are normal. He has had no infections other than a few episodes of otitis media. The in vitro proliferative responses of lymphcytes to mitogens and tetanus toxoid have been normal.Sequencing of adenosine deaminase cDNA subclones prepared from a B-lymphoblastoid cell line identified two missense mutations (data not shown). One group of subclones had a novel guanine-to-thymidine (G-to-T) mutation at position 316 (221 bp from the starting site of translation) that changed a glycine (GGC) to a valine (GTC) at codon 74 and eliminated a BbvI restriction site in exon 4. All the cDNA subclones with the wild-type Gly74 had a previously reported20,21 cytidine-to-thymidine (C-to-T) mutation at position 1081 (986 bp from the starting site of translation), which causes a substitution of valine for alanine at position 329 and introduces a new BalI–MscI restriction site in exon 11. Heterozygosity for each mutation (Figure 3AFigure 3
The Adenosine Deaminase Genotype of the Patient with Deficiency of That Enzyme and the Effect of the Gly74Val Mutation on Adenosine Deaminase Activity.) was confirmed by digesting PCR-amplified fragments of genomic DNA containing exons 4 and 11 with BbvI and MscI, respectively (data not shown). The Ala329Val mutation is known to abolish the catalytic activity of adenosine deaminase.22 The in vitro translation product containing the novel Gly74Val mutation also lacked detectable enzymatic activity (Figure 3B and Figure 3C).Discussion
Moderately elevated serum hepatic-enzyme concentrations whose cause and importance are uncertain are found in some patients with adenosine deaminase deficiency. In a review of autopsy findings in eight patients, severe bridging portal fibrosis was found in two.23 In our patient, prolonged neonatal jaundice and elevated serum aminotransferase concentrations were the dominant features at presentation, obscuring signs of primary immunodeficiency. Once lymphopenia and the absence of lymphoid tissues were recognized and adenosine deaminase deficiency was diagnosed, an extensive evaluation failed to implicate known causes of hepatic dysfunction. No infectious agent was identified, nor was there evidence of graft-versus-host disease due to the transfer of maternal T cells across the placenta. However, the findings of enlarged hepatocytes and biliary stasis, though nonspecific, were similar to changes found in the livers of adenosine deaminase–deficient mice.6,7 The patient's serum aminotransferase and bilirubin concentrations declined rapidly to normal after the start of adenosine deaminase–replacement therapy. These changes occurred in parallel with the correction of metabolic abnormalities induced by the accumulation of adenosine deaminase substrates, but before the numbers and function of T lymphocytes improved.
No biochemical studies of the patient's hepatocytes were conducted. However, in studies of adenosine deaminase–deficient mice7 (and unpublished data), the increase in deoxyadenosine triphosphate (the major cause of lymphopenia3,24) in the liver was slight. The activity of adenosylhomocysteinase, which is inactivated by deoxyadenosine,25 was reduced by 85 percent, resulting in an increase in hepatic adenosylhomocysteine by a factor of five to six.7 Partial inactivation of adenosylhomocysteine may contribute to the lymphopenia in adenosine deaminase deficiency.3,25-29 Among the mechanisms responsible for these effects are the inhibition by adenosylhomocysteine of s-adenosylmethionine–dependent transmethylation reactions26,27,30 and possibly the depletion of methionine and folate pools. Limiting transmethylation by various means is hepatotoxic in rodents.31-33
On the basis of these findings, we suggest that adenosine deaminase deficiency can cause hepatitis in some patients, who may have unknown predisposing factors or carry certain adenosine deaminase alleles, more than 40 of which have been identified.3,10-13,20-22,34 The specificity of the alleles is most likely related to their effect on adenosine deaminase activity, and hence to the degree of metabolic abnormality. Both our patient's missense mutations, Gly74Val and Ala329Val, reduce catalytic activity greatly. His very high erythrocyte deoxyadenosine nucleotide value at diagnosis indicates severe adenosine deaminase deficiency in all tissues.3,10 Alternatively, specific adenosine deaminase alleles may act like the alpha1-antitrypsin Z allele, which causes hepatotoxicity by being deposited as aberrantly processed inclusions in hepatocytes.35 No inclusions were found in our patient's liver-biopsy specimen, and adenosine deaminase replacement would not be expected to correct dysfunction due to an intracellular accumulation of improperly processed enzyme.
The metabolic effects of adenosine deaminase deficiency may cause morbidity unrelated to immunodeficiency, even though the latter is the overriding clinical problem. This may explain why adenosine deaminase–deficient patients with severe combined immunodeficiency have generally fared worse than others undergoing transplantation of haploidentical bone marrow.36 Two centers, for example, reported overall survival rates of 56 and 58 percent among a total of 74 patients who underwent this procedure, but none of the 8 with adenosine deaminase deficiency survived; the adenosine deaminase–deficient patients were also more likely than others to die before transplantation could be performed.37,38 The hepatotoxicity of adenosine deaminase substrates may be additive with the effects of cytotoxic agents used to prepare these patients for marrow transplantation.
Supported by a grant (DK20902) from the National Institutes of Health (to Dr. Hershfield) and by Enzon, Inc. Dr. Hershfield is a consultant to Enzon, Inc.
We are indebted to Mr. Stephan Toutain for expert technical assistance.
Source Information
From the Eudowood Division of Pediatric Immunology (M.E.B., H.M.L.) and the Division of Pediatric Gastroenterology (K.S.), Johns Hopkins University School of Medicine, Baltimore; and the Departments of Medicine (F.X.A.-V., I.S., M.S.H.) and Biochemistry (M.S.H.), Duke University School of Medicine, Durham, N.C.
Address reprint requests to Dr. Bollinger at the Eudowood Division of Pediatric Immunology, Johns Hopkins Hospital, CMSC 1102, 600 N. Wolfe St., Baltimore, MD 21287-3923.
- References
References
1
Giblett ER ,Anderson JE ,Cohen F ,Pollara B ,Meuwissen HJ . Adenosine-deaminase deficiency in two patients with severely impaired cellular immunity. Lancet 1972;2:1067-1069
CrossRef | Web of Science | Medline2
Hirschhorn R . Adenosine deaminase deficiency. Immunodefic Rev 1990;2:175-198
Medline3
Hershfield MS, Mitchell BS. Immunodeficiency diseases caused by adenosine deaminase deficiency and purine nucleoside phosphorylase deficiency. In: Scriver CR, Beaudet AL, Sly WS, Valle D, eds. The metabolic and molecular bases of inherited disease. 7th ed. Vol. 2. New York: McGraw-Hill, 1995:1725-68.
4
Rosen FS ,Cooper MD ,Wedgwood RJP . The primary immunodeficiencies. N Engl J Med 1995;333:431-440
Full Text | Web of Science | Medline5
Hirschhorn R ,Papageorgiou PS ,Kesarwala HH ,Taft LT . Amelioration of neurologic abnormalities after “enzyme replacement“ in adenosine deaminase deficiency. N Engl J Med 1980;303:377-380
Full Text | Web of Science | Medline6
Wakamiya M ,Blackburn MR ,Jurecic R , et al. Disruption of the adenosine deaminase gene causes hepatocellular impairment and perinatal lethality in mice. Proc Natl Acad Sci U S A 1995;92:3673-3677
CrossRef | Web of Science | Medline7
Migchielsen AAJ ,Breuer ML ,van Roon MA , et al. Adenosine-deaminase-deficient mice die perinatally and exhibit liver-cell degeneration, atelectasis and small intestinal cell death. Nat Genet 1995;10:279-287
CrossRef | Web of Science | Medline8
Wiginton DA ,Adrian GS ,Hutton JJ . Sequence of human adenosine deaminase cDNA including the coding region and a small intron. Nucleic Acids Res 1984;12:2439-2446
CrossRef | Web of Science | Medline9
Wiginton DA ,Kaplan DJ ,States JC , et al. Complete sequence and structure of the gene for human adenosine deaminase. Biochemistry 1986;25:8234-8244
CrossRef | Web of Science | Medline10
Santisteban I ,Arredondo-Vega FX ,Kelly S , et al. Novel splicing, missense, and deletion mutations in seven adenosine deaminase-deficient patients with late/delayed onset of combined immunodeficiency disease: contribution of genotype to phenotype. J Clin Invest 1993;92:2291-2302
CrossRef | Web of Science | Medline11
Arredondo-Vega FX ,Santisteban I ,Kelly S ,Schlossman CM ,Umetsu DT ,Hershfield MS . Correct splicing despite mutation of the invariant first nucleotide of a 5' splice site: a possible basis for disparate clinical phenotypes in siblings with adenosine deaminase deficiency. Am J Hum Genet 1994;54:820-830
Web of Science | Medline12
Santisteban I ,Arredondo-Vega FX ,Kelly S , et al. Four new adenosine deaminase mutations, altering a zinc-binding histidine, two conserved alanines, and a 5' splice site. Hum Mutat 1995;5:243-250
CrossRef | Web of Science | Medline13
Santisteban I ,Arredondo-Vega FX ,Kelly S , et al. Three new adenosine deaminase mutations that define a splicing enhancer and cause severe and partial phenotypes: implications for evolution of a CpG hotspot and expression of a transduced ADA cDNA. Hum Mol Genet 1995;4:2081-2087
CrossRef | Web of Science | Medline14
Arredondo-Vega FX ,Kurtzberg J ,Chaffee S , et al. Paradoxical expression of adenosine deaminase in T cells cultured from a patient with adenosine deaminase deficiency and combined immunodeficiency. J Clin Invest 1990;86:444-452
CrossRef | Web of Science | Medline15
Hershfield MS ,Buckley RH ,Greenberg ML , et al. Treatment of adenosine deaminase deficiency with polyethylene glycol-modified adenosine deaminase. N Engl J Med 1987;316:589-596
Full Text | Web of Science | Medline16
Weinberg K ,Hershfield MS ,Bastian J , et al. T lymphocyte ontogeny in adenosine deaminase-deficient severe combined immune deficiency after treatment with polyethylene glycol-modified adenosine deaminase. J Clin Invest 1993;92:596-602
CrossRef | Web of Science | Medline17
Hershfield MS ,Chaffee S ,Sorensen RU . Enzyme replacement therapy with polyethylene glycol-adenosine deaminase in adenosine deaminase deficiency: overview and case reports of three patients, including two now receiving gene therapy. Pediatr Res 1993;33:Suppl:S42-S48
CrossRef | Web of Science | Medline18
Hershfield MS . PEG-ADA: an alternative to haploidentical bone marrow transplantation and an adjunct to gene therapy for adenosine deaminase deficiency. Hum Mutat 1995;5:107-112
CrossRef | Web of Science | Medline19
Hershfield MS . PEG-ADA replacement therapy for adenosine deaminase deficiency: an update after 8.5 years. Clin Immunol Immunopathol 1995;76:S228-S232
CrossRef | Medline20
Akeson AL ,Wiginton DA ,States JC ,Perme CM ,Dusing MR ,Hutton JJ . Mutations in the human adenosine deaminase gene that affect protein structure and RNA splicing. Proc Natl Acad Sci U S A 1987;84:5947-5951
CrossRef | Web of Science | Medline21
Markert ML ,Norby-Slycord C ,Ward FE . A high proportion of ADA point mutations associated with a specific alanine-to-valine substitution. Am J Hum Genet 1989;45:354-361
Web of Science | Medline22
Akeson AL ,Wiginton DA ,Dusing MR ,States JC ,Hutton JJ . Mutant human adenosine deaminase alleles and their expression of transfection into fibroblasts. J Biol Chem 1988;263:16291-16296
Web of Science | Medline23
Ratech H ,Greco MA ,Gallo G ,Rimoin DL ,Kamino H ,Hirschhorn R . Pathologic findings in adenosine deaminase-deficient severe combined immunodeficiency. I. Kidney, adrenal, and chondro-osseous tissue alterations. Am J Pathol 1985;120:157-169
Web of Science | Medline24
Benveniste P ,Cohen A . p53 Expression is required for thymocyte apoptosis induced by adenosine deaminase deficiency. Proc Natl Acad Sci U S A 1995;92:8373-8377
CrossRef | Web of Science | Medline25
Hershfield MS . Apparent suicide inactivation of human lymphoblast s-adenosylhomocysteine hydrolase by 2'-deoxyadenosine and adenine arabinoside: a basis for direct toxic effects of analogs of adenosine. J Biol Chem 1979;254:22-25
Web of Science | Medline26
Kredich NM ,Martin DV Jr . Role of s-adenosylhomocysteine in adenosine mediated toxicity in cultured mouse T lymphoma cells. Cell 1977;12:931-938
CrossRef | Web of Science | Medline27
Hershfield MS ,Kredich NM . Resistance of an adenosine kinase-deficient human lymphoblastoid cell line to effects of deoxyadenosine on growth, s-adenosylhomocysteine hydrolase inactivation, and dATP accumulation. Proc Natl Acad Sci U S A 1980;77:4292-4296
CrossRef | Web of Science | Medline28
Wolos JA ,Frondorf KA ,Davis GF ,Jarvi ET ,McCarthy JR ,Bowlin TL . Selective inhibition of T cell activation by an inhibitor of s-adenosyl-L-homocysteine hydrolase. J Immunol 1993;150:3264-3273
Web of Science | Medline29
Wolos JA ,Frondorf KA ,Esser RE . Immunosuppression mediated by an inhibitor of s-adenosyl-L-homocysteine hydrolase: prevention and treatment of collagen-induced arthritis. J Immunol 1993;151:526-534
Web of Science | Medline30
Kredich NM ,Hershfield MS . S-adenosylhomocysteine toxicity in normal and adenosine kinase-deficient lymphoblasts of human origin. Proc Natl Acad Sci U S A 1979;76:2450-2454
CrossRef | Web of Science | Medline31
Wainfan E ,Dizik M ,Stender M ,Christman JK . Rapid appearance of hypomethylated DNA in livers of rats fed cancer-promoting, methyl-deficient diets. Cancer Res 1989;49:4094-4097
Web of Science | Medline32
Chandar N ,Lombardi B ,Locker J . c-myc Gene amplification during hepatocarcinogenesis by a choline-devoid diet. Proc Natl Acad Sci U S A 1989;86:2703-2707
CrossRef | Web of Science | Medline33
Poirier LA . Methyl group deficiency in hepatocarcinogenesis. Drug Metab Rev 1994;26:185-199
CrossRef | Web of Science | Medline34
Hirschhorn R . Adenosine deaminase deficiency: molecular basis and recent developments. Clin Immunol Immunopathol 1995;76:S219-S227
CrossRef | Medline35
Cox DW. α1-Antitrypsin deficiency. In: Scriver CR, Beaudet AL, Sly WS, Valle D, eds. The metabolic and molecular bases of inherited disease. 7th ed. Vol. 3. New York: McGraw-Hill, 1995:4125-58.
36
O'Reilly RJ ,Keever CA ,Small TN ,Brochstein J . The use of HLA-non-identical T-cell-depleted marrow for transplants for correction of severe combined immunodeficiency disease. Immunodefic Rev 1989;1:273-309
Medline37
Stephan JL ,Vlekova V ,Le Deist F , et al. Severe combined immunodeficiency: a retrospective single-center study of clinical presentation and outcome in 117 patients. J Pediatr 1993;123:564-572
CrossRef | Web of Science | Medline38
Dror Y ,Gallagher R ,Wara DW , et al. Immune reconstitution in severe combined immunodeficiency disease after lectin-treated, T-cell-depleted haplocompatible bone marrow transplantation. Blood 1993;81:2021-2030
Web of Science | Medline
- Citing Articles (25)
Citing Articles
1
Bernard C. Portmann, Eve A. Roberts. 2012. Developmental abnormalities and liver disease in childhood. , 101-156.
CrossRef2
M. Moncada-Vélez, A. Vélez-Ortega, J. Orrego, I. Santisteban, J. Jagadeesh, M. Olivares, N. Olaya, M. Hershfield, F. Candotti, J. Franco. (2011) Somatic Mosaicism Caused by Monoallelic Reversion of a Mutation in T Cells of a Patient with ADA-SCID and the Effects of Enzyme Replacement Therapy on the Revertant Phenotype. Scandinavian Journal of Immunology 74:5, 471-481
CrossRef3
R. Sokolic, I. Maric, C. Kesserwan, E. Garabedian, I. C. Hanson, M. Dodds, R. Buckley, A. C. Issekutz, N. Kamani, K. Shaw, B. Tan, P. Bali, M. S. Hershfield, D. B. Kohn, A. S. Wayne, F. Candotti. (2011) Myeloid dysplasia and bone marrow hypocellularity in adenosine deaminase-deficient severe combined immune deficiency. Blood 118:10, 2688-2694
CrossRef4
H. Bobby Gaspar. (2010) Bone Marrow Transplantation and Alternatives for Adenosine Deaminase Deficiency. Immunology and Allergy Clinics of North America 30:2, 221-236
CrossRef5
Ami J. Shah, Donald B. Kohn. (2010) Neurocognitive Function of Patients with Severe Combined Immunodeficiency. Immunology and Allergy Clinics of North America 30:1, 143-151
CrossRef6
Marcella Camici, Vanna Micheli, Piero Luigi Ipata, Maria Grazia Tozzi. (2010) Pediatric neurological syndromes and inborn errors of purine metabolism. Neurochemistry International 56:3, 367-378
CrossRef7
Aisha V Sauer, Alessandro Aiuti. (2009) New insights into the pathogenesis of adenosine deaminase-severe combined immunodeficiency and progress in gene therapy. Current Opinion in Allergy and Clinical Immunology 9:6, 496-502
CrossRef8
H. B. Gaspar, A. Aiuti, F. Porta, F. Candotti, M. S. Hershfield, L. D. Notarangelo. (2009) How I treat ADA deficiency. Blood 114:17, 3524-3532
CrossRef9
Raz Somech, Yew Hon Lai, Eyal Grunebaum, Nicole Le Saux, Ernest Cutz, Chaim M. Roifman. (2009) Polyethylene glycol–modified adenosine deaminase improved lung disease but not liver disease in partial adenosine deaminase deficiency. Journal of Allergy and Clinical Immunology 124:4, 848-850
CrossRef10
Ping Liu, Ines Santisteban, Lauri M. Burroughs, Hans D. Ochs, Troy R. Torgerson, Michael S. Hershfield, David J. Rawlings, Andrew M. Scharenberg. (2009) Immunologic reconstitution during PEG-ADA therapy in an unusual mosaic ADA deficient patient. Clinical Immunology 130:2, 162-174
CrossRef11
F. Gloria-Bottini, M. Banci, P. Saccucci, N. Lucarini, F. Ianniello, G. Paradisi, A. Magrini, E. Bottini. (2009) Coronary Artery Disease: A Study on the Joint Role of Birth Weight, Adenosine Deaminase, and Gender. Cardiology Research and Practice 2009, 1-6
CrossRef12
P. Titman, E. Pink, E. Skucek, K. O'Hanlon, T. J. Cole, J. Gaspar, J. Xu-Bayford, A. Jones, A. J. Thrasher, E. G. Davies, P. A. Veys, H. B. Gaspar. (2008) Cognitive and behavioral abnormalities in children after hematopoietic stem cell transplantation for severe congenital immunodeficiencies. Blood 112:9, 3907-3913
CrossRef13
F. Gloria-Bottini, A. Magrini, E. Cozzoli, A. Bergamaschi, E. Bottini. (2008) ADA genetic polymorphism and the effect of smoking on neonatal bilirubinemia and developmental parameters. Early Human Development 84:11, 739-743
CrossRef14
Michael S Hershfield. (2003) Genotype is an important determinant of phenotype in adenosine deaminase deficiency. Current Opinion in Immunology 15:5, 571-577
CrossRef15
Makoto Otsu, Michael S. Hershfield, Laura M. Tuschong, Linda M. Muul, Masafumi Onodera, Tadashi Ariga, Yukio Sakiyama, Fabio Candotti. (2002) Flow Cytometry Analysis of Adenosine Deaminase (ADA) Expression: A Simple and Reliable Tool for the Assessment of ADA-Deficient Patients Before and After Gene Therapy. Human Gene Therapy 13:3, 425-432
CrossRef16
Linda F. Thompson. 2002. Adenosine Deaminase [ADA]. .
CrossRef17
M. R. Blackburn, J. B. Volmer, J. L. Thrasher, H. Zhong, J. R. Crosby, J. J. Lee, R. E. Kellems. (2000) Metabolic Consequences of Adenosine Deaminase Deficiency in Mice Are Associated with Defects in Alveogenesis, Pulmonary Inflammation, and Airway Obstruction. Journal of Experimental Medicine 192:2, 159-170
CrossRef18
Melissa B. Aldrich, Michael R. Blackburn, Rodney E. Kellems. (2000) The Importance of Adenosine Deaminase for Lymphocyte Development and Function. Biochemical and Biophysical Research Communications 272:2, 311-315
CrossRef19
Catherine A. Abbott, Geoffrey W. McCaughan, Miriam T. Levy, W. Bret Church, Mark D. Gorrell. (1999) Binding to human dipeptidyl peptidase IV by adenosine deaminase and antibodies that inhibit ligand binding involves overlapping, discontinuous sites on a predicted beta propeller domain. European Journal of Biochemistry 266:3, 798-810
CrossRef20
Francisco X. Arredondo-Vega, Ines Santisteban, Shannon Daniels, Stephan Toutain, Michael S. Hershfield. (1998) Adenosine Deaminase Deficiency: Genotype-Phenotype Correlations Based on Expressed Activity of 29 Mutant Alleles. The American Journal of Human Genetics 63:4, 1049-1059
CrossRef21
Donald B. Kohn, Michal S. Hershfield, Denise Carbonaro, Ann Shigeoka, Judith Brooks, E. Monika Smogorzewska, Lora W. Barsky, Raymond Chan, Felix Burotto, Geralyn Annett, Jan A. Nolta, Gay Crooks, Neena Kapoor, Melissa Eldetr, Diane Wara, Thomas Bowen, Edward Madsen, Floyd F. Synder, John Bastian, Linda Muul, R. Michael Blaese, Kenneth Weinberg, Robertson Parkman. (1998) T lymphocytes with a normal ADA gene accumulate after transplantation of transduced autologous umbilical cord blood CD34+ cells in ADA-deficient SCID neonates. Nature Medicine 4:7, 775-780
CrossRef22
Scott H. Sicherer, Mary E. Bollinger, Michael S. Hershfield, Hugh Sampson, Howard M. Lederman. (1998) Food allergy in a patient with adenosine deaminase deficiency undergoing enzyme replacement with polyethylene glycol–modified adenosine deaminase. Journal of Allergy and Clinical Immunology 101:4, 561-562
CrossRef23
M. Fiore, R. Ammendola, L. Gaetaniello, C. De Felice, R. Iorio, A. Vegnente, B. Balestrieri, G. Palmese, M. Sommantico, C. Pignata. (1998) Chronic Unexplained Liver Disease in Children With Primary Immunodeficiency Syndromes. Journal of Clinical Gastroenterology 26:3, 187-192
CrossRef24
FX Arredondo-Vega, I Santisteban, LD Notarangelo, J. El Dahr, R Buckley, C Roifman, ME Conley, MS Hershfield. (1998) Seven novel mutations in the adenosine deaminase (ADA) gene in patients with severe and delayed onset combined immunodeficiency: G74C, V129M, G140E, R149W, Q199P, 462delG, and E337del. Human Mutation 11:6, 482-482
CrossRef25
A. Fischer, M. Cavazzana-Calvo, G. De Saint Basile, J. P. DeVillartay, J. P. Di Santo, C. Hivroz, F. Rieux-Laucat, F. Le Deist. (1997) NATURALLY OCCURRING PRIMARY DEFICIENCIES OF THE IMMUNE SYSTEM. Annual Review of Immunology 15:1, 93-124
CrossRef
