Original Article
Absence of Association or Genetic Linkage between the Angiotensin-Converting–Enzyme Gene and Left Ventricular Mass
N Engl J Med 1996; 334:1023-1028April 18, 1996
- Abstract
Background
Homozygous carriers of the D allele of the angiotensin-converting–enzyme (ACE) gene have been reported to be at increased risk for various cardiovascular disorders, including left ventricular hypertrophy. We investigated the potential role of the ACE gene in influencing left ventricular mass.
Methods
Quantitative echocardiographic data and DNA samples were available for 2439 subjects from the Framingham Heart Study. ACE genotypes were determined by an assay based on the polymerase chain reaction. (The D allele of the ACE gene contains a deletion, whereas the I [insertion] allele does not.) Left ventricular mass and the prevalence of left ventricular hypertrophy, adjusted for clinical covariates, were analyzed according to genotype. Genetic linkage between the ACE locus and left ventricular mass was evaluated by quantitative analysis of pairs of siblings.
Results
The ACE genotype was associated neither with left ventricular mass nor with the prevalence of left ventricular hypertrophy. Mean (±SE) left ventricular mass (adjusted for sex) among subjects carrying the DD, DI, and II genotypes was 165±1.6, 165±1.3, and 166±2.0 g, respectively (P = 0.90). The prevalence of left ventricular hypertrophy among the three genotype groups was 15.6 percent, 13.6 percent, and 15.6 percent, respectively (P = 0.36), and the adjusted relative risk of left ventricular hypertrophy associated with the DD genotype was 1.10 (95 percent confidence interval, 0.86 to 1.19). Linkage analysis in 759 pairs of siblings using both the ACE D/I marker and a microsatellite polymorphism at the neighboring locus for the human growth hormone gene failed to support any role of ACE in influencing left ventricular mass.
Conclusions
The ACE genotype showed no association with echocardiographically determined left ventricular mass, nor did it confer an increased risk of left ventricular hypertrophy. We found no appreciable role of the ACE gene in influencing left ventricular mass.
Media in This Article
Table 1
Characteristics of the Subjects According to ACE Genotype and Sex.Table 2
Left Ventricular Mass According to the ACE Genotype.Article Activity
- Article
Left ventricular hypertrophy is recognized as a major independent risk factor for morbidity and mortality from cardiovascular causes.1-4 Blood pressure, obesity, and age are important determinants of left ventricular mass2; however, they account only for part of the observed variance.5 Evidence that left ventricular mass is a familial trait6-10 suggests the influence of genetic factors; the absence of simple mendelian patterns of inheritance — except in rare syndromes11 — identifies left ventricular mass as a complex phenotype that is influenced by interacting genetic and environmental factors.
In humans the gene for angiotensin-converting enzyme (ACE) occurs in two allelic forms, distinguished by the presence (insertion, I) or absence (deletion, D) of a 287-base-pair repetitive DNA domain in intron 16. Homozygosity for the D allele was recently reported to be an independent risk factor for electrocardiographically defined left ventricular hypertrophy.12 In a large cross-sectional sample the DD genotype was associated with an overall relative risk of 1.76 that was attributable to a fourfold increase in risk in a subsample of 172 normotensive men.
The ACE D/I polymorphism is known to account for about half the variance in ACE plasma levels, with higher values occurring in persons with two D alleles.13-15 On the basis of a number of experimental and clinical observations, the renin–angiotensin system was postulated to be in an activated state in DD homozygotes, leading to speculation that this genotype was associated with cardiac hypertrophy. Angiotensin peptides exert trophic influences on cardiomyocytes in culture,16,17 and the expression of genes encoding components of the renin–angiotensin system is up-regulated in hypertrophy and remodeling.18-21 The ability of ACE inhibitors to induce the regression of hypertensive left ventricular hypertrophy22,23 and prevent ventricular remodeling after myocardial infarction24-26 provides an intriguing clinical correlate to these observations.
The identification of a genetic marker that could be used to predict the risk of developing left ventricular hypertrophy has major implications for such factors as prognostication and risk stratification. On the basis of its association with increased plasma ACE activity, the DD genotype might even represent a modifiable risk factor responsive to treatment with ACE inhibitors. Before such far-reaching conclusions can be entertained, evidence based on rigorously performed studies using state-of-the-art diagnostic, epidemiologic, and molecular genetic standards is mandatory. We therefore conducted a large-scale investigation based on echocardiographic assessment of left ventricular mass in a well-characterized sample of subjects from the Framingham Heart Study, using association algorithms and, as an additional powerful analytic tool, pedigree-based linkage analyses.
Methods
Study Population
The details of the design and methods of the Framingham Heart Study have been presented elsewhere.27 Briefly, starting in 1948, 5209 subjects between the ages of 28 and 62 years were enrolled in the cohort study, and beginning in 1971, a total of 5124 of their children and their children's spouses were enrolled.28 Surviving participants have been examined at regular intervals.28 Blood samples for DNA were collected between 1987 and 1991. Of 6214 subjects who underwent echocardiographic studies between 1979 and 1983, the results for 4973 were technically acceptable. Of these 4973 subjects, 2534 were excluded from the present study for the following reasons: age under 20 years (10 subjects), the presence of a systolic murmur of grade 3 or greater or the presence of a diastolic murmur (108), a creatinine level above 2.0 mg per deciliter (177 μmol per liter) (11), the lack of a DNA sample (1293, 774 of whom had died or did not participate in the 1987 to 1991 examination cycle), inaccessibility of DNA samples (1100), and untypability of blood samples (12). Thus, a total of 2439 subjects were studied.
Clinically relevant variables including age, height, weight, systolic and diastolic blood pressure, blood glucose concentration, and prevalence of diabetes, ischemic heart disease, congestive heart failure, and antihypertensive treatment at the time of echocardiography were determined with the use of previously published definitions and criteria.29
Echocardiography
As previously described for the Framingham Study,30 M-mode echocardiographic measurements were performed at end-diastole, according to the recommendations of the American Society of Echocardiography31 and the Penn convention.32 With the use of these measurements, left ventricular mass was determined by the following equation:
left ventricular mass (in grams) = 1.04[(LVIDD + VST + PWT)3 - (LVIDD)3] - 13.6,
where LVIDD is end-diastolic left ventricular internal diameter, VST is ventricular septal thickness, and PWT is posterior-wall thickness. Left ventricular mass was used as an unadjusted variable and was also adjusted for height (the mass in grams divided by the height in meters).30
Sex-specific population-based echocardiographic values derived from a healthy reference sample served to define categorical criteria for the presence or absence of left ventricular hypertrophy.30 Values exceeding the 95th percentile of this distribution (143 in men and 102 in women) were considered to indicate left ventricular hypertrophy.
Determination of ACE Genotypes
DNA was extracted from blood samples according to standard protocols.33,34 We used a modification of the published methods for the determination of ACE genotypes.35 Briefly, 5 μl containing approximately 5 to 20 ng of genomic DNA was covered with oil, denatured at 95°C for three minutes, and cooled to 80°C before 10 μl of polymerase-chain-reaction (PCR) master mix,35 containing 0.15 U of Taq DNA polymerase, was added. The primers used, the thermocycling protocol, and the approach to electrophoresis, retesting of DD homozygotes, replicate scoring, and quality control have been described previously.35
Determination of Genotypes for the Human Growth Hormone Gene Polymorphism
The genotype of a highly polymorphic microsatellite associated with the gene for human growth hormone (HGH), known to be located very close to ACE,36 was determined in all pairs of siblings. Genomic DNA was amplified during a 35-cycle, two-step PCR protocol (95°C for 15 seconds and 72°C for 2 minutes), with a reaction mix that differed from the one used for the determination of ACE genotype in the concentration of magnesium chloride (2.5 mM), deoxynucleoside triphosphates (200 μM each of adenosine triphosphate, cytidine triphosphate, thymidine triphosphate, and guanosine triphosphate), and primers (100 nM). One of the two primers (sense, 5'actgcactccagcctcggagacag3'; reverse, 5'agagcaggtggtgtggtgctactc3') was labeled at the 5' end with [32P]γ-ATP. Reaction products were resolved over sequencing gels containing 6 percent polyacrylamide, 8 M urea, and 30 percent formamide and visualized by autoradiography. Parallel sequencing ladders were used for size standardization. Scoring was carried out as described previously.35
Statistical Analysis
Association Algorithms
Multiple linear regression was used to compare quantitative data on left ventricular mass among subjects with the DD, DI, and II genotypes.37 Each group was analyzed separately according to sex and together (after adjustment with weighted least-squares analysis for the differences between the sexes in the variance of left ventricular mass), with and without adjustments for covariates (age, height, weight, systolic blood pressure, and the presence of ischemic heart disease, congestive heart failure, or diabetes mellitus), with the GLM program in SAS software.38 Secondary tests were carried out to test for dominant, recessive, and additive modes of inheritance. Unadjusted means represent simple, empirical values. Adjusted means were estimated by linear models to incorporate sex differences and the effects of other covariates listed previously. Left ventricular hypertrophy (absence or presence) was analyzed as a categorical variable by logistic regression.39 Separate-sex and pooled analyses, without and with adjustment for covariates, and before and after partitioning into four subgroups defined according to body-mass index (above or below the sex-specific median) and the presence or absence of hypertension (defined as diastolic blood pressure >90 mm Hg, systolic blood pressure >140 mm Hg, or the need for antihypertensive pharmacotherapy) were conducted with the Logistic program in SAS software. To exclude the possibility of bias, all tests were also performed on a subgroup of the sample that included only 1 randomly chosen member from each nuclear family (1717 subjects). All tests were two-sided, and a P value of less than 0.05 was considered to indicate statistical significance. The power to test for differences among mean values in the three genotype groups was assessed for each genotype stratified according to sex and with the estimated root-mean-square error of left ventricular mass after modeling with genotypes and risk factors (26.91 in men, 17.82 in women, and 22.88 in the pooled group).
Algorithms for Linkage Analysis in Pairs of Siblings
The Framingham Heart Study includes 2787 extended families ranging in size from 1 to 25 members. Linkage analysis in the present study was performed on 367 families with at least 2 members (254, 74, 32, 4, 2, and 1 families with 2, 3, 4, 5, 6, and 7 siblings each, respectively) with typable DNA and data on left ventricular mass, comprising 897 persons and providing 759 unique pairs of siblings for linkage analysis (there are n(n - 1)/2 pairs of siblings in a family with n siblings). Algorithms for quantitative-trait linkage analysis40,41 of the ACE and HGH genotypes in pairs of siblings were used with the SAGE SIBPAL programs.42 This nonparametric method accommodates continuous rather than categorical phenotypic variables, requires no genetic model assumptions, allows the incorporation of covariates, and optimizes the informational content of data by deriving power from both trait-concordant and trait-discordant pairs of siblings (in contrast with methods used to analyze pairs of siblings concordant for a categorical disease phenotype): concordant pairs of siblings are expected to share alleles at an implicated locus, whereas the opposite is expected for discordant pairs.
Regression of the squared difference in traits between pairs of siblings on the estimated proportion of alleles shared on the basis of descent (in lieu of actual information, which is available for only a small fraction of the sibships) was used to evaluate linkage. The regression coefficient, β1, was estimated as β1 = -2(1 - 2θ)2 σ2, where θ is the recombination frequency between marker and trait and σ2 is the genetic variance of the trait. β1 is zero if θ equals 0.5 (no linkage) and σ2 equals 0 (no genetic variance), or if both variables equal zero, and β1 will be negative if θ is less than 0.5 and σ2 is greater than 0.
The assumption that pairs of siblings are independent and from a randomly mating population was supported by the finding that the extent of linkage disequilibrium between ACE and HGH was identical to that in a large cross-section of the U.S. population (data not shown).
Results
Allele and Genotype Frequencies
Among the 2439 subjects in the study, the frequencies of the ACE D and I alleles were 0.551 and 0.449, respectively. The observed frequencies of 0.296, 0.510, and 0.194 for the DD, DI, and II genotypes, respectively, agree with the frequencies predicted by Hardy–Weinberg equilibrium (chi-square = 0.946; P = 0.62). The frequencies of 0.553 and 0.447, respectively, for the D and I alleles and frequencies of 0.300, 0.506, and 0.194 for the DD, DI, and II genotypes, respectively, in the subgroup that included only 1 member from each nuclear family (1717 subjects) did not materially affect the results, corresponded with maximum-likelihood estimates of allele frequencies43 (0.543 and 0.457 for D and I, respectively), and maintained the frequencies predicted by Hardy–Weinberg equilibrium.
Thirty-five alleles were observed for the HGH marker. The associated polymorphism information content (a measure ranging from 0 to 1 for the least and most informative markers, respectively) was 0.955 (0.373 for ACE).
No significant differences were found between men and women or among the three ACE-genotype groups as regards age and prevalence of ischemic heart disease, congestive heart failure, diabetes mellitus, and antihypertensive treatment. Height, weight, body-mass index, and systolic blood pressure tended to be higher in men than in women, but did not differ significantly among the ACE-genotype groups (Table 1Table 1
Characteristics of the Subjects According to ACE Genotype and Sex.).Genotype–Phenotype Associations
Subjects with the DD, DI, and II genotypes had remarkably similar mean values for left ventricular mass (Table 2Table 2
Left Ventricular Mass According to the ACE Genotype.). No statistically significant differences among genotypes were found for unadjusted or adjusted mean left ventricular mass. Whether the analyses were carried out separately for men and women, for pooled data adjusted for sex, or for subgroups classified according to body-mass index and hypertension status, and whether they were performed according to dominant, recessive, or additive modes of inheritance, the differences associated with genotype were small and considerably less than the average 27-g difference accounted for by having a body-mass index above rather than below the median or the average 18-g difference observed between hypertensive and normotensive subjects.Analysis in which left ventricular mass was included as a dichotomous variable (presence or absence of left ventricular hypertrophy) for different modes of inheritance similarly failed to reveal any effect of the ACE genotype (Table 3Table 3
Prevalence of Left Ventricular Hypertrophy According to the ACE Genotype.). Neither in the entire sample nor in any subgroup defined according to sex, body-mass index, or blood-pressure status was the ACE genotype associated with differences in the prevalence of left ventricular hypertrophy.To ensure that the inclusion of family members did not bias the results (an unlikely possibility in the absence of rare alleles and effectively of no concern if the null hypothesis is accepted), the analyses were repeated in a subgroup that included only 1 randomly chosen member from each nuclear family (1717 subjects). Almost identical results for genotype-specific and sex-specific mean values and variances of left ventricular mass were again documented, as was the absence of an association between the ACE genotype and the prevalence of left ventricular hypertrophy (data not shown).
Linkage Studies
Quantitative analysis of 759 pairs of siblings for the ACE and HGH genotypes with the use of data on left ventricular mass standardized for sex and height and both with and without adjustment for covariates (body-mass index and blood pressure) revealed regression coefficients of -0.0043 (P = 0.40) for ACE and -0.0037 (P = 0.38) for HGH. These results, which remained unchanged after the analysis was weighted for multiplex sibships,40 provided no support for the presence of linkage between the ACE gene or the ACE locus and left ventricular mass.
Discussion
Left ventricular hypertrophy is an important risk factor for cardiovascular morbidity and mortality.1-4 Rare familial forms of cardiac hypertrophy are inherited as classic mendelian traits; the molecular basis of several of them has recently been elucidated.11 More commonly, left ventricular hypertrophy has multiple causes, has a pattern of familial aggregation,6,10 and is associated with other risk factors, such as hypertension and obesity.2 The genetic underpinnings of these nonmendelian forms of left ventricular hypertrophy are obscure; however, recent observations have suggested that homozygosity for the ACE D allele may represent a marker, or risk factor, for this condition.12,44 In contrast to these reports, we found no evidence of an association of the D/I polymorphism and echocardiographically determined left ventricular mass or left ventricular hypertrophy, or for the role of any other molecular variant of the ACE gene and locus in an epidemiologically well characterized, large cross-sectional sample.
There are several explanations for the discrepancy between our findings and the earlier observations. Previous studies were limited by small samples,44 post hoc analyses of subgroups,12 the selection of control samples from patient populations,44 and suboptimal characterization of phenotypes.12 Electrocardiographic criteria for the diagnosis of left ventricular hypertrophy are notoriously insensitive as compared with echocardiographic criteria31,32,45; the high prevalence of left ventricular hypertrophy reported by Schunkert et al.12 — 19.6 percent in their overall sample (249 of 1270 subjects) and of 18.9 percent in normotensive, middle-aged men (113 of 597 subjects) — arouses concern about the methods used or selection bias (among analogous groups of subjects in the Framingham Study, the electrocardiographically determined prevalence of left ventricular hypertrophy was 4.1 percent and 2.1 percent, respectively46). A recent study using echocardiography reached conclusions identical to ours.47 Also, genetic-association studies are very sensitive to the selection of representative, genetically compatible controls, a problem often compounded by small samples. As we have recently pointed out,35 there is considerable variability in the frequency of the DD genotype among so-called controls in many smaller studies and sometimes even within a single study; in fact, Schunkert et al.12 reported a prevalence of the DD genotype among controls ranging from 17.8 percent to 29.8 percent. The large number of subjects examined in the present study reduces the likelihood of selection bias among controls, and the finding of almost identical allele and genotype frequencies in a similarly large population35 gives us considerable confidence in the reliability of our data. In an effort to replicate the subgroup in which the most striking association between the ACE genotype and left ventricular hypertrophy had previously been reported,12 we divided our sample into high- and low-risk subgroups, according to blood pressure and body-mass index, and found no such association.
As with all studies that fail to reject the null hypothesis, assessment of statistical power is important. There was excellent power to detect small differences in left ventricular mass: assuming that the D allele has a linear, additive effect on left ventricular mass, our study provided 80 percent power to detect either an overall difference in left ventricular mass (between the DD and II genotypes) of 3.24 g among all subjects or a difference of 6.20 g in men and 3.46 g in women. Likewise, if the D allele is assumed to have a recessive effect (i.e., analysis for the effect of DD vs. that of DI and II combined), there was 80 percent power to detect a difference in left ventricular mass of 4.91 g in the entire sample and of 9.46 g in men and 5.26 g in women. If the D allele was assumed to have a dominant effect (i.e., analysis for the effect of DD combined with DI vs. that of II ), there was 80 percent power to detect a difference in left ventricular mass of 5.67 g in the entire sample and of 10.94 g in men and 6.03 g in women.
Although our results show no effect of the ACE gene or locus on left ventricular mass, there is evidence in the Framingham Heart Study of its heritability.48 Correlations for left ventricular mass are two to three times higher among siblings and parent–child pairs than among second-degree relatives or unrelated pairs of spouses.48 These findings indicate the presence of familial aggregation of the trait and confirm the appropriateness of the population studied.
Unlike previous investigations focusing on the role of the ACE gene (except for one examining its role in hypertension49), ours had the opportunity to analyze the study population using genetic-linkage algorithms. This approach overcomes the main limitation of association studies with the D/I marker: inherently low specificity of a test in which the indicator is more common than the condition studied. The use of genetic-linkage algorithms eliminates concern about incomplete linkage disequilibrium between the D/I marker and a putative disease mutation, addressing the possible contribution of the gene to left ventricular hypertrophy independently of association with any particular marker allele. The two markers used for this analysis, ACE D/I and the HGH microsatellite, are complementary: the former, albeit less informative, is located directly at the gene; the latter, although much more informative, is located 1.9 cM from ACE (according to two-point linkage analysis50). The power of this analysis, on the basis of the number of pairs of siblings available, was 78.4 percent to detect a genetic effect of ACE of 20 percent on the variance of left ventricular mass, and 97.6 percent to detect a genetic effect of 30 percent or greater. Whereas quantitative analysis of pairs of siblings, by its very design, cannot be used to exclude linkage positively, our failure to detect it in a sample as large as the one examined, and with the use of two complementary polymorphic markers, suggests that no major gene effects are attributable to the ACE or HGH genes or loci, although this conclusion must be drawn with caution.
We recognize that M-mode echocardiography for the determination of left ventricular mass is valid only if the geometric assumptions of the model are fulfilled. Since fewer than 4 percent of all subjects had congestive heart failure or coronary heart disease, the magnitude of this potential limitation is small. The sample examined is representative of the ambulatory, noninstitutionalized Framingham Heart Study population. Exclusion of a less healthy group of patients from the analysis (persons who had undergone echocardiography but for whom, because of death or failure to attend the subsequent examination cycle, DNA samples were not available) could have potentially biased our results. However, only if we postulate that the effects of the ACE genotype on left ventricular hypertrophy were exclusively manifest and quite pronounced in this group, would this have affected the overall results of the study (by extrapolation) — an unlikely possibility given the observed similar odds ratios for left ventricular hypertrophy associated with the ACE genotype regardless of conventional risk factors, and contrary to the originally reported limitation of the purported association of the DD genotype and left ventricular hypertrophy to young, normotensive men. The exclusion of all 427 subjects who were taking antihypertensive medications or other cardiac drugs (since such drugs may have potential confounding effects) did not affect the results.
The regression of hypertensive left ventricular hypertrophy23 and the prevention of ventricular remodeling after myocardial infarction24-26 observed in patients treated with ACE inhibitors suggest that the renin–angiotensin system has an important role in the determination of cardiac mass; however, the operative mechanisms have thus far remained elusive. The present data fail to support a role of ACE (and HGH) gene mutations in determining left ventricular mass and establish that the ACE D/I polymorphism is not a useful marker to predict the risk of left ventricular hypertrophy.
Supported by a Research Career Development Award (K04-HL03138-01) from the National Heart, Lung, and Blood Institute and a Harcourt General Charitable Foundation Young Investigator's Award (to Dr. Lindpaintner), by a contract with the National Institutes of Health (N01-HC-38038), and by a Public Health Service resource grant (RR03655) from the Division of Research Resources.
We are indebted to Mr. Huang Chao for expert technical assistance.
Source Information
From the Cardiovascular Division, Department of Medicine, Brigham and Women's Hospital (K.L., M.L., M.A.P.); the Department of Cardiology, Children's Hospital (K.L.); the Divisions of Cardiology and Clinical Epidemiology, Department of Medicine, Beth Israel Hospital (D.L.); Harvard Medical School (K.L., M.L., M.A.P., D.L.); the Department of Neurology (R.H.M.) and the Divisions of Epidemiology and Preventive Medicine, Department of Medicine (M.G.L., V.S.R., D.L.), Boston University Medical School; and the Lipid Metabolism Laboratory, U.S. Department of Agriculture Human Nutrition Research Center on Aging, Tufts University School of Medicine (J.M.O., E.J.S.) — all in Boston; the Framingham Heart Study, Framingham, Mass. (M.G.L., P.W.F.W., R.S.V., D.L.); the Department of Biometry and Genetics, Louisiana State University Medical Center, New Orleans (A.F.W.); and the National Heart, Lung, and Blood Institute, Bethesda, Md. (P.W.F.W., D.L.).
Address reprint requests to Dr. Lindpaintner at the Division of Cardiovascular Diseases, Brigham and Women's Hospital, 75 Francis St., Boston, MA 02115.
- References
References
1
Kannel WB ,Gordon T ,Castelli WP ,Margolis JR . Electrocardiographic left ventricular hypertrophy and risk of coronary heart disease: the Framingham Study. Ann Intern Med 1970;72:813-822
Medline2
Levy D ,Anderson KM ,Savage DD ,Kannel WB ,Christiansen JC ,Castelli WP . Echocardiographically detected left ventricular hypertrophy: prevalence and risk factors: the Framingham Heart Study. Ann Intern Med 1988;108:7-13
Web of Science | Medline3
Levy D ,Garrison RJ ,Savage DD ,Kannel WB ,Castelli WP . Prognostic implications of echocardiographically determined left ventricular mass in the Framingham Heart Study. N Engl J Med 1990;322:1561-1566
Full Text | Web of Science | Medline4
Sullivan JM ,Vander Zwaag RV ,el-Zeky F ,Ramanathan KB ,Mirvis DM . Left ventricular hypertrophy: effect on survival. J Am Coll Cardiol 1993;22:508-513
CrossRef | Medline5
Lauer MS ,Anderson KM ,Larson MG ,Levy D . A new method for indexing left ventricular mass for differences in body size. Am J Cardiol 1994;74:487-491
CrossRef | Web of Science | Medline6
Fagard R ,Van Den Broeke C ,Bielen E ,Amery A . Maximum oxygen uptake and cardiac size and function in twins. Am J Cardiol 1987;60:1362-1367
CrossRef | Web of Science | Medline7
Landry F ,Bouchard C ,Dumesnil J . Cardiac dimension changes with endurance training: indications of a genotype dependency. JAMA 1985;254:77-80
CrossRef | Web of Science | Medline8
Harshfield GA ,Grim CE ,Hwang C ,Savage DD ,Anderson SJ . Genetic and environmental influences on echocardiographically determined left ventricular mass in black twins. Am J Hypertens 1990;3:538-543
Web of Science | Medline9
Verhaaren HA ,Schieken RM ,Mosteller M ,Hewitt JK ,Eaves LJ ,Nance WE . Bivariate genetic analysis of left ventricular mass and weight in pubertal twins (the Medical College of Virginia twin study). Am J Cardiol 1991;68:661-668
CrossRef | Web of Science | Medline10
Bielen E ,Fagard R ,Amery A . Inheritance of heart structure and physical exercise capacity: a study of left ventricular structure and exercise capacity in 7-year-old twins. Eur Heart J 1990;11:7-16
Web of Science | Medline11
Schwartz K ,Carrier L ,Guicheney P ,Komajda M . Molecular basis of familial cardiomyopathies. Circulation 1995;91:532-540
Web of Science | Medline12
Schunkert H ,Hense H-W ,Holmer SR , et al. Association between a deletion polymorphism of the angiotensin-converting-enzyme gene and left ventricular hypertrophy. N Engl J Med 1994;330:1634-1638
Full Text | Web of Science | Medline13
Rigat B ,Hubert C ,Alhenc-Gelas F ,Cambien F ,Corvol P ,Soubrier F . An insertion/deletion polymorphism in the angiotensin I-converting enzyme gene accounting for half the variance of serum enzyme levels. J Clin Invest 1990;86:1343-1346
CrossRef | Web of Science | Medline14
Tiret L ,Rigat B ,Visvikis S , et al. Evidence, from combined segregation and linkage analysis, that a variant of the angiotensin I-converting enzyme (ACE) gene controls plasma ACE levels. Am J Hum Genet 1992;51:197-205
Web of Science | Medline15
Costerousse O ,Allegrini J ,Lopez M ,Alhenc-Gelas F . Angiotensin I-converting enzyme in human circulating mononuclear cells: genetic polymorphism of expression in T-lymphocytes. Biochem J 1993;290:33-40
Web of Science | Medline16
Baker KM ,Aceto JF . Angiotensin II stimulation of protein synthesis and cell growth in chick heart cells. Am J Physiol 1990;259:H610-H618
Web of Science | Medline17
Sadoshima J ,Xu Y ,Slayter HS ,Izumo S . Autocrine release of angiotensin II mediates stretch-induced hypertrophy of cardiac myocytes in vitro. Cell 1993;75:977-984
CrossRef | Web of Science | Medline18
Baker KM ,Chernin MI ,Wixson SK ,Aceto JF . Renin-angiotensin system involvement in pressure-overload cardiac hypertrophy in rats. Am J Physiol 1990;259:H324-H332
Web of Science | Medline19
Lindpaintner K ,Lu W ,Neidermajer N , et al. Selective activation of cardiac angiotensinogen gene expression in post-infarction ventricular remodeling in the rat. J Mol Cell Cardiol 1993;25:133-143
CrossRef | Web of Science | Medline20
Hirsch AT ,Talsness CE ,Schunkert H ,Paul M ,Dzau VJ . Tissue-specific activation of cardiac angiotensin-converting enzyme in experimental heart failure. Circ Res 1991;69:475-482
Web of Science | Medline21
Fabris B ,Jackson B ,Kohzuki M ,Perich R ,Johnston CI . Increased cardiac angiotensin-converting enzyme in rats with chronic heart failure. Clin Exp Pharmacol Physiol 1990;17:309-314
CrossRef | Web of Science | Medline22
Pfeffer JM ,Pfeffer MA ,Mirsky I ,Braunwald E . Regression of left ventricular hypertrophy and prevention of left ventricular dysfunction by captopril in the spontaneously hypertensive rat. Proc Natl Acad Sci U S A 1982;79:3310-3314
CrossRef | Web of Science | Medline23
Julien J ,Dufloux MA ,Prasquier R , et al. Effects of captopril and minoxidil on left ventricular hypertrophy in resistant hypertensive patients: a 6 month double-blind comparison. J Am Coll Cardiol 1990;16:137-142
CrossRef | Web of Science | Medline24
Pfeffer MA ,Braunwald E ,Moye LA , et al. Effect of captopril on mortality and morbidity in patients with left ventricular dysfunction after myocardial infarction: results of the Survival and Ventricular Enlargement trial. N Engl J Med 1992;327:669-677
Full Text | Web of Science | Medline25
The SOLVD Investigators
Full Text | Web of Science | Medline26
Rutherford JD ,Pfeffer MA ,Moye LA , et al. Effects of captopril on ischemic events after myocardial infarction: results of the Survival and Ventricular Enlargement trial. Circulation 1994;90:1731-1738
Web of Science | Medline27
Dawber TR ,Meadors GF ,Moore FE Jr . Epidemiological approaches to heart disease: the Framingham Study. Am J Public Health 1951;41:279-286
CrossRef | Web of Science28
Kannel WB ,Feinleib M ,McNamara PM ,Garrison RJ ,Castelli WP . An investigation of coronary heart disease in families: the Framingham offspring study. Am J Epidemiol 1979;110:281-290
Web of Science | Medline29
Shurtleff D. Some characteristics related to the incidence of cardiovascular disease and death: Framingham Study, 18 year follow-up. In: Kannel WB, Gordon T, eds. The Framingham Study: an epidemiological investigation of cardiovascular disease. Sect. 30. Washington, D.C.: Government Printing Office, 1974. (NIH publication no. 74-599.)
30
Levy D ,Savage DD ,Garrison RJ ,Anderson KM ,Kannel WB ,Castelli WP . Echocardiographic criteria for left ventricular hypertrophy: the Framingham Heart Study. Am J Cardiol 1987;59:956-960
CrossRef | Web of Science | Medline31
Sahn DJ ,DeMaria A ,Kisslo J ,Weyman A . Recommendations regarding quantitation in M-mode echocardiography: results of a survey of echocardiographic measurements. Circulation 1978;58:1072-1083
Web of Science | Medline32
Devereux RB ,Reichek N . Echocardiographic determination of left ventricular mass in man: anatomic validation of the method. Circulation 1977;55:613-618
Web of Science | Medline33
Gross-Bellard M ,Oudet P ,Chambon P . Isolation of high-molecular-weight DNA from mammalian cells. Eur J Biochem 1973;36:32-38
CrossRef | Medline34
Miller SA ,Dykes DD ,Polesky HF . A simple salting out procedure for extracting DNA from human nucleated cells. Nucleic Acids Res 1988;16:1215-1215
CrossRef | Web of Science | Medline35
Lindpaintner K ,Pfeffer MA ,Kreutz R , et al. A prospective evaluation of an angiotensin-converting-enzyme gene polymorphism and the risk of ischemic heart disease. N Engl J Med 1995;332:706-711
Full Text | Web of Science | Medline36
Jeunemaitre X ,Lifton RP ,Hunt SC ,Williams RR ,Lalouel JM . Absence of linkage between the angiotensin converting enzyme locus and human essential hypertension. Nat Genet 1992;1:72-75
CrossRef | Web of Science | Medline37
Kleinbaum DG, Kupper LL, Muller KE. Applied regression analysis and other multivariable methods. 2nd ed. Boston: PWS-Kent, 1988.
38
SAS/STAT users guide, version 6. 4th ed. Cary, N.C.: SAS Institute, 1989:891-996, 1071-126.
39
Hosmer DW Jr, Lemeshow S. Applied logistic regression. New York: John Wiley, 1989.
40
Amos CI ,Elston RC ,Wilson AF ,Bailey-Wilson JE . A more powerful robust sib-pair test of linkage for quantitative traits. Genet Epidemiol 1989;6:435-449
CrossRef | Web of Science | Medline41
Amos CI ,Elston RC . Robust methods for the detection of genetic linkage for quantitative data from pedigrees. Genet Epidemiol 1989;6:349-360[Erratum, Genet Epidemiol 1989;6:727.]
CrossRef | Web of Science | Medline42
S.A.G.E., statistical analysis for genetic epidemiology, release 2.1, SIBPAL version 2.5. New Orleans: Louisiana State University Center, 1991.
43
Boehnke M . Allele frequency estimation from data on relatives. Am J Hum Genet 1991;48:22-25
Web of Science | Medline44
Iwai N ,Ohmichi N ,Nakamura Y ,Kinoshita M . DD genotype of the angiotensin-converting enzyme gene is a risk factor for left ventricular hypertrophy. Circulation 1994;90:2622-2628
Web of Science | Medline45
Ganau A ,Devereux RB ,Pickering TG , et al. Relation of left ventricular hemodynamic load and contractile performance to left ventricular mass in hypertension. Circulation 1990;81:25-36
CrossRef | Web of Science | Medline46
Levy D ,Labib SB ,Anderson KM ,Christiansen JC ,Kannel WB ,Castelli WB . Determinants of sensitivity and specificity of electrocardiographic criteria for left ventricular hypertrophy. Circulation 1990;81:815-820
CrossRef | Web of Science | Medline47
Kupari M ,Perola M ,Koskinen P ,Virolainen J ,Karhunen PJ . Left ventricular size, mass, and function in relation to angiotensin-converting enzyme gene polymorphism in humans. Am J Physiol 1994;267:H1107-H1111
Web of Science | Medline48
Post WS, Larson MG, Myers RH, Galderisi M, Levy D. Heritability of left ventricular mass. J Am Coll Cardiol (in press). abstract.
49
Iwai N ,Inagami T . Identification of a candidate gene responsible for the high blood pressure of spontaneously hypertensive rats. J Hypertens 1992;10:1155-1157
CrossRef | Web of Science | Medline50
Lathrop GM ,Lalouel JM . Easy calculations of lod scores and genetic risks on small computers. Am J Hum Genet 1984;36:460-465
Web of Science | Medline
- Citing Articles (75)
Citing Articles
1
Sevgi Yimenicioglu, Serdar Oztuzcu, Ercan Sivasli, Mehri Igci, Yusuf Ziya Igci, Seniz Demiryürek, Esma Ozkara, Bulent Gogebakan, Ahmet Arslan, Mehmet Yavuz Coskun. (2011) ACE Gene Polymorphism in Premature Neonates with Respiratory Distress Syndrome. Genetic Testing and Molecular Biomarkers110729142036006
CrossRef2
Zudin Puthucheary, James R.A. Skipworth, Jai Rawal, Mike Loosemore, Ken Van Someren, Hugh E. Montgomery. (2011) The ACE Gene and Human Performance. Sports Medicine 41:6, 433-448
CrossRef3
Y. Jin, T. Kuznetsova, M. Bochud, T. Richart, L. Thijs, D. Cusi, R. Fagard, J. A. Staessen. (2011) Heritability of left ventricular structure and function in Caucasian families. European Journal of Echocardiography 12:4, 326-332
CrossRef4
A I Lynch, W Tang, G Shi, R B Devereux, J H Eckfeldt, D K Arnett. (2011) Epistatic effects of ACE I/D and AGT gene variants on left ventricular mass in hypertensive patients: the HyperGEN study. Journal of Human Hypertension
CrossRef5
James R. A. Skipworth, Zudin A. Puthucheary, Jai Rawal, Hugh E. Montgomery. 2011. The ACE Gene and Performance. , 195-203.
CrossRef6
Francois Alhenc-Gelas, Pierre Corvol. 2011. Molecular and Physiological Aspects of Angiotensin I Converting Enzyme. .
CrossRef7
Cho-Kai Wu, Jing-Ling Luo, Xue-Ming Wu, Chia-Ti Tsai, Jou-Wei Lin, Juey-Jen Hwang, Jiunn-Lee Lin, Chuen-Den Tseng, Fu-Tien Chiang. (2009) A propensity score-based case–control study of renin–angiotensin system gene polymorphisms and diastolic heart failure. Atherosclerosis 205:2, 497-502
CrossRef8
Donna K Arnett, Richard B Devereux, Dabeeru C Rao, Na Li, Weihong Tang, Rachel Kraemer, Steven A Claas, Joanlise M Leon, Ulrich Broeckel. (2009) Novel genetic variants contributing to left ventricular hypertrophy: the HyperGEN study. Journal of Hypertension 27:8, 1585-1593
CrossRef9
S. Zalvidea, G. Py, K. Lambert, B. Jover, M. Dauzat, D. Le Gallais. (2008) High plasmatic angiotensin-converting enzyme (ACE) activity is not correlated with training-induced left ventricular growth in ACE congenic rats. Acta Physiologica 194:2, 141-147
CrossRef10
T.-H. Lin, H.-C. Chiu, Y.-T. Lee, H.-M. Su, W.-C. Voon, H.-W. Liu, W.-T. Lai, S.-H. Sheu. (2007) Association Between Functional Polymorphisms of Renin-Angiotensin System, Left Ventricular Mass, and Geometry Over 4 Years in a Healthy Chinese Population Aged 60 Years and Older. The Journals of Gerontology Series A: Biological Sciences and Medical Sciences 62:10, 1157-1163
CrossRef11
Eyup Kulah, Ahmet Dursun, Erol Aktunc, Serefden Acikgoz, Mustafa Aydin, Murat Can, Aydn Dursun. (2007) Effects of angiotensin-converting enzyme gene polymorphism and serum vitamin D levels on ambulatory blood pressure measurement and left ventricular mass in Turkish hypertensive population. Blood Pressure Monitoring 12:4, 207-213
CrossRef12
Omer Aras, Steven A. Messina, Jamshid Shirani, William C. Eckelman, Vasken Dilsizian. (2007) The role and regulation of cardiac angiotensin-converting enzyme for noninvasive molecular imaging in heart failure. Current Cardiology Reports 9:2, 150-158
CrossRef13
Antonio Pelliccia, Paul D Thompson. (2006) The genetics of left ventricular remodeling in competitive athletes. Journal of Cardiovascular Medicine 7:4, 267-270
CrossRef14
Tatiana Tsoutsman, Lien Lam, Christopher Semsarian. (2006) GENES, CALCIUM AND MODIFYING FACTORS IN HYPERTROPHIC CARDIOMYOPATHY. Clinical and Experimental Pharmacology and Physiology 33:1-2, 139-145
CrossRef15
Gysèle S. Bleumink, Anna F.C. Schut, Miriam C.J.M. Sturkenboom, Jaap W. Deckers, Cornelia M. van Duijn, Bruno H.Ch. Stricker. (2004) Genetic polymorphisms and heart failure. Genetics in Medicine 6:6, 465-474
CrossRef16
MANINDER S. BEDI, LISA A. POSTAVA, SRINIVAS MURALI, GUY A. MACGOWAN, MICHAEL MATHIER, DENNIS M. MCNAMARA, BARRY LONDON. (2004) Interaction of Implantable Defibrillator Therapy with Angiotensin-Converting Enzyme Deletion/Insertion Polymorphism. Journal of Cardiovascular Electrophysiology 15:10, 1162-1166
CrossRef17
ANGELA YEE-MOON WANG, PHILIP KAM-TAO LI, SIU-FAI LUI, JOHN E SANDERSON. (2004) Review Article. Angiotensin converting enzyme inhibition for cardiac hypertrophy in patients with end-stage renal disease: What is the evidence?. Nephrology 9:4, 190-197
CrossRef18
Gavin Doolan, Lan Nguyen, Jessica Chung, Jodie Ingles, Christopher Semsarian. (2004) Progression of left ventricular hypertrophy and the angiotensin-converting enzyme gene polymorphism in hypertrophic cardiomyopathy. International Journal of Cardiology 96:2, 157-163
CrossRef19
Yumiko Sakka, Tetsuya Babazono, Asako Sato, Noriko Ujihara, Yasuhiko Iwamoto. (2004) ACE gene polymorphism, left ventricular geometry, and mortality in diabetic patients with end-stage renal disease. Diabetes Research and Clinical Practice 64:1, 41-49
CrossRef20
D
nes P
CrossRef21
Yuxiao FU, Tomohiro KATSUYA, Akiko MATSUO, Koichi YAMAMOTO, Hiroshi AKASAKA, Yoichi TAKAMI, Yoshio IWASHIMA, Ken SUGIMOTO, Kazuhiko ISHIKAWA, Mitsuru OHISHI, Hiromi RAKUGI, Toshio OGIHARA. (2004) Relationship of Bradykinin B2 Receptor Gene Polymorphism with Essential Hypertension and Left Ventricular Hypertrophy. Hypertension Research 27:12, 933-938
CrossRef22
L. Covolo, U. Gelatti, M. Metra, F. Donato, S. Nodari, N. Pezzali, L. Dei Cas, G. Nardi. (2003) Angiotensin-converting-enzyme gene polymorphism and heart failure: a case–control study. Biomarkers 8:5, 429-436
CrossRef23
Jop H. van Berlo, Yigal M. Pinto. (2003) Polymorphisms in the RAS and cardiac function. The International Journal of Biochemistry & Cell Biology 35:6, 932-943
CrossRef24
Angela Yee-Moon Wang, Juliana Chung-Ngor Chan, Mei Wang, Emily Poon, Siu-Fai Lui, Philip Kam-Tao Li, John Sanderson. (2003) Cardiac hypertrophy and remodeling in relation to ACE and angiotensinogen genes genotypes in Chinese dialysis patients. Kidney International 63:5, 1899-1907
CrossRef25
Marcin Gruchala, Dariusz Ciećwierz, Karolina Ochman, Bartosz Wasag, Andrzej Koprowski, Andrzej Wojtowicz, Witold Dubaniewicz, Radoslaw Targoński, Wojciech Sobiczewski, Adam Grzybowski, Piotr Romanowski, Janusz Limon, Andrzej Rynkiewicz. (2003) Left Ventricular Size, Mass and Function in Relation to Angiotensin-Converting Enzyme Gene and Angiotensin-II Type 1 Receptor Gene Polymorphisms in Patients with Coronary Artery Disease. Clinical Chemistry and Laboratory Medicine 41:4, 522-528
CrossRef26
Y.-H. Choi, J.-H. Kim, D. K. Kim, J.-W. Kim, D.-K. Kim, M. S. Lee, C. H. Kim, S. C. Park. (2003) Distributions of ACE and APOE Polymorphisms and Their Relations With Dementia Status in Korean Centenarians. The Journals of Gerontology Series A: Biological Sciences and Medical Sciences 58:3, M227-M231
CrossRef27
David W. Moskowitz. (2002) Is Angiotensin I-Converting Enzyme a "Master" Disease Gene?. Diabetes Technology & Therapeutics 4:5, 683-711
CrossRef28
Mikolaj Winnicki, Virend K. Somers, Valentina Accurso, Michal Hoffmann, Ryszard Pawlowski, Gianfranco Frigo, Pieralberto Visentin, Paolo Palatini. (2002) Alpha-Adducin Gly460Trp polymorphism, left ventricular mass and plasma renin activity. Journal of Hypertension 20:9, 1771-1777
CrossRef29
Philippe Charron, Michel Komajda. (2002) Genes and their polymorphisms in mono- and multifactorial cardiomyopathies:. Pharmacogenomics 3:3, 367-378
CrossRef30
María P. Ocaranza, Ana M. Piddo, Perla Faúndez, Sergio Lavandero, Jorge E. Jalil. (2002) Angiotensin I-converting enzyme gene polymorphism influences chronic hypertensive response in the rat Goldblatt model. Journal of Hypertension 20:3, 413-420
CrossRef31
Tianhua Niu, Xiu Chen, Xiping Xu. (2002) Angiotensin Converting Enzyme Gene Insertion/Deletion Polymorphism and Cardiovascular Disease. Drugs 62:7, 977-993
CrossRef32
F. Diet, C. Graf, N. Mahnke, G. Wassmer, H. G. Predel, I. Palma-Hohmann, R. Rost, M. Bohm. (2001) ACE and angiotensinogen gene genotypes and left ventricular mass in athletes. European Journal of Clinical Investigation 31:10, 836-842
CrossRef33
Olli A. Kajander, Markku Kupari, Markus Perola, Jarkko Pajarinen, Vesa Savolainen, Antti Penttila, Pekka J. Karhunen. (2001) Testing Genetic Susceptibility Loci for Alcoholic Heart Muscle Disease. Alcoholism: Clinical and Experimental Research 25:10, 1409-1413
CrossRef34
Jan R Ortlepp, Uwe Janssens, Frank Bleckmann, Johannes Lauscher, Sabine Merkelbach-Bruse, Peter Hanrath, Rainer Hoffmann. (2001) A chymase gene variant is associated with atherosclerosis in venous coronary artery bypass grafts. Coronary Artery Disease 12:6, 493-497
CrossRef35
Francesco P Schena, Christian D'Altri, Giuseppina Cerullo, Carlo Manno, Loreto Gesualdo. (2001) ACE gene polymorphism and IgA nephropathy: An ethnically homogeneous study and a meta-analysis. Kidney International 60:2, 732-740
CrossRef36
Guido Filler, Fang Yang, Anja Martin, Joachim Stolpe, Hans-Helmut Neumayer, Berthold Hocher. (2001) Renin angiotensin system gene polymorphisms in pediatric renal transplant recipients. Pediatric Transplantation 5:3, 166-173
CrossRef37
José C Rodrı́guez-Pérez, Francisco Rodrı́guez-Esparragón, Octavio Hernández-Perera, Aránzazu Anabitarte, Antonio Losada, Alfonso Medina, Enrique Hernández, Dolores Fiuza, Octavio Avalos, Carla Yunis, Carlos M Ferrario. (2001) Association of angiotensinogen m235t and a(-6)g gene polymorphisms with coronary heart disease with independence of essential hypertension: the procagene study. Journal of the American College of Cardiology 37:6, 1536-1542
CrossRef38
Enyioma N. OBINECHE, Philippe M. FROSSARD, Awais M. BOKHARI. (2001) An Association Study of Five Genetic Loci and Left Ventricular Hypertrophy amongst Gulf Arabs.. Hypertension Research 24:6, 635-639
CrossRef39
Roland E Schmieder, Jeanette Erdmann, Christian Delles, Johannes Jacobi, Eckart Fleck, Karl Hilgers, Vera Regitz-Zagrosek. (2001) Effect of the angiotensin II type 2-receptor gene (+1675 G/A) on left ventricular structure in humans. Journal of the American College of Cardiology 37:1, 175-182
CrossRef40
Mitsuru Ohishi, Hiromi Rakugi, Tetsuro Miki, Tomohiro Katsuya, Atsunori Okamura, Kei Kamide, Yukiko Nakata, Seiju Takami, Hiroshi Ikegami, Yoshihiro Yanagitani, Yoshikatsu Tabuchi, Yuichi Kumahara, Jitsuo Higaki, Toshio Ogihara. (2000) Deletion Polymorphism Of Angiotensin-Converting Enzyme Gene Is Associated With Postprandial Hyperglycaemia In Individuals Undergoing General Check-Up. Clinical and Experimental Pharmacology and Physiology 27:7, 483-487
CrossRef41
Sean O. Henderson, Gerhard A. Coetzee &NA;, Ronald K. Ross, Mimi C. Yu, Brian E. Henderson. (2000) Elevated Mortality Rates from Circulatory Disease in African American Men and Women of Los Angeles County, California???A Possible Genetic Susceptibility?. The American Journal of the Medical Sciences 320:1, 18-23
CrossRef42
Henry Völzke, Sabine Hertwig, Rainer Rettig. (2000) The insertion/deletion polymorphism of the angiotensin-converting enzyme gene and the risk for restenosis after PTCA. International Journal of Angiology 9:2, 82-86
CrossRef43
Roberto Pontremoli, Maura Ravera, Francesca Viazzi, Clizia Nicolella, Valeria Berruti, Giovanna Leoncini, Francesca Giacopelli, Gian Paolo Bezante, Giorgio Sacchi, Roberto Ravazzolo, Giacomo Deferrari. (2000) Genetic polymorphism of the renin-angiotensin system and organ damage in essential hypertension. Kidney International 57:2, 561-569
CrossRef44
Björn Mayer, Heribert Schunkert. (2000) ACE-Gen-Polymorphismus und kardiovaskuläre Erkrankungen. Herz 25:1, 1-6
CrossRef45
ALEŠ LINHART, KAMIL SEDLÁČEK, MARIE JÁCHYMOVÁ, ANTONÍN JINDRA, STANISLAV BERAN, VLADIMÍR VONDRÁČEK, SAMUEL HELLER, KAREL HORKÝ. (2000) Lack of Association of Angiotensin-converting Enzyme and Angiotensinogen Genes Polymorphisms with Left Ventricular Structure in Young Normotensive Men. Blood Pressure 9:1, 47-51
CrossRef46
F. Richard, C. Berr, C. Amant, N. Helbecque, P. Amouyel, A. Alpérovitch. (2000) Effect of the angiotensin I-converting enzyme I/D polymorphism on cognitive decline
. Neurobiology of Aging 21:1, 75-80
CrossRef47
A H. Jan Danser, Jaap Deinum, Arthur P.R.M. Osterop, Peter J.J. Admiraal, Maarten A.D.H. Schalekamp. (1999) Angiotensin I to angiotensin II conversion in the human forearm and leg. Effect of the angiotensin converting enzyme gene insertion/deletion polymorphism. Journal of Hypertension 17:Supplement, 1867-1872
CrossRef48
Johannes Jacobi, Karl F. Hilgers, Markus P. Schlaich, Winfried Siffert, Roland E. Schmieder. (1999) 825T allele of the G-protein β3 subunit gene (GNB3) is associated with impaired left ventricular diastolic filling in essential hypertension. Journal of Hypertension 17:10, 1457-1462
CrossRef49
Friedrich C Luft. (1999) BAD GENES, GOOD PEOPLE, ASSOCIATION, LINKAGE, LONGEVITY AND THE PREVENTION OF CARDIOVASCULAR DISEASE. Clinical and Experimental Pharmacology and Physiology 26:7, 576-579
CrossRef50
Bassam A Nassar, Jeremy Dunn, Lawrence M Title, Blair J O’Neill, Susan A Kirkland, Ekram Zayed, Iqbal R Bata, Richard C Cantrill, Jenny Johnstone, Gale I Dempsey, Meng-Hee Tan, W.Carl Breckenridge, David E Johnstone. (1999) Relation of genetic polymorphisms of apolipoprotein E, angiotensin converting enzyme, apolipoprotein B-100, and glycoprotein IIIa and early-onset coronary heart disease. Clinical Biochemistry 32:4, 275-282
CrossRef51
Gian Paolo Rossi, Krzysztof Narkiewicz, Maurizio Cesari, Mikolaj Winnicki, Justyna Bigda, Marzena Chrostowska, Radoslaw Szczech, Ryszard Pawlowski, Achille C. Pessina. (1999) Genetic determinants of plasma ACE and renin activity in young normotensive twins. Journal of Hypertension 17:5, 647-655
CrossRef52
P.C White, A Hautanen, M Kupari. (1999) Aldosterone synthase (CYP11B2) polymorphisms and cardiovascular function. The Journal of Steroid Biochemistry and Molecular Biology 69:1-6, 409-412
CrossRef53
O. Costerousse, K. Lindpaintner, M. Paul, D. Ganten, R. Kreutz. (1999) Interstrain Differences in Angiotensin I-Converting Enzyme Mrna and Activity Levels. Comparison Between Stroke-Prone Spontaneously Hypertensive Rats and Wistar-Kyoto Rats. Clinical and Experimental Hypertension 21:4, 377-393
CrossRef54
A H. Jan Danser, Frans H.M. Derkx, Hans-Werner Hense, Xavier Jeunemaître, Günter A.J. Riegger, Heribert Schunkert. (1998) Angiotensinogen (M235T) and angiotensin-converting enzyme (I/D) polymorphisms in association with plasma renin and prorenin levels. Journal of Hypertension 16:Supplement, 1879-1883
CrossRef55
Martin Pfohl, Michael Fetter, Matthias Koch, Carolin M Barth, Rüdiger Weiß, Hans U Häring. (1998) Association between angiotensin I-converting enzyme genotypes, extracranial artery stenosis, and stroke. Atherosclerosis 140:1, 161-166
CrossRef56
Giuseppe Cannella, Ernesto Paoletti, Sergio Barocci, Fabio Massarino, Roberto Delfino, Giambattista Ravera, Giovanni Di Maio, Arcangelo Nocera, Pietro Patrone, Davide Rolla. (1998) Angiotensin-converting enzyme gene polymorphism and reversibility of uremic left ventricular hypertrophy following long-term antihypertensive therapy. Kidney International 54:2, 618-626
CrossRef57
Christina Unterberg, Heinrich Kreuzer, Arnd B. Buchwald. (1998) Das Renin-Angiotensin-System bei kardiovaskulären Erkrankungen. Medizinische Klinik 93:7, 416-425
CrossRef58
Aldo Celentano, Francesco P. Mancini, Marina Crivaro, Vittorio Palmieri, Valentino De Stefano, L Aldo Ferrara, Giovanni Di Minno, Giovanni de Simone. (1998) Influence of cardiovascular risk factors on relation between angiotensin converting enzyme-gene polymorphism and blood pressure in arterial hypertension. Journal of Hypertension 16:7, 985-991
CrossRef59
Patricia Fernandez-Llama, Esteban Poch, Josep Oriola, Albert Botey, Elisabet Coll, Alejandro Darnell, Francisca Rivera, Luis Revert. (1998) Angiotensin converting enzyme gene I/D polymorphism in essential hypertension and nephroangiosclerosis. Kidney International 53:6, 1743-1747
CrossRef60
Pavel Hamet, Zdenka Pausova, Viacheslav Adarichev, Kira Adaricheva, Johanne Tremblay. (1998) Hypertension. Journal of Hypertension 16:4, 397-418
CrossRef61
Marzena Chrostowska, Krzysztof Narkiewicz, Justyna Bigda, Mikolaj Winnicki, Ryszard Pawlowski, Gian Paolo Rossi, Barbara Krupa-wojciechowska. (1998) Ambulatory Systolic Blood Pressure is Related to the Deletion Allele of the Angiotensin I Converting Enzyme Gene in Young Normotensives with Parental History of Hypertension. Clinical and Experimental Hypertension 20:3, 283-294
CrossRef62
Heribert Schunkert. (1998) Molecular Genetics of Congestive Heart Failure. Scandinavian Cardiovascular Journal 32:47, 37-43
CrossRef63
Jan A. Staessen, Ji G. Wang, Giuliana Ginocchio, Victor Petrov, Arturo P. Saavedra, Florent Soubrier, Robert Vlietinck, Robert Fagard. (1997) The deletion/insertion polymorphism of the angiotensin converting enzyme gene and cardiovascular-renal risk. Journal of Hypertension 15:12, 1579-1592
CrossRef64
T. Matsusaka, I. Ichikawa. (1997) BIOLOGICAL FUNCTIONS OF ANGIOTENSIN AND ITS RECEPTORS. Annual Review of Physiology 59:1, 395-412
CrossRef65
Peter B.M. Clarkson, Neeraj Prasad, Catherine MacLeod, Brian Burchell, Thomas M. MacDonald. (1997) Influence of the angiotensin converting enzyme I/D gene polymorphisms on left ventricular diastolic filling in patients with essential hypertension. Journal of Hypertension 15:9, 995-1000
CrossRef66
David-Alexandre Trégouët, Pierre Ducimetiere, Laurence Tiret. (1997) Testing Association between Candidate-Gene Markers and Phenotype in Related Individuals, by Use of Estimating Equations. The American Journal of Human Genetics 61:1, 189-199
CrossRef67
Kr\[zstrok]ys\[zstrok]tof Strojek, Władysław Grzeszczak, Ewa Morawin, Miroslaw Adamski, Beata Lacka, Henryk Rudzki, Susanne Schmidt, Christine Keller, Eberhard Ritz. (1997) Nephropathy of type II diabetes: Evidence for hereditary factors?. Kidney International 51:5, 1602-1607
CrossRef68
Shinji Tamaki, Naoharu Iwai, Nobuyuki Ohmichi, Hitoshi Shimoike, Masafumi Izumi, Yasuyuki Nakamura, Masahiko Kinoshita, Kazuhiko Katsuyama, Takaaki Sugita, Shouji Watarida, Atsumi Mori. (1997) EFFECT OF GENOTYPE ON THE ANGIOTENSIN-CONVERTING ENZYME mRNA LEVEL IN HUMAN ATRIA. Clinical and Experimental Pharmacology and Physiology 24:5, 305-308
CrossRef69
Ian G. Chadwick, Laurence O'Toole, Alyn H. Morice, Wilfred W. Yeo, Peter R. Jackson, Lawrence E. Ramsay. (1997) Pressor and Hormonal Responses to Angiotensin I Infusion in Healthy Subjects of Different Angiotensin-Converting Enzyme Genotypes. Journal of Cardiovascular Pharmacology 29:4, 485-489
CrossRef70
Ken C. Chiu, Jennifer E. McCarthy. (1997) The insertion allele at the angiotensin I—Converting enzyme gene locus is associated with insulin resistance. Metabolism 46:4, 395-399
CrossRef71
P. M. Frossard, E. N. Obineche, Y. I. Elshahat, G. G. Lestringant. (1997) Deletion polymorphism in the angiotensin-converting enzyme gene is not associated with hypertension in a Gulf Arab population. Clinical Genetics 51:3, 211-213
CrossRef72
Francesco Perticone, Roberto Ceravolo, Carmela Cosco, Maria Trapasso, Adriana Zingone, Paola Malatesta, Nicola Perrotti, Donatella Tramontano, Pier L Mattioli. (1997) Deletion Polymorphism of Angiotensin-Converting Enzyme Gene and Left Ventricular Hypertrophy in Southern Italian Patients. Journal of the American College of Cardiology 29:2, 365-369
CrossRef73
Walter Friedl, Franz Krempler, Friedrich Sandhofer, Bernhard Paulweber. (1996) Insertion/deletion polymorphism in the angiotensin-converting-enzyme gene and blood pressure during ergometry in normal males. Clinical Genetics 50:6, 541-544
CrossRef74
(1996) Absence of Association or Genetic Linkage between the Angiotensin-Converting–Enzyme Gene and Left Ventricular Mass. New England Journal of Medicine 335:14, 1070-1071
Full Text75
Hiroaki Yoshida, Valentina Kon, Iekuni Ichikawa. (1996) Polymorphisms of the renin-angiotensin system genes in progressive renal diseases. Kidney International 50:3, 732-744
CrossRef
- Letters
