Original Article
Coexistence of Hereditary Homocystinuria and Factor V Leiden — Effect on Thrombosis
N Engl J Med 1996; 334:763-768March 21, 1996
- Abstract
Background
Venous and arterial thromboembolism occurs in only about one third of patients homozygous for homocystinuria, which suggests that other, contributory factors are necessary for the development of thrombosis in these patients. Factor V Leiden, an R506Q mutation in the gene coding for factor V, is the most common cause of familial thrombosis and could be a potentiating factor.
Methods
We determined activated partial-thromboplastin times in the presence and absence of activated protein C and tested for the factor V Leiden mutation in 45 members of seven unrelated consanguineous kindreds in which at least 1 member was homozygous for homocystinuria.
Results
Thrombosis (venous, arterial, or both) occurred in 6 of 11 patients with homocystinuria (age, 0.2 to 8 years). All six also had the factor V Leiden mutation. One patient with prenatally diagnosed homocystinuria who was also heterozygous for factor V Leiden has received warfarin therapy since birth and has not had thrombosis (age, 18 months). Of four patients with homocystinuria who did not have factor V Leiden, none had thrombosis (ages at this writing, 1 to 17 years). Three women who were heterozygous for both homocystinuria and factor V Leiden had recurrent fetal loss and placental infarctions.
Conclusions
Patients with concurrent homocystinuria and factor V Leiden can have an increased risk of thrombosis. Screening for factor V Leiden may be indicated in patients with homocystinuria and their family members.
Media in This Article
Figure 1
Pedigrees of Seven Families with Homocystinuria in Which the Factor V Leiden Mutation Was Studied.Table 1
Clinical and Laboratory Data on 11 Patients with Homozygous Homocystinuria.Article Activity
- Article
Homocystinuria is caused by deficient activity of one of several enzymes in methionine metabolism, either as a primary defect or as a result of defects in the cytosolic metabolism of cobalamin.1-4 Hyperhomocysteinemia can also be due to a deficiency of vitamin B6, folate, or vitamin B12.5,6 The major clinical features of patients homozygous for homocystinuria are mental retardation, ectopia lentis, skeletal abnormalities, and life-threatening thromboembolic events.2,3 It is intriguing that thrombosis develops in only about one third of patients with homocystinuria; the reason for this variability, which is found even among siblings, is unknown.7 The thrombotic episodes, which are likely to occur before the age of 30, include deep-vein thrombosis, pulmonary embolism, and arterial thrombosis involving in particular cerebral, peripheral, and coronary vessels.2,7
Hereditary resistance to activated protein C is currently regarded as the most frequent cause of familial thrombosis.8 Activated protein C is an important physiologic anticoagulant. Generated from protein C on the surface of endothelial cells by the action of thrombomodulin-modified thrombin, it inactivates factors VIIIa and Va.9 Most cases of resistance to activated protein C stem from a missense mutation in the gene coding for factor V, in which adenine replaces guanine at nucleotide 1691 (G1691A). This change leads to the substitution of glutamine for arginine at position 506 (R506Q), thereby altering the first cleavage site involved in the activation of factor V.10,11 This mutation, also designated factor V Leiden, has been found in 30 to 60 percent of cases of familial thrombophilia in patients of various ethnic origins and in 3 to 7 percent of healthy people in two white populations.8,12 Although the risk of thrombosis increases by a factor of 50 to 100 among persons homozygous for factor V Leiden and by a factor of 5 to 10 among heterozygotes,8,13 many people with the mutant gene may not have signs of thrombosis unless they also have another genetic defect, such as a deficiency of protein C or protein S,14,15 or unless they are exposed to additional precipitating factors, such as oral contraceptives, pregnancy, or surgery.8,16
We investigated whether the coexistence of additional genetic defects or acquired conditions affected the expression of thrombosis in patients with homocystinuria.
Methods
Family Studies
The study population comprised 45 members of seven unrelated Israeli Arab families in which at least 1 member was homozygous for homocystinuria. Informed consent was obtained from the parents of the patients and from other adult family members. The study was approved by the Human Studies Ethics Committee of Rambam Medical Center. We constructed detailed pedigrees (Figure 1Figure 1
Pedigrees of Seven Families with Homocystinuria in Which the Factor V Leiden Mutation Was Studied.) and reviewed the medical files and autopsy reports of the patients homozygous for homocystinuria.Biochemical and Enzymatic Studies
Plasma concentrations of amino acids were determined by ion-exchange chromatography. Free and protein-bound plasma homocysteine concentrations were measured by high-performance liquid chromatography.17 Methylmalonic acid was quantitated by gas chromatography and mass spectrometry.18
Homozygosity for homocystinuria was diagnosed on the basis of clinical features, elevated plasma homocysteine levels (range, 43 to 370 μmol per liter; range in normal subjects, 6 to 19 μmol per liter), and elevated urinary homocysteine levels (150 to 520 μmol per gram of creatinine). The plasma methionine level ranged from 1.5 to 15 mg per deciliter (100 to 980 μmol per liter) in patients with cystathionine β-synthase deficiency and was reduced or normal in patients with methylenetetrahydrofolate reductase deficiency or cobalamin defects.
Human fibroblasts were obtained from skin-punch biopsy specimens from all the patients homozygous for homocystinuria. Fibroblasts were grown in Eagle minimum essential medium (Sigma chemical, St. Louis) as previously described,19 and cystathionine β-synthase deficiencies, methylenetetrahydrofolate reductase deficiencies, and cobalamin C/D defects (combined deficiencies of 5'-deoxyadenosylcobalamin and methylcobalamin) were confirmed with slight modifications of previously described methods.20-24 Similar procedures were used with amniocytes obtained by amniocentesis for prenatal diagnosis.
Measurements of Coagulation
Samples of whole blood (4.5 ml) were collected in Vacutainer tubes containing 0.5 ml of 0.12 M sodium citrate and were centrifuged at 2000 × g for 20 minutes to obtain platelet-poor plasma, which was kept frozen at -70°C until it was tested. The normal values for each test were defined as ranging from -2 SD to +2 SD of the mean value in 20 normal subjects. Protein C antigen was determined by enzyme immunoassay with a protein C kit (Asserachrom, Stago, Asnières, France; normal range, 60 to 136 units per deciliter). Protein C activity was determined by a chromogenic method with a protein C kit (Stachrom, Stago). The assay was calibrated with a calibration plasma (Instrumentation Laboratory, Milan, Italy; normal range, 78 to 146 units per deciliter). Antithrombin III activity was determined by a chromogenic method (Antithrombin III Asserachrom kit, Stago; normal range, 78 to 128 units per deciliter). Total protein S antigen was determined with the Asseraplate Protein kit (Stago; normal range, 70 to 130 units per deciliter). Free protein S was determined by electroimmunoassay of the plasma supernatants after precipitation with polyethylene glycol (Sigma 5000, 25 percent; normal range, 65 to 130 units per deciliter).
Assay for Resistance to Activated Protein C
Resistance to activated protein C was measured by determining the activated partial-thromboplastin times in the absence and presence of activated protein C (Coatest activated protein C resistance kit, Chromogenix, Molndal, Sweden). The results were expressed as the ratio of the two values. Plasma samples from 33 normal subjects were tested, and the mean (±2 SD) ratio was found to be 2.7±0.4. A ratio of less than 2.1 but not less than 1.6 was considered suggestive of heterozygosity for factor V Leiden, and a ratio of less than 1.6 was considered consistent with homozygosity.
Detection of the R506Q Mutation of the Factor V Gene
Blood samples were collected in EDTA, and genomic DNA was prepared by standard techniques. A 206-base-pair (bp) DNA fragment of the factor V gene that includes nucleotide 1691 was amplified by the polymerase chain reaction (PCR) with the forward primer 5'CATACTACAGTGACGTGGAC3' and the reverse primer 5'TGTTCTCTTGAAGGAAATGC3'. Digestion of this 206-bp fragment by MnlI yielded three fragments (47, 36, and 123 bp) in the normal allele, and two fragments (47 and 159 bp) in the mutant allele. The PCR was carried out in 25 μl of reaction mixture consisting of buffer (10 mM Tris–hydrochloric acid [ph 9.0], 50 mM potassium chloride, 1.5 mM magnesium chloride, 0.1 percent Triton X-100, and 0.2 mg of bovine serum albumin per milliliter), 0.2 nM of each nucleoside triphosphate, 250 nM of each primer, 100 to 200 ng of the DNA sample, and 0.125 μl of Taq polymerase (Appligene, Illkirch, France). The PCR was performed in 30 cycles consisting of 30 seconds at 94°C, 120 seconds at 63°C, and 180 seconds at 72°C. Eight microliters of the 206-bp amplified DNA product was digested with 1 μU of MnlI (New England Biolabs, Beverly, Mass.) at 37°C for three hours. Then the sample was subjected to electrophoresis on 4 percent NuSieve agarose gels (FMC, Rockland, Me.), and the fragments were visualized with ethidium bromide.
Results
The pedigrees of the seven highly consanguineous families with homocystinuria are shown in Figure 1, which indicates the observed or inferred genotypes for homocystinuria and factor V Leiden, as well as other genetic disorders.
Case Histories
Family 1
Subject VI-1 from Family 1 presented at the age of three weeks with severe hypotonia and a bulging fontanelle. The presence of arterial and venous thrombosis and hydrocephalus was later determined on a computed tomographic (CT) scan of the brain and was confirmed at autopsy five months thereafter. Homocystinuria due to a methylenetetrahydrofolate reductase deficiency was diagnosed. The patient's activated protein C resistance ratio was 1.6. The parents, who were inferred to be obligate heterozygotes for homocystinuria, were also heterozygous for factor V Leiden.
Family 2
Subject VI-7 from Family 2 was homozygous for homocystinuria because of cystathionine β-synthase deficiency. At the age of eight years, after an eye operation for dislocated optic lenses, he had deep-vein thrombosis with massive pulmonary embolism. Heparin treatment was given, followed by warfarin for six months. The patient was found to be homozygous for factor V Leiden.
Family 3
Subject V-2 from Family 3 presented at the age of four weeks with severe hypotonia and failure to thrive. CT of the brain disclosed arterial and venous thrombosis and hydrocephalus, because of which a ventriculoperitoneal shunt was inserted. This infant was homozygous for methylenetetrahydrofolate reductase deficiency and had severe psychomotor retardation, and she died at the age of two years from aspiration pneumonitis. Her father (Subject IV-1) was found to be homozygous for factor V Leiden, and her mother (Subject IV-2) to be heterozygous.
Family 4
Subject VI-2 from Family 4 presented at the age of five years with dislocation of the optic lenses and was found to be homozygous for homocystinuria because of cystathionine β-synthase deficiency. At the age of 10, a markedly reduced plasma cobalamin level was also found. A defect of cobalamin absorption not corrected by the provision of the normal human intrinsic factor was suggestive of the Imerslund–Graesback syndrome.25 His elevated plasma homocysteine levels were not substantially altered by monthly injections of cobalamin. This child, who had both homocystinuria and selective vitamin B12 malabsorption, was not found to have the factor V Leiden mutation and remained free of any evidence of thrombosis at the age of 14. He is mildly retarded.
Family 5
Subjects IV-5 and IV-6 from Family 5 both presented with bilateral dislocation of the optic lenses and developmental delay at the age of five years. They were found to be homozygous for homocystinuria because of cystathionine β-synthase deficiency. At the age of 17, Subject IV-5 was found not to have factor V Leiden and has not had any thrombosis. In contrast, Subject IV-6, who was heterozygous for factor V Leiden, presented at the age of six years with left hemiparesis and in the ensuing years had three episodes of deep-vein thrombosis. At the age of 15, she was blind, severely retarded, and bedridden.
Family 6
Subject V-2 from Family 6 had generalized hypotonia and vomiting, beginning in the first week of life. At the age of three weeks, he was admitted to the hospital with hypothermia and seizures. Laboratory studies revealed pancytopenia, macrocytosis (mean corpuscular volume, 105 μm3), and elevated plasma homocysteine and methylmalonic acid levels. The diagnosis of a cobalamin C/D defect was confirmed by study of his fibroblasts. A CT scan of the brain showed no abnormality and no evidence of vascular occlusion. This child did not carry the factor V Leiden mutation and at the age of three years had not had thrombosis. He has severe mental retardation.
Family 7
Subject IV-6 from Family 7 presented at the age of three months with a bulging fontanelle and severe hypotonia. A CT scan of the brain revealed hydrocephalus but no evidence of cerebral thrombosis. A ventriculoperitoneal shunt was inserted. The diagnosis of homozygosity for homocystinuria due to a methylenetetrahydrofolate reductase deficiency was confirmed by study of her fibroblasts. At the age of one year, the patient had only moderate developmental retardation. This infant does not carry the factor V Leiden mutation.
Association of Thrombosis, Homocystinuria, and Factor V Leiden
Table 1Table 1
Clinical and Laboratory Data on 11 Patients with Homozygous Homocystinuria. lists the clinical and laboratory features of the 11 patients homozygous for homocystinuria from these seven families. Thromboembolic manifestations were observed in six patients, of whom four had cystathionine β-synthase deficiency and presented with thrombosis at the ages of seven or eight years. The remaining two had methylenetetrahydrofolate reductase deficiencies and thrombosis in early infancy. The thrombotic manifestations were mainly venous. However, arterial thrombosis was also documented by brain CT in two patients (and in one of these also by autopsy) and was suggested in two others by the clinical presentation of acute hemiparesis. In four of the six patients with homocystinuria who had thromboses, the events occurred in association with diarrhea, dehydration, or surgery.All six patients with homocystinuria who had thromboses were homozygous or heterozygous for factor V Leiden: one (Subject VI-7 in Family 2) was a homozygote; three (Subjects VI-5 and VI-6 in Family 2 and Subject V-2 in Family 3) were offspring of fathers homozygous for factor V Leiden and heterozygous mothers and thus could be either homozygotes or heterozygotes; and two patients (Subject IV-6 in Family 5 and Subject VI-1 in Family 1) were determined to be heterozygotes. In an additional patient (Subject V-4 in Family 3), homocystinuria was diagnosed prenatally and heterozygosity for factor V Leiden was identified postnatally. This infant was treated with warfarin, betaine, and leucovorin beginning at birth, and was healthy at 18 months.
Of the remaining four patients with homocystinuria (who were 1 to 17 years old at this writing), none has had thrombosis to date, even though two of them have had extremely high plasma homocysteine levels. None was found to carry the factor V Leiden mutation.
Among the 45 people we studied in the seven families, 33 had at least one of the mutant genes — either factor V Leiden or one of the defects causing homocystinuria. As Table 2Table 2
Association between Mutated Genotypes for Homocystinuria and Factor V Leiden and the Occurrence of Thrombosis in 33 Subjects from the Seven Families Studied. shows, thrombosis occurred only in family members who had a combination of defects, with the probable exception of one patient (Subject V-3 in Family 3) who had familial microvillus inclusion disease26; in this patient, recurrent thrombosis of the large veins was induced by central venous catheterization. She did not have homocystinuria but was homozygous for factor V Leiden. Her methylenetetrahydrofolate reductase genotype was not determined.Interestingly, three women, all in Family 1, were heterozygous for both methylenetetrahydrofolate reductase deficiency and factor V Leiden and had recurrent abortions with placental infarctions. Of 25 pregnancies in these women, 9 ended in spontaneous abortion and 7 were associated with placental infarctions and led to the birth of newborns small for their gestational ages.
The values for protein C, protein S, and antithrombin III were in the normal range in 43 persons we studied. The two subjects not tested were the patients homozygous for homocystinuria in Family 2 (Subjects VI-5 and VI-6) who could be inferred to be either homozygous or heterozygous for factor V Leiden on the basis of their parents' genotypes.
Discussion
Thromboembolism, venous, arterial, or both, is a major cause of death in patients homozygous for homocystinuria.2 However, among 629 such patients described in one survey, only 158 presented with thromboembolic events.2 Our data provide evidence that one reason for the variability of thrombosis in patients with homocystinuria is the presence or absence of factor V Leiden. A remarkable finding in the families we studied was that major thrombotic events occurred only in patients homozygous for homocystinuria who were also homozygous or heterozygous for factor V Leiden.
The likelihood that additional families with these two genetic defects will be identified is not remote, in view of the relatively high allelic frequency of factor V Leiden.8,12 The high prevalence of the mutation in the families we have described is probably due to their high rates of consanguinity. The family pedigrees (Figure 1) show a clustering of various other genetic diseases, reflecting the long history of intermarriage in this population.
Several recent reports have indicated that the concurrence of factor V Leiden and other genetic defects is frequent among patients with thrombophilia. Among patients with deficient protein C, protein S, or antithrombin III activity, 15 to 26 percent also had the factor V Leiden mutation.14,15,27-29 These double defects conferred a higher risk of thrombosis than did either defect alone, and the initial presentation of thrombosis occurred at an earlier age.14,27,28
Exogenous factors, such as surgery, diarrhea, trauma, immobilization, and pregnancy, can trigger thrombosis in patients who are heterozygous for protein C, protein S, or antithrombin III deficiency,30 as well as in patients with factor V Leiden.8,31,32 We found that such environmental risk factors also increased the tendency to thrombosis among patients homozygous for homocystinuria who have factor V Leiden.
Among women who are obligate heterozygotes for homocystinuria, the incidence of fetal loss may be increased,2 and a recent report suggests that there may also be an increased perinatal mortality rate in their offspring.33 The results of tests for resistance to activated protein C in the women in these studies were not reported. In our series, three women who were heterozygous for both homocystinuria and factor V Leiden had recurrent miscarriages, low-birth-weight babies, and placental infarctions. None had elevated plasma levels of antiphospholipid antibodies.34
High concentrations of homocysteine can induce the activation of factor V in endothelial cells35 and inhibit the activation of protein C,36,37 compromising a major mechanism by which blood coagulation is controlled. The increased tendency to thrombosis in patients with the combination of homocystinuria and factor V Leiden could result from an additive adverse effect of these two defects on a common protective mechanism in the coagulation cascade.
Mild-to-moderate increases in plasma levels of homocysteine have been thought to be an independent risk factor for arterial vascular disease38-40 and recurrent venous thrombosis.41,42 However, none of the 16 obligate carriers of cystathionine β-synthase deficiency or methylenetetrahydrofolate reductase deficiency whom we studied have presented with arterial disease or venous thrombosis to date. Most of these subjects were less than 50 years old when studied, and two of them were also homozygous and two heterozygous for factor V Leiden. These observations suggest that additional contributing factors may be needed for thrombosis to occur.
Our observations, as well as those of others, imply that a search for other hereditary thrombotic disorders should be conducted in patients who are found to carry mutant genes predisposing them to thrombosis. Patients with more than one mutation should be evaluated carefully before they undergo surgical, medical, or obstetrical procedures that carry an increased thrombotic risk, since they may require regimens of appropriate prophylactic anticoagulant therapy.
Supported in part by the Joseph Elias Fund for Medical Research, Technion Faculty of Medicine, Haifa, Israel.
Source Information
From the Department of Pediatrics (H.M., M.B.) and the Thrombosis and Hemostasis Unit (B.B., N.L.), Rambam Medical Center, Technion Faculty of Medicine, Haifa, Israel; the Institute of Thrombosis and Hemostasis, Department of Hematology, Sheba Medical Center, Sackler School of Medicine, Tel Aviv University, Tel Aviv, Israel (N.R., U.S.); Department of Pediatrics, Free University Hospital, Amsterdam (C.J.); and Basel University Children's Hospital, Basel, Switzerland (B.F.).
Address reprint requests to Dr. Mandel at the Department of Pediatrics, Rambam Medical Center, Haifa 31096, Israel.
- References
References
1
Holme E ,Kjellman B ,Ronge E . Betaine for treatment of homocystinuria caused by methylenetetrahydrofolate reductase deficiency. Arch Dis Child 1989;64:1061-1064
CrossRef | Web of Science | Medline2
Mudd SH, Levy HL, Skovby F. Disorders of transsulfuration. In: Scriver CR, Beaudet AL, Sly WS, Valle DL, eds. The metabolic and molecular bases of inherited disease. 7th ed. Vol. 1. New York: McGraw-Hill, 1995:1279-327.
3
Rosenblatt DS. Inherited disorders of folate transport and metabolism. In: Scriver CR, Beaudet AL, Sly WS, Valle DL, eds. The metabolic and molecular bases of inherited disease. 7th ed. Vol. 2. New York: McGraw-Hill, 1995:3111-28.
4
Fenton WA, Rosenberg LE. Inherited disorders of cobalamin transport and metabolism. In: Scriver CR, Beaudet AL, Sly WS, Valle DL, eds. The metabolic and molecular bases of inherited disease. 7th ed. Vol. 2. New York: McGraw-Hill, 1995:3129-49.
5
Selhub J ,Jacques PF ,Wilson PW ,Rush D ,Rosenberg IH . Vitamin status and intake as primary determinants of homocysteinemia in an elderly population. JAMA 1993;270:2693-2698
CrossRef | Web of Science | Medline6
Selhub J ,Jacques PF ,Bostom AG , et al. Association between plasma homocysteine concentrations and extracranial carotid-artery stenosis. N Engl J Med 1995;332:286-291
Full Text | Web of Science | Medline7
Mudd SH ,Skovby F ,Levy HL , et al. The natural history of homocystinuria due to cystathionine β-synthase deficiency. Am J Hum Genet 1985;37:1-31
Web of Science | Medline8
Dahlback B . Inherited thrombophilia: resistance to activated protein C as a pathogenic factor of venous thromboembolism. Blood 1995;85:607-614
Web of Science | Medline9
Esmon CT . The regulation of natural anticoagulant pathways. Science 1987;235:1348-1352
CrossRef | Web of Science | Medline10
Bertina RM ,Koeleman BPC ,Koster T , et al. Mutation in blood coagulation factor V associated with resistance to activated protein C. Nature 1994;369:64-67
CrossRef | Web of Science | Medline11
Greengard JS ,Sun X ,Xu X ,Fernandez JA ,Griffin JH ,Evatt B . Activated protein C resistance caused by Arg506Gln mutation in factor Va. Lancet 1994;343:1361-1362
CrossRef | Web of Science | Medline12
Koster T ,Rosendaal FR ,de Ronde H ,Briet E ,Vandenbroucke JP ,Bertina RM . Venous thrombosis due to poor anticoagulant response to activated protein C: Leiden Thrombophilia Study. Lancet 1993;342:1503-1506
CrossRef | Web of Science | Medline13
Rosendaal FR ,Koster T ,Vandenbroucke JP ,Reitsma PH . High risk of thrombosis in patients homozygous for factor V Leiden (activated protein C resistance). Blood 1995;85:1504-1508
Web of Science | Medline14
Koeleman BPC ,Reitsma PH ,Allaart CF ,Bertina RM . Activated protein C resistance as an additional risk factor for thrombosis in protein C-deficient families. Blood 1994;84:1031-1035
Web of Science | Medline15
Koeleman BPC ,van Rumpt D ,Hamulyak K ,Reitsma PH ,Bertina RM . Factor V Leiden: an additional risk factor for thrombosis in protein S deficient families? Thromb Haemost 1995;74:580-583
Web of Science | Medline16
Vandenbroucke JP ,Koster T ,Briet E ,Reitsma PH ,Bertina RM ,Rosendaal FR . Increased risk of venous thrombosis in oral-contraceptive users who are carriers of factor V Leiden mutation. Lancet 1994;344:1453-1457
CrossRef | Web of Science | Medline17
Ubbink JB ,Vermaak WJH ,Bissbort S . Rapid high-performance liquid chromatography assay for total homocysteine levels in human serum. J Chromatogr 1991;565:441-446
CrossRef | Web of Science | Medline18
Sweetman L. Organic acid analysis. In: Hommes FA, ed. Techniques in diagnostic human biochemical genetics: a laboratory manual. New York: Wiley–Liss, 1991:143-76.
19
Rosenblatt DS ,Cooper BA ,Lue-Shing S , et al. Folate distribution in cultured human cells: studies on 5,10-CH2-H4PteGlu reductase deficiency. J Clin Invest 1979;63:1019-1025
CrossRef | Web of Science | Medline20
Uhlendorf BW ,Mudd SH . Cystathionine synthase in tissue culture derived from human skin: enzyme defect in homocystinuria. Science 1968;160:1007-1009
CrossRef | Web of Science | Medline21
Boss GR . Cobalamin inactivation decreases purine and methionine synthesis in cultured lymphoblasts. J Clin Invest 1985;76:213-218
CrossRef | Web of Science | Medline22
Rosenblatt DS ,Erbe RW . Methylenetetrahydrofolate reductase in cultured human cells. II. Genetic and biochemical studies of methylenetetrahydrofolate reductase deficiency. Pediatr Res 1977;11:1141-1143
Web of Science | Medline23
Fowler B ,Wenzel F ,Baumgartner ER . Studies of cobalamin (vitamin B12) coenzyme synthesis and cobalamin-dependent enzymes in cultured skin fibroblasts. Enzyme Protein 1994;47:180-18124
Rosenblatt DS ,Thomas IT ,Watkins D ,Cooper BA ,Erbe RW . Vitamin B12 responsive homocystinuria and megaloblastic anemia: heterogeneity in methylcobalamin deficiency. Am J Med Genet 1987;26:377-383
CrossRef | Web of Science | Medline25
Grasbeck R . Familial selective vitamin B12 malabsorption. N Engl J Med 1972;287:358-358
Web of Science | Medline26
Cutz E ,Rhoads JM ,Drumm B ,Sherman PM ,Durie PR ,Forstner GG . Microvillus inclusion disease: an inherited defect of brush-border assembly and differentiation. N Engl J Med 1989;320:646-651
Full Text | Web of Science | Medline27
Gandrille S ,Greengard JS ,Alhenc-Gelas M , et al. Incidence of activated protein C resistance caused by the ARG 506 GLN mutation in factor V in 113 unrelated symptomatic protein C-deficient patients. Blood 1995;86:219-224
Web of Science | Medline28
Zoller B ,Berntsdotter A ,de Frutos PG ,Dahlback B . Resistance to activated protein C as an additional genetic risk factor in hereditary deficiency of protein S. Blood 1995;85:3518-3523
Web of Science | Medline29
van Boven HH ,Reitsma PH ,Rosendaal FR , et al. Interaction of factor V Leiden with inherited antithrombin deficiency. Thromb Haemost 1995;73:1256-1256 abstract.
Web of Science30
Bauer KA . Management of patients with hereditary defects predisposing to thrombosis including pregnant women. Thromb Haemost 1995;74:94-100
Web of Science | Medline31
Lindblad B ,Svensson PJ ,Dahlback B . Arterial and venous thromboembolism with fatal outcome and resistance to activated protein C. Lancet 1994;343:917-917
CrossRef | Web of Science | Medline32
Greengard JS ,Eichinger S ,Griffin JH ,Bauer KA . Variability of thrombosis among homozygous siblings with resistance to activated protein C due to an Arg→Gln mutation in the gene for factor V. N Engl J Med 1994;331:1559-1562
Full Text | Web of Science | Medline33
Burke G ,Robinson K ,Refsum H ,Stuart B ,Graham I . Intrauterine growth retardation, perinatal death, and maternal homocysteine levels. N Engl J Med 1994;326:69-70
Web of Science34
Triplett DA . Antiphospholipid antibodies and recurrent pregnancy loss. Am J Reprod Immunol 1989;20:52-67
Web of Science | Medline35
Rodgers GM ,Kane WH . Activation of endogenous factor V by a homocysteine-induced vascular endothelial cell activator. J Clin Invest 1986;77:1909-1916
CrossRef | Web of Science | Medline36
Rodgers GM ,Conn MT . Homocysteine, an atherogenic stimulus, reduces protein C activation by arterial and venous endothelial cells. Blood 1990;75:895-901
Web of Science | Medline37
Lentz SR ,Sadler JE . Inhibition of thrombomodulin surface expression and protein C activation by the thrombogenic agent homocysteine. J Clin Invest 1991;88:1906-1914
CrossRef | Web of Science | Medline38
Clarke R ,Daly L ,Robinson K , et al. Hyperhomocysteinemia: an independent risk factor for vascular disease. N Engl J Med 1991;324:1149-1155
Full Text | Web of Science | Medline39
Ueland PM, Refsum H, Brattström L. Plasma homocysteine and cardiovascular disease. In: Francis RB Jr, ed. Atherosclerotic cardiovascular disease, hemostasis, and endothelial function. New York: Marcel Dekker, 1992:183-236.
40
Rees MM ,Rodgers GM . Homocysteinemia: association of a metabolic disorder with vascular disease and thrombosis. Thromb Res 1993;71:337-359
CrossRef | Web of Science | Medline41
Falcon CR ,Cattaneo M ,Panzeri D ,Martinelli I ,Mannucci PM . High prevalence of hyperhomocyst(e)inemia in patients with juvenile venous thrombosis. Arterioscler Thromb 1994;14:1080-1083
CrossRef | Medline42
Den Heijer M ,Blom HJ ,Gerrits WBJ , et al. Is hyperhomocysteinaemia a risk factor for recurrent venous thrombosis? Lancet 1995;345:882-885
CrossRef | Web of Science | Medline
- Citing Articles (85)
Citing Articles
1
Richard J. Thompson, Bernard C. Portmann, Eve A. Roberts. 2012. Genetic and metabolic liver disease. , 157-259.
CrossRef2
Richard H. White, Robert C. Gosselin. (2009) Testing for Thrombophilia: Pitfalls, Limitations, and Marginal Impact on Treatment Duration Recommendations. Mount Sinai Journal of Medicine: A Journal of Translational and Personalized Medicine 76:3, 303-313
CrossRef3
Bradley A. Maron, Joseph Loscalzo. (2009) The Treatment of Hyperhomocysteinemia. Annual Review of Medicine 60:1, 39-54
CrossRef4
SM Naushad, Md Nurul Jain Jamal, R Angalena, C Krishna Prasad, A Radha Rama Devi. (2007) Hyperhomocysteinemia and the compound heterozygous state for methylene tetrahydrofolate reductase are independent risk factors for deep vein thrombosis among South Indians. Blood Coagulation & Fibrinolysis 18:2, 113-117
CrossRef5
Emmanuel Oger, Karine Lacut, Grégoire Le Gal, Francis Couturaud, Jean-Hervé Abalain, Bernard Mercier, Dominique Mottier. (2007) Interrelation of hyperhomocysteinemia and inherited risk factors for venous thromboembolism. Results from the E.D.I.TH. study: A hospital-based case–control study. Thrombosis Research 120:2, 207-214
CrossRef6
J.D. Torres, H. Cardona, L. Álvarez, W. Cardona-Maya, S.A. Castañeda, F. Quintero-Rivera, A. Cadavid, G. Bedoya, L. Tobón. (2006) Inherited thrombophilia is associated with deep vein thrombosis in a Colombian population. American Journal of Hematology 81:12, 933-937
CrossRef7
V. Ducros, J. Rousset, K. Garambois, C. Boujet, M.O. Rolland, K. Valenti, L. Bouillet, A. Jaillard, A. Favier. (2006) Hyperhomocystéinémie sévère révélant une homocystinurie chez deux jeunes adultes présentant un phénotype peu marqué. La Revue de Médecine Interne 27:2, 140-143
CrossRef8
Marianna P.R. Porto, Luciano C. Galdieri, Vanessa G. Pereira, Naja Vergani, José Cláudio C. da Rocha, Cecília Micheletti, Ana Maria Martins, Ana Beatriz A. Perez, Vânia D`Almeida. (2005) Molecular analysis of homocystinuria in Brazilian patients. Clinica Chimica Acta 362:1-2, 71-78
CrossRef9
B. Brenner. (2005) Thrombophilia and pregnancy. Hematology 10:4, 186-189
CrossRef10
T. Angeline, Heather A. Bentley, Arnold B. Hawk, Richard J. Manners, Harsha A. Mokashi, Nirmala Jeyaraj, Gregory J. Tsongalis. (2005) Prevalence of the Factor V G1691A and the Factor II/prothrombin G20210A gene polymorphisms among Tamilians. Experimental and Molecular Pathology 79:1, 9-13
CrossRef11
Nicholas M. Brown, Victoria M. Pratt, Arlene Buller, Lisa Pike-Buchanan, Joy B. Redman, Weimin Sun, Rebecca Chen, Beryl Crossley, Matthew J. McGinniss, Franklin Quan, Charles M. Strom. (2005) Detection of 677CT/1298AC ???double variant??? chromosomes: Implications for interpretation of MTHFR genotyping results. Genetics in Medicine 7:4, 278-282
CrossRef12
Benjamin Brenner. (2005) Thrombophilia in pregnancy and its role in abortion. Women s Health 1:1, 35
CrossRef13
Ates Karateke, Berna Haliloglu, Ayse Gurbuz. (2005) Third trimester nonrecurrent fetal loss is associated with factor V Leiden and prothrombin gene mutations. Journal of Maternal-Fetal and Neonatal Medicine 18:5, 299-304
CrossRef14
Fahri U
ar, Mehmet S
CrossRef15
Martin den Heijer. (2003) Hyperhomocysteinaemia as a Risk Factor for Venous Thrombosis: An Update of the Current Evidence. Clinical Chemistry and Laboratory Medicine 41:11, 1404-1407
CrossRef16
Tina Buchholz, Christian J. Thaler. (2003) Inherited Thrombophilia: Impact on Human Reproduction. American Journal of Reproductive Immunology 50:1, 20-32
CrossRef17
Demian F Obregon, Subramanyam N Murthy, Dennis B McNamara, Vivian A Fonseca. (2003) Novel approaches to the treatment of hyperhomocysteinaemia. Expert Opinion on Therapeutic Patents 13:7, 1023-1035
CrossRef18
Emily Chan, Vivian A. Fonseca. (2003) Management of Hyperhomocysteinemia. Metabolic Syndrome and Related Disorders 1:2, 159-170
CrossRef19
Benjamin Brenner. (2003) Inherited thrombophilia and pregnancy loss. Best Practice & Research Clinical Haematology 16:2, 311-320
CrossRef20
B BRENNER, M KUPFERMINC. (2003) Inherited thrombophilia and poor pregnancy outcome. Best Practice & Research Clinical Obstetrics & Gynaecology 17:3, 427-439
CrossRef21
Stephanie L Perry, Thomas L Ortel. (2003) Clinical and laboratory evaluation of thrombophilia. Clinics in Chest Medicine 24:1, 153-170
CrossRef22
Albert W. Tsai, Mary Cushman, Michael Y. Tsai, Susan R. Heckbert, Wayne D. Rosamond, Nena Aleksic, N. David Yanez, Bruce M. Psaty, Aaron R. Folsom. (2003) Serum homocysteine, thermolabile variant of methylene tetrahydrofolate reductase (MTHFR), and venous thromboembolism: Longitudinal investigation of thromboembolism etiology (LITE). American Journal of Hematology 72:3, 192-200
CrossRef23
N. F. Dowling, H. Austin, A. Dilley, C. Whitsett, B. L. Evatt, W. C. Hooper. (2003) The epidemiology of venous thromboembolism in Caucasians and African-Americans: the GATE Study1. Journal of Thrombosis and Haemostasis 1:1, 80-87
CrossRef24
Benjamin Brenner. (2002) Thrombophilia and pregnancy loss. Thrombosis Research 108:4, 197-202
CrossRef25
Mette Gaustadnes, Bridget Wilcken, Jana Oliveriusova, Jim McGill, Janice Fletcher, Jan P. Kraus, David E. Wilcken. (2002) The molecular basis of cystathionine ?-synthase deficiency in Australian patients: Genotype-phenotype correlations and response to treatment. Human Mutation 20:2, 117-126
CrossRef26
B Simorre, I Quéré, G Berrut, J.F Chassé, H Bellet, P Kamoun, C le Hello, J.M Saudubray, C Janbon. (2002) Les manifestations vasculaires de l’homocystinurie : étude rétrospective multicentrique. La Revue de Médecine Interne 23:3, 267-272
CrossRef27
Ryan S. Robetorye, George M. Rodgers. (2001) Update on selected inherited venous thrombotic disorders. American Journal of Hematology 68:4, 256-268
CrossRef28
Ursula Trondle1, G. Sunder-Plassmann2, H. Burgmann3, Heidi Buchmayer1, L. Kramer4, CH. Bieglmayer1, W. H. Horl2, Manuela Fodinger1. (2001) Molecular and Clinical Characterisation of Homocystinuria in Two Austrian Families with Cystathionine beta-Synthase Deficiency. Acta Medica Austriaca 28:5, 145-151
CrossRef29
C. Holzman, B. Bullen, R. Fisher, N. Paneth, L. Reuss, . (2001) Pregnancy outcomes and community health: the POUCH study of preterm birth. Paediatric and Perinatal Epidemiology 15:s2, 136-158
CrossRef30
Douglas R. Linfert, Gregory J. Tsongalis. (2001) Coexistence of the Methylenetetrahydrofolate Reductase Single-Nucleotide Polymorphism (C677T) in Patients With the Factor V Leiden or Prothrombin G20210A Polymorphisms. Diagnostic Molecular Pathology 10:2, 111-115
CrossRef31
Anne B. Guttormsen, Per M. Ueland, Warren D. Kruger, Cecilia E. Kim, Leiv Ose, Ivar F
CrossRef32
Mara Prengler, Natalie Sturt, Steve Krywawych, Robert Surtees, Raina Liesner, Fenella Kirkham. (2001) Homozygous thermolabile variant of the methylenetetrahy-drofolate reductase gene: a potential risk factor for hyperhomo-cysteinaemia, CVD, and stroke in childhood. Developmental Medicine & Child Neurology 43:4, 220-225
CrossRef33
Wayne W. Grody, John H. Griffin, Annette K. Taylor, Bruce R. Korf, John A. Heit. (2001) American College of Medical Genetics Consensus Statement on Factor V Leiden Mutation Testing. Genetics in Medicine 3:2, 139-148
CrossRef34
Birgitte H. Bendixen, Jerahme Posner, Richard Lango. (2001) Stroke in young adults and children. Current Neurology and Neuroscience Reports 1:1, 54-66
CrossRef35
R. Junker, Ulrike Nowak-Göttl, M. Fobker. (2001) Der Methylentetrahydrofolat-Reduktase (MTHFR) C677T- Polymorphismus und andere genetische Ursachen der Hyperhomocysteinämie bei venösen Gefäßverschlüssen. The Methyienetetrahydrofolate-reductase (MTHFR) C677T-Polymorphism and Other Genetic Causes of Hyperhomocysteinemia in Venous Thrombosis. LaboratoriumsMedizin 25:7-8, 239-253
CrossRef36
Mary E. Keebler, Cyrus Souza, Vivian Fonseca. (2001) Diagnosis and treatment of hyperhomocysteinemia. Current Atherosclerosis Reports 3:1, 54-63
CrossRef37
Benjamin Brenner. (2000) Inherited thrombophilia and fetal loss. Current Opinion in Hematology 7:5, 290-295
CrossRef38
Guiseppe Cella, Alberto Burlina, Alessandra Sbarai, Giovanna Motta, Antonio Girolami, Mauro Berrettini, William Strauss. (2000) Tissue Factor Pathway Inhibitor Levels in Patients with Homocystinuria. Thrombosis Research 98:5, 375-381
CrossRef39
John C. Wood, Sunita Maheshwari, William E. Hellenbrand. (2000) Pulmonary thrombosis, homocysteinemia, and reperfusion edema in an adolescent. Catheterization and Cardiovascular Interventions 50:1, 59-62
CrossRef40
T.B. Larsen, B. Nørgaard-Pedersen, J.B. Lundemose, N. Rüdiger, M. Gaustadnes, I. Brandslund. (2000) Sudden Infant Death Syndrome, Childhood Thrombosis, and Presence of Genetic Risk Factors for Thrombosis. Thrombosis Research 98:4, 233-239
CrossRef41
Ertan Yetkin, A. Riza Erbay, Selime Ayaz, Mehmet Ileri, Ahmet Yanik, Gülay Yetkin, Sengül Çehreli, Siber Göksel. (2000) Predictors of left ventricular thrombus formation in patients with anterior myocardial infarction: role of activated protein C resistance. Coronary Artery Disease 11:3, 269-272
CrossRef42
Isabelle Marie, Hervé Levesque, Véronique Lecam–Duchez, Jeanne–Yvonne– Borg, Philippe Ducrotté, C. Philippe. (2000) Mesenteric venous thrombosis revealing both factor II G20210A mutation and hyperhomocysteinemia related to pernicious anemia. Gastroenterology 118:1, 237-238
CrossRef43
O. Nygard, S. E. Vollset, H. Refsum, L. Brattstrom, P. M. Ueland. (1999) Total homocysteine and cardiovascular disease. Journal of Internal Medicine 246:5, 425-454
CrossRef44
Zeev Blumenfeld, Benjamin Brenner. (1999) Thrombophilia-associated pregnancy wastage. Fertility and Sterility 72:5, 765-774
CrossRef45
Jane M Benson, Dorothy Ellingsen, Mary A Renshaw, Amy G Resler, Bruce L Evatt, W.Craig Hooper. (1999) Multiplex Analysis of Mutations in Four Genes Using Fluorescence Scanning Technology. Thrombosis Research 96:1, 57-64
CrossRef46
Paolo Simioni. (1999) The molecular genetics of familial venous thrombosis. Best Practice & Research Clinical Haematology 12:3, 479-503
CrossRef47
Francisco F. Lopez, Joseph D. Sweeney, Abbe J. Blair, William M. Sikov. (1999) Spontaneous venous thrombosis in a young patient with combined factor V Leiden and lupus anticoagulant. American Journal of Hematology 62:1, 58-60
CrossRef48
Veronique Le Cam-Duchez, Sophie Gandrille, David Tregouet, Martine Alhenc-Gelas, Joseph Emmerich, Jean-Noel Fiessinger, Jeanne-Yvonne Borg, Martine Aiach. (1999) Influence of three potential genetic risk factors for thrombosis in 43 families carrying the factor V Arg 506 to Gln mutation. British Journal of Haematology 106:4, 889-897
CrossRef49
David J. Perry. (1999) Hyperhomocysteinaemia. Best Practice & Research Clinical Haematology 12:3, 451-477
CrossRef50
Frederick T Kraus, Viviana I Acheen. (1999) Fetal thrombotic vasculopathy in the placenta: Cerebral thrombi and infarcts, coagulopathies, and cerebral palsy. Human Pathology 30:7, 759-769
CrossRef51
E. Crétel, P. Cacoub, Z. Amoura, P. Hausfater, I. Elalamy, J. Richemond, J.C. Piette. (1999) Résistance à la protéine C activée et thrombose portale: deux nouveaux cas et revue de la littérature. La Revue de Médecine Interne 20:7, 602-606
CrossRef52
Leo A.J. Kluijtmans, Godfried H.J. Boers, Jan P. Kraus, Lambert P. W.J. van den Heuvel, Johan R.M. Cruysberg, Frans J.M. Trijbels, Henk J. Blom. (1999) The Molecular Basis of Cystathionine β-Synthase Deficiency in Dutch Patients with Homocystinuria: Effect of CBS Genotype on Biochemical and Clinical Phenotype and on Response to Treatment. The American Journal of Human Genetics 65:1, 59-67
CrossRef53
Brian M. Legere, Raed A. Dweik, Alejandro C. Arroliga. (1999) VENOUS THROMBOEMBOLISM IN THE INTENSIVE CARE UNIT. Clinics in Chest Medicine 20:2, 367-384
CrossRef54
C. P. F. Taylor, J. K. Luckit, D. J. Perry. (1999) Inherited protein C deficiency, protein S deficiency and hyperhomocysteineaemia in a patient with hereditary spherocytosis. Clinical and Laboratory Haematology 21:3, 211-214
CrossRef55
Martin Wiesholzer, Melitta Kitzwögerer, Ferdinand Harm, Gabriele Barbieri, Anna-Christine Hauser, Andreas Pribasnig, Hans Bankl, Peter Balcke. (1999) Prevalence of preterminal pulmonary thromboembolism among patients on maintenance hemodialysis treatment before and after introduction of recombinant erythropoietin. American Journal of Kidney Diseases 33:4, 702-708
CrossRef56
Ron Hoffman, Assy Nimer, Naomi Lanir, Benjamin Brenner, Yaacov Baruch. (1999) Budd-chiari syndrome associated with factor V leiden mutation: A report of 6 patients. Liver Transplantation and Surgery 5:2, 96-100
CrossRef57
A. M. Cumming, C. R. Shiach. (1999) The investigation and management of inherited thrombophilia. Clinical & Laboratory Haematology 21:2, 77-92
CrossRef58
Angel Hernanz, Angeles Plaza, Emilio MartÍn-Mola, Eugenio De Miguel. (1999) Increased plasma levels of homocysteine and other thiol compounds in rheumatoid arthritis women. Clinical Biochemistry 32:1, 65-70
CrossRef59
Gillian E. Gibson, Hongzhe Li, Mark R. Pittelkow. (1999) Homocysteinemia and livedoid vasculitis. Journal of the American Academy of Dermatology 40:2, 279-281
CrossRef60
E Cardo, J Campistol, J Caritg, S Ruiz, M A Vilaseca, F Kirkham, H J Blom. (1999) Fatal haemorrhagic infarct in an infant with homocystinuria. Developmental Medicine & Child Neurology 41:2, 132-135
CrossRef61
Esther Cardo, M.Antónia Vilaseca, Jaume Campistol, Rafael Artuch, Catrina Colomé, Mercé Pineda. (1999) Evaluation of hyperhomocysteinaemia in children with stroke. European Journal of Paediatric Neurology 3:3, 113-117
CrossRef62
Wolfgang Lalouschek, Susanne Aull, Wolfgang Serles, Peter Schnider, Christine Mannhalter, Ingrid Pabinger-Fasching, Lüder Deecke, Karl Zeiler. (1999) C677T MTHFR Mutation and Factor V Leiden Mutation in Patients with TIA/Minor Stroke. Thrombosis Research 93:2, 61-69
CrossRef63
A. Piñar, R. Saenz, J. Rebollo, M. Gomez-Parra, F. Carrasco, J. M. Herrerias, M. Jimenez-Saenz. (1998) Portal and Mesenteric Vein Thrombosis in a Patient Heterozygous for a Mutation (Arg506 → Gln) in the Factor V Gen (Factor V Leiden). Journal of Clinical Gastroenterology 27:4, 361-363
CrossRef64
Helga Refsum, Per M. Ueland. (1998) Recent data are not in conflict with homocysteine as a cardiovascular risk factor. Current Opinion in Lipidology 9:6, 533-539
CrossRef65
Elvira Grandone, Maurizio Margaglione, Donatella Colaizzo, Giovanna D’Andrea, Giuseppe Cappucci, Vincenzo Brancaccio, Giovanni Di Minno. (1998) Genetic susceptibility to pregnancy-related venous thromboembolism: Roles of factor V Leiden, prothrombin G20210A, and methylenetetrahydrofolate reductase C677T mutations. American Journal of Obstetrics and Gynecology 179:5, 1324-1328
CrossRef66
JACOB SELHUB, ARMANDO D'ANGELO. (1998) Relationship Between Homocysteine and Thrombotic Disease. The American Journal of the Medical Sciences 316:2, 129-141
CrossRef67
W. CRAIG HOOPER, BRUCE L. EVATT. (1998) The Role of Activated Protein C Resistance in the Pathogenesis of Venous Thrombosis. The American Journal of the Medical Sciences 316:2, 120-128
CrossRef68
A. Girolami, P. Simioni, L. Scarano, B. Girolami, A. Marchiori. (1998) Hemorrhagic and thrombotic disorders due to factor V deficiencies and abnormalities: an updated classification. Blood Reviews 12:1, 45-51
CrossRef69
J. Townend, J. O'Sullivan, J.T. Wilde. (1998) Hyperhomocysteinaemia and vascular disease. Blood Reviews 12:1, 23-34
CrossRef70
I Shavit, B Brenner, N Lanir, I Kassis, A Lorber, N Shehadeh. (1998) Coexistence of acquired protein S and protein C deficiency and the Arg506Gln mutation in factor Va in a child with severe thromboembolic disease. Acta Paediatrica 87:3, 349-350
CrossRef71
H. Refsum, MD, P. M. Ueland, MD, O. Nygård, MD, S. E. Vollset, MD, Dr.PH. (1998) HOMOCYSTEINE AND CARDIOVASCULAR DISEASE. Annual Review of Medicine 49:1, 31-62
CrossRef72
(1998) Review. LaboratoriumsMedizin 22:9, 472-483
CrossRef73
I. Quéréé, J.F. Chassé, E. Dupuy, E. Bellet, P. Molho-Sabatier, G. Tobelem, C. Janbon. (1998) Homocysteine, 5,10-méthylénetétrahydrofolate reductase et thrombose veineuse profonde. Enquête auprès de 120 patients en médecine interne. La Revue de Médecine Interne 19:1, 29-33
CrossRef74
Daiva Rastenyt
, Jaakko Tuomilehto, Cinzia Sarti. (1998) Genetics of stroke—a review. Journal of the Neurological Sciences 153:2, 132-145
CrossRef75
M. Cattaneo. (1997) Hyperhomocysteinemia: A risk factor for arterial and venous thrombotic disease. International Journal of Clinical & Laboratory Research 27:2-4, 139-144
CrossRef76
C.J. Glueck, Robert N. Fontaine, Arun Gupta, Mahmood Alasmi. (1997) Myocardial infarction in a 35-year-old man with homocysteinemia, high plasminogen activator inhibitor activity, and resistance to activated protein C. Metabolism 46:12, 1470-1472
CrossRef77
J. I. P. Vries, G. A. Dekker, P. C. Huijgensb, C. Jakobs, B. M. E. Blomberg, H. P. Geijn. (1997) Hyperhomocysteinaemia and protein S deficiency in complicated pregnancies. BJOG: An International Journal of Obstetrics and Gynaecology 104:11, 1248-1254
CrossRef78
Olafur Thorarensen, Stephen Ryan, Jill Hunter, Donald P. Younkin. (1997) Factor V Leiden mutation: An unrecognized cause of hemiplegic cerebral palsy, neonatal stroke, and placental thrombosis. Annals of Neurology 42:3, 372-375
CrossRef79
Allan I. Bloom, Shmuel E. Cohen, Pinchas D. Lebensart, Orit Pappo, Ahmed Eid. (1997) Unusual spontaneous hepatic vein to paraumbilical vein shunt in a patient with Budd-Chiari syndrome and cirrhosis: a case report. Liver 17:4, 210-213
CrossRef80
B. Zöller, MD, A. Hillarp, PhD, E. Berntorp, MD, B. Dahlbäck, MD. (1997) ACTIVATED PROTEIN C RESISTANCE DUE TO A COMMON FACTOR V GENE MUTATION IS A MAJOR RISK FACTOR FOR VENOUS THROMBOSIS. Annual Review of Medicine 48:1, 45-58
CrossRef81
Scott R. Florell, George M. Rodgers. (1997) Inherited thrombotic disorders: An update. American Journal of Hematology 54:1, 53-60
CrossRef82
(1997) REVIEW. Clinical Chemistry and Laboratory Medicine 35:7, 501-516
CrossRef83
(1996) Hyperhomocysteinemia as a Risk Factor for Deep-Vein Thrombosis. New England Journal of Medicine 335:13, 974-976
Full Text84
Fangyu Peng, Douglas Triplett, Linda Barna, Daryl Morrical. (1996) PULMONARY EMBOLISM AND PREMATURE LABOR IN A PATIENT WITH BOTH FACTOR V LEIDEN MUTATION AND METHYLENETETRAHYDROFOLATE REDUCTASE GENE C677T MUTATION. Thrombosis Research 83:3, 243-251
CrossRef85
(1996) Thrombophilia, Homocystinuria, and Mutation of the Factor V Gene. New England Journal of Medicine 335:4, 289-290
Full Text
- Letters
