Original Article
Transmission of Hepatitis B Virus to Multiple Patients from a Surgeon without Evidence of Inadequate Infection Control
N Engl J Med 1996; 334:549-554February 29, 1996
- Abstract
Background
Although about 1 percent of surgeons are infected with hepatitis B virus (HBV), transmission from surgeons to patients is thought to be uncommon. In July 1992, a 47-year-old woman became ill with acute hepatitis B after undergoing a thymectomy in which a thoracic-surgery resident who had had acute hepatitis B six months earlier assisted.
Methods
To determine whether the surgeon transmitted HBV to this patient and others, we conducted chart reviews, interviews, and serologic testing of thoracic-surgery patients at the two hospitals where the surgeon worked from July 1991 to July 1992. Hepatitis B surface antigen (HBsAg) subtypes and DNA sequences from the surgeon and from infected patients were determined.
Results
Of 144 susceptible patients in whose surgery the infected surgeon participated, 19 had evidence of recent HBV infection (13 percent). One of the hospitals was selected for additional study, and none of the 124 susceptible patients of the other thoracic surgeons at this hospital had evidence of recent HBV infection (relative risk, ∞; 95 percent confidence interval, 4.7 to ∞). No evidence was found for any common source of HBV other than the infected surgeon. The HBsAg subtype and the partial HBV DNA sequences from the surgeon were identical to those in the infected patients. Transmission of the infection was associated with cardiac transplantation (relative risk, 4.9; 95 percent confidence interval, 1.5 to 15.5) but not with other surgical procedures. The surgeon was positive for hepatitis B e antigen and had a high serum HBV DNA concentration (15 ng per milliliter). Our investigations identified no deficiencies in the surgeon's infection-control practices.
Conclusions
In this outbreak there was surgeon-to-patient HBV transmission despite apparent compliance with recommended infection-control practices. We could not identify any specific events that led to transmission.
Media in This Article
Figure 2
Dendrogram of Multiple-Sequence Alignment Based on Pairwise Comparisons of Sequenced PCR Products.Figure 1
Hepatitis B Virus Infections among Patients Operated on by the Infected Surgeon, According to the Dateof Surgery.Article Activity
- Article
Approximately 24 million operations are performed annually in U.S. hospitals by an estimated 133,000 surgeons.1 The Centers for Disease Control and Prevention (CDC) estimate that 1900 U.S. surgeons are chronically infected with hepatitis B virus (HBV), but reports of surgeon-to-patient transmission of the virus are uncommon.2 Transmission of HBV to patients has been associated with health care workers with highly infectious disease who were positive for hepatitis B e antigen (HBeAg) and has generally involved breaches in standard infection-control practices, although correction of these deficiencies has not always prevented additional instances of transmission.3-6 We report an outbreak of HBV infection associated with an HBV-infected thoracic-surgery resident and suggest potential mechanisms of transmission.
Methods
In July 1992, a 47-year-old woman without identified risk factors became ill with acute hepatitis B four months after undergoing a thymectomy in which a thoracic-surgery resident participated. This surgeon was found to be susceptible to HBV on testing in December 1989 before completing a general-surgery residency elsewhere. He began the thoracic-surgery residency program in July 1991 after a year of research. He was offered the hepatitis B vaccine but never received it. In January 1992, he became fatigued, and in February he had jaundice with detectable hepatitis B surface antigen (HBsAg) and IgM antibody to hepatitis B core antigen (anti-HBc). He withdrew from surgical duty until March 1992, when his symptoms resolved, and he returned to practicing surgery having had no additional tests for HBsAg or HBeAg. He was still positive for HBsAg and HBeAg in July 1992, when the index patient was identified, and was relieved of surgical duties pending an investigation.
To determine whether other patients were infected with HBV, we obtained blood specimens in September 1992 from patients operated on by the surgeon during the study period, July 1991 to July 1992. The surgeon worked at two hospitals during this period, referred to here as Hospital A and Hospital B. For specimens collected within six months after surgery, we asked susceptible patients to provide second specimens six months or more after surgery to permit the detection of later seroconversion. Chart reviews and interviews of patients or their parents were conducted with standardized forms; demographic data and information about surgical characteristics, prior HBV infection, and community risk factors for infection were recorded. Sexual and household contacts of infected patients were tested to exclude them as sources of transmission. Patients were defined as having acute HBV infection (case patients) if they were IgM anti-HBc–positive or if they were seronegative within the year before surgery or on initial testing and positive for HBsAg or anti-HBc on final testing.
Retrospective Cohort Studies
A retrospective cohort study was conducted at Hospital A to determine whether the surgeon had transmitted HBV to the index patient and possibly others. We compared the risks of infection among patients he operated on and among patients who underwent thoracic surgery without his participation from November 1991 to July 1992. Patients who had thoracic surgery without the surgeon's participation were contacted by letter and follow-up telephone call and asked to provide demographic information and serum for evaluation. This retrospective cohort study included all patients who underwent thoracic surgery during the months when the surgeon was not working at Hospital A and every third patient of other thoracic surgeons during the months when he was working there.
A second retrospective cohort study evaluated risk factors for infection among the patients the surgeon operated on at Hospital A, where data were more complete. The study period was the same as that of the first retrospective cohort study. Data regarding characteristics of operations and surgical procedures were collected with standardized forms.
Additional information was collected by informally interviewing the surgeon, operating-room personnel (thoracic-surgery fellows, attending physicians, anesthesiologists, scrub nurses, and perfusionists), and nurses in the intensive care unit. The work schedules of nurses, phlebotomists, and respiratory therapists were reviewed for possible opportunities for transmission by circulating hospital personnel. The vaccination records and the results of serologic tests for HBV of operating-room personnel were reviewed, as were records of transfusions in patients. Testing was conducted at the CDC for HBsAg and antibody to HBsAg (anti-HBs) by radioimmunoassay and for anti-HBc and IgM anti-HBc by enzyme immunoassay (Abbott Laboratories, North Chicago, Ill.). In several instances, samples were tested at local clinical laboratories. Samples with detectable HBsAg were analyzed for HBsAg subtype by enzyme immunoassay with monoclonal antibodies.7
Analysis of Serum Samples
Serum from the surgeon, from the infected patients, and from an unrelated, acutely and chronically infected convenience sample of controls from the state in which the outbreak occurred were subjected to amplification by the polymerase chain reaction (PCR) to detect HBV DNA. Twenty microliters of serum was digested with proteinase K solution for one hour at 65°C, followed by phenol–chloroform extraction and alcohol precipitation. HBV1858 (5'ACTGTTCAAGCCTCCAAGCTG3'), HBV2437 (5'TTGAGATCTTCTGCGACGCGGC3'), and 5 units of Taq polymerase were added to the precipitate for amplification (30 cycles consisting of denaturation at 95°C for 30 seconds, annealing at 55°C for 30 seconds, and extension at 72°C for 45 seconds). The samples were purified and the sequence of 160 bases in the core region was determined with use of HBV1858P8 or the ABI automated sequencer and dye terminators (Applied Biosystems, Foster City, Calif.). The sequences were analyzed with the Pileup program, which performs progressive, pairwise comparisons and plots the results in a dendrogram to indicate similarity of sequences.9
The HBV DNA concentration in the surgeon's serum was determined by dot blot hybridization10 and by PCR end-point dilution. Tenfold serum dilutions were amplified by PCR and evaluated by agarose-gel electrophoresis. The threshold of HBV DNA detectability was compared with that of similarly diluted serum containing 100 million chimpanzee-infectious particles per milliliter.
Statistical Analysis
The relative risks and 95 percent confidence intervals were calculated with the use of Epi Info11; the associations between exposures and infection were assessed by univariate and stratified analysis; and the significance of differences in proportions was assessed by the chi-square test with the Mantel–Haenszel correction for independent samples or with Fisher's exact test.
Results
Identification of Cases
The surgeon operated on 239 patients (162 at Hospital A and 77 at Hospital B) from July 1, 1991, through July 16, 1992. Twenty-eight patients died before the investigation; none had recognized evidence of hepatitis. Of the remaining 211 patients, 184 (87 percent) were available for initial serologic testing, with 170 (81 percent) tested six months or more after surgery. Of these 170, 11 reported prior HBV infection or hepatitis B vaccination and had markers consistent with their histories; they were excluded from the analysis. Nineteen patients had evidence of acute HBV infection, as indicated by the presence of IgM anti-HBc or by anti-HBc seroconversion. Fifteen additional patients had HBV serologic markers but were negative for IgM anti-HBc and had no evidence indicating the presence or absence of seroconversion; seven of these patients had other risk factors for HBV infection. For purposes of analysis, these 15 patients were assumed to have been infected before surgery. The overall attack rate was therefore 13 percent (19 of 144) among susceptible patients available for follow-up.
The 19 case patients with acute HBV infection ranged in age from 14 months to 83 years (median, 51 years). Six (32 percent) had symptoms of acute hepatitis, one of whom required hospitalization. Three of the remaining patients died of other causes. Chronic HBV infection developed in 9 of the 16 surviving case patients (56 percent); 3 of these 9 had been receiving immunosuppressive therapy, and another was two years of age.
All 19 case patients or their parents reported no other risk factors for HBV infection. Sexual and household contacts of all but three patients underwent HBV testing; none were HBsAg-positive. Of the 19 case patients, 15 had had surgery at Hospital A and 4 at Hospital B. The procedures included coronary-artery bypass surgery (eight), orthotopic heart transplantation (four), repair of congenital heart defects (four), valve replacement (one), thymectomy (one), and open-lung biopsy (one). The procedures occurred throughout the study period without apparent clustering in time (Figure 1Figure 1
Hepatitis B Virus Infections among Patients Operated on by the Infected Surgeon, According to the Dateof Surgery.), even after we controlled for the number of susceptible patients undergoing surgery each month (data not shown).Determining the Source of the Outbreak
We conducted a retrospective cohort study to determine whether patients of other surgeons at Hospital A had acute HBV infection: a sample of 280 of 510 such patients who underwent surgery from November 1991 through June 1992 was selected for evaluation, including all patients who underwent thoracic surgery at Hospital A while the HBV-infected surgeon was not working there and every third patient of other thoracic surgeons at Hospital A while he was working there. Of these patients, 259 were alive; 124 consented to be tested, were determined to be susceptible at the time of surgery, and had six-month follow-up data available (Table 1Table 1
Serologic Survey of Patients Who Underwent Thoracic Surgery at Hospital A from July 1, 1991, to July 16, 1992.). None of the 124 had evidence of recent HBV infection. This result contrasts with the 15 who had such evidence (14 percent) among the 106 patients who were operated on by the surgeon at Hospital A (Table 1) (relative risk, ∞; 95 percent confidence interval, 4.7 to ∞).The two cohorts did not differ significantly according to age, sex, race, or the distribution of procedures (data not shown), although the average duration of surgery was longer for patients operated on by the infected surgeon than for patients operated on by other surgeons (5.4 vs. 4.5 hours; P<0.001). When patients undergoing thoracic surgery who had evidence of prior, but not recent, infection were included in the analysis as case patients, the difference in infection rates for the two cohorts remained significant: 24 of the 115 patients operated on by the infected surgeon were HBV-infected (21 percent), in contrast with 7 of the 131 patients operated on by other surgeons (5.3 percent) (relative risk, 3.9; 95 percent confidence interval, 1.8 to 8.7).
Opportunities for transmission from other nosocomial exposures were investigated. Twelve of 15 case patients at Hospital A (80 percent) had received blood transfusions, all from different donors. No other surgeon, anesthesiologist, nurse, phlebotomist, or respiratory therapist had documentation of HBV infection, and none treated more than seven case patients. Transmission to patients occurred at both Hospital A and Hospital B; the surgeon was the only common factor at the two hospitals.
The HBsAg subtype from the surgeon and from 13 of the 19 case patients at both hospitals for whom subtyping could be performed was adw2. We amplified HBV DNA from the surgeon, 9 case patients, and 19 unrelated community controls (7 with acute infection and 12 with chronic infection). The sequences from the surgeon and the case patients were identical. The sequences from all but 4 of the 19 community controls were different from each other and from the sequence from the surgeon (Figure 2Figure 2
Dendrogram of Multiple-Sequence Alignment Based on Pairwise Comparisons of Sequenced PCR Products.).Evaluation of Surgery-Related Risk Factors for HBV Infection
To identify risk factors for HBV infection, we conducted a retrospective cohort analysis of the patients the surgeon operated on at Hospital A (Table 2Table 2
HBV Infection among Patients Operated on by the Infected Surgeon at Hospital A, According to Demographic and Surgical Factors.). The infection rates did not differ according to sex or age. The rate was higher among whites than in other racial groups. The infection rate was higher among patients who received blood products during surgery or who had surgery lasting 5.5 hours or longer, but these differences were not statistically significant. The surgeon's patients underwent a variety of surgical procedures, but the infection rate was increased only among patients who underwent cardiac transplantation (relative risk, 4.9; 95 percent confidence interval, 1.5 to 15.5). This association remained significant when the duration of the procedure and the use of blood products were controlled for (data not shown). The infection rates were not associated with emergency (as opposed to elective) surgery, the use of a perfusion pump or cell saver, the specific operating room, or prior sternotomy. The analysis of these associations was unchanged by the inclusion of the 15 patients with serologic markers of HBV infection but without evidence of recent seroconversion (data not shown).Additional Fact-Finding
The surgeon reported no risk factors for HBV infection and was unaware of any percutaneous exposure to blood from HBV-infected patients. He indistinctly recalled only one or two needle sticks during the period under investigation, and he reported no injuries from sternal wires or other sharp objects. He reported that he always handled sharp objects with an instrument and did not blindly palpate suture needles. Although the surgeon reportedly often applied hemostatic material to sternal incisions with his gloved hands rather than with the protection of a sponge (the usual practice of other surgeons at the two hospitals), he recalled no glove punctures from this procedure. He performed no invasive procedures on case patients in the intensive care unit or the recovery room.
Other surgical personnel attested to the surgeon's good technique. He was left-handed, which sometimes interfered with the passing of instruments or simultaneous suturing by more than one surgeon. He did not use double gloves, but after contracting hepatitis B he modified his behavior by frequently changing gloves during operations. All surgical staff members, including the surgeon, reported that blood was routinely present on their hands when they removed their gloves after an operation, whether or not visible tears were present in the gloves and regardless of the type of gloves used.
In previous years, the surgeon had had a skin irritation that resolved after he changed to the routine use of hypoallergenic latex gloves. In addition, he had periodic pain over the radial side of the index fingers that he attributed to shear forces from tying sutures.
The serum HBV DNA concentration in the surgeon just after the index patient was identified was 15 ng per milliliter. The serum was estimated by semiquantitative PCR to contain 1 billion infectious particles per milliliter.
Discussion
The infected thoracic surgeon whom we studied transmitted HBV to at least 19 patients during surgery. No patients undergoing procedures performed by other thoracic surgeons had evidence of recent infection. The timing of the infections and the absence of other identified sources of infection among the case patients were consistent with transmission from the surgeon during surgery. The infections occurred at two different hospitals without common equipment or staff members other than the surgeon. The presence of HBsAg subtype adw2 in the surgeon and in the 13 case patients in whom the subtype of the antigen could be determined is unlikely to have occurred by chance alone.12 The DNA sequences of the HBV core region from the surgeon and from all 9 case patients who could be evaluated were identical and were different from that of all but 4 of the 19 community isolates.
Although reporting of HBV infection is not complete, both outbreaks and sporadic transmission of HBV from surgeon to patient appear to be uncommon. Evidence that the risk is low is limited and includes retrospective studies involving patients of infected health care workers,13-16 two case–control studies of patients with acute hepatitis B that found no association between disease and surgical history17 (and unpublished data), and the relatively small number of reported outbreaks of HBV given the estimated pool of infected surgeons.
Outbreaks provide information about specific mechanisms of transmission of HBV from surgeon to patient. Since the early 1970s, 29 such clusters have been reported worldwide,3,5,18-24 including 9 involving thoracic surgeons.5,19,22-24 Data from these outbreaks indicate an increased risk of HBV transmission from HBeAg-positive surgeons and during particularly invasive procedures.5,21,25 Transmission during many of these outbreaks was presumed to be caused by deficiencies in infection-control measures. Although this outbreak involved a high attack rate, our investigation did not identify any breaches in infection-control practices, despite an extensive search for potential modes of transmission. Unreported or unrecalled percutaneous exposures by the surgeon or operating-room staff are unlikely to explain such a high rate of transmission.
Although this is the first reported outbreak involving a thoracic surgeon in the United States, four such outbreaks have been reported in the United Kingdom during the past decade.5,24 We found no specific features characteristic of thoracic surgery that were associated with transmission. Surgical fields are generally well visualized during thoracic surgery, and blind needle palpation is not often practiced. Thoracic surgery is, however, inherently highly invasive and of long duration, and these features have been linked to percutaneous exposure,26-28 glove failure,29-31 and HBV transmission.21 Indeed, whether caused by the duration of surgery or by specific factors such as the closure of sternotomy incisions, frequent glove punctures during thoracic surgery have been reported.26,28,31,32 In this outbreak, there was no association of HBV infection with the duration of surgery or the use of blood products (a possible indication of the invasiveness of a procedure); two case patients, in fact, underwent brief procedures requiring no blood products (a thymectomy and an open-lung biopsy). We found no associations between HBV transmission and specific procedures, with the exception of cardiac transplantation, although in relative terms these were not long or complex procedures. Perhaps the minimal infectious inoculum of HBV is lower for patients receiving immunosuppressive therapy. Some surgeons have suggested that closure of the median sternotomy incision is associated with injury, although data to support this assertion are inconclusive.31,32 In our study, the surgeon's technique of applying hemostatic material to the sternal incision without a sponge may have caused injuries that were not apparent. However, one case patient underwent an open-lung biopsy that did not involve a median sternotomy.
This outbreak may have been related more closely to factors unique to the surgeon than to factors inherent in thoracic surgery: indeed, lung biopsy is a procedure with little resemblance to most other thoracic surgical procedures. Although HBeAg-positive persons almost always have highly infectious disease, the surgeon had an especially high concentration of HBV DNA during the outbreak, which may have contributed to a high risk of transmission. The surgeon's technical skills were apparently not a factor, since operating-room personnel did not recall that he had frequent needle sticks. The hand irritation experienced by the surgeon in previous years had resolved with the use of hypoallergenic latex gloves, and there was no evidence that the surgeon had dermatitis during the outbreak. Hypoallergenic gloves are subject to the same quality standards as standard surgical gloves.
The surgeon had pain over his index fingers during prolonged suturing. Other surgeons have described similar experiences to us; we are unaware of any studies addressing this phenomenon. While participating in a one-hour simulation of suture tying,33 the surgeon acquired paper-cut–like lesions on his fingers, and HBsAg and HBV DNA were isolated from washings of his hands. Such lesions, combined with the failure of his gloves, may have allowed contamination of patients with HBV. Although gloves frequently have leaks during surgery,27,28,31,34,35 they nonetheless appear to be fairly effective barriers against certain infections, even when leaks are present.36 Although there is increasing evidence that double gloves can prevent exposure of surgeons to blood during surgery,35 there is no evidence regarding the effectiveness of double gloves in protecting patients from blood-borne infections. Furthermore, advisory groups and professional organizations have not generally recommended the use of double gloves by surgeons. Additional studies are needed to assess the validity and generalizability of the suture-tying simulation and to define the role of gloves in preventing the intraoperative transmission of HBV.
This outbreak has had tragic consequences for the case patients, their families, and the surgeon, who has left surgical practice indefinitely. The entire episode could have been prevented had the surgeon received hepatitis B vaccine.
We are indebted to Laurene Mascola, M.D., M.P.H., Michael Lim, M.P.H., Maria Rosario Araneta, Ph.D., M.P.H., Heidi Sato, M.P.H., and Alison Itano, M.S., for their assistance during this investigation; to Carlton Youngblood for performing the serologic tests; to Paul Swenson, M.D., for performing HBsAg subtyping; to Alan Redeker, M.D., for providing serum specimens from HBV-infected persons for genotype analysis; to Susan Govindarajan, M.D., for dot blot hybridization analysis of specimens from the surgeon; to J. Shaw for editorial assistance; to Miriam Alter, Ph.D., M.P.H., David Bell, M.D., Mary Chamberland, M.D., M.P.H., Walter Bond, M.S., Martin Favero, Ph.D., and Karin Lindsay, M.D., for helpful suggestions; and to the thoracic surgeon described in this report, for his cooperation and substantial contributions.
Source Information
From the Hepatitis Branch, Division of Viral and Rickettsial Diseases, National Center for Infectious Diseases, Centers for Disease Control and Prevention, Atlanta (R.H., F.M.A., S.D.S., K.K., S.B.L., B.H.R., C.N.S.); the Department of Pediatrics, University of California at Los Angeles, Los Angeles (L.V.S., J.D.C.); and the Los Angeles County Health Department, Los Angeles (M.P.T.).
Address reprint requests to Dr. Shapiro at the Hepatitis Branch, Division of Viral and Rickettsial Diseases, Centers for Disease Control and Prevention, Mailstop G-37, 1600 Clifton Rd., Atlanta, GA 30333.
- References
References
1
Hospital statistics: the AHA profile of United States hospitals: 1994-95 edition. Chicago: American Hospital Association, 1994.
2
Recommendations for preventing transmission of human immunodeficiency virus and hepatitis B virus to patients during exposure-prone invasive proceduresMMWR Morb Mortal Wkly Rep 1991;40:1-9
Medline3
Lettau LA ,Smith JD ,Williams D , et al. Transmission of hepatitis B with resultant restriction of surgical practice. JAMA 1986;255:934-937
CrossRef | Web of Science | Medline4
Rimland D ,Parkin WE ,Miller GB Jr ,Schrack WD . Hepatitis B outbreak traced to an oral surgeon. N Engl J Med 1977;296:953-958
Full Text | Web of Science | Medline5
Heptonstall J . Outbreaks of hepatitis B virus infection associated with infected surgical staff. Commun Dis Rep CDR Rev 1991;1:R81-R856
Johnstone BL ,MacDonald S ,Lee S , et al. Nosocomial hepatitis B associated with orthopedic surgery -- Nova Scotia. Can Commun Dis Rep 1992;18:89-90
Medline7
Swenson PD ,Riess JT ,Krueger LE . Determination of HBsAg subtypes in different high risk populations using monoclonal antibodies. J Virol Methods 1991;33:27-38
CrossRef | Web of Science | Medline8
Robertson BH ,Khanna B ,Nainan OV ,Margolis HS . Epidemiologic patterns of wild-type hepatitis A virus determined by genetic variation. J Infect Dis 1991;163:286-292
CrossRef | Web of Science | Medline9
Program manual for the GCG package, version 7. Madison, Wis.: Genetics Computer Group, 1991.
10
Shafritz DA ,Lieberman HM ,Isselbacher KJ ,Wands JR . Monoclonal radioimmunoassays for hepatitis B surface antigen: demonstration of hepatitis B virus DNA or related sequences in serum and viral epitopes in immune complexes. Proc Natl Acad Sci U S A 1982;79:5675-5679
CrossRef | Web of Science | Medline11
Dean AG, Dean JA, Burton AH, Dicker RC. Epi Info, version 5: a word processing, database, and statistics program for epidemiology on microcomputers. Atlanta: Centers for Disease Control, 1990.
12
Dodd RY ,Holland PV ,Ni LY ,Smith HM ,Greenwalt TJ . Hepatitis B antigen: regional variation in incidence and subtype ratio in the American Red Cross donor population. Am J Epidemiol 1973;97:111-115
Web of Science | Medline13
Meyers JD ,Stamm WE ,Kerr MM ,Counts GW . Lack of transmission of hepatitis B after surgical exposure. JAMA 1978;240:1725-1727
CrossRef | Web of Science | Medline14
LaBrecque DR ,Muhs JM ,Lutwick LI ,Woolson RF ,Hierholzer WR . The risk of hepatitis B transmission from health care workers to patients in a hospital setting -- a prospective study. Hepatology 1986;6:205-208
CrossRef | Web of Science | Medline15
Alter HJ ,Chalmers TC ,Freeman BM , et al. Health-care workers positive for hepatitis B surface antigen: are their contacts at risk? N Engl J Med 1975;292:454-457
Full Text | Web of Science | Medline16
Williams SV ,Pattison CP ,Berquist KR . Dental infection with hepatitis B. JAMA 1975;232:1231-1233
CrossRef | Web of Science | Medline17
Alter MJ ,Coleman PJ ,Alexander WJ , et al. Importance of heterosexual activity in the transmission of hepatitis B and non-A, non-B hepatitis. JAMA 1989;262:1201-1205
CrossRef | Web of Science | Medline18
Prendergrast TJ Jr ,Teitelbaum S ,Peck B . Transmission of hepatitis B by a surgeon. West J Med 1991;154:353-35319
Bell DM ,Shapiro CN ,Ciesielski CA ,Chamberland ME . Preventing bloodborne pathogen transmission from health-care workers to patients: the CDC perspective. Surg Clin North Am 1995;75:1189-1203
Web of Science | Medline20
Carl M ,Blakey DL ,Francis DP ,Maynard JE . Interruption of hepatitis B transmission by modification of a gynaecologist's surgical technique. Lancet 1982;1:731-733
CrossRef | Web of Science | Medline21
Welch J ,Webster M ,Tilzey AJ ,Noah ND ,Banatvala JE . Hepatitis B infections after gynaecological surgery. Lancet 1989;1:205-207
CrossRef | Web of Science | Medline22
Coutinho RA ,Albrecht-van Lent P ,Stoutjesdijk L , et al. Hepatitis B from doctors. Lancet 1982;1:345-346
CrossRef | Web of Science | Medline23
Haerem JW ,Siebke JC ,Ulstrup J ,Geiran O ,Helle I . HBsAg transmission from a cardiac surgeon incubating hepatitis B resulting in chronic antigenemia in four patients. Acta Med Scand 1981;210:389-392
CrossRef | Web of Science | Medline24
Prentice MB ,Flower AJE ,Morgan GM , et al. Infection with hepatitis B virus after open heart surgery. BMJ 1992;304:761-764
CrossRef | Web of Science | Medline25
Hadler SC ,Sorley DL ,Acree KH , et al. An outbreak of hepatitis B in a dental practice. Ann Intern Med 1981;95:133-138
Web of Science | Medline26
Tokars JI ,Bell DM ,Culver DH , et al. Percutaneous injuries during surgical procedures. JAMA 1992;267:2899-2904
CrossRef | Web of Science | Medline27
Gerberding JL ,Littell C ,Tarkington A ,Brown A ,Schecter WP . Risk of exposure of surgical personnel to patients' blood during surgery at San Francisco General Hospital. N Engl J Med 1990;322:1788-1793
Full Text | Web of Science | Medline28
Popejoy SL ,Fry DE . Blood contact and exposure in the operating room. Surg Gynecol Obstet 1991;172:480-483
Web of Science | Medline29
Fell N ,Hopper W ,Williams J ,Brennan L ,Wilson C ,Devlin HB . Surgical glove failure rate. Ann R Coll Surg Engl 1989;71:7-10
Web of Science | Medline30
Quebbeman EJ ,Telford GL ,Wadsworth K ,Hubbard S ,Goodman H ,Gottlieb MS . Double gloving: protecting surgeons from blood contamination in the operating room. Arch Surg 1992;127:213-217
CrossRef | Web of Science | Medline31
Wong PS ,Young VK ,Youhana A ,Wright JE . Surgical glove punctures during cardiac operations. Ann Thorac Surg 1993;56:108-110
CrossRef | Web of Science | Medline32
Pate JW . Risks of blood exposure to the cardiac surgical team. Ann Thorac Surg 1990;50:248-250
CrossRef | Web of Science | Medline33
Harpaz R ,Van Seidlein L ,Averhoff FM , et al. Transmission of hepatitis B virus from a thoracic surgeon to patients. Infect Control Hosp Epidemiol 1994;15:352-352 abstract.34
Hosie KB ,Dunning JJ ,Bailey JS ,Firmin RK . Glove perforation during sternotomy closure. Lancet 1988;2:1500-1500
CrossRef | Web of Science | Medline35
Rose DA ,Ramiro N ,Perlman J , et al. Usage patterns and perforation rates for 6306 gloves from intra-operative procedures at San Francisco General Hospital. Infect Control Hosp Epidemiol 1994;15:349-349 abstract.36
Olsen RJ ,Lynch P ,Coyle MB ,Cummings J ,Bokete T ,Stamm WE . Examination gloves as barriers to hand contamination in clinical practice. JAMA 1993;270:350-353
CrossRef | Web of Science | Medline
- Citing Articles (63)
Citing Articles
1
Yoo-Kyung Cho, Byung-Cheol Song. (2012) Prevention of Viral Hepatitis and Vaccination. Korean Journal of Medicine 82:2, 123
CrossRef2
Anna S. F. Lok, Francesco Negro. 2011. Hepatitis B and D. , 537-581.
CrossRef3
B Onder, N B Ozer, F O Onder, B Selcuk, A Kurtaran, E Yalcin, M Akyüz. (2011) Incidence of acute hepatitis B in patients with spinal cord injury. Spinal Cord
CrossRef4
Michael Foltzer, Bruce Hamory. (2011) Protecting patients from harm: Design and implementation of an institutional bloodborne pathogen protocol. American Journal of Infection Control
CrossRef5
Sarah Turkel, David K. Henderson. (2011) Current Strategies for Managing Providers Infected with Bloodborne Pathogens. Infection Control and Hospital Epidemiology 32:5, 428-434
CrossRef6
Anna S. F. Lok. 2011. Hepatitis B. , 367-392.
CrossRef7
Haruki Komatsu, Hidenori Sugawara, Ayano Inui, Kenjiro Nagamine, Eitaro Hiejima, Tsuyoshi Sogo, Tomoo Fujisawa. (2011) Does the spread of hepatitis B virus genotype A increase the risk of intrafamilial transmission in Japan?. Journal of Infection and Chemotherapy 17:2, 272-277
CrossRef8
V. A. Arankalle, S. Gandhi, K. S. Lole, M. S. Chadha, G. M. Gupte, M. U. Lokhande. (2011) An outbreak of hepatitis B with high mortality in India: association with precore, basal core promoter mutants and improperly sterilized syringes. Journal of Viral Hepatitis 18:4, e20-e28
CrossRef9
Dudzinski, Denise M., Hébert, Philip C., Foglia, Mary Beth, Gallagher, Thomas H., . (2010) The Disclosure Dilemma — Large-Scale Adverse Events. New England Journal of Medicine 363:10, 978-986
Full Text10
Arash Mohebati, John Mihran Davis, Donald E. Fry. (2010) Current Risks of Occupational Blood-Borne Viral Infection. Surgical Infections 11:3, 325-331
CrossRef11
Mark H. Wilcox, Robert C. Spencer. 2010. Healthcare-Associated Infections. .
CrossRef12
Scott D. Holmberg. (2010) Molecular Epidemiology of Health Care–Associated Transmission of Hepatitis B and C Viruses. Clinics in Liver Disease 14:1, 37-48
CrossRef13
Abigail L. Carlson, Trish M. Perl. (2010) Health Care Workers as Source of Hepatitis B and C Virus Transmission. Clinics in Liver Disease 14:1, 153-168
CrossRef14
Angela Michelin, David K. Henderson. (2010) Infection Control Guidelines for Prevention of Health Care–Associated Transmission of Hepatitis B and C Viruses. Clinics in Liver Disease 14:1, 119-136
CrossRef15
W. Ray Kim. (2009) Epidemiology of hepatitis B in the United States. Hepatology 49:S5, S28-S34
CrossRef16
(2009) HIV and AIDS in the Workplace. Journal of Occupational and Environmental Medicine 51:2, 243-250
CrossRef17
Mariko Kobayashi, Kenji Ikeda, Yasuji Arase, Fumitaka Suzuki, Norio Akuta, Tetsuya Hosaka, Hitomi Sezaki, Hiromi Yatsuji, Masahiro Kobayashi, Yoshiyuki Suzuki, Sachiyo Watahiki, Rie Mineta, Satomi Iwasaki, Yuzo Miyakawa, Hiromitsu Kumada. (2008) Change of hepatitis B virus genotypes in acute and chronic infections in Japan. Journal of Medical Virology 80:11, 1880-1884
CrossRef18
AP Manjunath, JH Shepherd, DPJ Barton, JE Bridges, TEJ Ind. (2008) Glove perforations during open surgery for gynaecological malignancies. BJOG: An International Journal of Obstetrics & Gynaecology 115:8, 1015-1019
CrossRef19
W. Ray Kim. (2007) Epidemiology of hepatitis B in the United States. Current Hepatitis Reports 6:1, 3-8
CrossRef20
Anna S. F. Lok, Brian J. McMahon. (2007) Chronic hepatitis B. Hepatology 45:2, 507-539
CrossRef21
Jean-Pierre. Bronowicki. (2006) L’infection nosocomiale par le virus de l′hépatite B : un risque à ne pas méconnaître. Gastroentérologie Clinique et Biologique 30:12, 1346-1348
CrossRef22
M CAMPINSMARTI. (2006) Actitud ante los profesionales infectados por VHB o VHC. Gastroenterología y Hepatología 29, 210-215
CrossRef23
Scott D. Halpern, David A. Asch, Abraham Shaked, Peter Stock, Emily A. Blumberg. (2006) Inadequate Hepatitis B Vaccination and Post-Exposure Evaluation Among Transplant Surgeons. Annals of Surgery 244:2, 305-309
CrossRef24
Judith Tanner, Hazel Parkinson, Judith Tanner. 2006. Double gloving to reduce surgical cross-infection. .
CrossRef25
P. Gastmeier, C. Brandt, D. Sohr, H. Rüden. (2006) Postoperative Wundinfektionen. Der Chirurg 77:6, 506-511
CrossRef26
Jane L. Perry, Richard D. Pearson, Janine Jagger. (2006) Infected health care workers and patient safety: A double standard. American Journal of Infection Control 34:5, 313-319
CrossRef27
Ramon Berguer, Paul J. Heller. (2005) Strategies for Preventing Sharps Injuries in the Operating Room. Surgical Clinics of North America 85:6, 1299-1305
CrossRef28
Donald E. Fry. (2005) Occupational blood-borne diseases in surgery. The American Journal of Surgery 190:2, 249-254
CrossRef29
A. M. Reitsma, M. L. Closen, M. Cunningham, H. N. F. Minich, J. D. Moreno, R. L. Nichols, R. D. Pearson, R. G. Sawyer, B. Wispelwey, P. M. Tereskerz, P. A. Lombardo. (2005) Infected Physicians and Invasive Procedures: Safe Practice Management. Clinical Infectious Diseases 40:11, 1665-1672
CrossRef30
G. Y. Minuk, A. J. Cohen, N. Assy, M. Moser. (2005) Viral hepatitis and the surgeon. HPB: Official Journal of The International Hepato Pancreato Biliary Association 7:1, 56-64
CrossRef31
J Tanner, H Parkinson, Judith Tanner. 2002. Double gloving to reduce surgical cross-infection. .
CrossRef32
Anne M Eklund, Juhani Ojajärvi, Kirsi Laitinen, Matti Valtonen, Kalervo A Werkkala. (2002) Glove punctures and postoperative skin flora of hands in cardiac surgery. The Annals of Thoracic Surgery 74:1, 149-153
CrossRef33
Mark Russi. (2002) HIV and AIDS in the Workplace. Journal of Occupational and Environmental Medicine 44:6, 495-502
CrossRef34
Shirley Paton, Shimian Zou, Antonio Giulivi. (2002) More Should Be Done to Protect Surgical Patients From Intraoperative Hepatitis B Infection • . Infection Control and Hospital Epidemiology 23:6, 303-305
CrossRef35
Ingrid J. B. Spijkerman, Leen‐Jan van Doorn, Maria H. W. Janssen, Clementine J. Wijkmans, Marijke A. J. Bilkert‐Mooiman, Roel A. Coutinho, Gezina Weers‐Pothoff. (2002) Transmission of Hepatitis B Virus From a Surgeon to His Patients During High‐Risk and Low‐Risk Surgical Procedures During 4 Years • . Infection Control and Hospital Epidemiology 23:6, 306-312
CrossRef36
A. Mele, G. Ippolito, A. Craxì, R.C. Coppola, N. Petrosillo, M. Piazza, V. Puro, M. Rizzetto, L. Sagliocca, G. Taliani, A. Zanetti, M. Barni, E. Bianco, E. Bollero, A. Cargnel, M. Cattaneo, M. Chiaramonte, E. Conti, R. D'Amelio, D.M. De Stefano, S. Di Giulio, E. Franco, G. Gallo, M. Levrero, E. Mannella, S. Merli, F. Milazzo, A. Moiraghi, R. Polillo, D. Prati, P. Ragni, E. Sagnelli, P. Scognamiglio, L. Sommella, T. Stroffolini, T. Terrana, G. Tosolini, E. Vitiello, L. Zanesco, V. Ziparo, C. Maffei, M.L. Moro, R. Satolli, G. Traversa. (2001) Risk management of HBsAg or anti-HCV positive healthcare workers in hospital. Digestive and Liver Disease 33:9, 795-802
CrossRef37
VINCENZO PURO, GABRIELLA CARLI, PAOLA SCOGNAMIGLIO, ROLANDO PORCASI, GIUSEPPE IPPOLITO, . (2001) Risk of HIV and Other Blood-Borne Infections in the Cardiac Setting. Annals of the New York Academy of Sciences 946:1, 291-309
CrossRef38
Wen-Je Ko, Nai-Kuan Chou, Ron-Bin Hsu, Yih-Sharng Chen, Shoei-Shen Wang, Shu-Hsun Chu, Ming-Yang Lai. (2001) Hepatitis B virus infection in heart transplant recipients in a hepatitis B endemic area. The Journal of Heart and Lung Transplantation 20:8, 865-875
CrossRef39
Paul D. Swenson, Caroline Van Geyt, E. Russell Alexander, Holly Hagan, Jayne M. Freitag-Koontz, Shari Wilson, Hel
ne Norder, Lars O. Magnius, Lieven Stuyver. (2001) Hepatitis B virus genotypes and HBsAg subtypes in refugees and injection drug users in the United States determined by LiPA and monoclonal EIA. Journal of Medical Virology 64:3, 305-311
CrossRef40
D. R. Howell, M. H. Webster, J. A. J Barbara. (2000) Retrospective follow-up of recipients and donors of blood donations reactive for anti-HBc or for single HCV antibodies. Transfusion Medicine 10:4, 265-269
CrossRef41
V.G. Bain. (2000) Hepatitis B in transplantation. Transplant Infectious Disease 2:4, 153-165
CrossRef42
F. Sugauchi, M. Mizokami, E. Orito, T. Ohno, K. Hayashi, T. Kato, Y. Tanaka, H. Kato, R. Ueda. (2000) Molecular Evolutionary Analysis of the Complete Nucleotide Sequence of Hepatitis B Virus (HBV) in a Case of HBV Infection Acquired through a Needlestick Accident. Clinical Infectious Diseases 31:5, 1195-1201
CrossRef43
N.G. Zhevachevsky, N.Yu. Nomokonova, A.B. Beklemishev, G.F. Belov. (2000) Dynamic study of HBsAg and HBeAg in saliva samples from patients with hepatitis B infection: Diagnostic and epidemiological significance. Journal of Medical Virology 61:4, 433-438
CrossRef44
Jean-Pierre Allain, Patricia E. Hewitt, Richard S. Tedder, Lorna M. Williamson, . (1999) Evidence that anti-HBc but not HBV DNA testing may prevent some HBV transmission by transfusion. British Journal of Haematology 107:1, 186-195
CrossRef45
Rui T. Marinho, Miguel C. Moura, Marília Pedro, Fernando J. Ramalho, José F. Velosa. (1999) Hepatitis B Vaccination in Hospital Personnel and Medical Students. Journal of Clinical Gastroenterology 28:4, 317-322
CrossRef46
Dieter R. Petzold, Bernhard Tautz, Friedhelm Wolf, Joachim Drescher. (1999) Infection chains and evolution rates of hepatitis B virus in cardiac transplant recipients infected nosocomially. Journal of Medical Virology 58:1, 1-10
CrossRef47
K. Vickery, A.K. Deva, J. Zou, P. Kumaradeva, L.Bissett and Y.E. Cossart. (1999) Inactivation of duck hepatitis B virus by a hydrogen peroxide gas plasma sterilization system: laboratory and ‘in use’ testing. Journal of Hospital Infection 41:4, 317-322
CrossRef48
Sandra C. Thompson, Maureen Norris. (1999) Hepatitis B Vaccination of Personnel Employed in Victorian Hospitals: Are Those at Risk Adequately Protected? • . Infection Control and Hospital Epidemiology 20:1, 51-54
CrossRef49
Kurt Darr. (1999) Nexus: Acquired Immunodeficiency Syndrome (AIDS) Update, Part 1. Hospital Topics 77:4, 28-31
CrossRef50
J Quale. (1998) Deja vu: nosocomial hepatitis B virus transmission and fingerstick monitoring. The American Journal of Medicine 105:4, 296-301
CrossRef51
Elaine Ristinen, Ravinder Mamtani. (1998) Ethics of transmission of hepatitis B virus by health-care workers. The Lancet 352:9137, 1381-1383
CrossRef52
Francisco José Dutra Souto, Cor Jésus Fernandes Fontes, Ana Maria Coimbra Gaspar. (1998) Outbreak of hepatitis B virus in recent arrivals to the Brazilian Amazon. Journal of Medical Virology 56:1, 4-9
CrossRef53
Rui Tato Marinho, Fernando Ramalho, José Velosa. (1998) De novo hepatitis B infection after liver transplantation: Are all surgeons vaccinated against hepatitis B?. Liver Transplantation and Surgery 4:5, 437-437
CrossRef54
P.V. Holland. (1998) Post-Transfusion Hepatitis: Current Risks and Causes. Vox Sanguinis 74:S2, 135-141
CrossRef55
CHRISTOPHER J GRESENS, PAUL V HOLLAND. (1998) Current risks of viral hepatitis from blood transfusions. Journal of Gastroenterology and Hepatology 13:4, 443-449
CrossRef56
Lee, William M., . (1997) Hepatitis B Virus Infection. New England Journal of Medicine 337:24, 1733-1745
Full Text57
Peter J Cohen. (1997) Immunization for prevention and treatment of cocaine abuse: legal and ethical implications1This manuscript is an expanded version of a presentation at the NIDA Symposium held during the 27th Annual Medical-Scientific Conference of the American Society of Addiction Medicine, April, 1996. The views and opinions expressed herein are those of the author and do not necessarily reflect those of the National Institute on Drug Abuse.1. Drug and Alcohol Dependence 48:3, 167-174
CrossRef58
Paul V. Holland. (1997) Consent for transfusion: Is it informed?. Transfusion Medicine Reviews 11:4, 274-285
CrossRef59
ALWF Eddleston. (1997) Hepatitis B and health-care workers. The Lancet 349:9062, 1339-1340
CrossRef60
The Incident Investigation Teams and Others . (1997) Transmission of Hepatitis B to Patients from Four Infected Surgeons without Hepatitis B e antigen. New England Journal of Medicine 336:3, 178-185
Full Text61
(1996) Transmission of Hepatitis Viruses by Surgeons. New England Journal of Medicine 335:4, 284-287
Full Text62
Holland, Paul V., . (1996) Viral Infections and the Blood Supply. New England Journal of Medicine 334:26, 1734-1735
Full Text63
Gerberding, Julie Louise, . (1996) The Infected Health Care Provider. New England Journal of Medicine 334:9, 594-595
Full Text
- Letters
