Original Article
Brief Report
Short Stature Caused by a Mutant Growth Hormone
N Engl J Med 1996; 334:432-436February 15, 1996
- Article
The causes of growth hormone–dependent short stature are primary pituitary disease, pituitary deficiency due to hypothalamic dysfunction, and, less often, insensitivity to growth hormone. The prototypical syndrome of growth hormone insensitivity is Laron-type dwarfism, which is characterized by absent or defective growth hormone receptors. Kowarski et al. described two children with growth retardation resulting from biologically inactive growth hormone1; additional cases were reported subsequently.2-7 This disorder is characterized by high serum concentrations of immunoreactive growth hormone, low serum concentrations of insulin-like growth factor I (IGF-I), and increases in both serum IGF-I and linear growth after the administration of exogenous growth hormone. The molecular basis of the disorder is unknown.
In this report we describe a child with short stature and a mutant growth hormone caused by a single missense mutation in the growth hormone gene. In this child the growth hormone not only cannot activate the growth hormone receptor but also inhibits the action of wild-type growth hormone because of its greater affinity for growth hormone–binding protein and growth hormone receptor.
Case Report
The proband was a boy who weighed 2250 g and was 39 cm long at birth after 41 weeks of gestation. His parents were not related. At the age of 4.9 years, he was 81.7 cm tall (6.1 SD below the mean for age and sex) and had a bone age of 2 years. His body proportions were normal except for a prominent forehead and a saddle nose. The IGF-I concentration was 34 ng per milliliter (normal, 35 to 293). Basal serum growth hormone concentrations ranged from 7.0 to 14.0 ng per milliliter, and peak concentrations after insulin-induced hypoglycemia, arginine administration, and levodopa administration were 38.0, 15.0, and 35.0 ng per milliliter, respectively. Nocturnal urinary growth hormone excretion ranged from 58.8 to 76.7 pg per milligram of creatinine (normal, 7.1 to 41.1). Serum IGF-I concentrations were unchanged by three days of daily subcutaneous injections of 0.1 unit of recombinant human growth hormone per kilogram of body weight (0.035 mg per kilogram). During prolonged treatment with growth hormone (0.18 mg per kilogram per week subcutaneously, given in three divided doses), the serum IGF-I concentration was 200 ng per milliliter and the rate of linear growth increased to 6.0 cm per year (as compared with a rate of 3.9 cm per year before treatment). The characteristics of the patient and his family are shown in Table 1Table 1
Clinical Characteristics of the Proband and His Family..Methods
Hormone Assays
Serum immunoreactive growth hormone was measured with an immunoradiometric assay kit (Pharmacia, Uppsala, Sweden), and serum bioactive growth hormone was measured with the use of Nb2 rat-lymphoma cells as described previously.8 In this bioassay, rabbit antiserum to human prolactin (NIDDK-anti-hPRL-IC5; National Institutes of Health, Bethesda, Md.) was added at a dilution of 1:100,000 to neutralize the growth-stimulating action of prolactin. Serum IGF-I and insulin-like growth factor (IGF)–binding protein 3 were measured by radioimmunoassays.9,10 Serum concentrations of growth hormone–binding protein were determined with use of an assay, as described previously.11
Isoelectric Focusing
Isoelectric focusing was performed as described previously.12 Serum samples (200 to 300 μl) were electrofocused in a buffer containing 1 percent hydroxypropyl methylcellulose and 4 percent ampholine (pH gradient, 3.5 to 8.0) at 200 V for 12 hours and then at 500 V for 12 hours. The fractions were collected and assayed for immunoreactive growth hormone. Pooled serum samples from 10 normal subjects were used as the control.
Genetic Analysis
Genomic DNA was isolated from peripheral-blood leukocytes13 and amplified by the polymerase chain reaction (PCR) with three pairs of oligonucleotide primers (F3 and GAD, GSD and GAE, and GHS1 and GAD) (Figure 1A, 1B, and 1CFigure 1
Structure of the GH-1 Gene and the Primers Used for PCR Amplification (Panel A), the Sequence of the GH-1 Gene (Panel B), and the Proband's Pedigree and Genotype (Panel C)., and Table 2Table 2
Sequences of the Primers Used to Amplify the Growth Hormone Gene.). The PCR amplification with primer pairs F3 and GAD and GHS1 and GAD involved an initial period of denaturation for three minutes at 92°C, followed by 35 cycles consisting of one minute of denaturation at 92°C, two minutes of annealing at 60°C, two minutes of extension at 72°C, and a final period of extension at 72°C for seven minutes. The PCR amplification with the primer pair GSD and GAE involved 35 cycles consisting of one minute of denaturation at 92°C, one minute of annealing at 68°C, and one minute of extension at 72°C. The amplification products were extracted and subcloned into pBluescript SK(+) phagemid (Stratagene, La Jolla, Calif.) or pT7 blue vector (Novagen, Madison, Wis.) and sequenced with a DNA sequencer (model 373A, Perkin-Elmer, Applied Biosystems, Foster, Calif.). Once a mutation was identified, direct sequencing was performed with a double-stranded DNA cycle-sequencing kit (GIBCO BRL, Grand Island, N.Y.).RNA Analysis
Lymphocytes were separated by mono-poly resolving medium Ficoll–Hypaque density–gradient centrifugation (Flow Laboratories, Costa Mesa, Calif.), and total RNA was isolated as described previously.14 Then, complementary DNA (cDNA) was synthesized with 1 μg of total RNA.15 The cDNA was used for PCR to amplify cDNA for the growth hormone gene GH-1. Two pairs of oligonucleotide primers were used for PCR: GHS2 and GHAS1 and GHS3 and GHAS3 (Figure 1A, 1B, and 1C). The PCR amplification with the primer pair GHS2 and GHAS1 involved an initial period of denaturation for 3 minutes at 92°C, followed by 40 cycles consisting of 1 minute of denaturation at 92°C, 1.5 minutes of annealing at 68°C, 1.5 minutes of extension at 72°C, and a final period of extension at 72°C for 7 minutes. The PCR amplification with the primer pair GHS3 and GHAS3 involved 40 cycles consisting of 1 minute of denaturation at 92°C, 1 minute of annealing at 60°C, and 1.5 minutes of extension at 72°C. The amplified products were analyzed as described in the preceding section.
cDNA Constructs of Wild-Type and Mutant Growth Hormone
Growth hormone cDNA was amplified by PCR with the use of a cDNA library prepared from human growth hormone–producing pituitary adenoma cells, and the accuracy of the structure of growth hormone cDNA was confirmed by sequencing. The oligonucleotide primers used for PCR were GHS1 and 5'TAAGAATTCGAGGGGTCACAGGGATGCCACCCG3' (an antisense primer). The PCR conditions consisted of an initial period of denaturation at 92°C for 3 minutes, followed by 35 cycles consisting of 1 minute of denaturation at 92°C, 1.5 minutes of annealing at 48°C, 1.5 minutes of extension at 72°C, and a final period of extension at 72°C for 7 minutes. The mutant growth hormone cDNA was constructed with a Transformer mutagenesis kit (Clontech, Palo Alto, Calif.). To remove the signal sequence of growth hormone cDNA, PCR amplification was performed with a sense primer (5'GCGGATCCTTCCCAACCATTCCCTTATC3') that includes an artificial BamHI site and GHAs1 as an antisense primer.
Characterization of the Functional Properties of Wild-Type and Mutant Growth Hormone
Wild-type and mutant growth hormone cDNA was subcloned into a BamHI–EcoRI site in the pGEX-KG plasmid vector, which was then transformed into the Escherichia coli strain DH5α. Wild-type and mutant growth hormone was expressed and purified with a glutathione-S-transferase gene fusion system (Pharmacia). The bioactivity of the expression products was determined, and the products were assayed with a bioassay involving the Nb2 cell line. The Nb2 bioassay was performed in the presence and absence of serum from a patient who had undergone hypophysectomy. Recombinant human growth hormone–binding protein was added to the samples in increments of 10 μl, resulting in final concentrations of 0.1, 0.5, or 1.0 nM.
Competitive binding studies with [125I]human growth hormone were performed in the human lymphoblast cell line IM-9, which expresses growth hormone receptors, as described previously.16 Direct binding of wild-type and mutant growth hormone to recombinant human growth hormone–binding protein was determined by immunoprecipitation.
Growth hormone–dependent tyrosine phosphorylation in IM-9 cells was determined as described previously, with modifications.17 Antiphosphotyrosine monoclonal antibody (RC20, Transduction Laboratories, Lexington, Ky.) was used for both immunoprecipitation and Western blotting. Antibody binding was visualized with an enhanced chemiluminescence kit (Amersham, Buckinghamshire, United Kingdom).
Results
The bioactivity of the proband's growth hormone was below the normal range (Table 1). Isoelectric focusing of the proband's serum revealed the presence of an abnormal growth hormone peak in addition to a normal peak (Figure 2AFigure 2
Results of Isoelectric Focusing of Growth Hormone in Serum from the Proband (Panel A) and His Father (Panel B).); his father's serum contained only one peak (Figure 2B), as did serum from unrelated normal subjects (data not shown). We then determined the sequence of the GH-1 gene in the proband. A heterozygous single-base substitution was identified (Figure 1B), which resulted in the substitution of cysteine for arginine at codon 77. The genotypes of the proband and his family are shown in Figure 1C.To assess whether this mutation was responsible for the inactivity of the proband's growth hormone, the wild-type and mutant growth hormone were expressed as glutathione-S-transferase fusion proteins. Both forms of growth hormone were equally immunoreactive. Although the bioactivity of both proteins was similar when assayed in serum-free medium, the bioactivity of the mutant growth hormone was less than half that of wild-type growth hormone in the presence of serum from a patient who had undergone hypophysectomy, which contained neither growth hormone nor prolactin (data not shown). Because of the possibility of interference by growth hormone–binding protein in the Nb2-bioassay system, recombinant human growth hormone–binding protein was added to the assay medium. The mean (±SE) ratio of bioactivity to immunoreactivity of the mutant growth hormone was significantly reduced to 45±5 percent (P = 0.01) and 22±8 percent (P = 0.02) of the ratio for wild-type growth hormone in the presence of 0.5 and 1.0 nM recombinant human growth hormone–binding protein, respectively — concentrations similar to those in the serum of normal subjects.
Binding of [125I]human growth hormone to human growth hormone receptors in IM-9 cells was inhibited by wild-type and mutant growth hormone in a dose-dependent manner, and the mean concentrations at which binding was reduced by 50 percent were 0.84±0.30 and 0.86±0.41 nM, respectively (mean results of three experiments). Binding of [125I]human growth hormone to recombinant human growth hormone–binding protein was also inhibited by the normal and mutant protein in a dose-dependent manner; the 50 percent inhibitory concentration for the mutant protein (0.12±0.02 nM [mean results of three experiments]) was significantly lower than that for wild-type growth hormone (0.68±0.08 nM), indicating that the affinity of the mutant growth hormone for growth hormone–binding protein was approximately six times higher than that of wild-type growth hormone.
The mutant growth hormone not only failed to stimulate tyrosine phosphorylation by itself, but it also inhibited the activity of wild-type growth hormone, even when the concentration of wild-type growth hormone was 10 times higher than that of the mutant type (Figure 3Figure 3
Growth Hormone–Dependent Tyrosine Phosphorylation in IM-9 Cells.).Discussion
The proband was a boy with severe growth retardation (6.1 SD below the mean for age and sex at the age of 4.9 years) and delayed bone age who had high basal serum growth hormone concentrations and low IGF-I concentrations and increases in serum growth hormone on provocative testing. Although these findings were consistent with the presence of the growth hormone–insensitivity syndrome,18 that diagnosis was excluded because somatic linear growth improved during long-term administration of growth hormone. The serum growth hormone in this child was less bioactive than that of normal subjects, and the presence of an abnormal growth hormone molecule in his serum was confirmed by isoelectric focusing.
The patient's abnormal growth hormone resulted from the replacement of arginine by cysteine at codon 77 of the GH-1 gene. This codon is located in the second α helix of the growth hormone molecule, behind a site of binding to the growth hormone receptor.19,20 The substituted cysteine may form a new disulfide bond, changing the charge or conformation of the growth hormone molecule and thereby reducing the bioactivity of the mutant growth hormone.
Dimerization of growth hormone receptors induced by ligand binding and sequential protein phosphorylation in tyrosine residues are crucially important for growth hormone–induced signal transduction.21-24 The mutant growth hormone not only did not stimulate tyrosine phosphorylation in IM-9 cells but also inhibited the ability of wild-type growth hormone to stimulate tyrosine phosphorylation, thus having a dominant negative action.
Serum growth hormone–binding protein is structurally identical to the extracellular domain of the growth hormone receptor and serves as a growth hormone reservoir in vivo.25-27 In our patient, the affinity of the mutant growth hormone for growth hormone–binding protein was significantly higher than that of wild-type growth hormone. The binding of growth hormone to growth hormone receptors is believed to proceed sequentially (i.e., first at site 1 and then at site 2).19 Our findings suggest that the properties of the mutant growth hormone differ from those of wild-type growth hormone with respect to binding affinities at site 1 or 2.
The proband's father was phenotypically normal even though he had the same genetic abnormality as the proband. Isoelectric focusing revealed that the father's serum contained a single growth hormone peak corresponding to wild-type growth hormone. Why the mutant growth hormone gene was not expressed in the father is not known, although genomic imprinting cannot be ruled out.
In conclusion, we found a heterozygous missense mutation in the growth hormone gene of a child with severe growth retardation. As compared with wild-type growth hormone, the mutant growth hormone had a higher affinity for growth hormone–binding protein and was less active in phosphorylating growth hormone signal-transduction molecules. It also inhibited the action of wild-type growth hormone.
Supported in part by grants-in-aid for scientific research from the Japanese Ministry of Education, Science, and Culture ((C)05807089, 06807082, and 07671138) and by grants from the Japanese Ministry of Health and Welfare.
We are indebted to Drs. Toshiaki Tanaka and Mari Satoh for providing the Nb2 cell line and technical advice; to the Japanese Cancer Research Resources Bank for supplying the IM-9 cell line; to the National Institutes of Health for supplying anti-prolactin antibody; to Genentech, Inc., for providing recombinant human growth hormone–binding protein; to Japan Chemical Research, Inc., for providing recombinant human growth hormone; to Drs. Yoshihiro Masumura, Miyako Kishimoto, Ko Kotani, and Wataru Ogawa for excellent technical suggestions; to Miss Eriko Ohno for technical assistance; to Mitsubishi Kagaku BCL, Inc., for measuring serum growth hormone–binding protein and IGF-binding protein 3; and to Toray Research Center for performing isoelectric focusing.
Source Information
From the Third Division, Department of Medicine, Kobe University School of Medicine (Y.T., H.K., Y.O., H.A., K.C.), and the Department of Endocrinology and Metabolism, Kobe Children's Hospital (K.G.) — both in Kobe, Japan.
Address reprint requests to Dr. Takahashi at the Third Division, Department of Medicine, Kobe University School of Medicine, 7-5-1 Kusunoki-cho, Chuo-ku, Kobe, 650, Japan.
- References
References
1
Kowarski AA ,Schneider J ,Ben-Galim E ,Weldon VV ,Daughaday WH . Growth failure with normal serum RIA-GH and low somatomedin activity: somatomedin restoration and growth acceleration after exogenous GH. J Clin Endocrinol Metab 1978;47:461-464
CrossRef | Web of Science | Medline2
Valenta LJ ,Sigel MB ,Lesniak MA , et al. Pituitary dwarfism in a patient with circulating abnormal growth hormone polymers. N Engl J Med 1985;312:214-217
Full Text | Web of Science | Medline3
Hayek A ,Peake GT ,Greenberg RE . A new syndrome of short stature due to biologically inactive but immunoreactive growth hormone. Pediatr Res 1978;12:413-413 abstract.
CrossRef | Web of Science4
Rudman D ,Kutner MH ,Blackston RD ,Cushman RA ,Bain RP ,Patterson JH . Children with normal-variant short stature: treatment with human growth hormone for six months. N Engl J Med 1981;305:123-131
Full Text | Web of Science | Medline5
Frazer TE ,Gavin JR ,Daughaday WH ,Hillman RE ,Weldon VV . Growth hormone -- dependent growth failure. J Pediatr 1982;101:12-15
CrossRef | Web of Science | Medline6
Plotnick LP ,Van Meter QL ,Kowarski AA . Human growth hormone treatment of children with growth failure and normal growth hormone levels by immunoassay: lack of correlation with somatomedin generation. Pediatrics 1983;71:324-327
Web of Science | Medline7
Bright GM ,Rogol AD ,Johanson AJ ,Blizzard RM . Short stature associated with normal growth hormone and decreased somatomedin-C concentrations: response to exogenous growth hormone. Pediatrics 1983;71:576-580
Web of Science | Medline8
Tanaka T ,Shiu RPC ,Gout PW ,Beer CT ,Noble RL ,Friesen HG . A new sensitive and specific bioassay for lactogenic hormones: measurement of prolactin and growth hormone in human serum. J Clin Endocrinol Metab 1980;51:1058-1063
CrossRef | Web of Science | Medline9
Okimura Y ,Chihara K ,Kita T , et al. Discordance between growth hormone (GH) responses after GH-releasing hormone and insulin hypoglycemia in myotonic dystrophy. J Clin Endocrinol Metab 1988;67:1074-1079
CrossRef | Web of Science | Medline10
Baxter RC ,Martin JL . Radioimmunoassay of growth hormone-dependent insulin-like growth factor binding protein in human plasma. J Clin Invest 1986;78:1504-1512
CrossRef | Web of Science | Medline11
Carlsson LMS ,Rosberg S ,Vitangcol RV ,Wong WLT ,Albertsson-Wikland K . Analysis of 24-hour plasma profiles of growth hormone (GH)-binding protein, GH/GH-binding protein-complex, and GH in healthy children. J Clin Endocrinol Metab 1993;77:356-361
CrossRef | Web of Science | Medline12
Tsvetnitsky V ,Auchi L ,Nicolaou A ,Gibbons WA . Characterization of phospholipid methylation in rat brain myelin. Biochem J 1995;307:239-244
Web of Science | Medline13
Gross-Bellard M ,Oudet P ,Chambon P . Isolation of high-molecular-weight DNA from mammalian cells. Eur J Biochem 1973;36:32-38
CrossRef | Medline14
Maniatis T, Fritsch EF, Sambrook J. Molecular cloning, a laboratory manual. Cold Spring Harbor, N.Y.: Cold Spring Harbor Laboratory Press, 1982.
15
de Martynoff G ,Pays E ,Vassart G . Synthesis of a full length DNA complementary to thyroglobulin 33 S messenger RNA. Biochem Biophys Res Commun 1980;93:645-653
CrossRef | Web of Science | Medline16
Lesniak MA ,Gorden P ,Roth J ,Gavin JR III . Binding of 125I-human growth hormone to specific receptors in human cultured lymphocytes: characterization of the interaction and a sensitive radioreceptor assay. J Biol Chem 1974;249:1661-1667
Web of Science | Medline17
Silva CM ,Weber MJ ,Thorner MO . Stimulation of tyrosine phosphorylation in human cells by activation of the growth hormone receptor. Endocrinology 1993;132:101-108
CrossRef | Web of Science | Medline18
Rosenbloom AL . The chronicle of growth hormone receptor deficiency (Laron syndrome). Acta Paediatr Suppl 1992;383:117-120
Medline19
Cunningham BC ,Ultsch M ,De Vos AM ,Mulkerrin MG ,Clauser KR ,Wells JA . Dimerization of extracellular domain of the human growth hormone receptor by a single hormone molecule. Science 1991;254:821-825
CrossRef | Web of Science | Medline20
Fuh G ,Cunningham BC ,Fukunaga R ,Nagata S ,Goeddel DV ,Wells JA . Rational design of potent antagonists to the human growth hormone receptor. Science 1992;256:1677-1680
CrossRef | Web of Science | Medline21
Silva CM ,Day RN ,Weber MJ ,Thorner MO . Human growth hormone (GH) receptor is characterized as the 134-kilodalton tyrosine-phosphorylated protein activated by GH treatment in IM-9 cells. Endocrinology 1993;133:2307-2312
CrossRef | Web of Science | Medline22
Argetsinger LS ,Campbell GS ,Yang X , et al. Identification of JAK2 as a growth hormone receptor-associated tyrosine kinase. Cell 1993;74:237-244
CrossRef | Web of Science | Medline23
Silva CM ,Lu H ,Weber MJ ,Thorner MO . Differential tyrosine phosphorylation of JAK1, JAK2, and STAT1 by growth hormone and interferon-γ in IM-9 cells. J Biol Chem 1994;269:27532-27539
Web of Science | Medline24
Gronowski AM ,Zhong Z ,Wen Z ,Thomas MJ ,Darnell JE Jr ,Rotwein P . In vivo growth hormone treatment rapidly stimulates the tyrosine phosphorylation and activation of Stat3. Mol Endocrinol 1995;9:171-177
CrossRef | Web of Science | Medline25
Herington AC ,Ymer SI ,Tiong TS . Does the serum binding protein for growth hormone have a functional role? Acta Endocrinol (Copenh) 1991;124:Suppl 2:14-20
Medline26
Baumann G ,Amburn KD ,Buchanan TA . The effect of circulating growth hormone-binding protein on metabolic clearance, distribution, and degradation of human growth hormone. J Clin Endocrinol Metab 1987;64:657-660
CrossRef | Web of Science | Medline27
Baumann G ,Shaw MA ,Buchanan TA . In vivo kinetics of a covalent growth hormone-binding protein complex. Metabolism 1989;38:330-333
CrossRef | Web of Science | Medline
- Citing Articles (38)
Citing Articles
1
A.l.i. Mohamadi, Roberto Salvatori. 2012. Neuroendocrine Growth Disorders – Dwarfism, Gigantism. , 707-721.
CrossRef2
Sherry L. Franklin, Mitchell E. Geffner. (2011) Growth Hormone: The Expansion of Available Products and Indications. Pediatric Clinics of North America 58:5, 1141-1165
CrossRef3
Alfred Tenore, Daniela Driul. (2011) Genomics in Pediatric Endocrinology—Genetic Disorders and New Techniques. Pediatric Clinics of North America 58:5, 1061-1081
CrossRef4
Vibor Petkovic, Primus E. Mullis. (2011) Genetic defects causing functional and structural isolated growth hormone deficiency. Translational Neuroscience 2:2, 152-162
CrossRef5
Primus-E. Mullis. (2011) Genetics of GHRH, GHRH-receptor, GH and GH-receptor: Its impact on pharmacogenetics. Best Practice & Research Clinical Endocrinology & Metabolism 25:1, 25-41
CrossRef6
Michael J. Waters. 2011. The Growth Hormone Receptor. .
CrossRef7
Kyriaki S. Alatzoglou, Mehul T. Dattani. (2010) Genetic causes and treatment of isolated growth hormone deficiency—an update. Nature Reviews Endocrinology 6:10, 562-576
CrossRef8
Sara Pagani, Eduardo A. Chaler, Cristina Meazza, Mercedes Maceiras, Maria Eugenia Gonzalez, Marco A. Rivarola, Francesca Cantoni, Paola Travaglino, Lucia Della Croce, Kamilia Laarej, Mauro Bozzola, Alicia Belgorosky. (2010) Is BaF3 Bioassay Useful to Identify Patients with Bioinactive Growth Hormone?. Journal of Pediatric Endocrinology and Metabolism 23:8, 783-788
CrossRef9
Nurmamet Amet, Wei Wang, Wei-Chiang Shen. (2010) Human growth hormone–transferrin fusion protein for oral delivery in hypophysectomized rats. Journal of Controlled Release 141:2, 177-182
CrossRef10
Sherry L. Franklin, Mitchell E. Geffner. (2009) Growth Hormone: The Expansion of Available Products and Indications. Endocrinology & Metabolism Clinics of North America 38:3, 587-611
CrossRef11
Alfred Tenore, Daniela Driul. (2009) Genomics in Pediatric Endocrinology—Genetic Disorders and New Techniques. Endocrinology & Metabolism Clinics of North America 38:3, 471-490
CrossRef12
Ameeta Mehta, Evelien F. Gevers, Mehul T. Dattani. 2009. Congenital Disorders of the Hypothalamo-Pituitary-Somatotrope Axis. , 60-105.
CrossRef13
Jerry K. Wales. 2009. Evaluation of Growth Disorders. , 124-154.
CrossRef14
J.M. Wit, P.E. Clayton, A.D. Rogol, M.O. Savage, P.H. Saenger, P. Cohen. (2008) Idiopathic short stature: Definition, epidemiology, and diagnostic evaluation. Growth Hormone & IGF Research 18:2, 89-110
CrossRef15
RON G. ROSENFELD, PINCHAS COHEN. 2008. Disorders of Growth Hormone/Insulin-like Growth Factor Secretion and Action. , 254-334.
CrossRef16
Libia M. Hernández, Phillip D. K. Lee, Cecilia Camacho-Hübner. (2007) Isolated growth hormone deficiency. Pituitary 10:4, 351-357
CrossRef17
Primus E. Mullis. (2007) Genetics of Growth Hormone Deficiency. Endocrinology & Metabolism Clinics of North America 36:1, 17-36
CrossRef18
John A Phillips. 2006. Endocrine Disorders: Hereditary. .
CrossRef19
Erick J Richmond, Alan D Rogol. (2006) Individualized therapy for growth hormone deficiency. Expert Review of Endocrinology & Metabolism 1:1, 83-90
CrossRef20
Domené, Horacio M., Bengolea, Sonia V., Martínez, Alicia S., Ropelato, M. Gabriela, Pennisi, Patricia, Scaglia, Paula, Heinrich, Juan J., Jasper, Héctor G., . (2004) Deficiency of the Circulating Insulin-like Growth Factor System Associated with Inactivation of the Acid-Labile Subunit Gene. New England Journal of Medicine 350:6, 570-577
Full Text21
T. Sakatani, H. Kaji, Y. Takahashi, K. Iida, Y. Okimura, K. Chihara. (2003) Lactogenic hormone responsive element reporter gene activation assay for human growth hormone. Growth Hormone & IGF Research 13:5, 275-281
CrossRef22
M.T. Dattani. (2003) DNA testing in patients with GH deficiency at the time of transition. Growth Hormone & IGF Research 13, S122-S129
CrossRef23
David S. Millar, Mark D. Lewis, Martin Horan, Vicky Newsway, Tammy E. Easter, John W. Gregory, Linda Fryklund, Martin Norin, Elizabeth C. Crowne, Sally J. Davies, Phillip Edwards, Jeremy Kirk, Kim Waldron, Patricia J. Smith, John A. Phillips, Maurice F. Scanlon, Michael Krawczak, David N. Cooper, Annie M. Procter. (2003) Novel mutations of the growth hormone 1 (GH1) gene disclosed by modulation of the clinical selection criteria for individuals with short stature. Human Mutation 21:4, 424-440
CrossRef24
Jaroslava Lieskovska, Donglin Guo, Eva Derman. (2002) IL-6-overexpression brings about growth impairment potentially through a GH receptor defect. Growth Hormone & IGF Research 12:6, 388-398
CrossRef25
Joanne C Blair, Martin O Savage. (2002) The GH–IGF-I axis in children with idiopathic short stature. Trends in Endocrinology & Metabolism 13:8, 325-330
CrossRef26
John A. Phillips. 2002. Growth Hormone. .
CrossRef27
YOSHSITAKA HAYASHI, TAKASHI KAMIJO, MASAMICHI OGAWA, HISAO SEO. (2002) Familial Isolated Growth Hormone Deficiency: Genetics and Pathophysiology.. Endocrine Journal 49:3, 265-272
CrossRef28
Gerhard Baumann. (2002) Genetic Characterization of Growth Hormone Deficiency and Resistance. American Journal of PharmacoGenomics 2:2, 93-111
CrossRef29
Pierre C Sizonenko, Peter E Clayton, Pinchas Cohen, Raymond L Hintz, Toshiaki Tanaka, Zvi Laron. (2001) Diagnosis and management of growth hormone deficiency in childhood and adolescence. Growth Hormone & IGF Research 11:3, 137-165
CrossRef30
Derek Le Roith, Louis Scavo, Andrew Butler. (2001) What is the role of circulating IGF-I?. Trends in Endocrinology & Metabolism 12:2, 48-52
CrossRef31
Abel López-Bermejo, Caroline K. Buckway, Ron G. Rosenfeld. (2000) Genetic Defects of the Growth Hormone–Insulin-like Growth Factor Axis. Trends in Endocrinology & Metabolism 11:2, 39-49
CrossRef32
Wood, Alastair J.J., , Vance, Mary Lee, Mauras, Nelly, . (1999) Growth Hormone Therapy in Adults and Children. New England Journal of Medicine 341:16, 1206-1216
Full Text33
Yutaka Takahashi, Kazuo Chihara. (1999) Short stature by mutant growth hormones. Growth Hormone & IGF Research 9, 37-41
CrossRef34
P Rotwein. (1999) Human growth disorders: molecular genetics of the growth hormone–insulin-like growth factor I axis. Acta Paediatrica 88:s428, 148-151
CrossRef35
Arlan L Rosenbloom, Jaime Guevara-Aguirre. (1998) Lessons from the Genetics of Laron Syndrome. Trends in Endocrinology & Metabolism 9:7, 276-283
CrossRef36
Leona Cuttler. (1996) THE REGULATION OF GROWTH HORMONE SECRETION. Endocrinology & Metabolism Clinics of North America 25:3, 541-571
CrossRef37
Robert L. Rosenfield. (1996) ESSENTIALS OF GROWTH DIAGNOSIS. Endocrinology & Metabolism Clinics of North America 25:3, 743-758
CrossRef38
Laron, Zvi, . (1996) Short Stature Due to Genetic Defects Affecting Growth Hormone Activity. New England Journal of Medicine 334:7, 463-466
Full Text
