Original Article
Germ-Line BRCA1 Mutations in Jewish and Non-Jewish Women with Early-Onset Breast Cancer
N Engl J Med 1996; 334:143-149January 18, 1996
- Abstract
Background
Mutations in a germ-line allele of the BRCA1 gene contribute to the familial breast cancer syndrome. However, the prevalence of these mutations is unknown in women with breast cancer who do not have the features of this familial syndrome. We sought BRCA1 mutations in women who were given a diagnosis of breast cancer at an early age, because early onset is characteristic of a genetic predisposition to cancer.
Methods
Clinical information and peripheral-blood mononuclear cells were obtained from 418 women from the Boston metropolitan area in whom breast cancer was diagnosed at or before the age of 40. A comprehensive BRCA1 mutational analysis, involving automated nucleotide sequencing and a protein-truncation assay, was undertaken in 30 of these women, who had breast cancer before the age of 30. In addition, the BRCA1 mutation 185delAG, which is prevalent in the Ashkenazi Jewish population, was sought with an allele-specific polymerase-chain-reaction assay in 39 Jewish women among the 418 women who had breast cancer at or before the age of 40.
Results
Among 30 women with breast cancer before the age of 30, 4 (13 percent) had definite, chain-terminating mutations and 1 had a missense mutation. Two of the four Jewish women in this cohort had the 185delAG mutation. Among the 39 Jewish women with breast cancer at or before the age of 40, 8 (21 percent) carried the 185delAG mutation (95 percent confidence interval, 9 to 36 percent).
Conclusions
Germ-line BRCA1 mutations can be present in young women with breast cancer who do not belong to families with multiple affected members. The specific BRCA1 mutation known as 185delAG is strongly associated with the onset of breast cancer in Jewish women before the age of 40.
Media in This Article
Figure 1
Mutational Analysis of BRCA1. Table 1
Clinical Characteristics of 418 Women with Early-Onset Breast Cancer.Article Activity
- Article
The BRCA1 gene has been identified at the chromosome 17q locus, which is linked to familial breast and ovarian cancer.1,2 BRCA1, a potential tumor-suppressor gene, encodes a predicted 200-kd protein whose function is unknown. Genetic susceptibility to breast cancer results from the inactivation of one BRCA1 allele in the germ line, followed by the loss of the remaining allele in somatic breast tissue.1,3 Unlike mutations in other known tumor-suppressor genes, BRCA1 mutations have only been detected in specimens of breast-cancer tissue when there is a mutated germ-line allele. The role of BRCA1 mutations in breast cancer is therefore limited to women with a genetic susceptibility to this tumor.
Molecular analysis of familial breast cancer has identified BRCA1 mutations in 31 of 100 families, and genetic-linkage studies suggest that in half of kindreds with breast cancer and in 80 percent of families with a history of both breast and ovarian cancer, there is inheritance of a mutated BRCA1 allele.1,3-7 It has been estimated that in such kindreds the inheritance of a mutated BRCA1 allele confers a 59 percent chance that breast or ovarian cancer will appear by the age of 50 and an 82 percent chance that one of these cancers will appear by the age of 70.8,9
We do not know the incidence of germ-line BRCA1 mutations in women in the general population who may be at increased risk for breast cancer but who do not belong to large families with multiple affected members. About 6 to 19 percent of women with breast cancer have an affected relative,10,11 but this in itself does not reliably identify women with a high risk for a BRCA1 mutation. Coincidental cases in large families may reflect only the high incidence of sporadic breast cancer, and in small families the absence of multiple affected family members cannot rule out the presence of a BRCA1 mutation. Clinical features that suggest a genetic predisposition include bilateral breast cancer; bilateral premalignant lesions, such as lobular carcinoma in situ; and unusually young age at presentation.12
Early age at diagnosis is a useful marker of genetic susceptibility to cancer. In children predisposed to retinoblastoma or Wilms' tumor by a germ-line mutation in the RB or WT1 genes, cancer develops earlier than in patients with sporadic disease13,14; in adults with familial polyposis who carry a germ-line mutation in the APC gene, polyps and colonic carcinoma appear early in life.15,16 In women with familial breast cancer, tumors usually appear before the age of 45, a considerably younger age than is typical in the general population.17 An epidemiologic model predicts that 36 percent of all women in whom breast cancer appears between the ages of 20 and 29 have a genetic predisposition, as compared with 1 percent of women with breast cancer diagnosed at the age of 80 or older.18 The annual incidence of breast cancer in women 20 to 29 years old is 1.7 per 100,000 women; these young patients account for 1.5 percent of all cases of breast cancer in the United States.17 To test the hypothesis that women who have breast cancer at a young age have a high probability of carrying a BRCA1 mutation, we analyzed the prevalence of germ-line BRCA1 mutations in women with early-onset breast cancer. In addition, we studied Jewish women who had breast cancer at an early age to determine the presence of a specific BRCA1 allele with a mutation at position 185 involving a deletion of adenine and guanine (185delAG) that has recently been found in 1 percent of the Ashkenazi Jewish population.19
Methods
Study Patients
Women in whom breast cancer developed between 1981 and 1992 at or before the age of 40 were identified by retrospectively reviewing the medical records at four breast-cancer referral centers in Boston — Massachusetts General Hospital, Dana–Farber Cancer Institute, Beth Israel Hospital, and Faulkner Hospital. Among 850 eligible women, 418 agreed to donate blood for an analysis of genes for susceptibility to breast cancer, the results of which would not be disclosed. The blood samples were coded, and the confidentiality of the patients was preserved, in accordance with the guidelines for studies of human subjects of the collaborating hospitals. Medical and family histories and demographic variables (including religion and ethnic origin) were obtained by direct interviews, and pathological diagnoses were confirmed by a review of the medical records. In a rigorous determination of the presence of BRCA1 mutations in women with early-onset breast cancer, the entire coding region of the BRCA1 gene was analyzed in a subgroup of 30 women in whom breast cancer developed before the age of 30. In addition, 39 Jewish women among the 418 women who had breast cancer at or before the age of 40 were screened for the 185delAG mutation.
Blood Samples and Molecular Strategies
Blood samples were obtained for the extraction of genomic DNA and polyA messenger RNA (mRNA), which were isolated from peripheral-blood mononuclear cells by standard procedures. First-strand complementary DNA (cDNA) was synthesized from the polyA mRNA with random hexamers (Pharmacia). B lymphoblasts immortalized by the Epstein–Barr virus were also prepared from all specimens, and when appropriate, paraffin-embedded blocks of the primary tumor were obtained for a mutational analysis based on the polymerase chain reaction (PCR).
Protein Transcription–Translation Assay
Protein transcription–translation (PTT) analysis detects premature stop codons in a single reaction by amplifying DNA fragments of the coding region, transcribing the fragments into mRNA, and translating the mRNA into radiolabeled peptides.16,20 The results of genomic DNA–based PTT analysis of BRCA1 exon 11 were reported while this study was in preparation,21 and we undertook to screen the entire BRCA1 coding region using both mRNA and genomic DNA–based PTT analysis. BRCA1 contains 24 exons, the first of which is noncoding; exon 4 consists of a repetitive sequence of the Alu family that is omitted from most transcripts; and exon 11 contains 3.5 kb of the entire 5.6-kb coding sequence.1 The BRCA1 gene transcript was therefore divided into six overlapping fragments (Figure 1Figure 1
Mutational Analysis of BRCA1. , top panel): the 5' end, containing exons 2 through 10 and the 5' end of exon 11 (amino acids 1 through 265), and the 3' end, containing exons 12 through 24 and the 3' end of exon 11 (amino acids 1354 through 1864), were amplified as single fragments from randomly primed cDNA. Exon 11 was first amplified as a single 3.5-kb fragment from genomic DNA by long-range PCR, with ExTaq (Takara), followed by nested PCR amplification of four overlapping fragments (AP, containing amino acids 224 through 499; BP, containing amino acids 461 through 749; CP, containing amino acids 712 through 1056; and DP, containing amino acids 1020 through 1366). The 5' oligonucleotide for each of the six PCR fragments contained a T7 polymerase recognition site, a Kozak consensus sequence, and a start codon, to allow the transcription and translation of uncloned PCR products. The analysis of uncloned PCR products ensured that both BRCA1 alleles would be represented and reduced the possibility of any polymerase-induced error that might be present in an individual PCR product. One microgram of the PCR product was incubated with T7 polymerase and rabbit reticulocyte lysate in a transcription–translation mix (Promega) in the presence of 35S-labeled methionine (Amersham), followed by electrophoresis with 12 percent and 15 percent polyacrylamide–sodium dodecyl sulfate gels. The sequence of all primers used and the optimal PCR conditions have been submitted to the Breast Cancer Information Core electronic data base (Internet address: http://www.nchgr.nih.gov/dir/lab_transfer/bic/).Automated Nucleotide Sequencing
The sequence of the entire 5.6-kb coding region of BRCA1 was determined for each germ-line specimen with automated sequencing of both strands of uncloned PCR products using dye-labeled dideoxy terminators (Applied Biosystems). The use of uncloned PCR products allowed both alleles to be analyzed in a single reaction and minimized artifactual errors in any one product. The most direct approach, analysis of reverse-transcriptase PCR products spanning the entire BRCA1 transcript, was complicated by the low level of BRCA1 mRNA expression in peripheral-blood mononuclear cells and by alternative mRNA splicing at the 5' end of the transcript. Conditions were therefore optimal for sequencing analysis with templates derived by PCR amplification of both genomic DNA and cDNA. The 5' end of BRCA1 (exons 2 through 5, 7 through 10, and 13 and 14) was amplified from genomic DNA with primers complementary to the intron sequences flanking each exon. These exons could not be sequenced successfully from cDNA as a single fragment because of the extensive alternative splicing of the BRCA1 transcript in peripheral-blood mononuclear cells (alternative splicing of exons 5, 9 and 10 and alternative use of splice junctions in exons 8 and 14). Exon 6 was amplified from cDNA, because the flanking intron sequences were not optimal for analysis from genomic DNA; an initial reverse-transcriptase PCR spanning exons 2 through 11 was followed by a nested PCR containing exon 6. Exon 11 was amplified in 12 overlapping fragments from genomic DNA, as follows: 11A, from the intronic sequence through nucleotide 939; 11B, nucleotides 871 through 1251; 11C, nucleotides 1193 through 1537; 11D, nucleotides 1480 through 1850; 11E, nucleotides 1769 through 2134; 11F, nucleotides 2077 through 2438; 11G, nucleotides 2358 through 2759; 11H, nucleotides 2667 through 3012; 11I, nucleotides 2944 through 3299; 11J, nucleotides 3233 through 3590; 11K, nucleotides 3533 through 3907; and 11L, nucleotide 3820 through the intronic sequence. Exons 12 and 13 were amplified individually from genomic DNA with primers complementary to the flanking introns. The 3' end of BRCA1 (exons 13 through 24) was analyzed by reverse-transcriptase PCR amplification. An initial reverse-transcriptase PCR spanning exons 12 through 24 was used, followed by a nested PCR that produced four overlapping fragments spanning exons 13 through 16, 15 through 18, 17 through 22, and 21 through 24.
All PCR products were purified by electrophoresis on 2 percent low-melting-point agarose (FMC), and appropriate fragments were extracted by incubation at 65°C and treatment with 1 U of Agarase (Sigma). Cycle sequencing with Taq polymerase and dye-labeled dideoxy terminators was performed according to the manufacturer's instructions. The reaction products were analyzed with a DNA sequencer, and the sequence files were edited with the Factura program (Applied Biosystems). Base positions with a secondary peak at least half the height of the primary peak were marked with use of the degeneracy codes of the International Union of Biochemistry. For each PCR fragment, Factura-processed sense and antisense sequence files were aligned with the wild-type BRCA1 sequence with the Sequence Navigator program (Applied Biosystems). The primer sequences and PCR conditions were adjusted to provide optimal resolution for automated sequencing analysis (this information is available through the Breast Cancer Information Core data base). For PCR fragments that yielded unreliable results of automated sequencing analysis, a 5' tail containing M13-derived sequencing primers was attached to the amplification primers, and these standard primers were then used in the sequencing.
Detection of the 185delAG Mutation
To screen for the 185delAG mutation in BRCA1 exon 2, genomic DNA was amplified with four primers in a single PCR (annealing temperature, 58°C), as follows: primer 1 (sense), complementary to the 5' intron sequence 5'GAAGTTGTCATTTTATAAACCTTT3'; primer 2 (antisense), complementary to the 185delAG mutation 5'TGACTTACCAGATGGGACACTA3'; primer 3 (sense), complementary to the wild-type exon 2 sequence 5'ATTAATGCTATGCAGAAAATCTTAGAG3'; and primer 4 (antisense), complementary to the 3' intron sequence 5'GTATGTAAGGTCAATTCTGTTC3'. For each specimen, this combination of primers produced bands of 170 nucleotides (185delAG specific), 118 nucleotides (wild-type specific), and 282 or 284 nucleotides (control for the mutated and wild-type alleles, respectively).
Statistical Analysis
Ninety-five percent confidence intervals for the estimates of risk and the odds ratios were calculated with StatXact (Cytel). The association between familial risk and the rate of mutation was tested by Fisher's exact test. The attributable risk was estimated by methods used in retrospective studies under the assumption that the disease was rare (and therefore that the odds ratio was an approximation of the relative risk).22 The prevalence of the 185delAG mutation in the Jewish population was estimated to be 8 per 858 people, according to data reported elsewhere.19 Also, we assumed that the cumulative risk of breast cancer by the age of 40 was 1 in 217 women.17
Results
Clinical data were recorded and peripheral-blood specimens obtained for 418 women from the Boston metropolitan area in whom breast cancer was diagnosed at the age of 40 or earlier. To undertake comprehensive mutational screening of the BRCA1 gene, we first selected the 30 women who we presumed had the highest risk of a genetic predisposition, because they had breast cancer before the age of 30. Most of these women had been affected between the ages of 20 and 29 with infiltrating ductal carcinoma, with or without ductal carcinoma in situ, but tumors with less common histologic features were also noted, including infiltrating lobular, medullary, and anaplastic carcinomas; one five-year-old child had a juvenile secretory adenocarcinoma. In addition to diagnosis at an early age, 5 of the 30 women had bilateral breast cancer (2 patients), a definite family history of breast cancer (one in which three or more paternal or maternal relatives are affected and are from two or more generations; 2 patients), or both (1 patient) (Table 1Table 1
Clinical Characteristics of 418 Women with Early-Onset Breast Cancer.). These clinical features, which strongly suggest a genetic predisposition, were similar in the women with onset of disease before the age of 30 and those with onset between 30 and 40. Among all 418 women who had breast cancer at the age of 40 or earlier, 168 (40 percent) had at least one first- or second-degree affected relative (95 percent confidence interval, 36 to 46 percent), a figure that contrasts with estimates of 6 to 19 percent for the general population.10,11 Thus, most women in our study did not belong to characteristic breast-and-ovarian-cancer pedigrees, but they represented a subgroup of the general population that has an increased risk of a genetic predisposition to breast cancer.Screening for BRCA1 Mutations by the PTT Assay
Since the large size of the BRCA1 gene complicates mutational studies, we used two approaches: the PTT assay, a rapid screening test that can detect chain-terminating mutations,16,20,21 and automated nucleotide sequencing combined with the use of software to facilitate the identification of heterozygous mutations, a method that can detect all nucleotide substitutions in the BRCA1 coding region.
Seventy to 80 percent of BRCA1 mutations identified in kindreds with breast cancer are nonsense mutations or small insertions and deletions that shift the codon reading frame, causing premature protein termination.1,3-7 These mutations should be detectable by PTT analysis, in which overlapping fragments spanning the entire BRCA1 coding region are amplified by PCR, transcribed into mRNA, and translated into protein (Figure 1). Abnormally shortened peptides, indicative of the premature termination of translation, were sought among the protein fragments. For example, Patient 99 had both a truncated peptide and the expected full-size protein fragment, a finding consistent with a heterozygous mutation (Figure 1, middle panel). In this case, nucleotide sequencing showed a deletion of two bases at codon 327 in one of the two BRCA1 alleles. This mutation shifted the codon reading frame and accounted for premature chain termination (Figure 1, bottom panel). In Patient 364, a truncated protein product was traced to a nonsense mutation at codon 563 (Table 2Table 2
BRCA1 Mutations in Women with Breast Cancer before the Age of 30.).Automated Sequencing of the BRCA1 Coding Region
We sequenced the entire coding region of the BRCA1 in the 30 women who had breast cancer before the age of 30 (Table 2). In addition to Patients 99 and 364, two unrelated patients, Patients 231 and 253, had the same mutation, a heterozygous deletion of two nucleotides at codon 23 that leads to a frame shift and premature chain termination. The mutation was not detected by the PTT assay, because it was in the first coding exon and encoded a peptide only 39 amino acids long. This mutation, called 185delAG, has been found in patients with BRCA1-linked familial breast cancer.7,23 It was also found in 1 percent of 858 samples from people of Ashkenazi Jewish origin living in the United States and Israel — a prevalence consistent with the hypothesis that the mutation was inherited from a common ancestor in this Jewish population.19
The presence of 4 women with definite BRCA1 mutations (i.e., mutations resulting in unambiguous inactivation of the gene product) among 30 women who had breast cancer before age 30 yielded a significantly higher proportion (13 percent; 95 percent confidence interval, 4 to 31 percent) than did the 1 in 833 calculated for the general white population24 (P<0.001). Surprisingly, none of three women with definite family histories of breast cancer and only one of three women with bilateral tumors had BRCA1 mutations, indicating that BRCA1 contributes to the genetic predisposition to breast cancer in some cases but that other genetic factors also play a part.
Nucleotide-sequencing analysis also identified a missense mutation in Patient 285: a substitution of guanosine for adenosine at codon 1606, which produces a substitution of glutamic acid for lysine in the predicted protein sequence. This mutation has not been observed in BRCA1-linked breast cancer families, nor has it been reported as a common polymorphism in the general population3-7 (and the Breast Cancer Information Core electronic data base). This patient had no relatives with breast cancer who could be tested for the mutant allele. In her primary tumor, homozygosity for the mutant allele, which is characteristic of disease-associated mutations, was not found. The functional consequences of this amino acid substitution are therefore unknown. We detected six other nucleotide substitutions in BRCA1 in several patients (Table 2). Three of these substitutions were silent, and three resulted in amino acid changes. The common occurrence of these BRCA1 substitutions in the general population3-7 (and the Breast Cancer Information Core data base) suggests that they are polymorphic variants with no clinical relevance.
Prevalence of the 185delAG Mutation in Jewish Women with Early-Onset Breast Cancer
The 1 percent prevalence of the BRCA1 mutation 185delAG (at codon 23) in the Jewish population of Eastern European ancestry19 has aroused concern about its predictive value for breast cancer. It is possible that most Jewish women with the mutation do not have the same risk of breast cancer as women with a clearly defined history of familial cancer.24 We determined the prevalence of the 185delAG mutation in Jewish women with early-onset breast cancer, using an allele-specific PCR assay whose results were verified by nucleotide sequencing. Among the 30 women who had breast cancer diagnosed before the age of 30, 2 of 4 Jewish women carried the 185delAG mutation. We extended our analysis to the 388 women who were given a diagnosis of breast cancer between ages of 30 and 40. We found that 6 of 35 Jewish women in this group carried the mutation.
None of the eight Jewish women with the 185delAG mutation had a definite family history of breast cancer. However, 7 of the 8 had at least one affected first- or second-degree relative, as compared with 13 of the 31 Jewish women without this mutation (P = 0.02) (Table 3Table 3
Incidence of the BRCA1 Mutation 185delAG among Jewish Women with the Onset of Breast Cancer at or before the Age of 40.). Furthermore, breast cancer was diagnosed in 10 of 43 women (23 percent) who were first- or second-degree relatives of the carriers of the 185delAG mutation, as compared with 20 of 168 women (12 percent) who were related to the Jewish women without the mutation (P = 0.06). Thus, the 185delAG mutation was associated with a family history of breast cancer, although large-scale population studies will be needed to determine the exact penetrance of this mutant BRCA1 allele.Discussion
We found an increased prevalence of germ-line mutations in the BRCA1 gene among women with early-onset breast cancer. Among 30 women in whom breast cancer was diagnosed before the age of 30, we identified 4 who had definite germ-line BRCA1 mutations that caused premature termination of protein translation (13 percent) and 1 who had a missense mutation. The mutations in 3 of the 26 non-Jewish women were distributed throughout the BRCA1 coding sequence, a feature characteristic of the inactivation of tumor-susceptibility genes. The broad distribution of these mutations greatly complicates their detection. In addition, caution is required in interpreting amino acid substitutions, because distinguishing novel missense mutations from clinically unimportant polymorphisms is difficult. Therefore, only BRCA1 mutations that cause premature chain termination and missense mutations previously documented in familial breast and ovarian cancer should be considered definite mutations.
In contrast to the varied BRCA1 mutations in the non-Jewish population, the specific BRCA1 mutation we studied, 185delAG, was found frequently among young Jewish women with breast cancer. Given that this mutation has a prevalence of 1 percent in the Jewish population and a prevalence of 21 percent (95 percent confidence interval, 9 to 36 percent) among Jewish women with breast cancer at or before the age of 40, carriers of the 185delAG mutation appear to have a 27-fold increase in the risk of early-onset breast cancer (lower bound of the 97.5 percent confidence interval, 10). This indicates an attributable risk (the fraction of early-onset breast cancer in Jewish women that is due to this mutation) of approximately 20 percent (95 percent confidence interval, 6 to 31 percent). Caution has been urged in interpreting the risk of cancer associated with the 185delAG mutation in women who do not have a history of familial cancer.19,24 The penetrance of this allele is unknown in members of the general population who have not been selected on the basis of such history. It has been thought unlikely that 1 percent of Jewish families might share the severe cancer phenotype characteristic of BRCA1-associated familial breast cancer. Only large, prospective population studies can define the risk of breast and ovarian cancer associated with the 185delAG mutation. Given that the incidence of breast cancer by the age of 40 in the U.S. population is 1 in 217 (0.5 percent),17 we calculate that the predictive value of the 185delAG mutation for the development of breast cancer at or before the age of 40 is 9 percent. This estimate could be higher if the rate of early-onset breast cancer in the Jewish population exceeds that in the non-Jewish population. The lifetime risk of breast cancer associated with the 185delAG mutation in the general population is uncertain. Our calculation that 20 percent (range, 6 to 31 percent) of cases of breast cancer at or before the age of 40 in Jewish women are linked to the 185delAG mutation is similar to the attributable risk of 16 percent (range, 7 to 23 percent) predicted by Struewing and coworkers,19 who used age-specific penetrance rates derived from kindreds with familial breast cancer. In the general population, therefore, it is possible that the lifetime risk of cancer associated with the 185delAG mutation approaches that observed in such families.
Since the relative contribution of genetic factors to breast cancer declines markedly with age, the prevalence of the 185delAG mutation among older Jewish women with breast cancer (those over 40) is likely to be considerably lower. Genetic testing is therefore likely to be most effective in young Jewish women with breast cancer, among whom it may open the possibility of cancer prevention, early detection of second tumors, and genetic counseling for the women and their first- and second-degree relatives. The increased risk of early-onset breast cancer among carriers of the 185delAG mutation also suggests that intensified screening for breast cancer should start at an early age. However, testing for the 185delAG mutation in the general Ashkenazi Jewish population should await larger population-based studies that confirm the penetrance of 185delAG and the formulation of guidelines for the genetic counseling and clinical care of women who carry the mutation.
Supported in part by grants (to the Center for Cancer Risk Analysis) from the Massachusetts General Hospital and Oncor.
We are indebted to the women who participated in this study and to their referring physicians; to Mel Kronick and Morgan Conrad (of Applied Biosystems) for advice and for providing sequencing-analysis programs still in development; to Marga White and Lisa Sadzewicz (of OncorMed) for sharing reagents and information about BRCA1 sequencing protocols; and to the members of the Breast Cancer Information Core data base, in particular Roger Wiseman and Barbara Weber for sharing sequencing information and data on BRCA1 polymorphisms.
Source Information
From the Center for Cancer Risk Analysis and the Massachusetts General Hospital Cancer Center, Charlestown, Mass. (M.G.F., D.J.M., M.K., I.H., E.O., H.U., S.S.-A., P.B.-R., C.E., K.J.I., S.H.F., D.A.H.); and the Departments of Pathology (D.C.S.) and Medical and Surgical Oncology (D.M.F., B.L.S., J.W.Y., D.A.H.), Massachusetts General Hospital; the Department of Biostatistics, Harvard School of Public Health (D.M.F.); Dana–Farber Cancer Institute (J.E.G.); Beth Israel Hospital (R.B.D.); and Faulkner Hospital (K.A.M.) — all in Boston.
Address reprint requests to Dr. Haber at MGH Cancer Center, CNY7, Bldg. 149, Charlestown, MA 02129.
- References
References
1
Miki Y ,Swensen J ,Shattuck-Eidens D , et al. A strong candidate for the breast and ovarian cancer susceptibility gene BRCA1. Science 1994;266:66-71
CrossRef | Web of Science | Medline2
Hall JM ,Lee MK ,Newman B , et al. Linkage of early-onset familial breast cancer to chromosome 17q21. Science 1990;250:1684-1689
CrossRef | Web of Science | Medline3
Futreal PA ,Liu Q ,Shattuck-Eidens D , et al. BRCA1 mutations in primary breast and ovarian carcinomas. Science 1994;266:120-122
CrossRef | Web of Science | Medline4
Castilla LH ,Couch FJ ,Erdos MR , et al. Mutations in the BRCA1 gene in families with early-onset breast and ovarian cancer. Nat Genet 1994;8:387-391
CrossRef | Web of Science | Medline5
Simard J ,Tonin P ,Durocher F , et al. Common origins of BRCA1 mutations in Canadian breast and ovarian cancer families. Nat Genet 1994;8:392-398
CrossRef | Web of Science | Medline6
Friedman LS ,Ostermeyer EA ,Szabo CI , et al. Confirmation of BRCA1 by analysis of germline mutations linked to breast and ovarian cancer in ten families. Nat Genet 1994;8:399-404
CrossRef | Web of Science | Medline7
Shattuck-Eidens D ,McClure M ,Simard J , et al. A collaborative survey of 80 mutations in the BRCA1 breast and ovarian cancer susceptibility gene: implications for presymptomatic testing and screening. JAMA 1995;273:535-541
CrossRef | Web of Science | Medline8
Easton DF, Bishop DT, Ford D, Crockford GP, Breast Cancer Linkage Consortium
Web of Science | Medline9
Rowell S ,Newman B ,Boyd J ,King MC . Inherited predisposition to breast and ovarian cancer. Am J Hum Genet 1994;55:861-865
Web of Science | Medline10
Colditz GA ,Willett WC ,Hunter DJ , et al. Family history, age, and risk of breast cancer: prospective data from the Nurses' Health Study. JAMA 1993;270:338-343[Erratum, JAMA 1993;270:1548.]
CrossRef | Web of Science | Medline11
Slattery ML ,Kerber RA . A comprehensive evaluation of family history and breast cancer risk: the Utah Population Database. JAMA 1993;270:1563-1568
CrossRef | Web of Science | Medline12
Harris JR ,Lippman ME ,Veronesi U ,Willett W . Breast cancer. N Engl J Med 1992;327:319-28, 390
Full Text | Web of Science | Medline13
Knudson AG Jr . Mutation and cancer: a statistical study of retinoblastoma. Proc Natl Acad Sci U S A 1971;68:820-823
CrossRef | Web of Science | Medline14
Haber DA ,Housman DE . Rate-limiting steps: the genetics of pediatric cancers. Cell 1991;64:5-8
CrossRef | Web of Science | Medline15
Cannon-Albright LA ,Skolnick MH ,Bishop DT ,Lee RG ,Burt RW . Common inheritance of susceptibility to colonic adenomatous polyps and associated colorectal cancers. N Engl J Med 1988;319:533-537
Full Text | Web of Science | Medline16
Powell SM ,Petersen GM ,Krush AJ , et al. Molecular diagnosis of familial adenomatous polyposis. N Engl J Med 1993;329:1982-1987
Full Text | Web of Science | Medline17
Ries LAG, Miller BA, Hankey BR, Kosary CL, Harras A, Edwards BK, eds. SEER cancer statistics review, 1973-1991: tables and graphs. Bethesda, Md.: National Cancer Institute, 1994. (NIH publication no. 94-2789.)
18
Claus EB ,Risch N ,Thompson WD . Genetic analysis of breast cancer in the cancer and steroid hormone study. Am J Hum Genet 1991;48:232-242
Web of Science | Medline19
Struewing JP ,Abeliovich D ,Peretz T , et al. The carrier frequency of the BRCA1 185delAG mutation is approximately 1 percent in Ashkenazi Jewish individuals. Nat Genet 1995;11:198-200
CrossRef | Web of Science | Medline20
van der Luijt R ,Khan PM ,Vasen H , et al. Rapid detection of translation-terminating mutations at the adenomatous polyposis coli (APC) gene by direct protein truncation test. Genomics 1994;20:1-4
CrossRef | Web of Science | Medline21
Hogervorst FBL ,Cornelis RS ,Bout M , et al. Rapid detection of BRCA1 mutations by the protein truncation test. Nat Genet 1995;10:208-212
CrossRef | Web of Science | Medline22
Fleiss JL. Statistical methods for rates and proportions. 2nd ed. New York: John Wiley, 1981.
23
Struewing JP ,Brody LC ,Erdos MR , et al. Detection of eight BRCA1 mutations in 10 breast/ovarian cancer families, including 1 family with male breast cancer. Am J Hum Genet 1995;57:1-7
Web of Science | Medline24
Goldgar DE ,Reilly PR . A common BRCA1 mutation in the Ashkenazim. Nat Genet 1995;11:113-114
CrossRef | Web of Science | Medline
- Citing Articles (140)
Citing Articles
1
Lucian Negura, Nancy Uhrhammer, Anca Negura, Vlad Artenie, Eugen Carasevici, Yves-Jean Bignon. (2010) Complete BRCA mutation screening in breast and ovarian cancer predisposition families from a North-Eastern Romanian population. Familial Cancer 9:4, 519-523
CrossRef2
Ava Kwong, E. K. O. Ng, F. B. F. Law, L. P. Wong, M. Y. To, M. T. Cheung, H. N. Wong, V. W. Chan, Allison Kurian, D. W. West, J. M. Ford, E. S. K. Ma. (2010) High-resolution melting analysis for rapid screening of BRCA2 founder mutations in Southern Chinese breast cancer patients. Breast Cancer Research and Treatment 122:2, 605-607
CrossRef3
Sarinah Basro, Justus P. Apffelstaedt. (2010) Breast Cancer in Young Women in a Limited-Resource Environment. World Journal of Surgery 34:7, 1427-1433
CrossRef4
Atif Khan, Bruce G. Haffty. (2010) Breast-Conserving Therapy in Women with BRCA1/BRCA2-Associated Breast Cancer. Current Breast Cancer Reports 2:2, 90-95
CrossRef5
K. J. Ruddy, S. Gelber, J. Shin, J. E. Garber, R. Rosenberg, M. Przypysny, A. H. Partridge. (2010) Genetic testing in young women with breast cancer: results from a Web-based survey. Annals of Oncology 21:4, 741-747
CrossRef6
D G R Evans, A Moran, R Hartley, J Dawson, B Bulman, F Knox, A Howell, F Lalloo. (2010) Long-term outcomes of breast cancer in women aged 30 years or younger, based on family history, pathology and BRCA1/BRCA2/TP53 status. British Journal of Cancer 102:7, 1091-1098
CrossRef7
Takashi Yoshida, Hiroyuki Takei, Masafumi Kurosumi, Jun Ninomiya, Yuko Ishikawa, Yuji Hayashi, Katsunori Tozuka, Hanako Oba, Kaori Kawanowa, Kenichi Inoue, Toshio Tabei. (2010) True Recurrences and New Primary Tumors Have Different Clinical Features in Invasive Breast Cancer Patients with Ipsilateral Breast Tumor Relapse After Breast-Conserving Treatment. The Breast Journal 16:2, 127-133
CrossRef8
Helen Hanson, Shirley Hodgson. (2010) Cancer genetics and reproduction. Best Practice & Research Clinical Obstetrics & Gynaecology 24:1, 3-18
CrossRef9
Wendy K. Chung. 2010. Gender Differences in Hereditary Cancer SyndromesRisks, Management, and Testing for Inherited Predisposition to Cancer. , 481-494.
CrossRef10
E Hiripi, J Lorenzo Bermejo, X Li, J Sundquist, K Hemminki. (2009) Familial association of pancreatic cancer with other malignancies in Swedish families. British Journal of Cancer 101:10, 1792-1797
CrossRef11
Weiqiu Chen, Kaifeng Pan, Tao Ouyang, Jinfeng Li, Tianfeng Wang, Zhaoqing Fan, Tie Fan, Benyao Lin, Youyong Lu, Weicheng You, Yuntao Xie. (2009) BRCA1 germline mutations and tumor characteristics in Chinese women with familial or early-onset breast cancer. Breast Cancer Research and Treatment 117:1, 55-60
CrossRef12
Xiao-Yun Yang, Ming-Rong Xi, Kai-Xuan Yang, Hai Yu. (2009) Prognostic value of estrogen receptor and progesterone receptor status in young Chinese ovarian carcinoma patients. Gynecologic Oncology 113:1, 99-104
CrossRef13
W-H Kuo, A M-F Yen, P-H Lee, K-M Chen, J Wang, K-J Chang, T H-H Chen, H-S Tsau. (2009) Cumulative survival in early-onset unilateral and bilateral breast cancer: an analysis of 1907 Taiwanese women. British Journal of Cancer 100:4, 563-570
CrossRef14
Johannes Lodewikus Roos, Herman Walter Pretorius, Maria Karayiorgou. (2009) Clinical Characteristics of an Afrikaner Founder Population Recruited for a Schizophrenia Genetic Study. Annals of the New York Academy of Sciences 1151:1, 85-101
CrossRef15
Inbal Kedar-Barnes, Paul Rozen, Mordechai Shohat, Hagit N Baris. 2008. Genetic Disease in the Ashkenazim: Role of a Founder Effect. .
CrossRef16
Wen-Feng Li, Zhen Hu, Nan-Yan Rao, Chuang-Gui Song, Bin Zhang, Ming-Zhi Cao, Feng-Xi Su, Yong-Sheng Wang, Ping-Qing He, Gen-Hong Di, Kun-Wei Shen, Jiong Wu, Jin-Song Lu, Jian-Min Luo, Xiao-Yi Liu, Jie Zhou, Lei Wang, Lin Zhao, Yan-Bing Liu, Wen-Tao Yuan, Lin Yang, Zhen-Zhou Shen, Wei Huang, Zhi-Ming Shao. (2008) The prevalence of BRCA1 and BRCA2 germline mutations in high-risk breast cancer patients of Chinese Han nationality: two recurrent mutations were identified. Breast Cancer Research and Treatment 110:1, 99-109
CrossRef17
Olalla Robles, Teresa Blaxton, Helene Adami, Celso Arango, Gunvant Thaker, James Gold. (2008) Nonverbal Delayed Recognition in the Relatives of Schizophrenia Patients With or Without Schizophrenia Spectrum. Biological Psychiatry 63:5, 498-504
CrossRef18
Daphne W. Bell, Sang H. Kim, Andrew K. Godwin, Taryn A. Schiripo, Patricia L. Harris, Sara M. Haserlat, Doke C.R. Wahrer, Christopher A. Haiman, Mary B. Daly, Kristin B. Niendorf, Matthew R. Smith, Dennis C. Sgroi, Judy E. Garber, Olufunmilayo I. Olopade, Loic Le Marchand, Brian E. Henderson, David Altshuler, Daniel A. Haber, Matthew L. Freedman. (2007) Genetic and functional analysis ofCHEK2 (CHK2) variants in multiethnic cohorts. International Journal of Cancer 121:12, 2661-2667
CrossRef19
Jeong Kyeung Kim, Beom Seok Kwak, Jung Sun Lee, Soo Jung Hong, Hee Jeong Kim, Byung Ho Son, Sei Hyun Ahn. (2007) Do Very Young Korean Breast Cancer Patients Have Worse Outcomes?. Annals of Surgical Oncology 14:12, 3385-3391
CrossRef20
T. Malati. (2007) Tumour markers: An overview. Indian Journal of Clinical Biochemistry 22:2, 17-31
CrossRef21
C Apicella, JG Dowty, GS Dite, MA Jenkins, RT Senie, MB Daly, IL Andrulis, EM John, SS Buys, FP Li, G Glendon, W Chung, H Ozcelik, A Miron, K Kotar, MC Southey, WD Foulkes, JL Hopper. (2007) Validation study of the lambda model for predicting the BRCA1 or BRCA2 mutation carrier status of North American Ashkenazi Jewish women. Clinical Genetics 72:2, 87-97
CrossRef22
Rongwei Fu, Emily L. Harris, Mark Helfand, Heidi D. Nelson. (2007) Estimating risk of breast cancer in carriers ofBRCA1 andBRCA2 mutations: a meta-analytic approach. Statistics in Medicine 26:8, 1775-1787
CrossRef23
P. Gajalakshmi, Thanemozhi G. Natarajan, Deepa Selvi Rani, K. Thangaraj. (2007) A novel BRCA1 mutation in an Indian family with hereditary breast/ovarian cancer. Breast Cancer Research and Treatment 101:1, 3-6
CrossRef24
Chuan-Gui Song, Zhen Hu, Jiong Wu, Jian-Min Luo, Zhen-Zhou Shen, Wei Huang, Zhi-Ming Shao. (2006) The prevalence of BRCA1 and BRCA2 mutations in eastern Chinese women with breast cancer. Journal of Cancer Research and Clinical Oncology 132:10, 617-626
CrossRef25
H.L. Neville-Webbe, C.A. Evans, R.E. Coleman, I. Holen. (2006) Mechanisms of the Synergistic Interaction between the Bisphosphonate Zoledronic Acid and the Chemotherapy Agent Paclitaxel in Breast Cancer Cells in vitro. Tumor Biology 27:2, 92-103
CrossRef26
Eduardo Nagore, Alegr??a Montoro, Silvestre Oltra, Eduardo Ledesma, Rafael Botella-Estrada, Jos?? M. Mill??n, Vicente Oliver, Jos?? M. Fortea, Carlos Guill??n. (2005) Age does not appear to be a major indicator of CDKN2A or CDK4 mutations in melanoma patients in Spain. Melanoma Research 15:6, 555-558
CrossRef27
Kathleen K. Oros, Parviz Ghadirian, Celia M.T Greenwood, Chantal Perret, Zhen Shen, Yosabeth Paredes, Suzanna L. Arcand, Anne-Marie Mes-Masson, Steven A. Narod, William D. Foulkes, Diane Provencher, Patricia N. Tonin. (2004) Significant proportion of breast and/or ovarian cancer families of French Canadian descent harbor 1 of 5BRCA1 andBRCA2 mutations. International Journal of Cancer 112:3, 411-419
CrossRef28
Ping Zhou, Abram Recht. (2004) Young age and outcome for women with early-stage invasive breast carcinoma. Cancer 101:6, 1264-1274
CrossRef29
Lesley Andrews, Bettina Meiser, Carmel Apicella, Katherine Tucker. (2004) Psychological Impact of Genetic Testing for Breast Cancer Susceptibility in Women of Ashkenazi Jewish Background: A Prospective Study. Genetic Testing 8:3, 240-247
CrossRef30
Inbal Kedar-Barnes, Paul Rozen. (2004) The Jewish people: their ethnic history, genetic disorders and specific cancer susceptibility. Familial Cancer 3:3-4, 193-199
CrossRef31
Sharon A. Savage, Stephen J. Chanock. (2004) Using germ-line genetic variation to investigate and treat cancer. Drug Discovery Today 9:14, 610-618
CrossRef32
André Nkondjock, Parviz Ghadirian. (2004) Epidemiology of breast cancer among BRCA mutation carriers: an overview. Cancer Letters 205:1, 1-8
CrossRef33
Wendy S. Rubinstein. (2004) Hereditary breast cancer in Jews. Familial Cancer 3:3-4, 249-257
CrossRef34
Eliot M. Rosen, Saijun Fan, Richard G. Pestell, Itzhak D. Goldberg. (2003) BRCA1 gene in breast cancer. Journal of Cellular Physiology 196:1, 19-41
CrossRef35
Elizabeth B. Claus, Meredith Stowe, Darryl Carter. (2003) Family History of Breast and Ovarian Cancer and the Risk of Breast Carcinoma in situ. Breast Cancer Research and Treatment 78:1, 7-15
CrossRef36
G. Marie Swanson, Sandra Z. Haslam, Faouzi Azzouz. (2003) Breast cancer among young African-American women. Cancer 97:S1, 273-279
CrossRef37
Wen-Ying Lee. (2002) Applied Immunohistochemistry 10:4, 310-315
CrossRef38
Eugene Huang, Thomas A. Buchholz, Funda Meric, Savitri Krishnamurthy, Nadeem Q. Mirza, Frederick C. Ames, Barry W. Feig, Henry M. Kuerer, Merrick I. Ross, S. Eva Singletary, Marsha D. McNeese, Eric A. Strom, Kelly K. Hunt. (2002) Classifying local disease recurrences after breast conservation therapy based on location and histology. Cancer 95:10, 2059-2067
CrossRef39
G COUKOS, S RUBIN. (2002) Prophylactic oophorectomy. Best Practice & Research Clinical Obstetrics & Gynaecology 16:4, 597-609
CrossRef40
Lindsay Middelton, Eileen Dimond, Kathleen Calzone, Joie Davis, Jean Jenkins. (2002) The Role of the Nurse in Cancer Genetics. Cancer Nursing 25:3, 196-206
CrossRef41
Bruce G Haffty, Elizabeth Harrold, Atif J Khan, Pradip Pathare, Tanya E Smith, Bruce C Turner, Peter M Glazer, Barbara Ward, Daryl Carter, Ellen Matloff, Allen E Bale, Mayra Alvarez-Franco. (2002) Outcome of conservatively managed early-onset breast cancer by BRCA1/2 status. The Lancet 359:9316, 1471-1477
CrossRef42
Kristen M. Shannon, Marcie L. Lubratovich, Dianne M. Finkelstein, Barbara L. Smith, Simon N. Powell, Michael V. Seiden. (2002) Model-based predictions of BRCA1/2 mutation status in breast carcinoma patients treated at an academic medical center. Cancer 94:2, 305-313
CrossRef43
Nelson L.S Tang, K.W Choy, C.P Pang, W Yeo, P.J Johnson. (2001) Prevalence of breast cancer predisposition gene mutations in Chinese women and guidelines for genetic testing. Clinica Chimica Acta 313:1-2, 179-185
CrossRef44
N. Loman, O. Johannsson, U. Kristoffersson, H. Olsson, A. Borg. (2001) Family History of Breast and Ovarian Cancers and BRCA1 and BRCA2 Mutations in a Population-Based Series of Early-Onset Breast Cancer. JNCI Journal of the National Cancer Institute 93:16, 1215-1223
CrossRef45
Marc D. Schwartz, Judith Benkendorf, Caryn Lerman, Claudine Isaacs, Anna Ryan-Robertson, Lenora Johnson. (2001) Impact of educational print materials on knowledge, attitudes, and interest in BRCA1/BRCA2. Cancer 92:4, 932-940
CrossRef46
L Barr, D.G Evans. (2001) There may never be a final cure for breast cancer. European Journal of Surgical Oncology (EJSO) 27:4, 338-339
CrossRef47
Patricia N. Tonin, Chantal Perret, Julie A. Lambert, Anne-Jos
e Paradis, Tania Kantemiroff, Marie-H
CrossRef48
Sharon B. Cantor, Daphne W. Bell, Shridar Ganesan, Elizabeth M. Kass, Ronny Drapkin, Steven Grossman, Doke C.R. Wahrer, Dennis C. Sgroi, William S. Lane, Daniel A. Haber, David M. Livingston. (2001) BACH1, a Novel Helicase-like Protein, Interacts Directly with BRCA1 and Contributes to Its DNA Repair Function. Cell 105:1, 149-160
CrossRef49
A Ghaderi, A Talei, S Farjadian, A Mosalaei, M Doroudchi, H Kimura. (2001) Germline BRCA1 mutations in Iranian women with breast cancer. Cancer Letters 165:1, 87-94
CrossRef50
Linda A. Jacobs. (2001) Jewish Culture, Health Belief Systems, and Genetic Risk for Cancer. Nursing Forum 36:2, 5-12
CrossRef51
Brita Arver, Åke Borg, Annika Lindblom. (2001) First BRCA1 and BRCA2 Gene Testing Implemented in the Health Care System of Stockholm. Genetic Testing 5:1, 1-8
CrossRef52
Nancy A. Press, Yutaka Yasui, Susan Reynolds, Sharon J. Durfy, Wylie Burke. (2001) Women's interest in genetic testing for breast cancer susceptibility may be based on unrealistic expectations. American Journal of Medical Genetics 99:2, 99-110
CrossRef53
Charis Eng, Heather Hampel, Albert de la Chapelle. (2001) G
ENETIC TESTING FOR CANCER PREDISPOSITION . Annual Review of Medicine 52:1, 371-400
CrossRef54
Noriko Ikeda, Yasuo Miyoshi, Kohri Yoneda, Eiichi Shiba, Yoshizo Sekihara, Moritoshi Kinoshita, Shinzaburo Noguchi. (2001) Frequency ofBRCA1 andBRCA2 germline mutations in Japanese breast cancer families. International Journal of Cancer 91:1, 83-88
CrossRef55
Yitshak Kreiss, Frida Barak, Ruth Gershoni Baruch, Ephrat Levy-Lahad, Elon Pras, Eitan Friedman. (2000) The Founder Mutations in the BRCA1 , BRCA2 , and ATM Genes in Moroccan Jewish Women with Breast Cancer. Genetic Testing 4:4, 403-407
CrossRef56
D Turchetti, L Cortesi, M Federico, C Bertoni, L Mangone, Se Ferrari, V Silingardi. (2000) BRCA1 mutations and clinicopathological features in a sample of Italian women with early-onset breast cancer. European Journal of Cancer 36:16, 2083-2089
CrossRef57
Ami Fishman, Eyal Dekel, Angela Chetrit, Liat Lerner-Geva, Amiram Bar-Am, Dan Beck, Uziel Beller, Gilad Ben-Baruch, Benjamin Piura, Eitan Friedman, Jeffery P. Struewing, Baruch Modan. (2000) Patients with Double Primary Tumors in the Breast and Ovary— Clinical Characteristics and BRCA1–2 Mutations Status. Gynecologic Oncology 79:1, 74-78
CrossRef58
Ellen T Matloff. (2000) The breast surgeon’s role in BRCA1 and BRCA2 testing. The American Journal of Surgery 180:4, 294-298
CrossRef59
Brita Arver, Quan Du, Jindong Chen, Liping Luo, Annika Lindblom. (2000) Hereditary breast cancer: a review. Seminars in Cancer Biology 10:4, 271-288
CrossRef60
Mary E. Barcus, Andrea Ferreira-Gonzalez, Arlene M. Buller, David S. Wilkinson, Carleton T. Garrett. (2000) Genetic changes in solid tumors. Seminars in Surgical Oncology 18:4, 358-370
CrossRef61
Pierre O. Chappuis, Victoria Nethercot, William D. Foulkes. (2000) Clinico-pathological characteristics of BRCA1- and BRCA2-related breast cancer. Seminars in Surgical Oncology 18:4, 287-295
CrossRef62
Graciela Kuperstein, William D Foulkes, Parviz Ghadirian, Jalil Hakimi, Steven A Narod. (2000) A rapid fluorescent multiplexed-PCR analysis (FMPA) for founder mutations in the BRCA1 and BRCA2 genes. Clinical Genetics 57:3, 213-220
CrossRef63
Ephrat Levy-Lahad, Michal Krieger, Orit Gottfeld, Paul Renbaum, Gaya Klein, Shlomit Eisenberg, Amnon Lahad, Bella Kaufman, Raphael Catane. (2000) BRCA1 and BRCA2 mutation carriers as potential candidates for chemoprevention trials. Journal of Cellular Biochemistry 77:S34, 13-18
CrossRef64
William E. Richards, Holly H. Gallion, Jason P. Schmittschmitt, Dawn V. Holladay, Simon A. Smith. (1999) BRCA1-Related and Sporadic Ovarian Cancer in the Same Family: Implications for Genetic Testing. Gynecologic Oncology 75:3, 468-472
CrossRef65
John F. Stratton, Deborah Thompson, Lynda Bobrow, Neha Dalal, Martin Gore, D.T. Bishop, Ian Scott, Gareth Evans, Peter Daly, Douglas F. Easton, Bruce A.J. Ponder. (1999) The Genetic Epidemiology of Early-Onset Epithelial Ovarian Cancer: A Population-Based Study. The American Journal of Human Genetics 65:6, 1725-1732
CrossRef66
R Eeles. (1999) Screening for hereditary cancer and genetic testing, epitomised by breast cancer. European Journal of Cancer 35:14, 1954-1962
CrossRef67
Susan L. Neuhausen. (1999) Ethnic differences in cancer risk resulting from genetic variation. Cancer 86:S11, 2575-2582
CrossRef68
Rob Nicolson, Judith L Rapoport. (1999) Childhood-onset schizophrenia: rare but worth studying. Biological Psychiatry 46:10, 1418-1428
CrossRef69
Susan L. Neuhausen. (1999) Ethnic differences in cancer risk resulting from genetic variation. Cancer 86:S8, 1755-1762
CrossRef70
Kent L. Nastiuk, Mahesh Mansukhani, Mary Beth Terry, Piyumika Kularatne, Mark A. Rubin, Jonathan Melamed, Marilie D. Gammon, Michael Ittmann, John J. Krolewski. (1999) Common mutations in BRCA1 and BRCA2 do not contribute to early prostate cancer in Jewish men. The Prostate 40:3, 172-177
CrossRef71
E. Warner, W. Foulkes, P. Goodwin, W. Meschino, J. Blondal, C. Paterson, H. Ozcelik, P. Goss, D. Allingham-Hawkins, N. Hamel, L. Di Prospero, V. Contiga, C. Serruya, M. Klein, R. Moslehi, J. Honeyford, A. Liede, G. Glendon, J.-S. Brunet, S. Narod. (1999) Prevalence and Penetrance of BRCA1 and BRCA2 Gene Mutations in Unselected Ashkenazi Jewish Women With Breast Cancer. JNCI Journal of the National Cancer Institute 91:14, 1241-1247
CrossRef72
Fran
CrossRef73
J. Peto, N. Collins, R. Barfoot, S. Seal, W. Warren, N. Rahman, D. F. Easton, C. Evans, J. Deacon, M. R. Stratton. (1999) Prevalence of BRCA1 and BRCA2 Gene Mutations in Patients With Early-Onset Breast Cancer. JNCI Journal of the National Cancer Institute 91:11, 943-949
CrossRef74
Thomas S Frank. (1999) Laboratory identification of hereditary risk of breast and ovarian cancer. Current Opinion in Biotechnology 10:3, 289-294
CrossRef75
Cindy L. Carter, B. Jo Hailey. (1999) Psychological Issues in Genetic Testing for Breast Cancer. Women & Health 28:4, 73-91
CrossRef76
P. Devilee. (1999) BRCA1 and BRCA2 Testing: Weighing the Demand against the Benefits. The American Journal of Human Genetics 64:4, 943-948
CrossRef77
Nazneen Rahman, Michael R. Stratton. (1998) THE GENETICS OF BREAST CANCER SUSCEPTIBILITY. Annual Review of Genetics 32:1, 95-121
CrossRef78
Rajvir Dahiya, Guoren Deng. (1998) Molecular prognostic markers in breast cancer. Breast Cancer Research and Treatment 52:1-3, 185-200
CrossRef79
Patricia N. Tonin, Anne-Marie Mes-Masson, P. Andrew Futreal, Kenneth Morgan, Michelle Mahon, William D. Foulkes, David E.C. Cole, Diane Provencher, Parviz Ghadirian, Steven A. Narod. (1998) Founder BRCA1 and BRCA2 Mutations in French Canadian Breast and Ovarian Cancer Families. The American Journal of Human Genetics 63:5, 1341-1351
CrossRef80
Edison T. Liu. (1998) The uncoupling of race and cancer genetics. Cancer 83:S8, 1765-1769
CrossRef81
James W. Hampton, James F. Maher. (1998) Pedigree analysis of breast cancer in oklahoma indian women. Cancer 83:S8, 1796-1798
CrossRef82
Beverly J Lynch, Joseph A Holden, Saundra S Buys, Susan L Neuhausen, David K Gaffney. (1998) Pathobiologic characteristics of hereditary breast cancer. Human Pathology 29:10, 1140-1144
CrossRef83
Mary K. Anglin. (1998) Dismantling the master's house: Cancer activists, discourses of prevention, and environmental justice. Identities 5:2, 183-217
CrossRef84
Alexander Liede, Kelly Metcalfe, Kenneth Offit, Karen Brown, Shari Miller, Steven A. Narod, Roxana Moslehi. (1998) A family with three germline mutations in BRCAl and BRCA2. Clinical Genetics 54:3, 215-218
CrossRef85
Jacqueline Taylor, Margarita Lymboura, Paul E. Pace, Roger P. A'hern, Anil J. Desai, Sami Shousha, R. Charles Coombes, Simak Ali. (1998) An important role for BRCA1 in breast cancer progression is indicated by its loss in a large proportion of non-familial breast cancers. International Journal of Cancer 79:4, 334-342
CrossRef86
Giske Ursin, Ronald K. Ross, Jane Sullivan-Halley, Rosemarie Hanisch, Brian Henderson, Leslie Bernstein. (1998) Use of oral contraceptives and risk of breast cancer in young women. Breast Cancer Research and Treatment 50:2, 175-184
CrossRef87
Flora H. Fodor, Ainsley Weston, Ira J. Bleiweiss, Leslie D. McCurdy, Mary M. Walsh, Paul I. Tartter, Steven T. Brower, Christine M. Eng. (1998) Frequency and Carrier Risk Associated with Common BRCA1 and BRCA2 Mutations in Ashkenazi Jewish Breast Cancer Patients. The American Journal of Human Genetics 63:1, 45-51
CrossRef88
BARBARA A. KOENIG, HENRY T. GREELY, LAURA M. McCONNELL, HEATHER L. SILVERBERG, THOMAS A. RAFFIN. (1998) Genetic Testing for BRCA1 and BRCA2 : Recommendations of the Stanford Program in Genomics, Ethics, and Society. Journal of Women's Health 7:5, 531-545
CrossRef89
Daniel A Haber, Eric R Fearon. (1998) The promise of cancer genetics. The Lancet 351, SII1-SII8
CrossRef90
Lawrence C Brody, Barbara Bowles Biesecker. (1998) Breast Cancer Susceptibility Genes. Medicine 77:3, 208-226
CrossRef91
G. Bruce Mann, Patrick I. Borgen. (1998) Breast cancer genes and the surgeon. Journal of Surgical Oncology 67:4, 267-274
CrossRef92
Jill Greenman, Shehla Mohammed, David Ellis, Sally Watts, Gillian Scott, Louise Izatt, Diana Barnes, Ellen Solomon, Shirley Hodgson, Christopher Mathew. (1998) Identification of missense and truncating mutations in theBRCA1 gene in sporadic and familial breast and ovarian cancer. Genes, Chromosomes and Cancer 21:3, 244-249
CrossRef93
LEE-MAY CHEN, BETH Y. KARLAN. (1998) Early Detection and Risk Reduction for Familial Gynecologic Cancers. Clinical Obstetrics and Gynecology 41:1, 200-214
CrossRef94
Tone B. Aaman, Helge Stalsberg, David B. Thomas. (1998) Extra-tumoral breast tissue in breast-cancer patients: Variations with a family history of breast cancer. International Journal of Cancer 79:1, 39-43
CrossRef95
Leif W. Ellisen, MD, PhD, Daniel A. Haber, MD, PhD. (1998) HEREDITARY BREAST CANCER. Annual Review of Medicine 49:1, 425-436
CrossRef96
Eileen Dimond, Kathleen Calzone, Joie Davis, Jean Jenkins. (1998) The Role of the Nurse in Cancer Genetics. CANCER NURSING&trade 21:1, 57-75
CrossRef97
Tone Ikdahl Andersen, Hans Geir Eiken, Fergus Couch, Grete Kaada, Martina Skrede, Hilde Johnsen, Thomas A. Aloysius, Kjell M. Tveit, Lisbeth Tranebjærg, Anne Dørum, Pål Møller, Barbara L. Weber, Anne-Lise Børresen-Dale. (1998) Constant denaturant gel electrophoresis (CDGE) inBRCA1 mutation screening. Human Mutation 11:2, 166-174
CrossRef98
Laura Ottini, Cristina D'Amico, Cristiana Noviello, Claudia Pizzi, Clorindo Pagliarulo, Maria Cristina Curia, Gennaro Limite, Angelo Raffaele Bianco, Luigi Frati, Felice Giacomo Caramia, Alessandro Cama, Alma Contegiacomo, Renato Mariani-Costantini. (1998) Novel deletion at codon 1254 of the BRCA1 gene in an Italian breast cancer kindred. Human Mutation 11:S1, S237-S239
CrossRef99
Fred Rosner. (1998) Genetic susceptibility testing. Cancer 82:1, 232-234
CrossRef100
Uziel Beller, David Halle, Raphael Catane, Bella Kaufman, Gila Hornreich, Ephrat Levy-Lahad. (1997) High Frequency of BRCA1 and BRCA2 Germline Mutations in Ashkenazi Jewish Ovarian Cancer Patients, Regardless of Family History. Gynecologic Oncology 67:2, 123-126
CrossRef101
A. D. K. Hill, J. M. Doyle, E. W. McDermott, N. J. O'Higgins. (1997) Hereditary breast cancer. British Journal of Surgery 84:10, 1334-1339
CrossRef102
A. Ravaioli, D. Canuti, L. Gianni, F. Desiderio, M. Scarpellini, M. Nicolini, C. Fava, S. Bartolini, F. Monti, L. Bernardi, R. Pozzuoli, F. Barbanti, A. Manzo, P. Pivi. (1997) Prognostic factors in hereditary and sporadic breast cancers: analysis of an Italian series of 602 patients. The Breast 6:5, 275-280
CrossRef103
L. R. Cavalli, L. M. B. Cavaliéri, L. A. Ribeiro, I. J. Cavalli, R. Silveira, S. R. Rogatto. (1997) Cytogenetic Evaluation of 20 Primary Breast Carcinomas. Hereditas 126:3, 261-268
CrossRef104
Mahesh M. Mansukhani, Kent L. Nastiuk, Hanina Hibshoosh, Piyumika Kularatne, Donna Russo, John J. Krolewski. (1997) Convenient, Nonradioactive, Heteroduplex-based Methods for Identifying Recurrent Mutations in the BRCA1 and BRCA2 Genes. Diagnostic Molecular Pathology 6:4, 229-237
CrossRef105
Stephen E. Karp, Patricia N. Tonin, Louis R. B
CrossRef106
Michael Swift. (1997) Breast cancer genetics. The Lancet 350:9074, 365
CrossRef107
Side, Lucy, Taylor, Brigit, Cayouette, Matthew, Conner, Edward, Thompson, Patricia, Luce, Michael, Shannon, Kevin, . (1997) Homozygous Inactivation of the NF1 Gene in Bone Marrow Cells from Children with Neurofibromatosis Type 1 and Malignant Myeloid Disorders. New England Journal of Medicine 336:24, 1713-1720
Full Text108
Robert S. Stern, Liisa H. Vakeva. (1997) Noncutaneous Malignant Tumors in the PUVA Follow-up Study: 1975-1996.. Journal of Investigative Dermatology 108:6, 897-900
CrossRef109
Struewing, Jeffery P., Hartge, Patricia, Wacholder, Sholom, Baker, Sonya M., Berlin, Martha, McAdams, Mary, Timmerman, Michelle M., Brody, Lawrence C., Tucker, Margaret A., . (1997) The Risk of Cancer Associated with Specific Mutations of BRCA1 and BRCA2 among Ashkenazi Jews. New England Journal of Medicine 336:20, 1401-1408
Full Text110
Couch, Fergus J., DeShano, Michelle L., Blackwood, M. Anne, Calzone, Kathleen, Stopfer, Jill, Campeau, Lisa, Ganguly, Arupa, Rebbeck, Timothy, Weber, Barbara L., Jablon, Lisa, Cobleigh, Melody A., Hoskins, Kent, Garber, Judy E., . (1997) BRCA1 Mutations in Women Attending Clinics That Evaluate the Risk of Breast Cancer. New England Journal of Medicine 336:20, 1409-1415
Full Text111
Krainer, Michael, Silva-Arrieta, Sandra, FitzGerald, Michael G., Shimada, Akira, Ishioka, Chikashi, Kanamaru, Ryunosuke, MacDonald, Deborah J., Unsal, Hilal, Finkelstein, Dianne M., Bowcock, Anne, Isselbacher, Kurt J., Haber, Daniel A., . (1997) Differential Contributions of BRCA1 and BRCA2 to Early-Onset Breast Cancer. New England Journal of Medicine 336:20, 1416-1422
Full Text112
Mary K. Anglin. (1997) Working from the inside out: Implications of breast cancer activism for biomedical policies and practices. Social Science & Medicine 44:9, 1403-1415
CrossRef113
Hilmi Özcelik, Beverly Schmocker, Nando Di Nicola, Xiu-Hong Shi, Bernard Langer, Malcolm Moore, Bryce R. Taylor, Steven A. Narod, Gerarda Darlington, Irene L. Andrulis, Steven Gallinger, Mark Redston. (1997) Germline BRCA2 6174delT mutations in Ashkenazi Jewish pancreatic cancer patients. Nature Genetics 16:1, 17-18
CrossRef114
Anne M. Bowcock. (1997) Breast Cancer Genes. The Breast Journal 3:s1, 1-6
CrossRef115
Charis Eng, Jan Vijg. (1997) Genetic testing: The problems and the promise. Nature Biotechnology 15:5, 422-426
CrossRef116
Stratton, John F., Gayther, Simon A., Russell, Paul, Dearden, Jo, Gore, Martin, Blake, Peter, Easton, Doug, Ponder, Bruce A.J., . (1997) Contribution of BRCA1 Mutations to Ovarian Cancer. New England Journal of Medicine 336:16, 1125-1130
Full Text117
A GARVIN. (1997) BRCA1 mutations found in archived early onset breast tumours. European Journal of Cancer 33:4, 683-686
CrossRef118
Dieter Niederacher, Frauke Picard, Claudia van Roeyen, Han-Xiang An, Hans Georg Bender, Matthias Wilhelm Beckmann. (1997) Patterns of allelic loss on chromosome 17 in sporadic breast carcinomas detected by fluorescent-labeled microsatellite analysis. Genes, Chromosomes and Cancer 18:3, 181-192
CrossRef119
Michael G. FitzGerald, James M. Bean, Sanjay R. Hegde, Hilal Unsal, Deborah J. MacDonald, D. Paul Harkin, Dianne M. Finkelstein, Kurt J. Isselbacher, Daniel A. Haber. (1997) Heterozygous ATM mutations do not contribute to early onset of breast cancer. Nature Genetics 15:3, 307-310
CrossRef120
Frank Hartmann, Michael Pfreundschuh. (1997) Onkologie ’96. Medizinische Klinik 92:2, 83-100
CrossRef121
Ellen S. Tambor, Barbara K. Rimer, Tara S. Strigo. (1997) Genetic testing for breast cancer susceptibility: Awareness and interest among women in the general population. American Journal of Medical Genetics 68:1, 43-49
CrossRef122
Alisa M. Goldstein, Roni T. Falk, Jeannette F. Korczak, Jay H. Lubin. (1997) Detecting gene-environment interactions using a case-control design. Genetic Epidemiology 14:6, 1085-1089
CrossRef123
SUSAN L. NEUHAUSEN, ELAINE A. OSTRANDER. (1997) Mutation Testing of Early-Onset Breast Cancer Genes BRCA1 and BRCA2. Genetic Testing 1:2, 75-83
CrossRef124
LISA S. PARKER, RACHEL ANKENY MAJESKE. (1996) Standards of Care and Ethical Concerns in Genetic Testing and Screening. Clinical Obstetrics and Gynecology 39:4, 873-884
CrossRef125
Joseph G. Hacia, Lawrence C. Brody, Mark S. Chee, Stephen P.A. Fodor, Francis S. Collins. (1996) Detection of heterozygous mutations in BRCA1 using high density oligonucleotide arrays and two–colour fluorescence analysis. Nature Genetics 14:4, 441-447
CrossRef126
P. Tonin, B. Weber, K. Offit, F. Couch, T.R. Rebbeck, S. Neuhausen, A.K. Godwin, M. Daly, J. Wagner-Costalos, D. Berman, G. Grana, E. Fox, M.F. Kane, R.D. Kolodner, M. Krainer, D.A. Haber, J.P. Struewing, E. Warner, B. Rosen, C. Lerman, B. Peshkin, L. Norton, O. Serova, W.D. Foulkes, H.T. Lynch, G.M. Lenoir, S.A. Narod, J.E. Garber. (1996) Frequency of recurrent BRCA1 and BRCA2 mutations in Ashkenazi Jewish breast cancer families. Nature Medicine 2:11, 1179-1183
CrossRef127
Klaus Grade, Burkhard Jandrig, Siegfried Scherneck. (1996) BRCA1 mutation update and analysis. Journal of Cancer Research and Clinical Oncology 122:11, 702-706
CrossRef128
Benjamin B. Roa, Alfred A. Boyd, Kelly Volcik, C. Sue Richards. (1996) Ashkenazi Jewish population frequencies for common mutations in BRCA1 and BRCA2. Nature Genetics 14:2, 185-187
CrossRef129
Carole Oddoux, Jeffery P. Struewing, C. Mark Clayton, Susan Neuhausen, Lawrence C. Brody, Michael Kaback, Bruce Haas, Larry Norton, Patrick Borgen, Suresh Jhanwar, David Goldgar, Harry Ostrer, Kenneth Offit. (1996) The carrier frequency of the BRCA2 6174delT mutation among Ashkenazi Jewish individuals is approximately 1%. Nature Genetics 14:2, 188-190
CrossRef130
Elizabeth B. Claus, Joellen M. Schildkraut, W. Douglas Thompson, Neil J. Risch. (1996) The genetic attributable risk of breast and ovarian cancer. Cancer 77:11, 2318-2324
CrossRef131
K.M Egan, D Trichopoulos, M.J Stampfer, W.C Willett, P.A Newcomb, A Trentham-Dietz, M.P Longnecker, J.A Baron, M.J Stampfer, W.C Willett. (1996) Jewish religion and risk of breast cancer. The Lancet 347:9016, 1645-1646
CrossRef132
Heather Bryant. (1996) Genetic screening for breast cancer in Ashkenazi women. The Lancet 347:9016, 1638-1639
CrossRef133
(1996) Genetic Screening for Breast Cancer. New England Journal of Medicine 334:18, 1200-1201
Full Text134
(1996) Breast Cancer and BRCA1 Mutations. New England Journal of Medicine 334:18, 1197-1200
Full Text135
Susan Neuhausen, Teresa Gilewski, Larry Norton, Thao Tran, Peter McGuire, Jeff Swensen, Heather Hampel, Patrick Borgen, Karen Brown, Mark Skolnick, Donna Shattuck-Eidens, Suresh Jhanwar, David Goldgar, Kenneth Offit. (1996) Recurrent BRCA2 6174delT mutations in Ashkenazi Jewish women affected by breast cancer. Nature Genetics 13:1, 126-128
CrossRef136
JefferyP. Struewing, RobertE. Tarone, LawrenceC. Brody, FrederickP. Li, JohnD. Boice. (1996) BRCA1 mutations in young women with breast cancer. The Lancet 347:9013, 1493
CrossRef137
Collins, Francis S., . (1996) BRCA1 — Lots of Mutations, Lots of Dilemmas. New England Journal of Medicine 334:3, 186-188
Full Text138
Langston, Amelia A., Malone, Kathleen E., Thompson, Jennifer D., Daling, Janet R., Ostrander, Elaine A., . (1996) BRCA1 Mutations in a Population-Based Sample of Young Women with Breast Cancer. New England Journal of Medicine 334:3, 137-142
Full Text139
Fergus J. Couch, Barbara L. Weber, . (1996) Mutations and Polymorphisms in the familial early-onset breast cancer (BRCA1) gene. Human Mutation 8:1, 8-18
CrossRef140
David F. Barker, Eduardo R.A. Almeida, Graham Casey, Pamela R. Fain, Shu-Yuan Liao, Irene Masunaka, Barbara Noble, Tom Kurosaki, Hoda Anton-Culver. (1996) BRCA1 R841W: A strong candidate for a common mutation with moderate phenotype. Genetic Epidemiology 13:6, 595-604
CrossRef
- Letters
