Original Article
Mutations in the Nonstructural Protein 5a Gene and Response to Interferon in Patients with Chronic Hepatitis C Virus 1b Infection
N Engl J Med 1996; 334:77-82January 11, 1996
- Abstract
Background
A region associated with sensitivity to interferon has been identified in the nonstructural protein 5A (NS5A) of hepatitis C virus (HCV) genotype 1b. The region spans amino acid residues 2209 to 2248 (NS5A2209–2248) of HCV-J, a strain of HCV-1b whose complete genomic sequence has been identified. We examined whether the NS5A2209–2248 sequence present before therapy could be used as a predictor of the response to interferon therapy in patients with chronic HCV-1b infection.
Methods
We retrospectively analyzed 84 patients with chronic HCV-1b infection who had received interferon alfa (total dose, 516 million to 880 million units) for six months. Pretreatment serum samples were analyzed. The amino acid sequence of NS5A2209–2248 was determined by direct sequencing of the HCV genome amplified by the polymerase chain reaction (PCR) and was compared with the established sequence for HCV-J.
Results
A complete response, as evidenced by the absence of HCV RNA in serum on nested reverse-transcription PCR for six months after therapy, did not occur in any of the 30 patients whose NS5A2209–2248 sequences were identical to that of HCV-J (wild type). Five of 38 patients (13 percent) with 1 to 3 changes in NS5A2209–2248 (intermediate type) had complete responses, as did all 16 patients with 4 to 11 amino acid substitutions (mutant type), indicating that the mutant type was significantly associated with a complete response (P<0.001). Although base-line serum HCV RNA levels, as measured by a branched-chain DNA assay, were lower in patients with the mutant type of NS5A2209–2248 than in those with the other types (P<0.001), multivariate analyses revealed that the number of amino acid substitutions in NS5A2209–2248 was the only variable associated with an independent effect on the outcome of interferon therapy (odds ratio, 5.3; 95 percent confidence interval, 1.6 to 18; P = 0.007).
Conclusions
In patients with chronic HCV-1b infection, there is a substantial correlation between responses to interferon and mutations in the NS5A gene.
Media in This Article
Figure 1
Sequence of Amino Acid Residues 2209 to 2248 in Nonstructural Protein 5A (NS5A2209–2248) of HCV in 84 Patients Infected with HCV-1b and Treated with Interferon Alfa.Figure 2
Serum HCV RNA Levels in Relation to the Type of NS5A2209–2248 Sequence Present before Treatment and the Response to Interferon Therapy.Article Activity
- Article
Hepatitis C virus (HCV), which has a positive-sense, single-stranded RNA genome with approximately 9400 nucleotides, causes most cases of chronic non-A, non-B hepatitis.1,2 Chronic hepatitis C infection can progress to liver cirrhosis and hepatocellular carcinoma over the course of 20 to 30 years.3
Interferon is the sole therapy for chronic hepatitis C, although only 25 percent of patients treated for 6 to 12 months have sustained remissions, with the eradication of HCV (complete response).4 The effects of interferon differ among the various HCV genotypes.5 Because HCV genotype 1b (HCV-1b) is resistant to interferon,6 the rate of complete response is only 10 to 40 percent, which is much lower than those of the other genotypes, such as HCV-2a or HCV-2b, with rates of complete response of 60 to 90 percent.7-10 HCV-1b is the most frequent variant worldwide, with a high incidence (37 to 80 percent) in Asian, American, and European countries studied to date.11-14 Patients with HCV-1b infection have more active disease and are more likely to have progression to liver cirrhosis and hepatocellular carcinoma than patients with other HCV genotypes.13,15-18 Therefore, the resistance of HCV-1b to interferon is a serious problem in the management of chronic hepatitis infection. Since interferon therapy is expensive19 and may cause serious adverse effects,4 it would be useful to be able to predict the efficacy of interferon in HCV-1b infection.
The HCV genome encodes structural proteins that constitute the viral particle and nonstructural proteins that are expressed only in hepatocytes.1 Nonstructural protein 5A (NS5A) is the amino-terminal half of nonstructural protein 5; the carboxyl-terminal half (NS5B) contains RNA-dependent RNA polymerase that replicates the HCV RNA genome.13 The function of NS5A is not known. Recently, using comparative analysis of the full-length HCV genome,20 we showed that a small region of NS5A (NS5A2209–2248) of HCV-1b is associated with sensitivity to interferon. The numbering of the amino acid sequence, 2209 to 2248, was based on that of HCV-J, a strain of HCV-1b, whose complete genomic sequence has been determined.21 In the interferon-resistant strains that remained after therapy, the NS5A2209–2248 sequence was the same as that in the prototypical HCV-1b strains (HCV-J, HC-J4,22 and HCV-JTa23), whereas interferon-sensitive strains had multiple amino acid substitutions in this region. In that study, interferon-resistant HCV-1b sequences were determined only after interferon therapy. Thus, we did not evaluate the importance of the NS5A2209–2248 sequences present before treatment with respect to the prediction of the efficacy of interferon. Other clinical factors that may influence the efficacy of interferon, such as serum HCV RNA concentrations16 or histologic factors affecting the liver,8 have also not been evaluated simultaneously with the NS5A2209–2248 region. Therefore, we tested the hypothesis that the NS5A2209–2248 sequence present before treatment predicts the response to interferon therapy in patients infected with HCV-1b. We also investigated the relation among the response to interferon, pretreatment NS5A2209–2248 sequences, and other clinical factors.
Methods
Patients
We retrospectively analyzed patients with chronic HCV-1b infection who had been treated with interferon alfa between January 1992 and December 1993. During this period, we treated 107 patients (67 men and 40 women) who were positive for anti-HCV antibodies on a second-generation assay (Ortho Diagnostic Systems, Raritan, N.J.) and for HCV RNA on the basis of a nested reverse-transcription polymerase chain reaction (PCR) targeted to the 5' noncoding region.24 All patients had detectable HCV RNA with the 1b genotype, as determined by a mixed-primer PCR targeted to the core region of the HCV genome.25 We studied 84 of these patients (57 men and 27 women).
To be eligible for the study, the patients had to have biopsy-proved chronic hepatitis, to have received interferon alfa for six months in a dose of 6 million to 10 million units intramuscularly three times a week (total dose, 516 million to 880 million units), and to have been followed for at least six months before and after therapy. Twenty-two patients had received recombinant interferon alfa-2a (Roferon-A, Hoffmann–LaRoche, Basel, Switzerland), 38 recombinant interferon alfa-2b (Intron A, Schering-Plough, Kenilworth, N.J.), and 24 human lymphoblastoid interferon alfa (Sumiferon, Sumitomo Pharmaceuticals, Osaka, Japan). Patients with a positive test for serum hepatitis B surface antigen, coinfection with other HCV genotypes, histologic findings of liver cirrhosis, other causes of hepatocellular injury (such as alcoholism, autoimmune hepatitis, primary biliary cirrhosis, or a history of treatment with hepatotoxic drugs), and a need for hemodialysis were excluded. The amino acid sequences of NS5A in five patients were included in our earlier report,21 but no other clinical or virologic information was given (these patients were identified as 12, 13, 14, 17, and 18 in the previous report and are referred to as patients 76, 78, 52, 73, and 84, respectively, in this report).
The protocol for interferon treatment of chronic hepatitis C followed the guidelines approved by National Health Insurance of Japan and was in accordance with the Helsinki Declaration of 1975, as revised in 1983. Written informed consent was obtained from all patients before they underwent liver biopsy and received interferon therapy.
Analytic Methods
The following factors were analyzed to determine whether they were related to the efficacy of interferon: age, sex, history of transfusion, duration of infection, stage of fibrosis on liver biopsy, total dose of interferon, type of interferon given, pretreatment serum alanine aminotransferase level, serum HCV RNA level, and amino acid sequence of NS5A2209–2248 before treatment. The duration of infection was estimated as the interval from blood transfusion to interferon therapy in 28 patients with a history of blood transfusion. The remaining 56 patients had sporadic infection without any identifiable source of transmission of HCV, such as occupational exposure to blood or blood products or intravenous-drug abuse, and these patients were excluded from the analysis of the duration of infection. Liver-biopsy specimens were evaluated blindly by an independent interpreter according to the stage of fibrosis (mild, moderate, or severe).26 Serum HCV RNA levels were determined by a branched-chain DNA assay27 (Quantiplex HCV RNA, Chiron, Emeryville, Calif.). The limit of detection of this assay was 0.5 million genome equivalents per milliliter.
Patients were monitored monthly with serial determinations of alanine aminotransferase. Serum was tested for HCV RNA just before therapy was started and every three months thereafter with the use of nested reverse-transcription PCR targeted to the 5' noncoding region, the detection limit of which was 100 copies of viral genome per milliliter of serum.28 Patients were considered to have had a complete response to interferon if serum alanine aminotransferase levels were normal for six months after therapy, with no evidence of serum HCV RNA on nested reverse-transcription PCR at the cessation of treatment and three and six months thereafter. Otherwise, patients were considered to have had no response. To ensure the optimal detection and quantitation of HCV RNA,29 serum was separated from blood samples within two hours after they were obtained and then stored at -80°C without thawing until use.
Nucleotide Sequencing of the NS5A Gene
Extraction of RNA from serum and reverse-transcription PCR were performed as described previously.30 The PCR primers and sequencing primers were synthesized with a DNA synthesizer (model 391, Applied Biosystems Japan, Chiba, Japan). To determine the nucleotide sequence of the NS5A region, we amplified nucleotides 6703 to 7320 (numbered on the basis of the sequence of HCV-J) of HCV complementary DNA using the outer set of primers. One microliter of the first PCR product was transferred to the second PCR reaction along with nested 5' and 3' primers. An M13 forward primer (5'TGTAAAACGACGGCCAGT3') and an M13 reverse primer (5'CAGGAAACAGCTATGACC3') were attached to the 5' terminal of the 5' and 3' nested primers, respectively, to facilitate direct sequencing by an automated DNA sequencer (model 373S, Applied Biosystems Japan). Both strands of the PCR products were sequenced with the Prism dye termination kit (Applied Biosystems Japan), according to the manufacturer's instructions. The sequencing primer was the M13 forward primer for the sense strand and the M13 reverse primer for the antisense strand. The resulting amino acid sequences of NS5A2209–2248 were compared with the NS5A2209–2248 sequence identified in HCV-J.
The sequences of the primers used for the nested PCR were as follows: 5' outer set, 5'TGGATGGAGTGCGGTTGCACAGGTA3' (nucleotides 6703 to 6727); 3' outer set, 5'TCTTTCTCCGTGGAGGTGGTATTGG3' (nucleotides 7296 to 7320); 5' inner set, 5'TGTAAAACGACGGCCAGTCAGGTACGCTCCGGCGTGCA3'(nucleotides 6722 to 6741), with the sequence of the M13 forward primer underlined; and 3' inner set, 5'CAGGAAACAGCTATGACCGGGGCCTTGGTAGGTGGCAA3'(nucleotides 7275 to 7294), with the sequence of the M13 reverse primer underlined.
Statistical Analysis
Categorical data were compared by the chi-square test or Fisher's exact test. Distributions of continuous variables were analyzed by the Mann–Whitney U test or Student's t-test with two groups (i.e., no response and complete response), by Kruskal–Wallis test or parametric analysis of variance with adjustment for multiple comparison by Scheffé's method with three groups (i.e., wild, intermediate, and mutant types of NS5A2209–2248), as appropriate, with Statview 4.0 software (Abacus Concepts, Berkeley, Calif.). Multivariate analysis was performed by multiple logistic-regression analysis (JMP program, SAS Institute, Cary, N.C.). All tests of significance were two-tailed, with P values of less than 0.05 considered to indicate statistical significance.
Results
Twenty-one of the 84 patients (25 percent) had complete responses, whereas 63 (75 percent) had no response (Table 1Table 1
Clinical Characteristics of 84 Patients with Chronic Hepatitis C, According to Their Responses to Interferon Therapy.). Patients with complete responses had more changes in the NS5A2209–2248 sequence than those with no response (median number of changes, 5 vs. 1; P<0.001). They also had lower serum HCV RNA levels before treatment, as determined by a branched-chain DNA assay (median, <0.5 million vs. 4.4 million genome equivalents per milliliter; P<0.001). There were no statistically significant differences between groups in the other variables examined.The amino acid sequences of NS5A2209–2248 in the 84 patients are shown in Figure 1Figure 1
Sequence of Amino Acid Residues 2209 to 2248 in Nonstructural Protein 5A (NS5A2209–2248) of HCV in 84 Patients Infected with HCV-1b and Treated with Interferon Alfa.. Thirty patients (36 percent) had the wild-type sequence, with no amino acid changes; 16 (19 percent) had the mutant type, with 4 to 11 amino acid changes; and 38 (45 percent) had an intermediate type, with 1 to 3 amino acid changes. All 16 patients with the mutant type of NS5A2209–2248 sequence had complete responses, whereas all 30 with the wild type had no response (P<0.001). Thirty-three of the 38 patients with the intermediate type of NS5A2209–2248 sequence had no response (P<0.001 for the comparison with the patients with the mutant type).Clinical variables were analyzed according to the type of NS5A2209–2248 sequence (Table 2Table 2
Clinical Characteristics of 84 patients with Chronic Hepatitis C, According to the Type of NS5A2209–2248 Sequence Identified.). Serum HCV RNA levels before treatment were significantly lower in the patients with the mutant type than in those with the wild type (median, <0.5 million vs. 4.7 million genome equivalents per milliliter; P<0.001) or the intermediate type (median, 4.0 million genome equivalents per milliliter; P<0.001). The other variables examined were not significantly different among the three groups.The relations among serum HCV RNA levels, NS5A2209–2248 types, and responses to interferon are shown in Figure 2Figure 2
Serum HCV RNA Levels in Relation to the Type of NS5A2209–2248 Sequence Present before Treatment and the Response to Interferon Therapy.. The 63 percent rate of complete response in the 24 patients with HCV RNA levels below 0.5 million genome equivalents per milliliter was significantly higher than the rate of 10 percent (P<0.001) in the 60 patients with HCV RNA levels of at least 0.5 million genome equivalents per milliliter. However, three patients with the mutant type of NS5A2209–2248 had complete responses despite having HCV RNA levels of at least 0.5 million genome equivalents per milliliter, and six patients with the wild type had no response despite having HCV RNA levels below 0.5 million genome equivalents per milliliter. In the patients with the intermediate type of NS5A2209–2248 sequence, there were no significant differences between the 33 patients with no responses to interferon and the 5 patients with complete responses with respect to serum HCV RNA levels (median, 4.1 million vs. 0.8 million genome equivalents per milliliter; P = 0.31), the number of amino acid changes in NS5A2209–2248 (median, 1 in both groups; P = 0.69) (Figure 1), or other variables (data not shown).We used multiple logistic-regression analysis to examine a variety of variables (Table 3Table 3
Multivariate Analysis of the Effect of Variables on the Response to Interferon.) that might contribute to a complete response to interferon. Serum HCV RNA levels were stratified into three categories: values below 0.5 million genome equivalents per milliliter (the limit of detection), values of 0.5 million to 15 million genome equivalents per milliliter, and values above 15 million genome equivalents per milliliter. The number of amino acid changes in NS5A2209–2248 was the only variable associated with an independent effect on the outcome of interferon therapy (odds ratio, 5.3; 95 percent confidence interval, 1.6 to 18; P = 0.007). Although serum HCV RNA levels were correlated with the response to interferon and the number of amino acid changes in NS5A2209–2248 in univariate analyses, in multivariate analyses they were not an independent predictor of the response to interferon, even when patients with HCV RNA levels below 0.5 million genome equivalents per milliliter were compared with patients with levels above 15 million genome equivalents per milliliter (P = 0.23).Discussion
We found a significant correlation between the response to interferon in patients with chronic HCV-1b infection and the number of amino acid substitutions that were present before therapy in a small region of NS5A. All patients with 4 to 11 amino acid changes in the NS5A2209–2248 sequence of HCV-1b (mutant type) had complete responses to interferon therapy, whereas all the patients with no amino acid changes (wild type) and 87 percent of those with 1 to 3 amino acid changes (intermediate type) had no responses. Thus, interferon therapy as currently offered is insufficient for patients with interferon-resistant HCV-1b with wild-type or intermediate-type NS5A2209–2248 sequences.
Of the various clinical variables examined, the number of amino acid substitutions in NS5A2209–2248 was the only independent predictor of the response to interferon. Among patients infected with the same genotype of HCV, those with higher serum HCV RNA levels are more resistant to interferon.10,14,27,31 In our study, univariate analysis confirmed the relation between serum HCV RNA levels and the response to interferon; however, multivariate analysis showed that the serum HCV RNA level was not an independent predictor. Our data suggest that serum HCV RNA levels are indirectly associated with the response to interferon through their relation to the sequence of NS5A2209–2248 and that the NS5A2209–2248 sequence itself is a more accurate predictor of response.
The mechanism by which NS5A2209–2248 affects the response to interferon or serum HCV RNA level is not known. The relation between the type of NS5A2209–2248 sequence and the HCV RNA level suggests that NS5A2209–2248 has an important role in HCV replication. Thus, mutations in NS5A2209–2248 may suppress the replication of HCV and increase susceptibility to interferon. It was recently reported that amino acid residues 2200 to 2250, which encompass NS5A2209–2248, are essential for the phosphorylation of NS5A.32 Alternatively, NS5A2209–2248 may be a direct target of antiviral proteins induced by interferon.
Supported by grants in aid (05454243 and 06670525) from the Ministry of Education, Science, Sports, and Culture and by a grant from the Viral Hepatitis Research Foundation.
Source Information
From the Second Department of Internal Medicine (N.E., I.S., Y.A., M.K., T.M., C.Y., Y.O., F.M., C.S.) and Division of Health Science (C.S.), Faculty of Medicine, Tokyo Medical and Dental University, and the Department of Internal Medicine, Musashino Red Cross Hospital (N.I.) — both in Tokyo, Japan.
Address reprint requests to Dr. Sato at the Second Department of Internal Medicine, Faculty of Medicine, Tokyo Medical and Dental University, 1-5-45 Yushima, Bunkyo-ku, Tokyo 113, Japan.
- References
References
1
Houghton M ,Weiner A ,Han J ,Kuo G ,Choo QL . Molecular biology of the hepatitis C viruses: implications for diagnosis, development and control of viral disease. Hepatology 1991;14:381-388
CrossRef | Web of Science | Medline2
Choo QL ,Kuo G ,Weiner AJ ,Overby LR ,Bradley DW ,Houghton M . Isolation of a cDNA clone derived from a blood-borne non-A, non-B viral hepatitis genome. Science 1989;244:359-362
CrossRef | Web of Science | Medline3
Kiyosawa K ,Sodeyama T ,Tanaka E , et al. Interrelationship of blood transfusion, non-A, non-B hepatitis and hepatocellular carcinoma: analysis by detection of antibody to hepatitis C virus. Hepatology 1990;12:671-675
CrossRef | Web of Science | Medline4
Hoofnagle JH . Therapy of acute and chronic viral hepatitis. Adv Intern Med 1994;39:241-275
Medline5
Simmonds P . Variability of hepatitis C virus. Hepatology 1995;21:570-583
CrossRef | Web of Science | Medline6
Takada N ,Takase S ,Enomoto N ,Takada A ,Date T . Clinical backgrounds of the patients having different types of hepatitis C virus genomes. J Hepatol 1992;14:35-40[Erratum, J Hepatol 1992;14:435.]
CrossRef | Web of Science | Medline7
Yoshioka K ,Kakumu S ,Wakita T , et al. Detection of hepatitis C virus by polymerase chain reaction and response to interferon-alpha therapy: relationship to genotypes of hepatitis C virus. Hepatology 1992;16:293-299
CrossRef | Web of Science | Medline8
Mita E ,Hayashi N ,Hagiwara H , et al. Predicting interferon therapy efficacy from hepatitis C virus genotype and RNA titer. Dig Dis Sci 1994;39:977-982
CrossRef | Web of Science | Medline9
Hino K ,Sainokami S ,Shimoda K , et al. Genotypes and titers of hepatitis C virus for predicting response to interferon in patients with chronic hepatitis C. J Med Virol 1994;42:299-305
CrossRef | Web of Science | Medline10
Tsubota A ,Chayama K ,Ikeda K , et al. Factors predictive of response to interferon-alpha therapy in hepatitis C virus infection. Hepatology 1994;19:1088-1094
CrossRef | Web of Science | Medline11
Enomoto N ,Takada A ,Nakao T ,Date T . There are two major types of hepatitis C virus in Japan. Biochem Biophys Res Commun 1990;170:1021-1025
CrossRef | Web of Science | Medline12
Nakao T ,Enomoto N ,Takada N ,Takada A ,Date T . Typing of hepatitis C virus genomes by restriction fragment length polymorphism. J Gen Virol 1991;72:2105-2112
CrossRef | Web of Science | Medline13
van Doorn LJ . Review: molecular biology of the hepatitis C virus. J Med Virol 1994;43:345-356
CrossRef | Web of Science | Medline14
Mahaney K ,Tedeschi V ,Maertens G , et al. Genotypic analysis of hepatitis C virus in American patients. Hepatology 1994;20:1405-1411
CrossRef | Web of Science | Medline15
van der Poel CL ,Cuypers HT ,Reesink HW . Hepatitis C virus six years on. Lancet 1994;344:1475-1479
CrossRef | Web of Science | Medline16
Nousbaum J-P ,Pol S ,Nalpas B ,Landais P ,Berthelot P ,Brechot C . Hepatitis C virus type 1b (II) infection in France and Italy. Ann Intern Med 1995;122:161-168
Web of Science | Medline17
Silini E ,Bono F ,Cividini A , et al. Differential distribution of hepatitis C virus genotypes in patients with and without liver function abnormalities. Hepatology 1995;21:285-290
CrossRef | Web of Science | Medline18
Takada N ,Takase S ,Takada A ,Date T . Differences in the hepatitis C virus genotypes in different countries. J Hepatol 1993;17:277-283
CrossRef | Web of Science | Medline19
Davis GL . Recombinant alpha-interferon treatment of non-A, non-B (type C) hepatitis: review of studies and recommendations for treatment. J Hepatol 1990;11:Suppl 1:S72-S77
CrossRef | Web of Science | Medline20
Enomoto N ,Sakuma I ,Asahina Y , et al. Comparison of full-length sequences of interferon-sensitive and resistant hepatitis C virus 1b: sensitivity to interferon is conferred by amino acid substitutions in the NS5A region. J Clin Invest 1995;96:224-230
CrossRef | Web of Science | Medline21
Kato N ,Hijikata M ,Ootsuyama Y , et al. Molecular cloning of the human hepatitis C virus genome from Japanese patients with non-A, non-B hepatitis. Proc Natl Acad Sci U S A 1990;87:9524-9528
CrossRef | Web of Science | Medline22
Okamoto H ,Kojima M ,Okada S , et al. Genetic drift of hepatitis C virus during an 8.2-year infection in a chimpanzee: variability and stability. Virology 1992;190:894-899
CrossRef | Web of Science | Medline23
Tanaka T ,Kato N ,Nakagawa M , et al. Molecular cloning of hepatitis C virus genome from a single Japanese carrier: sequence variation within the same individual and among infected individuals. Virus Res 1992;23:39-53
CrossRef | Web of Science | Medline24
Okamoto H ,Okada S ,Sugiyama Y , et al. Detection of hepatitis C virus RNA by a two-stage polymerase chain reaction with two pairs of primers deduced from the 5'-noncoding region. Jpn J Exp Med 1990;60:215-222
Medline25
Okamoto H ,Sugiyama Y ,Okada S , et al. Typing hepatitis C virus by polymerase chain reaction with type-specific primers: application to clinical surveys and tracing infectious sources. J Gen Virol 1992;73:673-679
CrossRef | Web of Science | Medline26
Desmet VJ ,Gerber M ,Hoofnagle JH ,Manns M ,Scheuer PJ . Classification of chronic hepatitis: diagnosis, grading and staging. Hepatology 1994;19:1513-1520
CrossRef | Web of Science | Medline27
Lau JY ,Davis GL ,Kniffen J , et al. Significance of serum hepatitis C virus RNA levels in chronic hepatitis C. Lancet 1993;341:1501-1504[Erratum, Lancet 1993;342:504.]
CrossRef | Web of Science | Medline28
Sakamoto N ,Enomoto N ,Kurosaki M ,Marumo F ,Sato C . Detection and quantification of hepatitis C virus RNA replication in the liver. J Hepatol 1994;20:593-597
CrossRef | Web of Science | Medline29
Davis GL ,Lau JY ,Urdea MS , et al. Quantitative detection of hepatitis C virus RNA with a solid-phase amplification method: definition of optimal conditions for specimen collection and clinical application in interferon-treated patients. Hepatology 1994;19:1337-1341
CrossRef | Web of Science | Medline30
Enomoto N ,Kurosaki M ,Tanaka Y ,Marumo F ,Sato C . Fluctuation of hepatitis C virus quasispecies in persistent infection and interferon treatment revealed by single-strand conformation polymorphism analysis. J Gen Virol 1994;75:1361-1369
CrossRef | Web of Science | Medline31
Hagiwara H ,Hayashi N ,Mita E , et al. Quantitative analysis of hepatitis C virus RNA in serum during interferon alfa therapy. Gastroenterology 1993;104:877-883
Web of Science | Medline32
Tanji Y ,Kaneko T ,Satoh S ,Shimotohno K . Phosphorylation of hepatitis C virus-encoded nonstructural protein NS5A. J Virol 1995;69:3980-3986
Web of Science | Medline
- Citing Articles (344)
Citing Articles
1
N. Srinivasan, G. Agarwal, R. M. Bhaskara, R. Gadkari, O. Krishnadev, B. Lakshmi, S. Mahajan, S. Mohanty, R. Mudgal, R. Rakshambikai, S. Sandhya, G. Sudha, L. Swapna, N. Tyagi. (2013) Influence of Genomic and Other Biological Data Sets in the Understanding of Protein Structures, Functions and Interactions. International Journal of Knowledge Discovery in Bioinformatics 2:1, 24-44
CrossRef2
Kazuhiko Hayashi, Yoshiaki Katano, Teiji Kuzuya, Yoshihiko Tachi, Takashi Honda, Masatoshi Ishigami, Akihiro Itoh, Yoshiki Hirooka, Tetsuya Ishikawa, Isao Nakano, Fumihiro Urano, Kentaro Yoshioka, Hidenori Toyoda, Takashi Kumada, Hidemi Goto. (2012) Prevalence of hepatitis C virus genotype 1a in Japan and correlation of mutations in the NS5A region and single-nucleotide polymorphism of interleukin-28B with the response to combination therapy with pegylated-interferon-alpha 2b and ribavirin. Journal of Medical Virology 84:3, 438-444
CrossRef3
C. Kondo, M. Atsukawa, A. Tsubota, N. Itokawa, T. Fukuda, Y. Matsushita, H. Kidokoro, T. Kobayashi, Y. Narahara, K. Nakatsuka, H. Kanazawa, C. Sakamoto. (2012) An open-label randomized controlled study of pegylated interferon/ribavirin combination therapy for chronic hepatitis C with versus without fluvastatin. Journal of Viral Hepatitisno-no
CrossRef4
Kyoko Mori, Youki Ueda, Yasuo Ariumi, Hiromichi Dansako, Masanori Ikeda, Nobuyuki Kato. (2012) Development of a drug assay system with hepatitis C virus genome derived from a patient with acute hepatitis C. Virus Genes
CrossRef5
Pierre-Alain Rubbo, Philippe Van de Perre, Edouard Tuaillon. (2012) The long way toward understanding host and viral determinants of therapeutic success in HCV infection. Hepatology International
CrossRef6
Ahmed El-Shamy, Soo-Ryang Kim, Yoshi-Hiro Ide, Noriko Sasase, Susumu Imoto, Lin Deng, Ikuo Shoji, Hak Hotta. (2012) Polymorphisms of Hepatitis C Virus Non-Structural Protein 5A and Core Protein and Clinical Outcome of Pegylated-Interferon/Ribavirin Combination Therapy. Intervirology 55:1, 1-11
CrossRef7
Keizo Kato, Takeshi Yonezawa, Chizuko Tachibana, Hiroyuki Tachibana, Satoshi Watanabe, Yasushi Mandai, Rei Kashima, Kazushi Fukuda. (2012) Response-guided therapy based on reaction to the initial dose using administration of peginterferon α-2a alone or in combination with ribavirin in naïve patients with chronic hepatitis C of serotype 2 and high viral loads. Kanzo 53:1, 18-27
CrossRef8
Darius Moradpour, François Penin, Charles Rice. 2012. Replication of Hepatitis C Virus. , 97-110.
CrossRef9
Sanja Glisic, Nevena Veljkovic, Snezana Jovanovic Cupic, Nada Vasiljevic, Jelena Prljic, Branislava Gemovic, Vladimir Perovic, Veljko Veljkovic. (2011) Assessment of Hepatitis C Virus Protein Sequences with Regard to Interferon/Ribavirin Combination Therapy Response in Patients with HCV Genotype 1b. The Protein Journal
CrossRef10
Tomokazu Kawaoka, Hiroshi Aikata, Daisuke Miyaki, Eisuke Murakami, Takahiro Azakami, Shintaro Takaki, Yuko Nagaoki, Yoshimasa Hashimoto, Yoshio Katamura, Akira Hiramatsu, Koji Waki, Nobuhiko Hiraga, Daiki Miki, Masataka Tsuge, Michio Imamura, Yoshiiku Kawakami, Shoichi Takahashi, Hidenori Ochi, Hirotaka Tashiro, Hideki Ohdan, Kazuaki Chayama. (2011) Eradication of hepatitis C virus genotype 1 after liver transplantation by interferon therapy before surgery: Report of three patients with analysis of interleukin-28 polymorphism, hepatitis C virus core region and interferon-sensitivity determining regio. Hepatology Research 41:11, 1126-1131
CrossRef11
Yasumi Furui, Yuji Hoshi, Kazumoto Murata, Kiyoaki Ito, Kou Suzuki, Shigeharu Uchida, Masahiro Satake, Masashi Mizokami, Kenji Tadokoro. (2011) Prevalence of Amino acid mutation in hepatitis C virus core region among Japanese volunteer blood donors. Journal of Medical Virology 83:11, 1924-1929
CrossRef12
Masayuki Kurosaki, Namiki Izumi. (2011) Reply to: “Pre-treatment prediction of response to pegylated-interferon plus ribavarin for chronic hepatitis C using RVR”. Journal of Hepatology 55:5, 1164-1166
CrossRef13
Hisamitsu Miyaaki, Tatsuki Ichikawa, Hiroshi Yatsuhashi, Naota Taura, Satoshi Miuma, Tetsuya Usui, Sayaka Mori, Shimeru Kamihira, Yasuhito Tanaka, Masashi Mizokami, Kazuhiko Nakao. (2011) Suppressor of cytokine signal 3 and IL28 genetic variation predict the viral response to peginterferon and ribavirin. Hepatology Researchno-no
CrossRef14
Kazuhiko Hayashi, Yoshiaki Katano, Takashi Honda, Masatoshi Ishigami, Akihiro Itoh, Yoshiki Hirooka, Tetsuya Ishikawa, Isao Nakano, Kentaro Yoshioka, Hidenori Toyoda, Takashi Kumada, Hidemi Goto. (2011) Association of interleukin 28B and mutations in the core and NS5A region of hepatitis C virus with response to peg-interferon and ribavirin therapy. Liver International 31:9, 1359-1365
CrossRef15
Shouichi Yokozaki, Yoshiaki Katano, Kazuhiko Hayashi, Masatoshi Ishigami, Akihiro Itoh, Yoshiki Hirooka, Isao Nakano, Hidemi Goto. (2011) Mutations in two PKR-binding domains in chronic hepatitis C of genotype 3a and correlation with viral loads and interferon responsiveness. Journal of Medical Virology 83:10, 1727-1732
CrossRef16
E. C. Thomson, J. A. Smith, P. Klenerman. (2011) The natural history of early hepatitis C virus evolution; lessons from a global outbreak in human immunodeficiency virus-1-infected individuals. Journal of General Virology 92:10, 2227-2236
CrossRef17
Hideyuki Tamai, Naoki Shingaki, Tatsuya Shiraki, Hiroshi Tukuda, Yoshiyuki Mori, Kosaku Moribata, Shotaro Enomoto, Hisanobu Deguchi, Kazuki Ueda, Izumi Inoue, Takao Maekita, Mikitaka Iguchi, Kimihiko Yanaoka, Masashi Oka, Masao Ichinose. (2011) Prediction of sustained response to low-dose pegylated interferon alpha-2b plus ribavirin in patients with genotype 1b and high hepatitis C virus level using viral reduction within 2 weeks after therapy initiation. Hepatology Researchno-no
CrossRef18
Nobuhiko Hiraga, Hiromi Abe, Michio Imamura, Masataka Tsuge, Shoichi Takahashi, C. Nelson Hayes, Hidenori Ochi, Chise Tateno, Katsutoshi Yoshizato, Yusuke Nakamura, Naoyuki Kamatani, Kazuaki Chayama. (2011) Impact of viral amino acid substitutions and host interleukin-28b polymorphism on replication and susceptibility to interferon of hepatitis C virus. Hepatology 54:3, 764-771
CrossRef19
B. E. Pickett, R. Striker, E. J. Lefkowitz. (2011) Evidence for separation of HCV subtype 1a into two distinct clades. Journal of Viral Hepatitis 18:9, 608-618
CrossRef20
Koji Yokoyama, Masaharu Takahashi, Tsutomu Nishizawa, Shigeo Nagashima, Suljid Jirintai, Shigeru Yotsumoto, Hiroaki Okamoto, Mariko Y. Momoi. (2011) Identification and characterization of a natural inter-genotypic (2b/1b) recombinant hepatitis C virus in Japan. Archives of Virology 156:9, 1591-1601
CrossRef21
Hiromi Abe, C. Nelson Hayes, Hidenori Ochi, Masataka Tsuge, Daiki Miki, Nobuhiko Hiraga, Michio Imamura, Shoichi Takahashi, Michiaki Kubo, Yusuke Nakamura, Naoyuki Kamatani, Kazuaki Chayama. (2011) Inverse association of IL28B genotype and liver mRNA expression of genes promoting or suppressing antiviral state. Journal of Medical Virology 83:9, 1597-1607
CrossRef22
Makoto Kadokura, Shinya Maekawa, Ryota Sueki, Mika Miura, Kazuki Komase, Hiroko Shindo, Fumitake Amemiya, Tomoyoshi Uetake, Taisuke Inoue, Minoru Sakamoto, Mina Nakagawa, Naoya Sakamoto, Mamoru Watanabe, Nobuyuki Enomoto. (2011) Analysis of the complete open reading frame of hepatitis C virus in genotype 2a infection reveals critical sites influencing the response to peginterferon and ribavirin therapy. Hepatology International 5:3, 789-799
CrossRef23
Hiroko Shindo, Shinya Maekawa, Kazuki Komase, Ryota Sueki, Mika Miura, Makoto Kadokura, Kuniaki Shindo, Fumitake Amemiya, Takatoshi Kitamura, Yasuhiro Nakayama, Taisuke Inoue, Minoru Sakamoto, Shun-ichi Okada, Yasuhiro Asahina, Namiki Izumi, Masao Honda, Shuichi Kaneko, Nobuyuki Enomoto. (2011) Characterization of naturally occurring protease inhibitor-resistance mutations in genotype 1b hepatitis C virus patients. Hepatology International
CrossRef24
Mika Miura, Shinya Maekawa, Makoto Kadokura, Ryota Sueki, Kazuki Komase, Hiroko Shindo, Takako Ohmori, Asuka Kanayama, Kuniaki Shindo, Fumitake Amemiya, Yasuhiro Nakayama, Takatoshi Kitamura, Tomoyoshi Uetake, Taisuke Inoue, Minoru Sakamoto, Shunichi Okada, Nobuyuki Enomoto. (2011) Analysis of viral amino acids sequences and the IL28B SNP influencing the development of hepatocellular carcinoma in chronic hepatitis C. Hepatology International
CrossRef25
Koji Ishii, Mie Shinohara, Michio Kogame, Misato Shiratori, Katsuya Higami, Kaori Kanayama, Kazue Shiozawa, Noritaka Wakui, Hidenari Nagai, Manabu Watanabe, Yasukiyo Sumino. (2011) Effects of mutation number in interferon sensitivity determining region on peripheral blood CD4+ T cell subsets (Th1, Th2) in chronic hepatitis C patients with hepatitis C virus genotype 1b and high viral load. Hepatology International
CrossRef26
Tohru Noguchi, Akihiro Tamori, Naoki Ogura, Yuji Hori, Satoru Ikeda, Shuhei Nishiguchi. (2011) Investigation of Interferon-α Response by a Single Amino Acid Substitution of Nonstructural Protein 5A in Hepatitis C Virus-Infected Patients. Journal of Interferon & Cytokine Research 31:8, 589-599
CrossRef27
Akira Honda, Yasushi Matsuzaki. (2011) Cholesterol and chronic hepatitis C virus infection. Hepatology Research 41:8, 697-710
CrossRef28
Takao Watanabe, Ichiro Konishi, Shuichiro Shigematsu, Kazuhiro Uesugi, Kouji Joko, Hirotaka Seike, Shinichi Okada, Hiroaki Miyaoka, Seiji Nakanishi, Masanori Abe, Bunzo Matsuura, Kojiro Michitaka, Norio Horiike, Yoichi Hiasa, Morikazu Onji. (2011) Sustained virological response of patients with hepatitis C virus genotype 2 depends on pegylated interferon compliance. Hepatology Research 41:8, 722-730
CrossRef29
K. Chayama, C. N. Hayes, H. Abe, D. Miki, H. Ochi, Y. Karino, J. Toyota, Y. Nakamura, N. Kamatani, H. Sezaki, M. Kobayashi, N. Akuta, F. Suzuki, H. Kumada. (2011) IL28B But Not ITPA Polymorphism Is Predictive of Response to Pegylated Interferon, Ribavirin, and Telaprevir Triple Therapy in Patients With Genotype 1 Hepatitis C. Journal of Infectious Diseases 204:1, 84-93
CrossRef30
Yoshimasa Hashimoto, Hidenori Ochi, Hiromi Abe, Yasufumi Hayashida, Masataka Tsuge, Fukiko Mitsui, Nobuhiko Hiraga, Michio Imamura, Shoichi Takahashi, C. Nelson Hayes, Waka Ohishi, Michaki Kubo, Tatsuhiko Tsunoda, Naoyuki Kamatani, Yusuke Nakamura, Kazuaki Chayama. (2011) Prediction of response to peginterferon-alfa-2b plus ribavirin therapy in Japanese patients infected with hepatitis C virus genotype 1b. Journal of Medical Virology 83:6, 981-988
CrossRef31
Suguru Yoneda, Takeji Umemura, Satoru Joshita, Tetsuya Ichijo, Akihiro Matsumoto, Kaname Yoshizawa, Yoshihiko Katsuyama, Masao Ota, Eiji Tanaka, . (2011) Serum chemokine levels are associated with the outcome of pegylated interferon and ribavirin therapy in patients with chronic hepatitis C. Hepatology Research 41:6, 587-593
CrossRef32
Takahiro Azakami, C. Nelson Hayes, Hitomi Sezaki, Mariko Kobayashi, Norio Akuta, Fumitaka Suzuki, Hiromitsu Kumada, Hiromi Abe, Daiki Miki, Masataka Tsuge, Michio Imamura, Yoshiiku Kawakami, Shoichi Takahashi, Hidenori Ochi, Yusuke Nakamura, Naoyuki Kamatani, Kazuaki Chayama. (2011) Common genetic polymorphism of ITPA gene affects ribavirin-induced anemia and effect of peg-interferon plus ribavirin therapy. Journal of Medical Virology 83:6, 1048-1057
CrossRef33
Ahmed El-Shamy, Ikuo Shoji, Takafumi Saito, Hisayoshi Watanabe, Yoshi-Hiro Ide, Lin Deng, Sumio Kawata, Hak Hotta. (2011) Sequence heterogeneity of NS5A and core proteins of hepatitis C virus and virological responses to pegylated-interferon/ribavirin combination therapy. Microbiology and Immunology 55:6, 418-426
CrossRef34
Hiromi Abe, C. Nelson Hayes, Hidenori Ochi, Toshiro Maekawa, Masataka Tsuge, Daiki Miki, Fukiko Mitsui, Nobuhiko Hiraga, Michio Imamura, Shoichi Takahashi, Michiaki Kubo, Yusuke Nakamura, Kazuaki Chayama. (2011) IL28 variation affects expression of interferon stimulated genes and peg-interferon and ribavirin therapy. Journal of Hepatology 54:6, 1094-1101
CrossRef35
Yoshio Sumida, Kazuyuki Kanemasa, Tasuku Hara, Yutaka Inada, Kyoko Sakai, Shunsuke Imai, Naohisa Yoshida, Kohichiroh Yasui, Yoshito Itoh, Takeshi Okanoue, Toshikazu Yoshikawa. (2011) Impact of amino acid substitutions in hepatitis C virus genotype 1b core region on liver steatosis and glucose tolerance in non-cirrhotic patients without overt diabetes. Journal of Gastroenterology and Hepatology 26:5, 836-842
CrossRef36
H. Ochi, T. Maekawa, H. Abe, Y. Hayashida, R. Nakano, M. Imamura, N. Hiraga, Y. Kawakami, S. Aimitsu, J.-H. Kao, M. Kubo, T. Tsunoda, H. Kumada, Y. Nakamura, C. N. Hayes, K. Chayama. (2011) IL-28B predicts response to chronic hepatitis C therapy - fine-mapping and replication study in Asian populations. Journal of General Virology 92:5, 1071-1081
CrossRef37
Mario Masarone, Marcello Persico. (2011) Antiviral therapy: why does it fail in HCV-related chronic hepatitis?. Expert Review of Anti-infective Therapy 9:5, 535-543
CrossRef38
S. Yoneda, T. Umemura, Y. Katsuyama, A. Kamijo, S. Joshita, M. Komatsu, T. Ichijo, A. Matsumoto, K. Yoshizawa, M. Ota, E. Tanaka, . (2011) Association of Serum Cytokine Levels With Treatment Response to Pegylated Interferon and Ribavirin Therapy in Genotype 1 Chronic Hepatitis C Patients. Journal of Infectious Diseases 203:8, 1087-1095
CrossRef39
Hidenori Toyoda, Takashi Kumada, Seiki Kiriyama, Makoto Tanikawa, Yasuhiro Hisanaga, Akira Kanamori, Toshifumi Tada, Takahiro Arakawa, Masashi Fujimori, Takuro Niinomi, Naoto Ando, Satoshi Yasuda, Keisuke Sakai, Jun Kimura. (2011) High ability to predict the treatment outcome of peginterferon and ribavirin combination therapy based on the reduction in HCV RNA levels at 4 weeks after starting therapy and amino acid substitutions in the hepatitis C virus in patients infected with HCV genotype 1b. Journal of Gastroenterology 46:4, 501-509
CrossRef40
Kazuaki Chayama, C. Nelson Hayes, Kentaro Yoshioka, Hisataka Moriwaki, Takashi Okanoue, Shotaro Sakisaka, Tetsuo Takehara, Makoto Oketani, Joji Toyota, Namiki Izumi, Yoichi Hiasa, Akihiro Matsumoto, Hideyuki Nomura, Masataka Seike, Yoshiyuki Ueno, Hiroshi Yotsuyanagi, Hiromitsu Kumada. (2011) Factors predictive of sustained virological response following 72 weeks of combination therapy for genotype 1b hepatitis C. Journal of Gastroenterology 46:4, 545-555
CrossRef41
K. Hayashi, Y. Katano, M. Ishigami, A. Itoh, Y. Hirooka, I. Nakano, F. Urano, K. Yoshioka, H. Toyoda, T. Kumada, H. Goto. (2011) Mutations in the core and NS5A region of hepatitis C virus genotype 1b and correlation with response to pegylated-interferon-alpha 2b and ribavirin combination therapy. Journal of Viral Hepatitis 18:4, 280-286
CrossRef42
K. Kumthip, C. Pantip, P. Chusri, S. Thongsawat, A. O’Brien, K. E. Nelson, N. Maneekarn. (2011) Correlation between mutations in the core and NS5A genes of hepatitis C virus genotypes 1a, 1b, 3a, 3b, 6f and the response to pegylated interferon and ribavirin combination therapy. Journal of Viral Hepatitis 18:4, e117-e125
CrossRef43
N. Laufer, F. Bolcic, M.J. Rolón, A. Martinez, R. Reynoso, H. Pérez, H. Salomón, P. Cahn, J. Quarleri. (2011) HCV RNA decline in the first 24h exhibits high negative predictive value of sustained virologic response in HIV/HCV genotype 1 co-infected patients treated with peginterferon and ribavirin. Antiviral Research 90:1, 92-97
CrossRef44
Masayuki Kurosaki, Naoya Sakamoto, Manabu Iwasaki, Minoru Sakamoto, Yoshiyuki Suzuki, Naoki Hiramatsu, Fuminaka Sugauchi, Akihiro Tamori, Mina Nakagawa, Namiki Izumi. (2011) Sequences in the interferon sensitivity-determining region and core region of hepatitis C virus impact pretreatment prediction of response to PEG-interferon plus ribavirin: Data mining analysis. Journal of Medical Virology 83:3, 445-452
CrossRef45
Troels K.H. Scheel, Judith M. Gottwein, Lotte S. Mikkelsen, Tanja B. Jensen, Jens Bukh. (2011) Recombinant HCV Variants With NS5A From Genotypes 1–7 Have Different Sensitivities to an NS5A Inhibitor but Not Interferon-α. Gastroenterology 140:3, 1032-1042.e6
CrossRef46
Masayuki Kurosaki, Yasuhito Tanaka, Nao Nishida, Naoya Sakamoto, Nobuyuki Enomoto, Masao Honda, Masaya Sugiyama, Kentaro Matsuura, Fuminaka Sugauchi, Yasuhiro Asahina, Mina Nakagawa, Mamoru Watanabe, Minoru Sakamoto, Shinya Maekawa, Akito Sakai, Shuichi Kaneko, Kiyoaki Ito, Naohiko Masaki, Katsushi Tokunaga, Namiki Izumi, Masashi Mizokami. (2011) Pre-treatment prediction of response to pegylated-interferon plus ribavirin for chronic hepatitis C using genetic polymorphism in IL28B and viral factors. Journal of Hepatology 54:3, 439-448
CrossRef47
Jun Itakura, Yasuhiro Asahina, Nobuharu Tamaki, Itsuko Hirayama, Yutaka Yasui, Tomohiro Tanaka, Mitsuaki Sato, Ken Ueda, Teiji Kuzuya, Kaoru Tsuchiya, Hiroyuki Nakanishi, Masayuki Kurosaki, Gretchen S. Gabriel, George J. Schneider, Namiki Izumi. (2011) Changes in hepatitis C viral load during first 14 days can predict the undetectable time point of serum viral load by pegylated interferon and ribavirin therapy. Hepatology Research 41:3, 217-224
CrossRef48
Masayuki Kurosaki, Naoya Sakamoto, Manabu Iwasaki, Minoru Sakamoto, Yoshiyuki Suzuki, Naoki Hiramatsu, Fuminaka Sugauchi, Hiroshi Yatsuhashi, Namiki Izumi. (2011) Pretreatment prediction of response to peginterferon plus ribavirin therapy in genotype 1 chronic hepatitis C using data mining analysis. Journal of Gastroenterology 46:3, 401-409
CrossRef49
A. T. L. de Queiróz, V. Maracaja-Coutinho, A. C. G. Jardim, P. Rahal, I. M. V. G. de Carvalho-Mello, S. R. Matioli. (2011) Relation of pretreatment sequence diversity in NS5A region of HCV genotype 1 with immune response between pegylated-INF/ribavirin therapy outcomes. Journal of Viral Hepatitis 18:2, 142-148
CrossRef50
Yoshito Itoh, Takeshi Nishimura, Hiroaki Hashimoto, Kanji Yamaguchi, Toshihisa Niimi, Chihiro Yokomizo, Hideki Fujii, Masahito Minami, Kohichiroh Yasui, Hironori Mitsuyoshi, Takeshi Okanoue, Tetsuo Takehara, Yoichi Hiasa, Morikazu Onji, Toshikazu Yoshikawa. (2011) Simple formula to predict response to peginterferon alpha2b and ribavirin combination therapy in genotype 1 chronic hepatitis C patients with high viral loads. Hepatology Research 41:2, 126-132
CrossRef51
Kazuaki Chayama, C Nelson Hayes. (2011) Hepatitis C virus: How genetic variability affects pathobiology of disease. Journal of Gastroenterology and Hepatology 26, 83-95
CrossRef52
Paul J Clark, Alex J Thompson, John G McHutchison. (2011) IL28B Genomic-Based Treatment Paradigms for Patients With Chronic Hepatitis C Infection: The Future of Personalized HCV Therapies. The American Journal of Gastroenterology 106:1, 38-45
CrossRef53
Ijaz Ali, Sanaullah Khan, Sobia Attaullah, Shahid Khan, Jabbar Khan, Sami Siraj, Aqib Iqbal, Zahoor A Swati, Muhammad Idrees. (2011) Response to combination therapy of HCV 3a infected Pakistani patients and the role of NS5A protein. Virology Journal 8:1, 258
CrossRef54
Noboru Hirashima, Hiroaki Iwase, Tomoyuki Tsuzuki, Asako Kamiya, Misaki Yokoi, Masayuki Saitoh, Dai Tamaki, Yoshimitsu Ryuge, Yusuke Hibino, Masaaki Shimada, Hidemi Goto. (2011) Double filtration plasmapheresis and peginterferon plus ribavirin combination therapy for chronic hepatitis C patients with genotype 1b and high viral load not cured by previous interferon therapy. Kanzo 52:9, 575-583
CrossRef55
Victoria L. Demetriou, Eftychia Kyriakou, Leondios G. Kostrikis. (2011) Near-Full Genome Characterisation of Two Natural Intergenotypic 2k/1b Recombinant Hepatitis C Virus Isolates. Advances in Virology 2011, 1-7
CrossRef56
Dipankar Bhattacharya, Molly A Accola, Israr H Ansari, Rob Striker, William M Rehrauer. (2011) Naturally occurring genotype 2b/1a hepatitis C virus in the United States. Virology Journal 8:1, 458
CrossRef57
Soo Ryang Kim, Jun Saito, Susumu Imoto, Takamitsu Komaki, Yoshiaki Nagata, Ke Ih Kim, Noriko Sasase, Noriyo Kimura, Kanako Sasatani, Erika Konishi, Yutaka Hasegawa, Aya Fujinami, Mitsuhiro Ohta, Ahmed El-Shamy, Yasuhito Tanaka, Masahiko Sugano, Masanori Sakashita, Akira Nakamura, Shinobu Tsuchida, Tetsuya Makino, Tetsumi Kawada, Takatoshi Nakajima, Teruhisa Morikawa, Akira Muramatsu, Hak Hotta, Masatoshi Kudo. (2011) Double-Filtration Plasmapheresis plus Interferon-β for HCV-1b Patients with Non-Sustained Virological Response to Previous Combination Therapy. Digestion 84:s1, 10-16
CrossRef58
Masatoshi Kudo. (2011) Tailor-Made Therapy for Viral Hepatitis: Recent Advances. Digestion 84:s1, 1-4
CrossRef59
Masahiro Takita, Satoru Hagiwara, Tadaaki Arizumi, Sousuke Hayaishi, Taisuke Ueda, Satoshi Kitai, Norihisa Yada, Tatsuo Inoue, Yasunori Minami, Hobyung Chung, Kazuomi Ueshima, Toshiharu Sakurai, Masatoshi Kudo. (2011) Association of Interleukin-28B and Hepatitis C Genotype 1 with a High Viral Load and Response to Pegylated Interferon plus Ribavirin Therapy. Digestion 84:s1, 56-61
CrossRef60
Kazuaki Chayama, C. Nelson Hayes, Kentaro Yoshioka, Hisataka Moriwaki, Takeshi Okanoue, Shotaro Sakisaka, Tetsuo Takehara, Makoto Oketani, Joji Toyota, Namiki Izumi, Yoichi Hiasa, Akihiro Matsumoto, Hideyuki Nomura, Masataka Seike, Yoshiyuki Ueno, Hiroshi Yotsuyanagi, Hiromitsu Kumada. (2010) Accumulation of refractory factors for pegylated interferon plus ribavirin therapy in older female patients with chronic hepatitis C. Hepatology Research 40:12, 1155-1167
CrossRef61
Naoya Sakamoto, Yasuhito Tanaka, Mina Nakagawa, Hiroshi Yatsuhashi, Shuhei Nishiguchi, Nobuyuki Enomoto, Seishin Azuma, Yuki Nishimura-Sakurai, Sei Kakinuma, Nao Nishida, Katsushi Tokunaga, Masao Honda, Kiyoaki Ito, Masashi Mizokami, Mamoru Watanabe. (2010) ITPA gene variant protects against anemia induced by pegylated interferon-α and ribavirin therapy for Japanese patients with chronic hepatitis C. Hepatology Research 40:11, 1063-1071
CrossRef62
Takasuke Fukuhara, Akinobu Taketomi, Takashi Motomura, Shinji Okano, Akinori Ninomiya, Takayuki Abe, Hideaki Uchiyama, Yuji Soejima, Ken Shirabe, Yoshiharu Matsuura, Yoshihiko Maehara. (2010) Variants in IL28B in Liver Recipients and Donors Correlate With Response to Peg-Interferon and Ribavirin Therapy for Recurrent Hepatitis C. Gastroenterology 139:5, 1577-1585.e3
CrossRef63
Daniel X.M. Zhou, Paul K.S. Chan, Tiejun Zhang, Damien C. Tully, John S. Tam. (2010) Sequence diversity of hepatitis C virus 6a within the extended interferon sensitivity-determining region correlates with interferon-alpha/ribavirin treatment outcomes. Virus Research 153:1, 44-49
CrossRef64
Tarik Asselah, Emilie Estrabaud, Ivan Bieche, Martine Lapalus, Simon De Muynck, Michel Vidaud, David Saadoun, Vassili Soumelis, Patrick Marcellin. (2010) Hepatitis C: viral and host factors associated with non-response to pegylated interferon plus ribavirin. Liver International 30:9, 1259-1269
CrossRef65
Hiromi Abe, Hidenori Ochi, Toshiro Maekawa, C. Nelson Hayes, Masataka Tsuge, Daiki Miki, Fukiko Mitsui, Nobuhiko Hiraga, Michio Imamura, Shoichi Takahashi, Waka Ohishi, Koji Arihiro, Michiaki Kubo, Yusuke Nakamura, Kazuaki Chayama. (2010) Common variation of IL28 affects gamma-GTP levels and inflammation of the liver in chronically infected hepatitis C virus patients. Journal of Hepatology 53:3, 439-443
CrossRef66
Masao Honda, Akito Sakai, Tatsuya Yamashita, Yasunari Nakamoto, Eishiro Mizukoshi, Yoshio Sakai, Taro Yamashita, Mikiko Nakamura, Takayoshi Shirasaki, Katsuhisa Horimoto, Yasuhito Tanaka, Katsushi Tokunaga, Masashi Mizokami, Shuichi Kaneko. (2010) Hepatic ISG Expression Is Associated With Genetic Variation in Interleukin 28B and the Outcome of IFN Therapy for Chronic Hepatitis C. Gastroenterology 139:2, 499-509
CrossRef67
Mai Sanjo, Takafumi Saito, Rika Ishii, Yuko Nishise, Hiroaki Haga, Kazuo Okumoto, Junitsu Ito, Hisayoshi Watanabe, Koji Saito, Hitoshi Togashi, Kazuto Fukuda, Yasuharu Imai, Ahmed El-Shamy, Lin Deng, Ikuo Shoji, Hak Hotta, Sumio Kawata. (2010) Secondary structure of the amino-terminal region of HCV NS3 and virological response to pegylated interferon plus ribavirin therapy for chronic hepatitis C. Journal of Medical Virology 82:8, 1364-1370
CrossRef68
Norio Akuta, Fumitaka Suzuki, Miharu Hirakawa, Yusuke Kawamura, Hiromi Yatsuji, Hitomi Sezaki, Yoshiyuki Suzuki, Tetsuya Hosaka, Masahiro Kobayashi, Mariko Kobayashi, Satoshi Saitoh, Yasuji Arase, Kenji Ikeda, Kazuaki Chayama, Yusuke Nakamura, Hiromitsu Kumada. (2010) Amino acid substitution in hepatitis C virus core region and genetic variation near the interleukin 28B gene predict viral response to telaprevir with peginterferon and ribavirin. Hepatology 52:2, 421-429
CrossRef69
Hidenori Toyoda, Takashi Kumada, Toshifumi Tada, Takahiro Arakawa, Kazuhiko Hayashi, Takashi Honda, Yoshiaki Katano, Hidemi Goto. (2010) Association between HCV amino acid substitutions and outcome of peginterferon and ribavirin combination therapy in HCV genotype 1b and high viral load. Journal of Gastroenterology and Hepatology 25:6, 1072-1078
CrossRef70
Hideki Fujii, Yoshito Itoh, Naoki Ohnishi, Masafumi Sakamoto, Tohru Ohkawara, Yoshihiko Sawa, Koichi Nishida, Takeshi Nishimura, Kanji Yamaguchi, Kohichiroh Yasui, Masahito Minami, Takeshi Okanoue, Yasuo Ohkawara, Toshikazu Yoshikawa. (2010) Relapse of hepatitis C in a pegylated-interferon-α-2b plus ribavirin-treated sustained virological responder. Hepatology Research 40:6, 654-660
CrossRef71
Mina Nakagawa, Naoya Sakamoto, Mayumi Ueyama, Kaoru Mogushi, Satoshi Nagaie, Yasuhiro Itsui, Seishin Azuma, Sei Kakinuma, Hiroshi Tanaka, Nobuyuki Enomoto, Mamoru Watanabe. (2010) Mutations in the interferon sensitivity determining region and virological response to combination therapy with pegylated-interferon alpha 2b plus ribavirin in patients with chronic hepatitis C-1b infection. Journal of Gastroenterology 45:6, 656-665
CrossRef72
M. Francisca Palomares-Jerez, Jaime Guillén, José Villalaín. (2010) Interaction of the N-terminal segment of HCV protein NS5A with model membranes. Biochimica et Biophysica Acta (BBA) - Biomembranes 1798:6, 1212-1224
CrossRef73
Takasuke Fukuhara, Akinobu Taketomi, Shinji Okano, Toru Ikegami, Yuji Soejima, Ken Shirabe, Yoshihiko Maehara. (2010) Mutations in hepatitis C virus genotype 1b and the sensitivity of interferon-ribavirin therapy after liver transplantation. Journal of Hepatology 52:5, 672-680
CrossRef74
Bruno Roche, Didier Samuel. (2010) Are viral or host factors predictive of response to interferon–ribavirin in transplant patients with hepatitis C?. Journal of Hepatology 52:5, 630-632
CrossRef75
Izumi Namiki, Shuhei Nishiguchi, Keisuke Hino, Fumitaka Suzuki, Hiromitsu Kumada, Yoshihito Itoh, Yusuhiro Asahina, Akihiro Tamori, Naoki Hiramatsu, Norio Hayashi, Masatoshi Kudo. (2010) Management of hepatitis C; Report of the Consensus Meeting at the 45th Annual Meeting of the Japan Society of Hepatology (2009). Hepatology Research 40:4, 347-368
CrossRef76
Norio Akuta, Fumitaka Suzuki, Miharu Hirakawa, Yusuke Kawamura, Hiromi Yatsuji, Hitomi Sezaki, Yoshiyuki Suzuki, Tetsuya Hosaka, Masahiro Kobayashi, Mariko Kobayashi, Satoshi Saitoh, Yasuji Arase, Kenji Ikeda, Hiromitsu Kumada. (2010) Amino acid substitutions in the hepatitis C virus core region of genotype 1b affect very early viral dynamics during treatment with telaprevir, peginterferon, and ribavirin. Journal of Medical Virology 82:4, 575-582
CrossRef77
Sidney Pestka. 2010. Type I Interferons and Receptors. .
CrossRef78
Jaime Guillén, Alejandro González-Álvarez, José Villalaín. (2010) A membranotropic region in the C-terminal domain of Hepatitis C virus protein NS4B. Biochimica et Biophysica Acta (BBA) - Biomembranes 1798:3, 327-337
CrossRef79
John Scott, Atif Zaman, Michael Chang. 2010. Viral Hepatitis. , 315-327.
CrossRef80
H. J. Yuan, M. Jain, K. K. Snow, M. Gale Jr, W. M. Lee, . (2010) Evolution of hepatitis C virus NS5A region in breakthrough patients during pegylated interferon and ribavirin therapy. Journal of Viral Hepatitis 17:3, 208-216
CrossRef81
Eiichi Tomita, Kazuki Ando, Jun-ichi Sugihara, Youichi Nishigaki, Tetsuya Yamada, Ryoko Ando, Masao Takemura, Mitsuru Seishima. (2010) Advantage of IFN-β/α2b same-day administration for ribavirin-intolerant patients with chronic hepatitis C. Hepatology Research 40:3, 261-268
CrossRef82
Sumio Watanabe, Nobuyuki Enomoto, Kazuhiko Koike, Namiki Izumi, Hajime Takikawa, Etsuko Hashimoto, Fuminori Moriyasu, Hiromitsu Kumada, Michio Imawari, . (2010) Prolonged treatment with pegylated interferon α 2b plus ribavirin improves sustained virological response in chronic hepatitis C genotype 1 patients with late response in a clinical real-life setting in Japan. Hepatology Research 40:2, 135-144
CrossRef83
Hideaki Kato, Makoto Nakamura, Atsushi Nakamura, Ryuzo Ueda. (2010) A case of compensated liver cirrhosis with hepatitis C virus of genotype 1b and high viral load in whom sustained virological response was achieved by 2-year administration of very low-dose recombinant interferon alpha-2b. European Journal of Gastroenterology & Hepatology 22:1, 121-122
CrossRef84
Young-Joo Jin, Yoon Kyung Park, Gui Jun Yun, Han Chu Lee, Sook-Hyang Jeong, Gang Mo Kim, Young-Suk Lim, Young-Hwa Chung, Yung Sang Lee, Dong Jin Suh. (2010) Mutations within the interferon sensitivity determining region in Korean patients infected with hepatitis C virus genotype 1b. The Korean Journal of Hepatology 16:2, 158
CrossRef85
Chun-Hao Chen, Ming-Lung Yu. (2010) Evolution of Interferon-Based Therapy for Chronic Hepatitis C. Hepatitis Research and Treatment 2010, 1-12
CrossRef86
Namiki Izumi, Yasuhiro Asahina, Masayuki Kurosaki. (2010) Predictors of Virological Response to a Combination Therapy with Pegylated Interferon Plus Ribavirin Including Virus and Host Factors. Hepatitis Research and Treatment 2010, 1-7
CrossRef87
Nobuo Waguri, Koichi Furukawa, Haruo Ikeda, Masahiro Hayashi, Junji Kouhisa, Isamu Hama, Takeshi Yokoo, Tsuneo Aiba, Osamu Yoneyama, Kazuhito Sugimura, Kentaro Igarashi, Satoshi Tsukioka. (2010) A case of hepatitis C related cirrhosis with sustained virological response by a long-term, intermittent use of low-dose natural interferon-alpha. Kanzo 51:1, 6-12
CrossRef88
N. Bouzgarrou, E. Hassen, W. Mahfoudh, S. Gabbouj, E. Schvoerer, A. Ben Yahia, N. Ben Mami, H. Triki, L. Chouchane. (2009) NS5A ISDR-V3 region genetic variability of Tunisian HCV-1b strains: Correlation with the response to the combined interferon/Ribavirin therapy. Journal of Medical Virology 81:12, 2021-2028
CrossRef89
A. C. W. Jenke, S. Moser, V. Orth, M. Zilbauer, P. Gerner, S. Wirth. (2009) Mutation frequency of NS5A in patients vertically infected with HCV genotype 1 predicts sustained virological response to peginterferon alfa-2b and ribavirin combination therapy. Journal of Viral Hepatitis 16:12, 853-859
CrossRef90
Fumitaka Suzuki, Norio Akuta, Yoshiyuki Suzuki, Hitomi Sezaki, Hiromi Yatsuji, Yusuke Kawamura, Tetsuya Hosaka, Masahiro Kobayashi, Yasuji Arase, Kenji Ikeda, Rie Mineta, Satomi Iwasaki, Sachiyo Watahiki, Mariko Kobayashi, Yuzo Miyakawa, Hiromitsu Kumada. (2009) Rapid loss of hepatitis C virus genotype 1b from serum in patients receiving a triple treatment with telaprevir (MP-424), pegylated interferon and ribavirin for 12 weeks. Hepatology Research 39:11, 1056-1063
CrossRef91
Mahmoud M. El Hefnawi, Wessam H. El Behaidy, Aliaa A. Youssif, Atek Z. Ghalwash, Lamya A. El Housseiny, Suher Zada. (2009) Natural Genetic Engineering of Hepatitis C Virus NS5A for Immune System Counterattack. Annals of the New York Academy of Sciences 1178:1, 173-185
CrossRef92
Birke Bartosch, Robert Thimme, Hubert E. Blum, Fabien Zoulim. (2009) Hepatitis C virus-induced hepatocarcinogenesis. Journal of Hepatology 51:4, 810-820
CrossRef93
Shinya Maekawa, Nobuyuki Enomoto. (2009) Viral factors influencing the response to the combination therapy of peginterferon plus ribavirin in chronic hepatitis C. Journal of Gastroenterology 44:10, 1009-1015
CrossRef94
Takeshi Okanoue, Yoshito Itoh, Hiroaki Hashimoto, Kohichiroh Yasui, Masahito Minami, Tetsuo Takehara, Eiji Tanaka, Morikazu Onji, Joji Toyota, Kazuaki Chayama, Kentaro Yoshioka, Namiki Izumi, Norio Akuta, Hiromitsu Kumada. (2009) Predictive values of amino acid sequences of the core and NS5A regions in antiviral therapy for hepatitis C: a Japanese multi-center study. Journal of Gastroenterology 44:9, 952-963
CrossRef95
Yoshinari Kawai, Masanori Ikeda, Ken-ichi Abe, Masahiko Yano, Yasuo Ariumi, Hiromichi Dansako, Kazuhide Yamamoto, Nobuyuki Kato. (2009) Development of a hepatitis C virus relapse model using genome-length hepatitis C virus ribonucleic acid-harboring cells possessing the interferon-α-resistance phenotype. Hepatology Research 39:9, 898-909
CrossRef96
Hiroki Ikeda, Michihiro Suzuki, Chiaki Okuse, Norie Yamada, Masaru Okamoto, Minoru Kobayashi, Yoshihiko Nagase, Hideaki Takahashi, Koutarou Matsunaga, Nobuyuki Matsumoto, Fumio Itoh, Hiroshi Yotsuyanagi, Yu Koitabashi, Kiyomi Yasuda, Shiro Iino. (2009) Short-term prolongation of pegylated interferon and ribavirin therapy for genotype 1b chronic hepatitis C patients with early viral response. Hepatology Research 39:8, 753-759
CrossRef97
Norio Akuta, Fumitaka Suzuki, Miharu Hirakawa, Yusuke Kawamura, Hiromi Yatsuji, Hitomi Sezaki, Yoshiyuki Suzuki, Tetsuya Hosaka, Masahiro Kobayashi, Mariko Kobayashi, Satoshi Saitoh, Yasuji Arase, Kenji Ikeda, Hiromitsu Kumada. (2009) Amino acid substitutions in the hepatitis C virus core region of genotype 1b are the important predictor of severe insulin resistance in patients without cirrhosis and diabetes mellitus. Journal of Medical Virology 81:6, 1032-1039
CrossRef98
M.-L. Chang, K.-F. Sung, I.-S. Sheen, S.-M. Lin, C.-T. Yeh. (2009) A liver slice culture-based ex vivo assay to predict the outcome of antiviral therapy for chronic hepatitis C. Journal of Viral Hepatitis 16:5, 359-366
CrossRef99
José M. Cuevas, Manuela Torres-Puente, Nuria Jiménez-Hernández, María A. Bracho, Inmaculada García-Robles, Fernando Carnicer, Juan del Olmo, Enrique Ortega, Fernando González-Candelas, Andrés Moya. (2009) Combined therapy of interferon plus ribavirin promotes multiple adaptive solutions in hepatitis C virus. Journal of Medical Virology 81:4, 650-656
CrossRef100
Claudio Argentini, Domenico Genovese, Stefano Dettori, Maria Rapicetta. (2009) HCV genetic variability: from quasispecies evolution to genotype classification. Future Microbiology 4:3, 359-373
CrossRef101
Hideyuki Nomura, Yugo Miyagi, Hironori Tanimoto, Masashi Higashi, Hiromi Ishibashi. (2009) Effective prediction of outcome of combination therapy with pegylated interferon alpha 2b plus ribavirin in Japanese patients with genotype-1 chronic hepatitis C using early viral kinetics and new indices. Journal of Gastroenterology 44:4, 338-345
CrossRef102
Jing Xu, Shufeng Liu, Yihui Xu, Po Tien, Guangxia Gao. (2009) Identification of the nonstructural protein 4B of hepatitis C virus as a factor that inhibits the antiviral activity of interferon-alpha. Virus Research 141:1, 55-62
CrossRef103
Nami Mori, Michio Imamura, Yoshiiku Kawakami, Hiromi Saneto, Tomokazu Kawaoka, Shintaro Takaki, Hiroshi Aikata, Shoichi Takahashi, Kazuaki Chayama, . (2009) Randomized trial of high-dose interferon-α-2b combined with ribavirin in patients with chronic hepatitis C: Correlation between amino acid substitutions in the core/NS5A region and virological response to interferon therapy. Journal of Medical Virology 81:4, 640-649
CrossRef104
Ella H. Sklan, Prista Charuworn, Philip S. Pang, Jeffrey S. Glenn. (2009) Mechanisms of HCV survival in the host. Nature Reviews Gastroenterology & Hepatology 6:4, 217-227
CrossRef105
Kazuhiko Hayashi, Yoshiaki Katano, Takashi Honda, Masatoshi Ishigami, Akihiro Itoh, Yoshiki Hirooka, Isao Nakano, Fumihiro Urano, Kentaro Yoshioka, Hidenori Toyoda, Takashi Kumada, Hidemi Goto. (2009) Mutations in the interferon sensitivity-determining region of hepatitis C virus genotype 2a correlate with response to pegylated-interferon-alpha 2a monotherapy. Journal of Medical Virology 81:3, 459-466
CrossRef106
Norio Akuta, Fumitaka Suzuki, Miharu Hirakawa, Yusuke Kawamura, Hiromi Yatsuji, Hitomi Sezaki, Yoshiyuki Suzuki, Tetsuya Hosaka, Masahiro Kobayashi, Mariko Kobayashi, Satoshi Saitoh, Yasuji Arase, Kenji Ikeda, Hiromitsu Kumada. (2009) A matched case-controlled study of 48 and 72 weeks of peginterferon plus ribavirin combination therapy in patients infected with HCV genotype 1b in Japan: amino acid substitutions in HCV core region as predictor of sustained virological response. Journal of Medical Virology 81:3, 452-458
CrossRef107
Yasuji Arase, Fumitaka Suzuki, Hitomi Sezaki, Yusuke Kawamura, Yoshiyuki Suzuki, Masahiro Kobayashi, Norio Akuta, Tetsuya Hosaka, Hiromi Yatsuji, Miharu Hirakawa, Mariko Kobayashi, Satoshi Saitoh, Kenji Ikeda, Hiromitsu Kumada. (2009) The Efficacy of Interferon-beta Monotherapy for Elderly Patients with Type C Hepatitis of Genotype 2. Internal Medicine 48:16, 1337-1342
CrossRef108
Noritomo Shimada, Kai Yoshizawa, Makiko Ika, Akira Dobashi, Naoto Nomura, Gotaro Toda, Akihito Tsubota, Hiroshi Abe, Yoshio Aizawa. (2009) Response-guided therapy in Japanese chronic hepatitis C patients infected with genotype 1b and high viral load. Kanzo 50:12, 687-702
CrossRef109
Shuhei Nishiguchi, Namiki Izumi, Keisuke Hino, Fumitaka Suzuki, Hiromitsu Kumada, Yoshito Ito, Yasuhiro Asahina, Akihiro Tamori, Naoki Hiramatsu, Norio Hayashi, Masatoshi Kudo. (2009) JSH Consensus Kobe 2009: Diagnosis and Treatment of Hepatitis C. Kanzo 50:11, 665-677
CrossRef110
Noboru Hirashima, Masaaki Shimada, Hiroaki Iwase, Hidemi Goto. (2009) Double filtration plasmapheresis and peginterferon plus ribavirin combination therapy for chronic hepatitis C patients non-responded by previous interferon therapy. Kanzo 50:12, 738-740
CrossRef111
Haruaki Shirakawa, Akihiro Matsumoto, Satoru Joshita, Michiharu Komatsu, Naoki Tanaka, Takeji Umemura, Tetsuya Ichijo, Kaname Yoshizawa, Kendo Kiyosawa, Eiji Tanaka, . (2008) Pretreatment prediction of virological response to peginterferon plus ribavirin therapy in chronic hepatitis C patients using viral and host factors. Hepatology 48:6, 1753-1760
CrossRef112
Fuat Kurbanov, Yasuhito Tanaka, Elena Chub, Isao Maruyama, Aziza Azlarova, Hiroshi Kamitsukasa, Tomoyoshi Ohno, Stefania Bonetto, Isabelle Moreau, Liam J. Fanning, Florence Legrand‐Abravanel, Jaques Izopet, Nikolai Naoumov, Takashi Shimada, Sergei Netesov, Masashi Mizokami. (2008) Molecular Epidemiology and Interferon Susceptibility of the Natural Recombinant Hepatitis C Virus Strain RF1_2k/1b. The Journal of Infectious Diseases 198:10, 1448-1456
CrossRef113
Annika Kau, Johannes Vermehren, Christoph Sarrazin. (2008) Treatment predictors of a sustained virologic response in hepatitis B and C. Journal of Hepatology 49:4, 634-651
CrossRef114
Arleta Kowala-Piaskowska, Paulina Jackowiak, Magdalena Figlerowicz, Magdalena Alejska, Wojciech Służewski, Marek Figlerowicz. (2008) Analiza zmienności wirusowego białka NS5A u dzieci z przewlekłym zapaleniem wątroby typu C – poszukiwanie korelacji pomiędzy polimorfizmem genetycznym wirusa a odpowiedzią na leczenie. Badania wstępne. Pediatria Polska 83:5, 455-463
CrossRef115
T. Kimura, M. Imamura, N. Hiraga, T. Hatakeyama, D. Miki, C. Noguchi, N. Mori, M. Tsuge, S. Takahashi, Y. Fujimoto, E. Iwao, H. Ochi, H. Abe, T. Maekawa, K. Arataki, C. Tateno, K. Yoshizato, T. Wakita, T. Okamoto, Y. Matsuura, K. Chayama. (2008) Establishment of an infectious genotype 1b hepatitis C virus clone in human hepatocyte chimeric mice. Journal of General Virology 89:9, 2108-2113
CrossRef116
J. M. Cuevas, M. Torres-Puente, N. Jimnez-Hernndez, M. A. Bracho, I. Garca-Robles, F. Carnicer, J. D. Olmo, E. Ortega, A. Moya, F. Gonzlez-Candelas. (2008) Refined analysis of genetic variability parameters in hepatitis C virus and the ability to predict antiviral treatment response. Journal of Viral Hepatitis 15:8, 578-590
CrossRef117
Norio Akuta, Fumitaka Suzuki, Yusuke Kawamura, Hiromi Yatsuji, Hitomi Sezaki, Yoshiyuki Suzuki, Tetsuya Hosaka, Masahiro Kobayashi, Mariko Kobayashi, Yasuji Arase, Kenji Ikeda, Hiromitsu Kumada. (2008) Efficacy of low-dose intermittent interferon-alpha monotherapy in patients infected with hepatitis C virus genotype 1b who were predicted or failed to respond to pegylated interferon plus ribavirin combination therapy. Journal of Medical Virology 80:8, 1363-1369
CrossRef118
Thomas Kuntzen, Andrew Berical, Jean Ndjomou, Phil Bennett, Arne Schneidewind, Niall Lennon, Bruce W. Birren, Carla Kuiken, Matthew R. Henn, Peter Simmonds, Todd M. Allen. (2008) A set of reference sequences for the hepatitis C genotypes 4d, 4f, and 4k covering the full open reading frame. Journal of Medical Virology 80:8, 1370-1378
CrossRef119
Ahmed El‐Shamy, Motoko Nagano‐Fujii, Noriko Sasase, Susumu Imoto, Soo‐Ryang Kim, Hak Hotta. (2008) Sequence variation in hepatitis C virus nonstructural protein 5A predicts clinical outcome of pegylated interferon/ribavirin combination therapy. Hepatology 48:1, 38-47
CrossRef120
Daisuke Sasaki, Kazuyuki Sugahara, Naoko Inokuchi, Katunori Yanagihara, Hiroo Hasegawa, Sayaka Mori, Yasuaki Yamada, Shimeru Kamihira. (2008) Screening for genetic heterogeneity in the interferon sensitivity determining region of the hepatitis C virus genome by polymerase chain reaction with melting curve analysis. Clinical Chemistry and Laboratory Medicine 46:7, 966-973
CrossRef121
Tohru Noguchi, Tomoko Otsubaki, Izuru Ando, Naoki Ogura, Satoru Ikeda, Kunitada Shimotohno. (2008) Isolation and gene analysis of interferon α-resistant cell clones of the hepatitis C virus subgenome. Virology 375:2, 424-432
CrossRef122
Sharif B. Missiha, Mario Ostrowski, E. Jenny Heathcote. (2008) Disease Progression in Chronic Hepatitis C: Modifiable and Nonmodifiable Factors. Gastroenterology 134:6, 1699-1714
CrossRef123
Federico Di Lello, Gabriel Garcia, Verónica Kott, Silvia Sookoian, Rodolfo Campos. (2008) Diversity of hepatitis C virus genotype 1b in Buenos Aires, Argentina: description of a new cluster associated with response to treatment. Journal of Medical Virology 80:4, 619-627
CrossRef124
Mitsuyasu Nakamura, Hidetsugu Saito, Masanori Ikeda, Shinichiro Tada, Naoki Kumagai, Nobuyuki Kato, Kunitada Shimotohno, Toshifumi Hibi. (2008) Possible molecular mechanism of the relationship between NS5B polymorphisms and early clearance of hepatitis C virus during interferon plus ribavirin treatment. Journal of Medical Virology 80:4, 632-639
CrossRef125
Yoshihiko Nagase, Hiroshi Yotsuyanagi, Chiaki Okuse, Kiyomi Yasuda, Tomohiro Kato, Kazuhiko Koike, Michihiro Suzuki, Kusuki Nishioka, Shiro Iino, Fumio Itoh. (2008) Effect of treatment with interferon α-2b and ribavirin in patients infected with genotype 2 hepatitis C virus. Hepatology Research 38:3, 252-258
CrossRef126
Manuela Torres-Puente, José M. Cuevas, Nuria Jiménez-Hernández, María A. Bracho, Inmaculada García-Robles, Fernando Carnicer, Juan del Olmo, Enrique Ortega, Andrés Moya, Fernando González-Candelas. (2008) Hepatitis C virus and the controversial role of the interferon sensitivity determining region in the response to interferon treatment. Journal of Medical Virology 80:2, 247-253
CrossRef127
Nuria Jiménez-Hernández, Vicente Sentandreu, José A. Castro, Manuela Torres-Puente, Alma Bracho, Inmaculada García-Robles, Enrique Ortega, Juan del Olmo, Fernando Carnicer, Fernando González-Candelas, Andrés Moya. (2008) Effect of antiviral treatment and host susceptibility on positive selection in hepatitis C virus (HCV). Virus Research 131:2, 224-232
CrossRef128
Yasuji Arase, Fumitaka Suzuki, Hitomi Sezaki, Yusuke Kawamura, Yoshiyuki Suzuki, Masahiro Kobayashi, Norio Akuta, Tetsuya Hosaka, Hiromi Yatsuji, Mariko Kobayashi, Satoshi Saitoh, Kenji Ikeda, Hiromitsu Kumada. (2008) The Efficacy of Short-Term Interferon-Beta Therapy for Type C Cirrhotic Patients with Genotype 2a and Low Virus Load. Internal Medicine 47:12, 1085-1090
CrossRef129
Ke-Qin Hu, John M. Vierling, Allan G. Redeker. (2008) Viral, host and interferon-related factors modulating the effect of interferon therapy for hepatitis C virus infection. Journal of Viral Hepatitis 8:1, 1
CrossRef130
He-Jun Yuan, William M Lee. (2008) Nonresponse to Treatment for Hepatitis C. Drugs 68:1, 27-42
CrossRef131
Chiaki Okuse, Daisuke Kumon, Minoru Kobayashi, Akira Endo, Yuichi Kinoshita, Yohei Noguchi, Naoki Izawa, Shunichiro Ozawa, Kazunari Nakahara, Norie Yamada, Masaru Okamoto, Hideaki Takahashi, Yoshiki Katakura, Kotaro Matsunaga, Nobuyuki Matsumoto, Toshiya Ishii, Hiroshi Yotsuyanagi, Shiro Iino, Michihiro Suzuki, Fumio Itoh. (2008) A case of chronic hepatitis C in which a 72-week course of pegylated interferon and ribavirin combination therapy resulted in relapse but a subsequent interferon monotherapy could induce sustained virological response. Kanzo 49:11, 495-500
CrossRef132
Aldona Kasprzak, Agnieszka Adamek. (2008) Role of hepatitis C virus proteins (C, NS3, NS5A) in hepatic oncogenesis. Hepatology Research 38:1, 1-26
CrossRef133
Y.-H. YEN, C.-H. HUNG, T.-H. HU, C.-H. CHEN, C.-M. WU, J.-H. WANG, S.-N. LU, C.-M. LEE. (2008) Mutations in the interferon sensitivity-determining region (nonstructural 5A amino acid 2209-2248) in patients with hepatitis C-1b infection and correlating response to combined therapy of pegylated interferon and ribavirin. Alimentary Pharmacology & Therapeutics 27:1, 72-79
CrossRef134
Noriko Sasase, Soo Ryang Kim, Ke Ih Kim, Miyuki Taniguchi, Susumu Imoto, Keiji Mita, Hak Hotta, Ikuo Shouji, Ahmed El-Shamy, Norifumi Kawada, Masatoshi Kudo, Yoshitake Hayashi. (2008) Usefulness of a New Immunoradiometric Assay of HCV Core Antigen to Predict Virological Response during PEG-IFN/RBV Combination Therapy for Chronic Hepatitis with High Viral Load of Serum HCV RNA Genotype 1b. Intervirology 51:1, 70-75
CrossRef135
Yusuke Kawamura, Yasuji Arase, Kenji Ikeda, Fumitaka Suzuki, Yoshiyuki Suzuki, Masahiro Kobayashi, Norio Akuta, Tetsuya Hosaka, Hitomi Sezaki, Hiromi Yatsuji, Mariko Kobayashi, Hiromitsu Kumada. (2008) The Efficacy of Short-term Interferon-beta Therapy for Chronic Hepatitis C Patients with Low Virus Load. Internal Medicine 47:5, 355-360
CrossRef136
Mitsuyasu Nakamura, Hidetsugu Saito, Toshifumi Hibi. (2008) Advances in Genomic Research on Hepatitis C Virus with a Useful Tool, Replicon System. The Keio Journal of Medicine 57:2, 75-83
CrossRef137
Takeshi Saito, Michael Gale. (2007) Regulation of innate immunity against hepatitis C virus infection. Hepatology Research 0:0, 071117021731007-???
CrossRef138
Chuanlai Shen, Ting Hu, Ling Shen, Lei Gao, Wei Xie, Jianqiong Zhang. (2007) Mutations in ISDR of NS5A gene influence interferon efficacy in Chinese patients with chronic hepatitis C virus genotype 1b infection. Journal of Gastroenterology and Hepatology 22:11, 1898-1903
CrossRef139
Norio Akuta, Fumitaka Suzuki, Yusuke Kawamura, Hiromi Yatsuji, Hitomi Sezaki, Yoshiyuki Suzuki, Tetsuya Hosaka, Masahiro Kobayashi, Mariko Kobayashi, Yasuji Arase, Kenji Ikeda, Hiromitsu Kumada. (2007) Predictors of viral kinetics to peginterferon plus ribavirin combination therapy in Japanese patients infected with hepatitis C virus genotype 1b. Journal of Medical Virology 79:11, 1686-1695
CrossRef140
Maria Stella De Mitri, Romina Cassini, Sabrina Bagaglio, Giulia Morsica, Pietro Andreone, Nicoletta Marino, Mauro Bernardi. (2007) Evolution of hepatitis C virus non-structural 5A gene in the progression of liver disease to hepatocellular carcinoma. Liver International 27:8, 1126-1133
CrossRef141
Fiona Fernandes, Daniel S. Poole, Spencer Hoover, Rannveig Middleton, Adin-Cristian Andrei, Justin Gerstner, Rob Striker. (2007) Sensitivity of hepatitis C virus to cyclosporine A depends on nonstructural proteins NS5A and NS5B. Hepatology 46:4, 1026-1033
CrossRef142
Sharif Missiha, Jenny Heathcote, Tamara Arenovich, Kamran Khan, . (2007) Impact of Asian Race on Response to Combination Therapy With Peginterferon Alfa-2a and Ribavirin in Chronic Hepatitis C. The American Journal of Gastroenterology 102:10, 2181-2188
CrossRef143
C.-H. Hung, C.-H. Chen, C.-M. Lee, C.-M. Wu, T.-H. Hu, J.-H. Wang, Y.-H. Yen, S.-N. Lu. (2007) Association of amino acid variations in the NS5A and E2-PePHD region of hepatitis C virus 1b with hepatocellular carcinoma. Journal of Viral Hepatitis 0:0, 070924202706007-???
CrossRef144
Shotaro Enomoto, Hideyuki Tamai, Masashi Oka, Naoki Shingaki, Tatsuya Shiraki, Machiko Takeuchi, Hisanobu Deguchi, Hirohito Magari, Izumi Inoue, Mikitaka Iguchi, Kimihiko Yanaoka, Kenji Arii, Mitsuhiro Fujishiro, Naohisa Yahagi, Hiroshi Yotsuyanagi, Masao Ichinose. (2007) Potent induction therapy with interferon and ribavirin combination therapy does not achieve a higher sustained virological response rate in chronic hepatitis C with genotype 1b and high hepatitis C virus RNA level. Hepatology Research 37:9, 692-700
CrossRef145
Juan Cristina, María del Pilar Moreno, Gonzalo Moratorio. (2007) Hepatitis C virus genetic variability in patients undergoing antiviral therapy. Virus Research 127:2, 185-194
CrossRef146
Ying Pan, Wei Wei, Lei Kang, Zhongqiang Wang, Jiali Fang, Ying Zhu, Jianguo Wu. (2007) NS5A protein of HCV enhances HBV replication and resistance to interferon response. Biochemical and Biophysical Research Communications 359:1, 70-75
CrossRef147
Claude Souvignet, Olivier Lejeune, Christian Trepo. (2007) Interferon-based treatment of chronic hepatitis C. Biochimie 89:6-7, 894-898
CrossRef148
M.A. García, E.F. Meurs, M. Esteban. (2007) The dsRNA protein kinase PKR: Virus and cell control. Biochimie 89:6-7, 799-811
CrossRef149
Hiroshi Yotsuyanagi, Kazuhiko Koike. (2007) Drug resistance in antiviral treatment for infections with hepatitis B and C viruses. Journal of Gastroenterology 42:5, 329-335
CrossRef150
Sohail A. Qureshi. (2007) Hepatitis C virus—biology, host evasion strategies, and promising new therapies on the horizon. Medicinal Research Reviews 27:3, 353-373
CrossRef151
Ichiro Konishi, Norio Horiike, Yoichi Hiasa, Yoshio Tokumoto, Toshie Mashiba, Kojiro Michitaka, Yasuyuki Miyake, Suguru Nonaka, Kouji Joukou, Bunzo Matsuura, Morikazu Onji. (2007) Diabetes mellitus reduces the therapeutic effectiveness of interferon-?2b plus ribavirin therapy in patients with chronic hepatitis C. Hepatology Research 37:5, 331-336
CrossRef152
Juan Cristina. (2007) Hepatitis C virus: quasispecies dynamics, virus persistance and antiviral therapy. Expert Opinion on Therapeutic Patents 17:5, 499-510
CrossRef153
M.-W. Welker, W.-P. Hofmann, C. Welsch, M. von Wagner, E. Herrmann, T. Lengauer, S. Zeuzem, C. Sarrazin. (2007) Correlation of amino acid variations within nonstructural 4B protein with initial viral kinetics during interferon-alpha-based therapy in HCV-1b-infected patients. Journal of Viral Hepatitis 14:5, 338-349
CrossRef154
Chiaki Okuse, Kayo Adachi, Yoshiki Katakura, Kotaro Matsunaga, Toshiya Ishii, Nobuyuki Matsumoto, Hiroshi Yotsuyanagi, Shiro Iino, Michihiro Suzuki, Fumio Itoh. (2007) A case of deep venous thrombosis associated with pegylated interferon α2b plus ribavirin treatment of chronic hepatitis C. Journal of Gastroenterology 41:12, 1231-1236
CrossRef155
Saburo Sone, Akiko Izawa, Hideki Narumi, Akemi Kajita, Junichi Tanabe, Fumihiro Taguchi. (2007) The combination of type I interferon and ribavirin has an inhibitory effect on mouse hepatitis virus infection. Hepatology Research 37:2, 121-126
CrossRef156
Ankur Goyal, Wolf P. Hofmann, Eva Hermann, Stella Traver, Syed S. Hissar, Naveen Arora, Hubert E. Blum, Stefan Zeuzem, Christoph Sarrazin, Shiv K. Sarin. (2007) The hepatitis C virus NS5A protein and response to interferon α: mutational analyses in patients with chronic HCV genotype 3a infection from India. Medical Microbiology and Immunology 196:1, 11-21
CrossRef157
Mutsumi Murayama, Yoshiaki Katano, Isao Nakano, Masatoshi Ishigami, Kazuhiko Hayashi, Takashi Honda, Yoshiki Hirooka, Akihiro Itoh, Hidemi Goto. (2007) A mutation in the interferon sensitivity-determining region is associated with responsiveness to interferon-ribavirin combination therapy in chronic hepatitis patients infected with a Japan-specific subtype of hepatitis C virus genotype 1b. Journal of Medical Virology 79:1, 35-40
CrossRef158
Peter D. Burbelo, Kathryn H. Ching, Thomas L. Mattson, Jason S. Light, Lisa R. Bishop, Joseph A. Kovacs. (2007) Rapid antibody quantification and generation of whole proteome antibody response profiles using LIPS (luciferase immunoprecipitation systems). Biochemical and Biophysical Research Communications 352:4, 889-895
CrossRef159
L. Krekulová, V. Řehák, L. W. Riley. (2006) Structure and functions of hepatitis C virus proteins: 15 years after. Folia Microbiologica 51:6, 665-680
CrossRef160
T. Kohashi, S. Maekawa, N. Sakamoto, M. Kurosaki, H. Watanabe, Y. Tanabe, C.-H. Chen, N. Kanazawa, M. Nakagawa, S. Kakinuma, T. Yamashiro, Y. Itsui, T. Koyama, N. Enomoto, M. Watanabe. (2006) Site-specific mutation of the interferon sensitivity-determining region (ISDR) modulates hepatitis C virus replication. Journal of Viral Hepatitis 13:9, 582-590
CrossRef161
Shigemi Hosogaya, Yukio Ozaki, Nobuyuki Enomoto, Yoshihiro Akahane. (2006) Analysis of prognostic factors in therapeutic responses to interferon in patients with chronic hepatitis C. Translational Research 148:2, 79-86
CrossRef162
Hiroshi Kohno, Shiomi Aimitsu, Mikiya Kitamoto, Yasuyuki Aisaka, Hiroiku Kawakami, Kazuaki Chayama. (2006) Prolonged Negative HCV-RNA Status Led to a Good Outcome in Chronic Hepatitis C Patients with Genotype 1b and Super-High Viral Load. Intervirology 49:6, 362-369
CrossRef163
Norio Akuta, Fumitaka Suzuki, Hitomi Sezaki, Yoshiyuki Suzuki, Tetsuya Hosaka, Takashi Someya, Masahiro Kobayashi, Satoshi Saitoh, Sachiyo Watahiki, Junko Sato, Mariko Kobayashi, Yasuji Arase, Kenji Ikeda, Hiromitsu Kumada. (2006) Predictive factors of virological non-response to interferon-ribavirin combination therapy for patients infected with hepatitis C virus of genotype1b and high viral load. Journal of Medical Virology 78:1, 83-90
CrossRef164
Stephen J Polyak. (2006) Resistance of hepatitis C virus to the host antiviral response. Future Virology 1:1, 89-98
CrossRef165
Shintaro Abe, Ryoichi Narita, Takeshi Oto, Akinari Tabaru, Makoto Otsuki. (2006) Effect of combination therapy with ribavirin and high-dose interferon-α2b for 24 weeks in chronic hepatitis C. Journal of Gastroenterology and Hepatology 21:1, 308-312
CrossRef166
Takashi Kumada, Hidenori Toyoda, Takashi Honda, Teiji Kuzuya, Yosiaki Katano, Isao Nakano, Hidemi Goto. (2006) Treatment of Chronic Hepatitis C with Interferon Alone or Combined with Ribavirin in Japan. Intervirology 49:1-2, 112-118
CrossRef167
Chuan-Mo Lee, Chao-Hung Hung, Sheng-Nan Lu, Jing-Houng Wang, Hung-Da Tung, Wu-Shiung Huang, Chao-Long Chen, Wei-Jen Chen, Chi-Sin Changchien. (2006) Viral Etiology of Hepatocellular Carcinoma and HCV Genotypes in Taiwan. Intervirology 49:1-2, 76-81
CrossRef168
J. Itakura, K. Nagayama, N. Enomoto, K. Hamano, N. Sakamoto, L. J. Fanning, E. Kenny-Walsh, F. Shanahan, M. Watanabe. (2005) Viral load change and sequential evolution of entire hepatitis C virus genome in Irish recipients of single source-contaminated anti-D immunoglobulin*. Journal of Viral Hepatitis 12:6, 594-603
CrossRef169
KOSEI HAMANO, NAOYA SAKAMOTO, NOBUYUKI ENOMOTO, NAMIKI IZUMI, YASUHIRO ASAHINA, MASAYUKI KUROSAKI, ERI UEDA, YOKO TANABE, SHINYA MAEKAWA, JUN ITAKURA, HIDEKI WATANABE, SEI KAKINUMA, MAMORU WATANABE. (2005) Mutations in the NS5B region of the hepatitis C virus genome correlate with clinical outcomes of interferon-alpha plus ribavirin combination therapy. Journal of Gastroenterology and Hepatology 20:9, 1401-1409
CrossRef170
Michael Gale, Eileen M. Foy. (2005) Evasion of intracellular host defence by hepatitis C virus. Nature 436:7053, 939-945
CrossRef171
Jordan J. Feld, Jay H. Hoofnagle. (2005) Mechanism of action of interferon and ribavirin in treatment of hepatitis C. Nature 436:7053, 967-972
CrossRef172
Atsushi Hokari, Mikio Zeniya, Hiroyasu Esumi, Tomohisa Ishikawa, Yukiko Kurasima, Gotaro Toda. (2005) Role of nitric oxide (NO) in interferon-alpha therapy for hepatitis C. Journal of Infection 51:1, 47-53
CrossRef173
S.-D. Lee, M.-L. Yu, P.-N. Cheng, M.-Y. Lai, Y.-C. Chao, S.-J. Hwang, W.-Y. Chang, T.-T. Chang, T.-Y. Hsieh, C.-J. Liu, D.-S. Chen. (2005) Comparison of a 6-month course peginterferon alpha-2b plus ribavirin and interferon alpha-2b plus ribavirin in treating Chinese patients with chronic hepatitis C in Taiwan. Journal of Viral Hepatitis 12:3, 283-291
CrossRef174
Y. Tanabe, K. Nagayama, N. Enomoto, N. Izumi, J. Tazawa, M. Kurosaki, N. Sakamoto, C. Sato, M. Watanabe. (2005) Characteristic sequence changes of hepatitis C virus genotype 2b associated with sustained biochemical response to IFN therapy. Journal of Viral Hepatitis 12:3, 251-261
CrossRef175
Jinhua Xiang, Christina Martinez-Smith, Michael Gale, Qing Chang, Douglas R. Labrecque, Warren N. Schmidt, Jack T. Stapleton. (2005) GB Virus Type C NS5A Sequence Polymorphisms: Association with Interferon Susceptibility and Inhibition of PKR-Mediated eIF2α Phosphorylation. Journal of Interferon & Cytokine Research 25:5, 261-270
CrossRef176
Kazumasa Watanabe, Kentaro Yoshioka, Motoyoshi Yano, Masatoshi Ishigami, Koji Ukai, Hiroshi Ito, Fumiyuki Miyata, Tetsuya Mizutani, Hidemi Goto. (2005) Mutations in the nonstructural region 5B of hepatitis C virus genotype 1b: Their relation to viral load, response to interferon, and the nonstructural region 5A. Journal of Medical Virology 75:4, 504-512
CrossRef177
Ling Lu, Tatsunori Nakano, Yunshao He, Yongshui Fu, Curt H. Hagedorn, Betty H. Robertson. (2005) Hepatitis C virus genotype distribution in China: Predominance of closely related subtype 1b isolates and existence of new genotype 6 variants. Journal of Medical Virology 75:4, 538-549
CrossRef178
Mireia Giménez-Barcons, Chunfu Wang, Ming Chen, José-María Sánchez-Tapias, Juan-Carlos Sáiz, Michael Gale. (2005) The Oncogenic Potential of Hepatitis C Virus NS5A Sequence Variants Is Associated with PKR Regulation. Journal of Interferon & Cytokine Research 25:3, 152-164
CrossRef179
K. Yoshioka, H. Ito, K. Watanabe, M. Yano, M. Ishigami, T. Mizutani, Y. Sasaki, H. Goto. (2005) Interferon sensitivity-determining region of nonstructural region 5A of hepatitis C virus genotype 1b correlates with serum alanine aminotransferase levels in chronic infection. Journal of Viral Hepatitis 12:2, 139-145
CrossRef180
K. Imanaka, S. Tamura, K. Fukui, N. Ito, S. Kiso, Y. Imai, T. Naka, T. Kishimoto, S. Kawata, Y. Shinomura, . (2005) Enhanced expression of suppressor of cytokine signalling-1 in the liver of chronic hepatitis C: possible involvement in resistance to interferon therapy. Journal of Viral Hepatitis 12:2, 130-138
CrossRef181
Nobuhiko Hiraga, Fumitaka Suzuki, Norio Akuta, Yoshiyuki Suzuki, Hitomi Sezaki, Tetsuya Hosaka, Takashi Someya, Masahiro Kobayashi, Satoshi Saitoh, Yasuji Arase, Kenji Ikeda, Mariko Kobayashi, Marie Matsuda, Sachiko Watabiki, Junko Satoh, Hiromitsu Kumada. (2005) Clinical and virological characteristics of untreated patients with chronic hepatitis C who develop serum alanine aminotransferase flare-up. Journal of Medical Virology 75:2, 240-248
CrossRef182
Wolf Peter Hofmann, Stefan Zeuzem, Christoph Sarrazin. (2005) Hepatitis C virus-related resistance mechanisms to interferon α-based antiviral therapy. Journal of Clinical Virology 32:2, 86-91
CrossRef183
Norio Akuta, Fumitaka Suzuki, Hitomi Sezaki, Yoshiyuki Suzuki, Tetsuya Hosaka, Takashi Someya, Masahiro Kobayashi, Satoshi Saitoh, Sachiyo Watahiki, Junko Sato, Marie Matsuda, Mariko Kobayashi, Yasuji Arase, Kenji Ikeda, Hiromitsu Kumada. (2005) Association of Amino Acid Substitution Pattern in Core Protein of Hepatitis C Virus Genotype 1b High Viral Load and Non-Virological Response to Interferon-Ribavirin Combination Therapy. Intervirology 48:6, 372-380
CrossRef184
Mitsuhiko Moriyama, Miki Kaneko, Hiroshi Matsumura, Akiko Fukushima, Hiroshi Aoki, Naohide Tanaka, Kazumichi Kuroda, Kazufumi Shimizu, Katsuya Hiraishi, Yasuyuki Arakawa. (2005) Removal of Hepatitis C Virus by G-1 Beads in Sera from Patients with Chronic Hepatitis C. Intervirology 48:2-3, 84-88
CrossRef185
Namiki Izumi, Asahina Yasuhiro, Masayuki Kurosaki, Yuko Onuki, Yuki Nishimura, Kazunari Inoue, Ken Ueda, Kaoru Tsuchiya, Hiroyuki Nakanishi, Masakatsu Uchihara, Shozo Miyake. (2005) Development of Hepatocellular Carcinoma after Interferon Therapy in Chronic Hepatitis C. Intervirology 48:1, 59-63
CrossRef186
Tae Hun Kim, Kyung A. Kim, Young Seok Lim, Geum-youn Gwak, Jung-Hwan Yoon, Gyeong Hoon Kang, Hyo-Suk Lee. (2005) Prediction of Treatment Outcome in Chronic Hepatitis C Patients Based on Early Viral Dynamics during High-Dose Induction Interferon and Ribavirin Therapy. Intervirology 48:4, 230-238
CrossRef187
Takaji WAKITA. (2005) Kanzo 46:12, 691-702
CrossRef188
Yukihito MINATO, Naoko MOCHIZUKI, Keiji KOSHIBU, Kouji HATTORI, Tatsuo SHIIGAI. (2005) Usefulness of NS5 Antibody Measurement in Recombinant Immunoblot Assay (RIBA) as a Clinical Test for Confirmation of Asymptomatic HCV Infection. JOURNAL OF THE JAPANESE ASSOCIATION OF RURAL MEDICINE 54:4, 640-643
CrossRef189
S LEE, S SCHOMMER, S KLEIBOEKER. (2004) Porcine reproductive and respiratory syndrome virus field isolates differ in in vitro interferon phenotypes. Veterinary Immunology and Immunopathology 102:3, 217-231
CrossRef190
CHRISTOPH SARRAZIN. (2004) Diagnosis of hepatitis C: update 2004. Journal of Gastroenterology and Hepatology 19:s7, S88-S93
CrossRef191
STEPHEN A LOCARNINI, TIM SHAW. (2004) Antiviral drug resistance in hepatitis B and C. Journal of Gastroenterology and Hepatology 19:s7, S322-S328
CrossRef192
Richard Webby, Erich Hoffmann, Robert Webster. (2004) Molecular constraints to interspecies transmission of viral pathogens. Nature Medicine 10:12s, S77-S81
CrossRef193
Darius Moradpour, Hubert E. Blum. (2004) A primer on the molecular virology of hepatitis C. Liver International 24:6, 519-525
CrossRef194
G. Missale, E. Cariani, C. Ferrari. (2004) Role of viral and host factors in HCV persistence: which lesson for therapeutic and preventive strategies?. Digestive and Liver Disease 36:11, 703-711
CrossRef195
Doris B. Strader. (2004) Hepatitis C virus among african-american persons. Current Hepatitis Reports 3:4, 129-135
CrossRef196
T. Kanda, O. Yokosuka, F. Imazeki, M. Tanaka, Y. Shino, H. Shimada, T. Tomonaga, F. Nomura, K. Nagao, T. Ochiai, H. Saisho. (2004) Inhibition of subgenomic hepatitis C virus RNA in Huh-7 cells: ribavirin induces mutagenesis in HCV RNA. Journal of Viral Hepatitis 11:6, 479-487
CrossRef197
Yasuhiko Sugawara, Masatoshi Makuuchi, Yuichi Matsui, Yoji Kishi, Nobuhisa Akamatsu, Junichi Kaneko, Norihiro Kokudo. (2004) Preemptive Therapy for Hepatitis C Virus after Living-Donor Liver Transplantation. Transplantation 78:9, 1308-1311
CrossRef198
Katsuyuki Namba, Kazuhito Naka, Hiromichi Dansako, Akito Nozaki, Masanori Ikeda, Yasushi Shiratori, Kunitada Shimotohno, Nobuyuki Kato. (2004) Establishment of hepatitis C virus replicon cell lines possessing interferon-resistant phenotype. Biochemical and Biophysical Research Communications 323:1, 299-309
CrossRef199
I. Vuillermoz, E. Khattab, E. Sablon, I. Ottevaere, D. Durantel, C. Vieux, C. Trepo, Fabien Zoulim. (2004) Genetic variability of hepatitis C virus in chronically infected patients with viral breakthrough during interferon-ribavirin therapy. Journal of Medical Virology 74:1, 41-53
CrossRef200
S. Maekawa, N. Enomoto, N. Sakamoto, M. Kurosaki, E. Ueda, T. Kohashi, H. Watanabe, C.-H. Chen, T. Yamashiro, Y. Tanabe, N. Kanazawa, M. Nakagawa, C. Sato, M. Watanabe. (2004) Introduction of NS5A mutations enables subgenomic HCV replicon derived from chimpanzee-infectious HC-J4 isolate to replicate efficiently in Huh-7 cells. Journal of Viral Hepatitis 11:5, 394-403
CrossRef201
Isao Nakano, Yoshihide Fukuda, Yoshiaki Katano, Hidenori Toyoda, Kazuhiko Hayashi, Takashi Kumada, Satoshi Nakano. (2004) Mutations of the interferon sensitivity-determining region (ISDR) correlate with the complexity of hypervariable region (HVR)-1 in the Japanese variant of hepatitis C virus (HCV) type 1b. Journal of Medical Virology 74:1, 54-61
CrossRef202
GERRY C MACQUILLAN, XIANWA NIU, DAVID SPEERS, SUZANNE ENGLISH, GEORGE GARAS, GERRY B HARNETT, WILLIAM D REED, JANE E ALLAN, GARY P JEFFREY. (2004) Does sequencing the PKRBD of hepatitis C virus NS5A predict therapeutic response to combination therapy in an Australian population?. Journal of Gastroenterology and Hepatology 19:5, 551-557
CrossRef203
B. Mullan, P. Sheehy, F. Shanahan, L Fanning. (2004) Do Taq-generated RT-PCR products from RNA viruses accurately reflect viral genetic heterogeneity?. Journal of Viral Hepatitis 11:2, 108-114
CrossRef204
D. Fujiwara, K. Hino, Y. Yamaguchi, Y. Kubo, S. Yamashita, K. Uchida, T. Konishi, H. Nakamura, M. Korenaga, M. Okuda, K. Okita. (2004) Type I interferon receptor and response to interferon therapy in chronic hepatitis C patients: a prospective study. Journal of Viral Hepatitis 11:2, 136-140
CrossRef205
Jean-Michel Pawlotsky. (2004) Mechanisms of drug resistance to current and future antiviral therapies for hepatitis C virus infection. Current Hepatitis Reports 3:1, 38-43
CrossRef206
Ángel Luis Ballesteros, Sandra Franco, Daniel Fuster, Ramón Planas, Miguel Ángel Martínez, Lesly Acosta, Guillem Sirera, Anna Salas, Jordi Tor, Celestino Rey-Joly, Bonaventura Clotet, Cristina Tural. (2004) Early HCV dynamics on Peg-interferon and ribavirin in HIV/HCV co-infection. AIDS 18:1, 59-66
CrossRef207
Fran
ois Penin, Jean Dubuisson, Felix A. Rey, Darius Moradpour, Jean-Michel Pawlotsky. (2004) Structural biology of hepatitis C virus. Hepatology 39:1, 5-19
CrossRef208
Yasuji Arase, Kenji Ikeda, Akihito Tsubota, Fumitaka Suzuki, Yoshiyuki Suzuki, Satoshi Saitoh, Masahiro Kobayashi, Norio Akuta, Takashi Someya, Tetsuya Hosaka, Hitomi Sezaki, Mariko Kobayashi, Hiromitsu Kumada. (2004) Interferon Therapy for 2 Years or Longer Reduces the Incidence of Hepatocarcinogenesis in Patients with Chronic Hepatitis C Viral Infection. Intervirology 47:6, 355-361
CrossRef209
Jean-Michel Pawlotsky. (2003) The nature of interferon-?? resistance in hepatitis C virus infection. Current Opinion in Infectious Diseases 16:6, 587-592
CrossRef210
Sheng-Shun Yang, Ming-Yang Lai, Ding-Shinn Chen, Gran-Hum Chen, Jia-Horng Kao. (2003) Mutations in the NS5A and E2-PePHD regions of hepatitis C virus genotype 1b and response to combination therapy of interferon plus ribavirin. Liver International 23:6, 426-433
CrossRef211
Thomas H
CrossRef212
Adrish Sen, Robert Steele, Asish K. Ghosh, Arnab Basu, Ranjit Ray, Ratna B. Ray. (2003) Inhibition of hepatitis C virus protein expression by RNA interference. Virus Research 96:1-2, 27-35
CrossRef213
Sandra Franco, Mireia Gim
CrossRef214
Hisashi Moriguchi, Raymond T Chung, Ana Maria Contreras, Namiki Izumi, Takamoto Uemura, Makoto Kobayashi, Chifumi Sato. (2003) The interferon sensitivity determining region in the era of combination therapies and the rational use of such therapies for patients with HCV genotype 1b infection. Gastroenterology 125:4, 1284-1286
CrossRef215
P Ferenci. (2003) Weight-based dosing of pegylated interferon-alpha in chronic hepatitis C. Digestive and Liver Disease 35:9, 601-606
CrossRef216
Nobuyuki Kato, Kazuo Sugiyama, Katsuyuki Namba, Hiromichi Dansako, Takashi Nakamura, Marika Takami, Kazuhito Naka, Akito Nozaki, Kunitada Shimotohno. (2003) Establishment of a hepatitis C virus subgenomic replicon derived from human hepatocytes infected in vitro. Biochemical and Biophysical Research Communications 306:3, 756-766
CrossRef217
Jean-Michel Pawlotsky. (2003) Mechanisms of antiviral treatment efficacy and failure in chronic hepatitis C. Antiviral Research 59:1, 1-11
CrossRef218
Annalucia Serafino, Maria Beatrice Valli, Federica Andreola, Annalisa Crema, Giampietro Ravagnan, Luisa Bertolini, Guido Carloni. (2003) Suggested role of the Golgi apparatus and endoplasmic reticulum for crucial sites of hepatitis C virus replication in human lymphoblastoid cells infected in vitro. Journal of Medical Virology 70:1, 31-41
CrossRef219
Emanuele Durante Mangoni, Daniel M. Forton, Giuseppe Ruggiero, Peter Karayiannis. (2003) Hepatitis C virus E2 and NS5A region variability during sequential treatment with two interferon-? preparations. Journal of Medical Virology 70:1, 62-73
CrossRef220
Nicole Pavio, Michael M. C. Lai. (2003) The hepatitis C virus persistence: how to evade the immune system?. Journal of Biosciences 28:3, 287-304
CrossRef221
YOSHIYASU KARINO, JOUJI TOYOTA, MASAAKI SUGAWARA, KAYO MIYAZAKI, YASUAKI KUWATA, KATSU YAMAZAKI, TAKAHIRO SATO, TAKUMI OHMURA, TAKASHI MATSUSHIMA. (2003) Hepatitis C virus genotypes and hepatic fibrosis regulate 24-h decline of serum hepatitis C virus RNA during interferon therapy in patients with chronic hepatitis C. Journal of Gastroenterology and Hepatology 18:4, 404-410
CrossRef222
Norio Akuta, Fumitaka Suzuki, Akihito Tsubota, Yoshiyuki Suzuki, Tetsuya Hosaka, Takashi Someya, Masahiro Kobayashi, Satoshi Saitoh, Yasuji Arase, Kenji Ikeda, Hiromitsu Kumada. (2003) Association of amino acid substitution pattern in nonstructural protein 5A of hepatitis C virus genotype2a low viral load and response to interferon monotherapy. Journal of Medical Virology 69:3, 376-383
CrossRef223
S. S. Lee. (2003) Indicators and predictors of response to anti-viral therapy in chronic hepatitis C. Alimentary Pharmacology and Therapeutics 17:5, 611-621
CrossRef224
C.-H. Hung, C.-M. Lee, S.-N. Lu, J.-F. Lee, J.-H. Wang, H.-D. Tung, T.-M. Chen, T.-H. Hu, W.-J. Chen, C.-S. Changchien. (2003) Mutations in the NS5A and E2-PePHD region of hepatitis C virus type 1b and correlation with the response to combination therapy with interferon and ribavirin. Journal of Viral Hepatitis 10:2, 87-94
CrossRef225
Uichiro Fuchizaki, Shuichi Kaneko, Yasunari Nakamoto, Yoshihiro Sugiyama, Kenichi Imagawa, Mikio Kikuchi, Kenichi Kobayashi. (2003) Synergistic antiviral effect of a combination of mouse interferon-? and interferon-? on mouse hepatitis virus. Journal of Medical Virology 69:2, 188-194
CrossRef226
STEPHEN A LOCARNINI. (2002) Mechanisms of drug resistance and novel approaches to therapy for chronic hepatitis C. Journal of Gastroenterology and Hepatology 17:s3, S351-S359
CrossRef227
Darius Moradpour, Volker Brass, Rainer Gosert, Benno Wölk, Hubert E. Blum. (2002) Hepatitis C: molecular virology and antiviral targets. Trends in Molecular Medicine 8:10, 476-482
CrossRef228
Khalid S.A. Khabar, Stephen J. Polyak. (2002) Hepatitis C Virus-Host Interactions: The NS5A Protein and the Interferon/Chemokine Systems. Journal of Interferon & Cytokine Research 22:10, 1005-1012
CrossRef229
Bruce A. Luxon, Michael Grace, Diana Brassard, Ronald Bordens. (2002) Pegylated interferons for the treatment of chronic hepatitis C infection. Clinical Therapeutics 24:9, 1363-1383
CrossRef230
G. Squadrito, G. Raffa, T. Restuccia, T. Pollicino, S. Brancatelli, G. Raimondo. (2002) Is investigation of hepatitis C virus NS5A gene heterogeneity a tool for predicting long-lasting response to interferon therapy in patients with HCV-1b chronic hepatitis?. Journal of Viral Hepatitis 9:5, 360-369
CrossRef231
Timothy L Tellinghuisen, Charles M Rice. (2002) Interaction between hepatitis C virus proteins and host cell factors. Current Opinion in Microbiology 5:4, 419-427
CrossRef232
Chiu-Ching Huang. (2002) Hepatitis infection in haemodialysis patients. Nephrology 7:3, 101-109
CrossRef233
Gregory R. Reyes. (2002) The nonstructural NS5A protein of hepatitis C virus: An expanding, multifunctional role in enhancing hepatitis C virus pathogenesis. Journal of Biomedical Science 9:3, 187-197
CrossRef234
Hiroe Kishine, Kazuo Sugiyama, Makoto Hijikata, Nobuyuki Kato, Hitoshi Takahashi, Takeshi Noshi, Yasunori Nio, Masahiro Hosaka, Yusuke Miyanari, Kunitada Shimotohno. (2002) Subgenomic replicon derived from a cell line infected with the hepatitis C virus. Biochemical and Biophysical Research Communications 293:3, 993-999
CrossRef235
Yupeng He, Michael G. Katze. (2002) To Interfere and to Anti-interfere: The Interplay Between Hepatitis C Virus and Interferon. Viral Immunology 15:1, 95-119
CrossRef236
Masaru Enomoto, Shuhei Nishiguchi, Susumu Shiomi, Motoharu Tanaka, Tadashi Yokogawa, Katsuhiko Fukuda, Tadashi Ueda, Akihiro Tamori, Daiki Habu, Tadashi Takeda, Yoshihisa Yano, Shuzo Otani. (2002) Changes in serum levels of hepatitis C virus genotype 1b monitored by real-time quantitative polymerase chain reaction as a predictor of long term response to interferon-alpha treatment. The American Journal of Gastroenterology 97:2, 420-426
CrossRef237
Kazuaki Chayama. (2002) Management of chronic hepatitis C and prevention of hepatocellular carcinoma. Journal of Gastroenterology 37:S13, 69-73
CrossRef238
Lesley J. Scott, Caroline M. Perry. (2002) Interferon-??-2b Plus Ribavirin. Drugs 62:3, 507-556
CrossRef239
Stephanie T. Shi, Stephen J. Polyak, Hong Tu, Deborah R. Taylor, David R. Gretch, Michael M.C. Lai. (2002) Hepatitis C Virus NS5A Colocalizes with the Core Protein on Lipid Droplets and Interacts with Apolipoproteins. Virology 292:2, 198-210
CrossRef240
Fabien Zoulim. (2001) Quantification and genotyping in management of chronic hepatitis B and C. Virus Research 82:1-2, 45-52
CrossRef241
Thomas F. Smith. (2001) SUSCEPECPTIBILITY TESTING. Infectious Disease Clinics of North America 15:4, 1263-1294
CrossRef242
K. Yoshioka, M. Kobayashi, E. Orito, K. Watanabe, M. Yano, Y. Sameshima, A. Kusakabe, H. Hirofuji, A. Fuji, J. Kuriki, M. Arao, K. Murase, M. Mizokami, S. Kakumu, . (2001) Biochemical response to interferon therapy correlates with interferon sensitivity-determining region in hepatitis C virus genotype 1b infection. Journal of Viral Hepatitis 8:6, 421-429
CrossRef243
Francesc Puig-Basagoiti, Juan-Carlos S
CrossRef244
Masaru Enomoto, Shuhei Nishiguchi, Susumu Shiomi, Motoharu Tanaka, Katsuhiko Fukuda, Tadashi Ueda, Akihiro Tamori, Daiki Habu, Tadashi Takeda, Yoshihisa Yano, Shuzo Otani. (2001) Comparison of real-time quantitative polymerase chain reaction with three other assays for quantitation of hepatitis C virus. Journal of Gastroenterology and Hepatology 16:8, 904-909
CrossRef245
Chie Kurihara, Narihiro Ishiyama, Yasumasa Nishiyama, Shuetsu Fukushi, Tsutomu Kageyama, Kazuhiko Katayama, Soichiro Miura. (2001) Molecular characterization of hepatitis C virus genotype 2a from the entire sequences of four isolates. Journal of Medical Virology 64:4, 466-475
CrossRef246
Marie-Ange Thelu, Maryline Baud, Vincent Leroy, Jean-Marie Seigneurin, Jean-Pierre Zarski. (2001) Dynamics of viral quasispecies during interferon therapy in non responder chronic hepatitis C patients. Journal of Clinical Virology 22:1, 125-131
CrossRef247
Lauer, Georg M., Walker, Bruce D., . (2001) Hepatitis C Virus Infection. New England Journal of Medicine 345:1, 41-52
Full Text248
I. Stratidaki, E. Skoulika, D. Kelefiotis, E. Matrella, G. Alexandrakis, A. Economou, E. Kouroumalis. (2001) NS5A mutations predict biochemical but not virological response to interferon-alpha treatment of sporadic hepatitis C virus infection in European patients. Journal of Viral Hepatitis 8:4, 243-248
CrossRef249
Shih-Yen Lo, Hans Hsienhong Lin. (2001) Variations within hepatitis C virus E2 protein and response to interferon treatment. Virus Research 75:2, 107-112
CrossRef250
Brian W Dymock. (2001) Emerging therapies for hepatitis C virus infection. Expert Opinion on Emerging Drugs 6:1, 13-42
CrossRef251
Luca G. Guidotti, Francis V. Chisari. (2001) N
ONCYTOLYTIC CONTROL OF VIRAL INFECTIONS BY THE INNATE AND ADAPTIVE IMMUNE RESPONSE . Annual Review of Immunology 19:1, 65-91
CrossRef252
F. Querenghi, Qiang Yu, G. Billaud, G. Maertens, C. Trépo, F. Zoulim. (2001) Evolution of hepatitis C virus genome in chronically infected patients receiving ribavirin monotherapy. Journal of Viral Hepatitis 8:2, 120-131
CrossRef253
Gary W. Witherell, Philip Beineke. (2001) Statistical analysis of combined substitutions in nonstructural 5A region of hepatitis C virus and interferon response. Journal of Medical Virology 63:1, 8-16
CrossRef254
Ke-Qin Hu, John M. Vierling, Allan G. Redeker. (2001) Viral, host and interferon-related factors modulating the effect of interferon therapy for hepatitis C virus infection. Journal of Viral Hepatitis 8:1, 1-18
CrossRef255
G.W. McCaughan, A. Zekry. (2000) Effects of immunosuppression and organ transplantation on the natural history and immunopathogenesis of hepatitis C virus infection. Transplant Infectious Disease 2:4, 166-185
CrossRef256
Hideki Aizaki, Sakura Saito, Toshio Ogino, Naoko Miyajima, Takashi Harada, Yoshiharu Matsuura, Tatsuo Miyamura, Masayoshi Kohase. (2000) Suppression of Interferon-Induced Antiviral Activity in Cells Expressing Hepatitis C Virus Proteins. Journal of Interferon & Cytokine Research 20:12, 1111-1120
CrossRef257
Deborah R Taylor, Stephanie T Shi, Michael M.C Lai. (2000) Hepatitis C virus and interferon resistance. Microbes and Infection 2:14, 1743-1756
CrossRef258
V. Meier, S. Mihm, G. Ramadori. (2000) MxA gene expression in peripheral blood mononuclear cells from patients infected chronically with hepatitis C virus treated with interferon-?. Journal of Medical Virology 62:3, 318-326
CrossRef259
Shiro Murashima, Ryukichi Kumashiro, Tatsuya Ide, Ichiro Miyajima, Teruko Hino, Yuriko Koga, Kunihide Ishii, Takato Ueno, Shotaro Sakisaka, Michio Sata. (2000) Effect of interferon treatment on serum 2?,5?-oligoadenylate synthetase levels in hepatitis C-infected patients. Journal of Medical Virology 62:2, 185-190
CrossRef260
Jian Song, Motoko Nagano-Fujii, Fan Wang, Ruth Florese, Tsunenori Fujita, Satoshi Ishido, Hak Hotta. (2000) Nuclear localization and intramolecular cleavage of N-terminally deleted NS5A protein of hepatitis C virus. Virus Research 69:2, 109-117
CrossRef261
Hisayoshi Watanabe, Takafumi Saito, Osamu Kawamata, Li Shao, Masanori Aoki, Yuki Terui, Hideki Mitsuhashi, Taku Matsuo, Yoshio Takeda, Koji Saito, Hitoshi Togashi, Haruhide Shinzawa, Tsuneo Takahashi. (2000) Clinical implications of TT virus superinfection in patients with chronic hepatitis C. The American Journal of Gastroenterology 95:7, 1776-1780
CrossRef262
Yasuyuki Terazawa, Kentaro Yoshioka, Makoto Kobayashi, Kazumasa Watanabe, Masatoshi Ishigami, Motoyoshi Yano, Kenji Takagi, Shinichi Kakumu. (2000) Mutations in interferon sensitivity-determining region of hepatitis C virus: its relation to change in viral load. The American Journal of Gastroenterology 95:7, 1781-1787
CrossRef263
Shinya Maekawa, Nobuyuki Enomoto, Masayuki Kurosaki, Kazuyoshi Nagayama, Fumiaki Marumo, Chifumi Sato. (2000) Genetic changes in the interferon sensitivity determining region of hepatitis C virus during the natural course of chronic hepatitis C. Journal of Medical Virology 61:3, 303-310
CrossRef264
M. Wright, J. Main, H.C. Thomas. (2000) Drug-resistant Viral Hepatitis. Journal of Infection 41:1, 1-4
CrossRef265
Tomoki Fujisawa, Norio Horiike, Kojiro Michitaka, Morikazu Onji. (2000) Influence of RNA titre and amino acid changes in the NS5A region of GB virus C/hepatitis G virus on the effectiveness of interferon therapy. Journal of Gastroenterology and Hepatology 15:6, 632-639
CrossRef266
Sabine Mihm, Masyar Monazahian, Stefanie Grethe, Volker Meier, Reiner Thomssen, Giuliano Ramadori. (2000) Lack of clinical evidence for involvement of hepatitis C virus interferon-? sensitivity-determining region variability in RNA-dependent protein kinase-mediated cellular antiviral responses. Journal of Medical Virology 61:1, 29-36
CrossRef267
Kondili, Taliani, Tosti, De Bac, Pasquazzi, Mele. (2000) Methodological issues in papers on IFN therapy: time for reappraisal. Journal of Viral Hepatitis 7:3, 184-195
CrossRef268
Yasushi Shiratori, Masao Omata. (2000) Predictors of the efficacy of interferon therapy for patients with chronic hepatitis C before and during therapy: how does this modify the treatment course?. Journal of Gastroenterology and Hepatology 15:5 (Suppl.), E141-E151
CrossRef269
M.H. Heim. (2000) Intracellular signalling and antiviral effects of interferons. Digestive and Liver Disease 32:3, 257-263
CrossRef270
Mei-Hwei Chang. (2000) Treatment of chronic hepatitis C virus infection in children. Best Practice & Research Clinical Gastroenterology 14:2, 341-350
CrossRef271
Victoria M. McKechnie, Peter R. Mills, Elizabeth A.B McCruden. (2000) The NS5a gene of hepatitis C virus in patients treated with interferon-?. Journal of Medical Virology 60:4, 367-378
CrossRef272
P. Halfon, P. Cacoub. (2000) Quantification virale du virus de l'hépatite C : présent et avenir. La Revue de Médecine Interne 21:2, 174-181
CrossRef273
Maria Stella De Mitri, Loredana Mele, Giulia Morsica, Chiu Hua Chen, Giovanni Sitia, Annagiulia Gramenzi, Pietro Andreone, Alfredo Alberti, Mauro Bernardi, Emilio Pisi. (2000) Effect of increasing dose of interferon on the evolution of hepatitis C virus 1b quasispecies. Journal of Medical Virology 60:2, 133-138
CrossRef274
Saito, Ebinuma, Satoh, Miyaguchi, Tada, Iwabuchi, Kumagai, Tsuchimoto, Morizane, Ishii. (2000) Immunological and virological predictors of outcome during interferon-α therapy of chronic hepatitis C. Journal of Viral Hepatitis 7:1, 64-74
CrossRef275
NOBUYUKI KATO. (2000) Genome of Human Hepatitis C Virus (HCV): Gene Organization, Sequence Diversity, and Variation. Microbial & Comparative Genomics 5:3, 129-151
CrossRef276
Michael A. Walker. (1999) Hepatitis C virus: an overview of current approaches and progress. Drug Discovery Today 4:11, 518-529
CrossRef277
Eishiro Mizukoshi, Shuichi Kaneko, Kyosuke Kaji, Shuichi Terasaki, Eiki Matsushita, Masahiro Muraguchi, Yasukazu Ohmoto, Kenichi Kobayashi. (1999) Serum levels of soluble interferon alfa/beta receptor as an inhibitory factor of interferon in the patients with chronic hepatitis C. Hepatology 30:5, 1325-1331
CrossRef278
Morris Paterson, Carl D. Laxton, Howard C. Thomas, Andrew M. Ackrill, Graham R. Foster. (1999) Hepatitis C virus NS5A protein inhibits interferon antiviral activity, but the effects do not correlate with clinical response. Gastroenterology 117:5, 1187-1197
CrossRef279
Stephen J Polyak. (1999) Interfering with interferon. Trends in Microbiology 7:10, 401
CrossRef280
Takeshi Murakami, Nobuyuki Enomoto, Masayuki Kurosaki, Namiki Izumi, Fumiaki Marumo, Chifumi Sato. (1999) Mutations in nonstructural protein 5A gene and response to interferon in hepatitis C virus genotype 2 infection. Hepatology 30:4, 1045-1053
CrossRef281
Mengji Lu, Manfred Wiese, Michael Roggendorf. (1999) Selection of genetic variants of the 5? noncoding region of hepatitis C virus occurs only in patients responding to interferon ? therapy. Journal of Medical Virology 59:2, 146-153
CrossRef282
Nieves Ibarrola, José A. Moreno-Monteagudo, Margarita Sáiz, Carmelo García-Monzón, Francisco Sobrino, Luisa García-Buey, Oreste Lo Iacono, Ricardo Moreno-Otero, Encarnación Martínez-Salas. (1999) Response to retreatment with interferon-? plus ribavirin in chronic hepatitis C patients is independent of the NS5A gene nucleotide sequence. The American Journal of Gastroenterology 94:9, 2487-2495
CrossRef283
Hugo R Rosen, David R Gretch. (1999) Hepatitis C virus: current understanding and prospects for future therapies. Molecular Medicine Today 5:9, 393-399
CrossRef284
M. Gerotto, F. Dal Pero, D. G. Sullivan, L. Chemello, L. Cavalletto, S. J. Polyak, P. Pontisso, D. R. Gretch, A. Alberti. (1999) Evidence for sequence selection within the non-structural 5A gene of hepatitis C virus type 1b during unsuccessful treatment with interferon-α. Journal of Viral Hepatitis 6:5, 367-372
CrossRef285
K. Rajender Reddy, Jay H. Hoofnagle, Myron J. Tong, William M. Lee, Paul Pockros, E. Jenny Heathcote, Donald Albert, Tenshang Joh. (1999) Racial differences in responses to therapy with interferon in chronic hepatitis C. Hepatology 30:3, 787-793
CrossRef286
J. M. Pawlotsky, G. Germanidis. (1999) The non-structural 5A protein of hepatitis C virus. Journal of Viral Hepatitis 6:5, 343-356
CrossRef287
Katsumi Morita, Katsuaki Tanaka, Satoru Saito, Takehiko Kitamura, Takayoshi Kiba, Takando Fujii, Kazushi Numata, Hisahiko Sekihara. (1999) Expression of interferon receptor genes in the liver as a predictor of interferon response in patients with chronic hepatitis C. Journal of Medical Virology 58:4, 359-365
CrossRef288
Raymond T. Chung, Alexander Monto, Jules L. Dienstag, Lee M. Kaplan. (1999) Mutations in the NS5A region do not predict interferon-responsiveness in American patients infected with genotype 1b hepatitis C virus. Journal of Medical Virology 58:4, 353-358
CrossRef289
Sabine Mihm, Masyar Monazahian, Stefanie Grethe, Charlotte Fechner, Giuliano Ramadori, Reiner Thomssen. (1999) Ratio of serum ?-GT/ALT rather than ISDR variability is predictive for initial virological response to IFN-? in chronic HCV infection. Journal of Medical Virology 58:3, 227-234
CrossRef290
Michie Hashimoto, Kazuaki Chayama, Masahiro Kobayashi, Akihito Tsubota, Yasuji Arase, Satoshi Saitoh, Yoshiyuki Suzuki, Kenji Ikeda, Marie Matsuda, Hiromi Koike, Mariko Kobayashi, Hiroshi Handa, Hiromitsu Kumada. (1999) Fluctuations of hepatitis C virus load are not related to amino acid substitutions in hypervariable region 1 and interferon sensitivity determining region. Journal of Medical Virology 58:3, 247-255
CrossRef291
S. Sherlock. (1999) The hepatic flaviviridae: summary. Journal of Viral Hepatitis 6:s1, 1-5
CrossRef292
J.-M. Pawlotsky. (1999) Hepatitis C virus (HCV) NS5A protein: role in HCV replication and resistance to interferon-alpha. Journal of Viral Hepatitis 6:s1, 47-48
CrossRef293
Michael R. Beard, Geoffrey Abell, Masao Honda, Anthony Carroll, Margaret Gartland, Berwyn Clarke, Koyu Suzuki, Robert Lanford, David V. Sangar, Stanley M. Lemon. (1999) An infectious molecular clone of a Japanese genotype 1b hepatitis C virus. Hepatology 30:1, 316-324
CrossRef294
Tang Zhenya, Josef Köck, Darius Moradpour, Yang Dongliang, Hao Lianjie, Hubert E. Blum. (1999) Pilotstudie zur Bedeutung von Mutationen der Hepatitis C Virus 1b “Interferon Sensitivity Determining Region” (NS5A aa 2209–2248) für das Ansprechen auf Interferon-α bei Patienten mit chronischer Hepatitis. Journal of Tongji Medical University 19:2, 115-119
CrossRef295
Laurent Alric, Jacques Izopet, Marylise Fort, Jean-Pierre Vinel, Patrick Fontenelle, Claudine Orfila, Jean-Louis Payen, K Sandres, Herve Desmorat, Jean-Paul Charlet, Michel Duffaut, Michel Abbal. (1999) Study of the association between major histocompatibility complex class II genes and the response to interferon alpha in patients with chronic hepatitis C infection. Human Immunology 60:6, 516-523
CrossRef296
R. Bartenschlager. (1999) The NS3/4A proteinase of the hepatitis C virus: unravelling structure and function of an unusual enzyme and a prime target for antiviral therapy. Journal of Viral Hepatitis 6:3, 165-181
CrossRef297
Michiko Shindo, Arai Ken, Tadao Okuno. (1999) Varying incidence of cirrhosis and hepatocellular carcinoma in patients with chronic hepatitis C responding differently to interferon therapy. Cancer 85:9, 1943-1950
CrossRef298
Vincent Soriano, Rafael Rodríguez-Rosado, Javier García-Samaniego. (1999) Management of chronic hepatitis C in HIV-infected patients. AIDS 13:5, 539-546
CrossRef299
Stephen J. Polyak, Denise M. Paschal, Susan McArdle, Michael J. Jr., Darius Moradpour, David R. Gretch. (1999) Characterization of the effects of hepatitis C virus nonstructural 5A protein expression in human cell lines and on interferon-sensitive virus replication. Hepatology 29:4, 1262-1271
CrossRef300
Takanobu Kato, Masashi Mizokami, Etsuro Orito, Ken-ichi Ohba, Tatsunori Nakano, Yutaka Kondo, Yasuhito Tanaka, Ryuzo Ueda, Motokazu Mukaide, Kiyomi Yasuda, Shiro Iino. (1999) Amino acid substitutions in NS5A region of GB virus C and response to interferon therapy. Journal of Medical Virology 57:4, 376-382
CrossRef301
Norio Horiike, Kojiro Michitaka, Toshikazu Masumoto, Izumi Okura, Sm Akbar, Morikazu Onji. (1999) Relationship between the effect of interferon therapy and the change of hepatitis C virus non-structural 5B gene. Journal of Gastroenterology and Hepatology 14:4, 345-351
CrossRef302
Lionel Frangeul, Pascale Cresta, Michele Perrin, Fran
CrossRef303
Eishiro Mizukoshi, Shuichi Kaneko, Masayuki Yanagi, Hideki Ohno, Kyosuke Kaji, Shuichi Terasaki, Atsushi Shimoda, Eiki Matsushita, Kenichi Kobayashi. (1998) Expression of interferon alpha/beta receptor in the liver of chronic hepatitis C patients. Journal of Medical Virology 56:3, 217-223
CrossRef304
Iacono, Garcia-Monzon, Almasio, Garcia-Buey, Craxi, Moreno-Otero. (1998) Soluble adhesion molecules correlate with liver inflammation and fibrosis in chronic hepatitis C treated with interferon-alpha. Alimentary Pharmacology and Therapeutics 12:11, 1091-1099
CrossRef305
Katsunori Suzuki, Haruhide Shinzawa, Makoto Kuboki, Masamichi Ishibashi, Eiichi Yoshii, Takafumi Saito, Tsuneo Takahashi. (1998) Secondary structure of the hepatitis C virus 5‘ untranslated region and efficacy of interferon therapy for chronic hepatitis C. Liver 18:5, 331-336
CrossRef306
Toshiko Fukuma, Nobuyuki Enomoto, Fumiaki Marumo, Chifumi Sato. (1998) Mutations in the interferon-sensitivity determining region of hepatitis C virus and transcriptional activity of the nonstructural region 5A protein. Hepatology 28:4, 1147-1153
CrossRef307
Kyong–Mi Chang. (1998) The mechanisms of chronicity in hepatitis C virus infection. Gastroenterology 115:4, 1015-1018
CrossRef308
Yoichi Kimura, Kazuhiro Hayashida, Hiromi Ishibashi, Yoshiyuki Niho, Kouhei Akazawa, Yusuke Yanagi. (1998) Attachment of hepatitis C virus to cultured cells: A novel predictive factor for successful interferon therapy. Journal of Medical Virology 56:1, 25-32
CrossRef309
Jacob Odeberg, Zhibing Yun, Anders Sönnerborg, Ola Weiland, Joakim Lundeberg. (1998) Variation in the hepatitis C virus NS5a region in relation to hypervariable region 1 heterogeneity during interferon treatment. Journal of Medical Virology 56:1, 33-38
CrossRef310
Chifumi Sato, Nobuyuki Enomoto. (1998) Mutations in the NS5A region of HCV and interferon efficacy. Gastroenterology 115:3, 796
CrossRef311
A. Doglio, C. Laffont, S. Thyss, J.-C. Lefebvre. (1998) Rapid genotyping of hepatitis C virus by direct cycle sequencing of PCR-amplified cDNAs and capillary electrophoresis analysis. Research in Virology 149:4, 219-227
CrossRef312
Silvio Magrin, Carmelo Fabiano, Fabrizio Gianguzza, Massimo Cutrera, Giuseppe Alaimo, Luigi Pagliaro. (1998) HCV NS5A mutations in europeans infected by genotype 1b. Gastroenterology 115:1, 244-245
CrossRef313
H. Sim, J. Wojcik, M. Margulies, J. A. Wade, J. Heathcote. (1998) Response to interferon therapy: influence of human leucocyte antigen alleles in patients with chronic hepatitis C. Journal of Viral Hepatitis 5:4, 249-253
CrossRef314
Fujito Kageyama, Yoshimasa Kobayashi, Gou Murohisa, Erina Shimizu, Fumitaka Suzuki, Masataka Kikuyama, Kenichi Souda, Tsunehisa Kawasaki, Hirotoshi Nakamura. (1998) Failure to respond to interferon-α 2a therapy is associated with increased hepatic iron levels in patients with chronic hepatitis C. Biological Trace Element Research 64:1-3, 185-196
CrossRef315
Mabee, Crippin, Lee. (1998) Review article: interferon and hepatitis C-factors predicting therapeutic outcome. Alimentary Pharmacology and Therapeutics 12:6, 509-518
CrossRef316
L. Origgi, M. Vanoli, A. Carbone, M. Grasso, G. Lunghi, R. Scorza. (1998) Hepatitis C virus genotypes and clinical features in hepatitis C virus-related mixed cryoglobulinemia. International Journal of Clinical & Laboratory Research 28:2, 96-99
CrossRef317
Takanobu Kato, Masashi Mizokami, Tatsunori Nakano, Etsuro Orito, Ken-ichi Ohba, Yutaka Kondo, Yasuhito Tanaka, Ryuzo Ueda, Motokazu Mukaide, Kaoru Fujita, Kiyomi Yasuda, Shiro Iino. (1998) Heterogeneity in E2 region of GBV-C/hepatitis G virus and hepatitis C virus. Journal of Medical Virology 55:2, 109-117
CrossRef318
Stefan Zeuzem, Jung-Hun Lee, Alexa Franke, Brigitte R
CrossRef319
MIZUHO FUKUDA, KAZUAKI CHAYAMA, AKIHITO TSUBOTA, MASAHIRO KOBAYASHI, MICHIE HASHIMOTO, YUKIKO MIYANO, HIROMI KOIKE, MARIKO KOBAYASHI, ISAO KOIDA, YASUJI ARASE, SATOSHI SAITOH, NAOYA MURASHIMA, KENJI IKEDA, HIROMITSU KUMADA. (1998) Predictive factors in eradicating hepatitis C virus using a relatively small dose of interferon. Journal of Gastroenterology and Hepatology 13:4, 412-418
CrossRef320
Michael Gale, Michael G Katze. (1998) Molecular Mechanisms of Interferon Resistance Mediated by Viral-Directed Inhibition of PKR, the Interferon-Induced Protein Kinase. Pharmacology & Therapeutics 78:1, 29-46
CrossRef321
Howe Sim, Colina Yim, Mel Krajden, Jenny Heathcote. (1998) Durability of Serological Remission in Chronic Hepatitis C Treated With Interferon-Alpha-2B. The American Journal of Gastroenterology 93:1, 39-43
CrossRef322
H. E. Blum. (1997) Hepatitis viruses: genetic variants and clinical significance. International Journal of Clinical & Laboratory Research 27:2-4, 213-224
CrossRef323
Haruki Komatsu, Tomoo Fujisawa, Ayano Inui, Yoshihiro Miyagawa, Masahiro Onoue. (1997) Mutations in the nonstructural protein 5A gene and response to interferon therapy in young patients with chronic hepatitis C virus 1b infection. Journal of Medical Virology 53:4, 361-365
CrossRef324
Yoshihiro Ide, Akihide Tanimoto, Yasuyuki Sasaguri, R. Padmanabhan. (1997) Hepatitis C virus NS5A protein is phosphorylated in vitro by a stably bound protein kinase from HeLa cells and by cAMP-dependent protein kinase A-α catalytic subunit. Gene 201:1-2, 151-158
CrossRef325
Wolfgang T. Hofgärtner, Stephen J. Polyak, Daniel G. Sullivan, Robert L. Carithers, David R. Gretch. (1997) Mutations in the NS5A gene of hepatitis C virus in North American patients infected with HCV genotype 1a or 1b. Journal of Medical Virology 53:2, 118-126
CrossRef326
Junji Kato, Masafumi Komatsu, Tsuyoshi Ono, Tohru Ishii, Takao Hoshino, Itaru Toyoshima, Mitsuro Chiba, Osamu Masamune. (1997) Utility of Hepatitis C Virus RNA Levels for Predicting the Therapeutic Efficacy of Interferon. Journal of Clinical Gastroenterology 25:3, 525-528
CrossRef327
G. Antonelli, E. Simeoni, M. Currenti, F. Pisa, V. Colizzi, M. Pistello, F. Dianzani. (1997) Interferon antibodies in patients with infectious diseases. Biotherapy 10:1, 7-14
CrossRef328
Berwyn E Clarke, Martin J Slater. (1997) Developments in hepatitis C during 1996 - 1997. Expert Opinion on Therapeutic Patents 7:9, 979-987
CrossRef329
Akihide Tanimoto, Yoshihiro Ide, Nobuyuki Arima, Yasuyuki Sasaguri, R. Padmanabhan. (1997) The Amino Terminal Deletion Mutants of Hepatitis C Virus Nonstructural Protein NS5A Function as Transcriptional Activators in Yeast. Biochemical and Biophysical Research Communications 236:2, 360-364
CrossRef330
R.W. Chamberlain, N.J. Adams, L.A. Taylor, P. Simmonds, R.M. Elliott. (1997) The Complete Coding Sequence of Hepatitis C Virus Genotype 5a, the Predominant Genotype in South Africa. Biochemical and Biophysical Research Communications 236:1, 44-49
CrossRef331
Stephen D.H.P. Malnick, Hemda Schmilovitz-Weiss. (1997) Editorial: Interferon Therapy for Chronic HCV Hepatitis: Trick or Treat?. Journal of Clinical Gastroenterology 25:1, 310-313
CrossRef332
MIKIO NISHIOKA, SYED AHMED MORSHED. (1997) Viral hepatitis in Japan: Update. Journal of Gastroenterology and Hepatology 12:6, S36-S44
CrossRef333
Dominik M. Alscher, J. Christian Bode. (1997) Therapie der Hepatitis C. Medizinische Klinik 92:3, 147-161
CrossRef334
Giovanni Stellato, Jorma Paavonen, Pekka Nieminen, Merilyn Hibma, Pekka Vilja, Matti Lehtinen. (1997) Diagnostic phase antibody response to the human papillomavirus type 16 E2 protein is associated with succesful treatment of genital HPV lesions with systemic interferon α-2b. Clinical and Diagnostic Virology 7:3, 167-172
CrossRef335
Patrizia Farci, Jens Bukh, Robert H. Purcell. (1997) The quasispecies of hepatitis C virus and the host immune response. Springer Seminars in Immunopathology 19:1, 5-26
CrossRef336
(1997) Review. Biological Chemistry 378:6, 445-476
CrossRef337
Frederick S. Nolte. (1997) Laboratory Diagnosis of Hepatitis C. Immunological Investigations 26:1-2, 199-207
CrossRef338
Kyong-Mi Chang, Barbara Rehermann, Francis V. Chisari. (1997) Immunopathology of hepatitis C. Springer Seminars in Immunopathology 19:1, 57-68
CrossRef339
R. I. Baker, J. Smith, J. Eikelboom, B. Leahy, I. Kay, N. Lavis, S. Palladino, W. Cheng, J. Price, C. Mews. (1996) Hepatitis C genotypes in Australian haemophilia patients. Australian and New Zealand Journal of Medicine 26:6, 789-792
CrossRef340
Norah A. Terrault. (1996) Treatment of Chronic Hepatitis B and Chronic Hepatitis C. Reviews in Medical Virology 6:4, 215-228
CrossRef341
Ryo Fukuda, Norihisa Ishimura, Shunji Ishihara, Alejandro Tokuda, Shuichi Satoh, Shino Sakai, Shuji Akagi, Makoto Watanabe, Shiro Fukumoto. (1996) Expression of interferon-alpha receptor mRNA in the liver in chronic liver diseases associated with hepatitis C virus: Relation to effectiveness of interferon therapy. Journal of Gastroenterology 31:6, 806-811
CrossRef342
Rajen Koshy, Geneviève Inchauspé. (1996) Evaluation of hepatitis C virus protein epitopes for vaccine development. Trends in Biotechnology 14:10, 364-369
CrossRef343
I. Sakuma, N. Enomoto, M. Kurosaki, F. Marumo, C. Sato. (1996) Selection of hepatitis C virus quasispecies during interferon treatment. Archives of Virology 141:10, 1921-1932
CrossRef344
Jay A. Fishman, Robert H. Rubin, Margaret J. Koziel, Brian J. G. Periera. (1996) HEPATITIS C VIRUS AND ORGAN TRANSPLANTATION. Transplantation 62:2, 147-154
CrossRef
