Original Article
The Genetic Basis of the Reduced Expression of Bilirubin UDP-Glucuronosyltransferase 1 in Gilbert's Syndrome
N Engl J Med 1995; 333:1171-1175November 2, 1995
- Abstract
Background
People with Gilbert's syndrome have mild, chronic unconjugated hyperbilirubinemia in the absence of liver disease or overt hemolysis. Hepatic glucuronidating activity, essential for efficient biliary excretion of bilirubin, is reduced to about 30 percent of normal.
Methods
We sequenced the coding and promoter regions of the gene for bilirubin UDP-glucuronosyltransferase 1 (bilirubin/uridine diphosphoglucuronate-glucuronosyltransferase 1) — the only enzyme that contributes substantially to bilirubin glucuronidation — in 10 unrelated patients with Gilbert's syndrome, 16 members of a kindred with a history of Crigler–Najjar syndrome type II, and 55 normal subjects.
Results
The coding region of the gene for the enzyme was normal in the 10 patients with Gilbert's syndrome. These patients were homozygous for two extra bases (TA) in the TATAA element of the 5' promoter region of the gene (A(TA)7TAA rather than the normal A(TA)6TAA). The presence of the longer TATAA element resulted in the reduced expression of a reporter gene, encoding firefly luciferase, in a human hepatoma cell line. The frequency of the abnormal allele was 40 percent among the normal subjects. The 3 men in the control group who were homozygous for the longer TATAA element had significantly higher serum bilirubin levels than the other 52 normal subjects (P = 0.009). Among the kindred with a history of Crigler–Najjar syndrome type II, only the six heterozygous carriers who had a longer TATAA element on the structurally normal allele had mild hyperbilirubinemia, characteristic of Gilbert's syndrome.
Conclusions
Reduced expression of bilirubin UDP-glucuronosyltransferase 1 due to an abnormality in the promoter region of the gene for this enzyme appears to be necessary for Gilbert's syndrome but not sufficient for the complete manifestation of the syndrome.
Media in This Article
Figure 3
Correlation between Serum Bilirubin Levels and the Length of the TATAA Element in the Promoter Region of the Gene for Bilirubin UDP-Glucuronosyltransferase 1 in 55 Normal Subjects.Figure 1
Length of the TATAA Element in the Promoter Region of the Gene for Bilirubin UDP-Glucuronosyltransferase 1.Article Activity
- Article
People with Gilbert's syndrome have mild, chronic unconjugated hyperbilirubinemia in the absence of liver disease or overt hemolysis.1,2 Although the syndrome is inherited, many people do not have a clear family history.3 An autosomal mode of inheritance has been proposed,4 and more recently, a recessive pattern of inheritance has been suggested.5 On the basis of serum bilirubin levels, 3 to 10 percent of the general population are estimated to have Gilbert's syndrome.6-8 Serum bilirubin levels fluctuate in people with Gilbert's syndrome and often fall within accepted normal limits, making it unclear whether these people constitute a distinct subpopulation6 or whether their bilirubin values represent the upper end of the normal distribution curve.7,8 Gilbert's syndrome is considered harmless in adults, although an incidental finding of hyperbilirubinemia may raise the possibility of liver disease and sometimes trigger unnecessary investigations. It is not known whether the syndrome has a role in exaggerated neonatal jaundice.
Hepatic glucuronidating activity, which is essential for efficient biliary excretion of bilirubin, is approximately 30 percent of normal in patients with Gilbert's syndrome.9,10 The reduced glucuronidation results in an increased proportion of bilirubin monoglucuronide in bile.11 In human liver, bilirubin glucuronidation is mediated by one specific isoform of microsomal bilirubin, UDP-glucuronosyltransferase (bilirubin/uridine diphosphoglucuronate-glucuronosyltransferase). Of the two isoforms reported,12,13 only bilirubin UDP-glucuronosyltransferase 1 contributes substantially to bilirubin glucuronidation.14
Genetic lesions causing an absence of enzymatic bilirubin glucuronidation result in Crigler–Najjar syndrome type I,2,15-21 whereas mutations causing severe deficiency of the enzyme result in Crigler–Najjar syndrome type II.22-24 Because mild hyperbilirubinemia is often found among relatives of patients with Crigler–Najjar syndrome, some have postulated that Gilbert's syndrome represents a heterozygous form of Crigler–Najjar syndrome.25,26 However, many carriers of Crigler–Najjar syndrome do not have hyperbilirubinemia,22 and the incidence of Gilbert's syndrome is much higher than that expected on the basis of the number of heterozygous carriers of Crigler–Najjar syndrome, which is 1 per 1 million births.
We studied the genetic basis of reduced hepatic bilirubin glucuronidation in people with Gilbert's syndrome and found that a variant TATAA element (which contains two extra nucleotides, TA) in the upstream promoter region of the gene for bilirubin UDP-glucuronosyltransferase 1 is associated with the syndrome. The TATAA element is the binding site for transcription factor IID, which is important in the initiation of transcription.27-31 The presence of this longer TATAA element in the promoter region of the gene for bilirubin UDP-glucuronosyltransferase 1 resulted in reduced expression of a reporter gene, encoding firefly luciferase, in a human hepatoma cell line. The presence of the longer TATAA element correlated with higher mean serum bilirubin levels in normal, healthy subjects and in compound heterozygous carriers of Crigler–Najjar syndrome type II.
Methods
Patients with Gilbert's Syndrome
We studied 10 patients with Gilbert's syndrome, ranging from 15 to 54 years of age. Blood was collected from all 10 after they provided informed consent. Criteria for the diagnosis of Gilbert's syndrome included a consistent mild elevation of serum bilirubin (level, 1.2 to 5.3 mg per deciliter [20 to 90 μmol per liter]). The bilirubin was at least 90 percent unconjugated according to van den Bergh's test and 99 percent unconjugated on the basis of high-performance liquid chromatography. Serum alanine aminotransferase and aspartate aminotransferase values were normal. Hemolysis was excluded on the basis of normal hemoglobin and haptoglobin values and reticulocyte counts. Three patients were given a 400-kcal diet for 24 hours, which doubled their serum bilirubin levels. Two patients underwent duodenal aspiration for bile-pigment analysis by high-performance liquid chromatography32; in both, monoglucuronide made up 30 percent of bilirubin conjugates.33
Subjects from a Kindred with Crigler–Najjar Syndrome Type II
We examined 2 patients with Crigler–Najjar syndrome type II, 10 heterozygous carriers, and 4 family members who were not carriers from a kindred with a history of the syndrome. Both patients were homozygous for a structural mutation that markedly reduced the catalytic activity of bilirubin UDP-glucuronosyltransferase.22,24 Four of the 10 heterozygous carriers had mild hyperbilirubinemia. All provided informed consent.
Control Subjects
We examined 55 normal subjects (28 women and 27 men; age, 21 to 55 years) with no known history of jaundice. All provided informed consent. Serum bilirubin was measured in samples collected on two different days.34 In our laboratory the upper limit of normal for serum bilirubin is 1.0 mg per deciliter (17.1 μmol per liter). For samples with a serum bilirubin level of 0.9 mg per deciliter (15.4 μmol per liter), less than 5 percent variation is found between samples collected on two different days.
Nucleotide Sequencing of Coding and Upstream Regions of the Gene for Bilirubin UDP-Glucuronosyltransferase 1
Genomic DNA was isolated from lymphocytes and the five exons constituting the coding region of the gene for bilirubin UDP-glucuronosyltransferase 1, and their flanking intron–exon junctions were amplified by the polymerase chain reaction (PCR) and sequenced as described.15 The segment of DNA 5' to the coding region (from nucleotide -227 to nucleotide 132) was amplified with a sense primer, 5'GAGGTTCTGGAAGTACTTTGC3', and an antisense primer, 5'CCAAGCATGCTCAGCCAG3'. PCR was performed for 30 cycles consisting of denaturation at 95°C for 30 seconds, annealing at 56°C for 30 seconds, and extension at 72°C for 30 seconds, with 1.5 mmol of magnesium chloride per liter used as a buffer. Both strands of the amplified segment were sequenced with two internal primers.
Functional Evaluation of the Variant Tataa Element
A fragment of the upstream region (from nucleotide -546 to nucleotide -4) of the bilirubin UDP-glucuronosyltransferase 1 gene was amplified by PCR with genomic DNA from a subject homozygous for the long TATAA element, A(TA)7TAA, and from a subject homozygous for the normal TATAA element, A(TA)6TAA. Amplimers were designed to introduce a XhoI and a HindIII site at the 5' and 3' ends of the amplicon (amplified product), respectively. The two amplicons were cloned in appropriate orientation in the XhoI and HindIII sites 5' to the entire coding region of firefly luciferase gene of the plasmid pXP1, which lacks a promoter region. The nucleotide sequences of both constructs were identical except for the addition of two bases in the longer TATAA box. A plasmid, pSV-lacZ (Promega, Madison, Wis.), containing the structural region of bacterial β-galactosidase driven by the promoter of the large transforming antigen of simian virus 40, was used to determine the efficiency of transfection. Cells from a well-differentiated human hepatoma cell line (HuH7) were grown to 40 percent confluence in RPMI medium containing 4 percent fetal-calf serum. The cells were cotransfected with 1.5 μg each of the test luciferase construct and pSV-lacZ with Lipofectin (GIBCO-BRL, Gaithersburg, Md.). After the cells were harvested, luciferase activity was determined with a Promega luciferase assay system. Protein content35 and o-aminophenol-β-galactosidase activity36 were determined as described previously.
Statistical Analysis
Mean serum bilirubin values were compared by analysis of variance or a two-tailed nonparametric Wilcoxon test.37 Statistical analyses were performed with Sigma Stat for Windows.
Results
Patients with Gilbert's Syndrome
In four unrelated patients with Gilbert's syndrome, the nucleotide sequences of all five exons encoding the gene for bilirubin UDP-glucuronosyltransferase 1 and all intron–exon junctions were normal, indicating that the syndrome in these patients was not caused by structural mutations. To investigate whether an abnormality of the promoter region caused reduced expression of the normal enzyme, we determined the sequence of a 247-nucleotide region immediately upstream of the translation-initiation codon. Normally, an A(TA)6TAA element is present between nucleotides -23 and -38.13 All four of the patients were homozygous for an additional TA in this element, resulting in the sequence A(TA)7TAA (Figure 1Figure 1
Length of the TATAA Element in the Promoter Region of the Gene for Bilirubin UDP-Glucuronosyltransferase 1.). Subsequently, we sequenced this region in six additional unrelated patients with Gilbert's syndrome, all of whom were found to be homozygous for the additional TA.Effect of the Longer TATAA Element on Gene Expression
To determine the effect of the longer TATAA element on gene expression, a 542-base-pair (bp) region upstream of the gene, which contained A(TA)6TAA, and a 544-bp region containing A(TA)7TAA were each linked upstream to a firefly luciferase gene, and the construct was transfected into a human hepatoma cell line (HuH7). To assess the efficiency of transfection, a β-galactosidase expression vector, driven by a viral promoter, was cotransfected. The expression of both reporter genes was assessed in four experiments; the mean results of the four experiments are shown in Figure 2Figure 2
Functional efficiency of Bilirubin UDP-Glucuronosyltransferase 1, According to Whether the Promoter Region of the Gene Contained the Normal or the Variant TATAAElement.. The expression of luciferase in the presence of the longer TATAA element was only 18 to 33 percent of that recorded in the presence of the normal TATAA element. There was no significant difference in the level of expression of the cotransfected o-aminophenol-β-galactosidase.Normal Subjects
The frequency of the two TATAA elements was determined in 55 normal subjects. Eight were homozygous for A(TA)7TAA, 19 were homozygous for A(TA)6TAA, and 28 were heterozygous. The calculated allele frequency for the longer TATAA element was 40 percent. The mean serum bilirubin levels (mean of values in blood samples obtained on two different days) were 0.5 mg per deciliter (8.3 μmol per liter) in the subjects who were homozygous for A(TA)6TAA, 0.6 mg per deciliter (10.4 μmol per liter) in the heterozygotes, and 0.8 mg per deciliter (12.8 μmol per liter) in the subjects who were homozygous for A(TA)7TAA (Figure 3Figure 3
Correlation between Serum Bilirubin Levels and the Length of the TATAA Element in the Promoter Region of the Gene for Bilirubin UDP-Glucuronosyltransferase 1 in 55 Normal Subjects.). The mean serum bilirubin levels were significantly higher (P = 0.009) in the 3 men who were homozygous for A(TA)7TAA than in the other normal subjects (1.0 mg per deciliter [17.1 μmol per liter] vs. 0.6 mg per deciliter in the other 52 subjects and 0.7 mg per deciliter [11.2 μmol per liter] in the other 24 normal men), whereas the mean values in the 5 women who were homozygous for A(TA)7TAA did not differ significantly from those in the subjects who were homozygous for A(TA)6TAA (0.6 mg per deciliter vs. 0.5 mg per deciliter [8.3 μmol per liter]).Kindred with Crigler–Najjar Syndrome Type II
In a large kindred with a history of Crigler–Najjar syndrome type II,22 2 family members with the syndrome who were homozygous for a structural mutation that reduces the catalytic activity of bilirubin UDP-glucuronosyltransferase to 4 percent of normal24 were studied, as were 10 family members who were heterozygous for this mutation (carriers) and 4 family members who were not carriers (Table 1Table 1
Association of the Length of the TATAA Element Present in the Alleles for Bilirubin UDP-Glucuronosyltransferase 1 with Serum Bilirubin Levels in a Kindred with a History of Crigler–Najjar Syndrome Type II.). The coding region of the second allele for the bilirubin UDP-glucuronosyltransferase 1 gene was normal in the heterozygotes. Determination of the sequence analyzed in the upstream region revealed that both patients with Crigler–Najjar syndrome type II were homozygous for A(TA)6TAA, indicating that the structurally mutated allele contains a normal promoter. In six of the heterozygous carriers, the structurally normal allele contained the long TATAA element, A(TA)7TAA, whereas in four the short element was present. The six heterozygotes with the promoter abnormality had significantly higher serum bilirubin values than the four with the normal TATAA element (1.6 mg per deciliter [27.4 μmol per liter] vs. 0.6 mg per deciliter, P = 0.01).Discussion
We investigated the genetic mechanism of reduced bilirubin UDP-glucuronosyltransferase 1 activity in Gilbert's syndrome. The absence of any mutation in the coding region of the gene in four consecutive unrelated patients indicates that the decreased bilirubin glucuronidation is not due to a structural alteration of the enzyme. The presence of a long TATAA element, containing an extra TA, in both alleles in these four patients and in six additional patients with Gilbert's syndrome suggested the involvement of this variant promoter in the reduced expression of the enzyme. As the binding site for transcription factor IID, the TATAA element has an important role in the initiation of transcription,27-31 and its mutation can result in reduced frequency and accuracy of transcription initiation.30,31 Our functional studies showed that the presence of the longer TATAA element in the upstream regulatory region of the gene reduces the expression of a reporter gene in a human hepatoma cell line. Together, these results suggest that the decreased bilirubin glucuronidating activity in Gilbert's syndrome results from reduced expression of the bilirubin glucuronidating enzyme.
All 10 patients with Gilbert's syndrome were homozygous for the longer TATAA element, suggesting that reduced expression of bilirubin UDP-glucuronosyltransferase 1 is essential for the syndrome. However, a mild reduction in the enzyme is not always sufficient for the full manifestation of the phenotype. Our results indicate that as much as 16 percent of the population should be homozygous for the long TATAA element, whereas only 3 to 10 percent of the general population have clinically diagnosed Gilbert's syndrome.6-8 Among the normal subjects, only men who were homozygous for the longer TATAA element had significant elevations in serum bilirubin levels, reflecting a greater bilirubin load in men per kilogram of body weight or the inhibition of enzymatic glucuronidation by androgenic steroids (or both).38 This finding is consistent with the high male-to-female ratio among patients with diagnosed Gilbert's syndrome.4,8 The presence of other inherited or acquired factors affecting bilirubin metabolism, in addition to reduced glucuronidation, may result in the full manifestation of the syndrome. In some patients, impaired hepatic uptake of bilirubin has been found.33,39,40 Although hemolysis is not part of the syndrome, many patients who consult physicians may have a high bilirubin load because of a slightly reduced erythrocyte life span.41 Fasting may also increase the bilirubin load,42,43 and the resulting hyperbilirubinemia may be exaggerated in patients with Gilbert's syndrome44 because of the reduced expression of the glucuronidating enzyme.
Gilbert's syndrome runs in families,3 although only one family member may have jaundice.2 Both autosomal dominant3 and autosomal recessive5 modes of inheritance have been proposed. Because homozygosity for A(TA)7TAA appears to be a requirement for the syndrome, our findings suggest an autosomal recessive mode of inheritance, whereas the high frequency of the structurally mutated allele may explain the appearance of a pseudodominant pattern of inheritance in some instances.
Our results also help to explain the high incidence of mild hyperbilirubinemia in relatives of patients with Crigler–Najjar syndrome. Heterozygous carriers of Crigler–Najjar syndrome have one structurally normal allele and would be expected to have bilirubin glucuronidating activity that is at least 50 percent of normal, so that normal serum bilirubin levels would be maintained. However, when this structurally normal allele contains the longer TATAA element, the decreased expression of bilirubin UDP-glucuronosyltransferase 1 results in hyperbilirubinemia.
In summary, reduced expression of bilirubin UDP-glucuronosyltransferase 1 due to an abnormality in the promoter region of the gene appears to be necessary for Gilbert's syndrome but is not sufficient for the complete manifestation of the condition.
Supported in part by grants from the National Institutes of Health (RO1-DK39137 to Dr. N. Chowdhury, RO1-DK46057 to Dr. J. Chowdhury, and P30-DK41296).
We are indebted to B. Goldhoorn and T. Out for technical assistance in DNA purification and sequence determination.
Source Information
From the Department of Gastroenterology and Hepatology, Academic Medical Center, Amsterdam, the Netherlands (P.J.B., C.B., A.B., G.N.J.T., R.P.J.O.E.); Marion Bessin Liver Research Center, Division of Gastroenterology and Liver Diseases, Departments of Medicine and Molecular Genetics, Albert Einstein College of Medicine, Bronx, N.Y. (J.R.C., S.G., N.R.C.); the Department of Clinical Genetics, Erasmus University, Rotterdam, the Netherlands (B.A.O., D.L.); and the Department of Gastroenterology and Hepatology, Academic Hospital Groningen, Groningen, the Netherlands (P.L.M.J.).
Address reprint requests to Dr. Bosma at FO-116, Academic Medical Center, Meibergdreef 9, 1105 AZ, Amsterdam, the Netherlands.
- References
References
1
Gilbert A ,Lereboullet P . La cholémie simple familiale. Semaine Med 1901;21:241-2432
Chowdhury JR, Chowdhury NR, Wolkoff AW, Arias JM. Heme and bile pigment metabolism. In: Arias IM, Boyer JL, Fausto N, Jakoby WB, Schachter DA, Schafritz DA, eds. The liver: biology and pathobiology. 3rd ed. New York: Raven Press, 1994:471-504.
3
Thompson RPH. Genetic transmission of Gilbert's syndrome. In: Okolicsanyi L, ed. Familial hyperbilirubinemia. New York: John Wiley, 1981:91-7.
4
Powell LW ,Hemingway E ,Billing BH ,Sherlock S . Idiopathic unconjugated hyperbilirubinemia (Gilbert's syndrome): a study of 42 families. N Engl J Med 1967;277:1108-1112
Full Text | Web of Science | Medline5
Owens IS ,Ritter JK . The novel bilirubin/phenol UDP-glucuronosyltransferase UGT1 gene locus: implications for multiple nonhemolytic familial hyperbilirubinemia phenotypes. Pharmacogenetics 1992;2:93-108
CrossRef | Medline6
Owens D ,Evans J . Population studies on Gilbert's syndrome. J Med Genet 1975;12:152-156
CrossRef | Web of Science | Medline7
Bailey A ,Robinson D ,Dawson AM . Does Gilbert's disease exist? Lancet 1977;1:931-933
CrossRef | Web of Science | Medline8
Sieg A ,Arab L ,Schlierf G ,Stiehl A ,Kommerell B . Die Prävalenz des Gilbert-Syndroms in Deutschland. Dtsch Med Wochenschr 1987;112:1206-1208
CrossRef | Web of Science | Medline9
Arias IM ,London IM . Bilirubin glucuronide formation in vitro: demonstration of a defect in Gilbert's disease. Science 1957;126:563-564
CrossRef | Web of Science | Medline10
Black M ,Billing BH . Hepatic bilirubin UDP-glucuronyl transferase activity in liver disease and Gilbert's syndrome. N Engl J Med 1969;280:1266-1271
Full Text | Web of Science | Medline11
Fevery J ,Blanckaert N ,Heirwegh KPM ,Preaux A-M ,Berthelot P . Unconjugated bilirubin and an increased proportion of bilirubin monoconjugates in the bile of patients with Gilbert's syndrome and Crigler-Najjar disease. J Clin Invest 1977;60:970-979
CrossRef | Web of Science | Medline12
Ritter JK ,Crawford JM ,Owens IS . Cloning of two human liver bilirubin UDP-glucuronosyltransferase cDNAs with expression in COS-1 cells. J Biol Chem 1991;266:1043-1047
Web of Science | Medline13
Ritter JK ,Chen F ,Sheen YY , et al. A novel complex locus UGT1 encodes human bilirubin, phenol, and other UDP-glucuronosyltransferase isozymes with identical carboxyl termini. J Biol Chem 1992;267:3257-3261
Web of Science | Medline14
Bosma PJ ,Seppen J ,Goldhoorn B , et al. Bilirubin UDP-glucuronosyltransferase 1 is the only relevant bilirubin glucuronidating isoform in man. J Biol Chem 1994;269:17960-17964[Erratum, J Biol Chem 1994;269(41):2542.]
Web of Science | Medline15
Bosma PJ ,Chowdhury NR ,Goldhoorn BG , et al. Sequence of exons and the flanking regions of human bilirubin-UDP-glucuronosyltransferase gene complex and identification of a genetic mutation in a patient with Crigler-Najjar syndrome, type I. Hepatology 1992;15:941-947
CrossRef | Web of Science | Medline16
Bosma PJ ,Chowdhury JR ,Huang TJ , et al. Mechanisms of inherited deficiencies of multiple UDP-glucuronosyltransferase isoforms in two patients with Crigler-Najjar syndrome, type I. FASEB J 1992;6:2859-2863
Web of Science | Medline17
Ritter JK ,Yeatman MT ,Ferreira P ,Owens IS . Identification of a genetic alteration in the code for bilirubin UDP-glucuronosyltransferase in the UGT1 gene complex of a Crigler-Najjar type I patient. J Clin Invest 1992;90:150-155
CrossRef | Web of Science | Medline18
Moghrabi N ,Clarke DJ ,Burchell B ,Boxer M . Cosegregation of intragenic markers with a novel mutation that causes Crigler-Najjar syndrome type I: implication in carrier detection and prenatal diagnosis. Am J Hum Genet 1993;53:722-729
Web of Science | Medline19
Ritter JK ,Yeatman MT ,Kaiser C ,Gridelli B ,Owens IS . A phenylalanine codon deletion at the UGT1 gene complex locus of a Crigler-Najjar type I patient generates a pH-sensitive bilirubin UDP-glucuronosyltransferase. J Biol Chem 1993;268:23573-23579
Web of Science | Medline20
Labrune P ,Myara A ,Hadchouel M , et al. Genetic heterogeneity of Crigler-Najjar syndrome type I: a study of 14 cases. Hepatology 1993;18:126A-126A abstract.
CrossRef | Web of Science21
Erps LT ,Ritter JK ,Hersh JH ,Blossom D ,Martin NC ,Owens IS . Identification of the two single base substitutions in the UGT1 gene locus which abolish bilirubin uridine diphosphate glucuronosyltransferase activity in vitro. J Clin Invest 1994;93:564-570
CrossRef | Web of Science | Medline22
Bosma PJ ,Goldhoorn B ,Oude Elferink RP ,Sinaasappel M ,Oostra BA ,Jansen PLM . A mutation in bilirubin uridine 5'-diphosphate-glucuronosyltransferase isoform 1 causing Crigler-Najjar syndrome type II. Gastroenterology 1993;105:216-220
Web of Science | Medline23
Moghrabi N ,Clarke DJ ,Boxer M ,Burchell B . Identification of an A-to-G missense mutation in exon 2 of the UGT1 gene complex that causes Crigler-Najjar syndrome type 2. Genomics 1993;18:171-173
CrossRef | Web of Science | Medline24
Seppen J ,Bosma PJ ,Goldhoorn BG , et al. Discrimination between Crigler-Najjar syndrome type I and II by expression of mutant bilirubin uridine diphosphate-glucuronosyltransferase. J Clin Invest 1994;94:2385-2391
CrossRef | Web of Science | Medline25
Arias IM ,Gartner LM ,Cohen M ,Ezzer JB ,Levi AJ . Chronic nonhemolytic unconjugated hyperbilirubinemia with glucuronosyltransferase deficiency: clinical, biochemical, pharmacologic and genetic evidence for heterogeneity. Am J Med 1969;47:395-409
CrossRef | Web of Science | Medline26
Hunter JO ,Thompson RPH ,Dunn PM ,Williams R . Inheritance of type 2 Crigler-Najjar hyperbilirubinemia. Gut 1973;14:46-49
CrossRef | Web of Science | Medline27
Maniatis T ,Goodbourn S ,Fischer JA . Regulation of inducible and tissue-specific gene expression. Science 1987;236:1237-1245
CrossRef | Web of Science | Medline28
Saltzman AG ,Weinmann R . Promoter specificity and modulation of RNA polymerase II transcription. FASEB J 1989;3:1723-1733
Web of Science | Medline29
Greenblatt J . Roles of TFIID in transcriptional initiation by RNA polymerase II. Cell 1991;66:1067-1070
CrossRef | Web of Science | Medline30
Grosveld GC ,de Boer E ,Shewmaker CK ,Flavell RA . DNA sequences necessary for transcription of the rabbit beta-globin gene in vivo. Nature 1982;295:120-126
CrossRef | Web of Science | Medline31
Dierks P ,van Ooyen A ,Cochran MD ,Dobkin C ,Reiser J ,Weissmann C . Three regions upstream from the cap site are required for efficient and accurate transcription of the rabbit beta-globin gene in mouse 3T6 cells. Cell 1983;32:695-706
CrossRef | Web of Science | Medline32
Spivak W ,Carey MC . Reverse-phase h.p.l.c. separation, quantification and preparation of bilirubin and its conjugates from native bile: quantitative analysis of the intact tetrapyrroles based on h.p.l.c. of their ethyl anthranilate azo derivatives. Biochem J 1985;225:787-805
Web of Science | Medline33
Billing BH ,Williams R ,Richards TG . Defects in hepatic transport of bilirubin in congenital hyperbilirubinaemia: an analysis of plasma bilirubin disappearance curves. Clin Sci 1964;27:245-257
Web of Science | Medline34
Jendrassik L ,Grof P . Vereinfachte photometrische Methoden zur Bestimmung des Blutbilirubins. Biochem Z 1938;297:81-89
Web of Science35
Bradford MM . A rapid and sensitive method for the quantitation of microgram quantities of protein utilizing the principle of protein-dye binding. Anal Biochem 1976;72:248-254
CrossRef | Web of Science | Medline36
Platt T, Müller-Hill B, Miller JH. Assay of β-galactosidase. In: Miller JH, ed. Experiments in molecular genetics. Cold Spring Harbor, N.Y.: Cold Spring Harbor Laboratory, 1972:352-5.
37
Altman DG. Practical statistics for medical research. London: Chapman & Hall, 1991.
38
Muraca M ,Fevery J . Influence of sex and sex steroids on bilirubin-uridine diphosphate-glucuronosyltransferase activity of rat liver. Gastroenterology 1984;87:308-313
Web of Science | Medline39
Berk PD ,Blaschke TF ,Waggoner JG . Defective bromosulfophthalein clearance in patients with constitutional hepatic dysfunction (Gilbert's syndrome). Gastroenterology 1972;63:472-481
Web of Science | Medline40
Martin JF ,Vierling J-M ,Wolkoff AW , et al. Abnormal hepatic transport of indocyanine green in Gilbert's syndrome. Gastroenterology 1976;70:385-391
Web of Science | Medline41
Berk PD ,Blaschke TF . Detection of Gilbert's syndrome in patients with hemolysis: a method using radioactive chromium. Ann Intern Med 1972;77:527-531
Web of Science | Medline42
Bensinger TA ,Maisels MJ ,Carlson DE ,Conrad ME . Effect of low caloric diet on endogenous carbon monoxide production: normal adults and Gilbert's syndrome. Proc Soc Exp Biol Med 1973;144:417-419
Web of Science | Medline43
Lundh B ,Johansson MB ,Mercke C ,Cavallin-Stahl E . Enhancement of heme catabolism by caloric restriction in man. Scand J Clin Lab Invest 1972;30:421-427
CrossRef | Web of Science | Medline44
Felsher BF ,Carpio NM ,VanCouvering K . Effect of fasting and phenobarbital on hepatic UDP-glucuronic acid formation in the rat. J Lab Clin Med 1979;93:414-427
Medline
- Citing Articles (353)
Citing Articles
1
Tolga Demirbas, Turgut Piskin, Murat Dayangac, Onur Yaprak, Murat Akyildiz, Yaman Tokat, Yildiray Yuzer. (2012) Right-lobe Liver Transplant From Donors With Gilbert Syndrome. Experimental and Clinical Transplantation 10:1, 39-42
CrossRef2
Tina Trdan Lušin, Robert Roškar, Aleš Mrhar. (2012) Evaluation of bisphenol A glucuronidation according to UGT1A1*28 polymorphism by a new LC–MS/MS assay. Toxicology 292:1, 33-41
CrossRef3
Nikola Kotur, Biljana Stankovic, Katerina Kassela, Marianthi Georgitsi, Anna Vicha, Iliana Leontari, Lidija Dokmanovic, Dragana Janic, Nada Krstovski, Kristel Klaassen, Milena Radmilovic, Maja Stojiljkovic, Gordana Nikcevic, Argiris Simeonidis, Gregory Sivolapenko, Sonja Pavlovic, George P Patrinos, Branka Zukic. (2012) 6-mercaptopurine influences TPMT gene transcription in a TPMT gene promoter variable number of tandem repeats-dependent manner. Pharmacogenomics 13:3, 283-295
CrossRef4
Carina Rodrigues, Emília Vieira, Rosário Santos, João de Carvalho, Alice Santos-Silva, Elísio Costa, Elsa Bronze-da-Rocha. (2012) Impact of UGT1A1 gene variants on total bilirubin levels in Gilbert syndrome patients and in healthy subjects. Blood Cells, Molecules, and Diseases
CrossRef5
Ramazan Kurt, Yusuf Yilmaz. (2012) Unconjugated hyperbilirubinemia and liver histology in patients with non-alcoholic fatty liver disease. Clinical Biochemistry
CrossRef6
Robert S. Foti, Michael B. Fisher. 2012. UDP-Glucuronosyltransferases: Pharmacogenetics, Functional Characterization, and Clinical Relevance. .
CrossRef7
Anahita Bhathena, David A. Katz. 2012. Genetics of Drug Disposition. .
CrossRef8
Themistocles Karpathios, Maria Moustaki, Panagiotis Yiallouros, Fariba Sharifi, Achilleas Attilakos, Anna Papadopoulou, Andrew Fretzayas. (2012) Severe Jaundice in Two Children with Kawasaki Disease: A Possible Association with Gilbert Syndrome. Journal of Korean Medical Science 27:1, 101
CrossRef9
Jung-Woo Bae, Chang-Ik Choi, Sang-Hun Park, Choon-Gon Jang, Seok-Yong Lee. (2012) ANALYTICAL LC-MS/MS METHOD FOR EZETIMIBE AND ITS APPLICATION FOR PHARMACOKINETIC STUDY. Journal of Liquid Chromatography & Related Technologies 35:1, 141-152
CrossRef10
Mladen Tzvetkov, Nicolas von Ahsen. (2012) Pharmacogenetic screening for drug therapy. Pathology1
CrossRef11
Richard J. Thompson, Bernard C. Portmann, Eve A. Roberts. 2012. Genetic and metabolic liver disease. , 157-259.
CrossRef12
Jayanta Roy-Chowdhury, Namita Roy-Chowdhury. 2012. Bilirubin Metabolism and Its Disorders. , 1079-1109.
CrossRef13
Allan W. Wolkoff, Paul D. Berk. 2011. Bilirubin Metabolism and Jaundice. , 120-151.
CrossRef14
Andrew Fretzayas, Maria Moustaki, Olga Liapi, Themistocles Karpathios. (2011) Eponym. European Journal of Pediatrics
CrossRef15
Sudeep P. Pushpakom, Munir Pirmohamed. 2011. Pharmacogenetics of Adverse Drug Reactions. , 121-156.
CrossRef16
Cynthia Sung, Pui Ling Lee, Liesbet L. Tan, Dorothy S.L. Toh. (2011) Pharmacogenetic Risk for Adverse Reactions to Irinotecan in the Major Ethnic Populations of Singapore. Drug Safety 34:12, 1167-1175
CrossRef17
Hilbert S. de Vries, Rene H.M. te Morsche, Kevin Jenniskens, Wilbert H.M. Peters, Dirk J. de Jong. (2011) A functional polymorphism in UGT1A1 related to hyperbilirubinemia is associated with a decreased risk for Crohn's disease. Journal of Crohn's and Colitis
CrossRef18
Shalini Datta, Abhijit Chowdhury, Malay Ghosh, Kaushik Das, Pankaj Jha, Roshan Colah, Mitali Mukerji, Partha P. Majumder. (2011) A Genome-Wide Search for Non-UGT1A1 Markers Associated with Unconjugated Bilirubin Level Reveals Significant Association with a Polymorphic Marker Near a Gene of the Nucleoporin Family. Annals of Human Geneticsno-no
CrossRef19
Shunsuke Mori, Kaoru Terada, Yukitaka Ueki. (2011) Tocilizumab-induced hyperbilirubinemia in Japanese patients with rheumatoid arthritis: its association with UDP glucuronosyltransferase 1A1 gene polymorphisms. Modern Rheumatology
CrossRef20
Rafael Haddad Astolfi, Diogo Diniz Gomes Bugano, Alice Aparecida Rodrigues Ferreira Francisco, Marcelo Moreira Tavares de Souza, Suzane Kioko Ono-Nita, Edmund Chada Baracat. (2011) Is Gilbert Syndrome a new risk factor for breast cancer?. Medical Hypotheses 77:2, 162-164
CrossRef21
Jun Long, Shaofang Zhang, Xiaoyan Fang, Yuyuan Luo, Jiebo Liu. (2011) Association of neonatal hyperbilirubinemia with uridine diphosphate-glucuronosyltransferase 1A1 gene polymorphisms: Meta-analysis. Pediatrics International 53:4, 530-540
CrossRef22
Kimie Sai, Yoshiro Saito. (2011) Ethnic differences in the metabolism, toxicology and efficacy of three anticancer drugs. Expert Opinion on Drug Metabolism & Toxicology 7:8, 967-988
CrossRef23
Bryony L. Jones, Dallas M. Swallow. (2011) The impact of cis-acting polymorphisms on the human phenotype. The HUGO Journal
CrossRef24
Carina Rodrigues, Elísio Costa, Emília Vieira, João De Carvalho, Rosário Santos, Petronila Rocha-Pereira, Alice Santos-Silva, Elsa Bronze-da-Rocha. (2011) Bilirubin Is Mainly Dependent on UGT1A1 Polymorphisms, Hemoglobin, Fasting Time and Body Mass Index. The American Journal of the Medical Sciences1
CrossRef25
Mark G. Bartlett, Glenn R. Gourley. (2011) Assessment of UGT Polymorphisms and Neonatal Jaundice. Seminars in Perinatology 35:3, 127-133
CrossRef26
Marianthi Georgitsi, Branka Zukic, Sonja Pavlovic, George P Patrinos. (2011) Transcriptional regulation and pharmacogenomics. Pharmacogenomics 12:5, 655-673
CrossRef27
Elwyn Elias. 2011. Jaundice and Cholestasis. , 234-256.
CrossRef28
S. R. Park, S.- Y. Kong, J. Rhee, Y.- I. Park, K. W. Ryu, J. H. Lee, Y.- W. Kim, I. J. Choi, C. G. Kim, J. Y. Lee, S.- J. Cho, N. K. Kim. (2011) Phase II study of a triplet regimen of S-1 combined with irinotecan and oxaliplatin in patients with metastatic gastric cancer: clinical and pharmacogenetic results. Annals of Oncology 22:4, 890-896
CrossRef29
Sammy Pak-lam Chen, Wing-tat Poon, Chloe Miu Mak, Ching-wan Lam, Yok-lam Kwong, Albert Yan-wo Chan, Sidney Tam. (2011) Application of pharmacogenetics: UGT1A1*28 and nilotinib-induced unconjugated hyperbilirubinaemia in a patient with chronic myeloid leukaemia. Pathology 43:3, 273-274
CrossRef30
Yang-Yang Huang, May-Jen Huang, Hai-Lung Wang, Cung-Cuan Chan, Ching-Shan Huang. (2011) Bilirubin concentrations in thalassemia heterozygotes in university students. European Journal of Haematology 86:4, 317-323
CrossRef31
Bouchra Edderkaoui. 2011. Determination of the Function of a Mutation. , 281-301.
CrossRef32
Mellissa Yong, Stephen M. Schwartz, Charlotte Atkinson, Karen W. Makar, Sushma S. Thomas, Frank Z. Stanczyk, Kim C. Westerlind, Katherine M. Newton, Victoria L. Holt, Wendy M. Leisenring, Johanna W. Lampe. (2011) Associations between polymorphisms in glucuronidation and sulfation enzymes and sex steroid concentrations in premenopausal women in the United States. The Journal of Steroid Biochemistry and Molecular Biology 124:1-2, 10-18
CrossRef33
Laura J. Horsfall, David Zeitlyn, Ayele Tarekegn, Endashaw Bekele, Mark G. Thomas, Neil Bradman, Dallas M. Swallow. (2011) Prevalence of Clinically Relevant UGT1A Alleles and Haplotypes in African Populations. Annals of Human Genetics 75:2, 236-246
CrossRef34
A. Tsunoda, K. Nakao, M. Watanabe, N. Matsui, A. Ooyama, M. Kusano. (2011) Associations of various gene polymorphisms with toxicity in colorectal cancer patients receiving oral uracil and tegafur plus leucovorin: a prospective study. Annals of Oncology 22:2, 355-361
CrossRef35
Jacek Majewski, Tomi Pastinen. (2011) The study of eQTL variations by RNA-seq: from SNPs to phenotypes. Trends in Genetics 27:2, 72-79
CrossRef36
HUNG-CHIEH CHOU, MEI-HUEI CHEN, HWAI-I YANG, YI-NING SU, WU-SHIUN HSIEH, CHIEN-YI CHEN, HUEY-LING CHEN, MEI-HWEI CHANG, PO-NIEN TSAO. (2011) 211 G to A Variation of UDP-Glucuronosyl Transferase 1A1 Gene and Neonatal Breastfeeding Jaundice. Pediatric Research 69:2, 170-174
CrossRef37
Shigeo Iijima, Takehiko Ohzeki, Yoshihiro Maruo. (2011) Hereditary Spherocytosis Coexisting with UDP-Glucuronosyltransferase Deficiency Highly Suggestive of Crigler-Najjar Syndrome Type II. Yonsei Medical Journal 52:2, 369
CrossRef38
Laura Alencastro de Azevedo, Ana Paula Santin, Sandrine Comparsi Wagner, Carina da Fontoura Zaleski, Hugo Bock, Maria Luiza Saraiva-Pereira, Simone Martins de Castro. (2011) Prevalence of UGT1A1 Gene Polymorphism in Patients with Hemolytic Anemia in Southern Brazil. Genetic Testing and Molecular Biomarkers 15:1-2, 107-110
CrossRef39
Neil A Hanchard, Jennifer Skierka, Amy Weaver, Brad S Karon, Dietrich Matern, Walter Cook, Dennis J O'Kane. (2011) UGT1A1 sequence variants and bilirubin levels in early postnatal life: a quantitative approach. BMC Medical Genetics 12:1, 57
CrossRef40
Rebecca Worsley-Hunt, Virginie Bernard, Wyeth W Wasserman. (2011) Identification of cis-regulatory sequence variations in individual genome sequences. Genome Medicine 3:10, 65
CrossRef41
D. Krishnakumar, Umamaheswaran Gurusamy, Kayathri Dhandapani, A. Surendiran, Ruchi Baghel, Ritushree Kukreti, Reneega Gangadhar, Ushakiran Prayaga, S. Manjunath, C. Adithan. (2011) Genetic polymorphisms of drug-metabolizing phase I enzymes CYP2E1, CYP2A6 and CYP3A5 in South Indian population. Fundamental & Clinical Pharmacologyno-no
CrossRef42
Jung-Woo Bae, Chang-Ik Choi, Jin-Hee Lee, Choon-Gon Jang, Myeon-Woo Chung, Seok-Yong Lee. (2011) Effects of UDP-glucuronosyltransferase polymorphisms on the pharmacokinetics of ezetimibe in healthy subjects. European Journal of Clinical Pharmacology 67:1, 39-45
CrossRef43
Sandi L. Navarro, Misty R. Saracino, Karen W. Makar, Sushma S. Thomas, Lin Li, Yingye Zheng, Lisa Levy, Yvonne Schwarz, Jeannette Bigler, John D. Potter, Johanna W. Lampe. (2011) Determinants of Aspirin Metabolism in Healthy Men and Women: Effects of Dietary Inducers of UDP-Glucuronosyltransferases. Journal of Nutrigenetics and Nutrigenomics 4:2, 110-118
CrossRef44
Roman Huber, Holger Ludtke, Johannes Wieber, Christiane Beckmann. (2011) Safety and effects of two mistletoe preparations on production of Interleukin-6 and other immune parameters - a placebo controlled clinical trial in healthy subjects. BMC Complementary and Alternative Medicine 11:1, 116
CrossRef45
Martin Lacko, Hennie M.J. Roelofs, Rene H.M. te Morsche, Adri C. Voogd, Michel B. Oude Ophuis, Wilbert H.M. Peters, Johannes J. Manni. (2010) Genetic polymorphism in the conjugating enzyme UGT1A1 and the risk of head and neck cancer. International Journal of Cancer 127:12, 2815-2821
CrossRef46
M A Mezzacappa, F P Facchini, A C Pinto, A E L Cassone, D S Souza, M A C Bezerra, D M Albuquerque, S T O Saad, F F Costa. (2010) Clinical and genetic risk factors for moderate hyperbilirubinemia in Brazilian newborn infants. Journal of Perinatology 30:12, 819-826
CrossRef47
Nancy F. Olivieri, Zahra Pakbaz, Elliott Vichinsky. (2010) HbE/β-Thalassemia: Basis of Marked Clinical Diversity. Hematology/Oncology Clinics of North America 24:6, 1055-1070
CrossRef48
Stephan Buch, Clemens Schafmayer, Henry Völzke, Marcus Seeger, Juan F. Miquel, Silvia C. Sookoian, Jan H. Egberts, Alexander Arlt, Carlos J. Pirola, Markus M. Lerch, Ulrich John, Andre Franke, Oliver von Kampen, Mario Brosch, Michael Nothnagel, Wolfgang Kratzer, Bernhard O. Boehm, Dieter C. Bröring, Stefan Schreiber, Michael Krawczak, Jochen Hampe. (2010) Loci From a Genome-Wide Analysis of Bilirubin Levels Are Associated With Gallstone Risk and Composition. Gastroenterology 139:6, 1942-1951.e2
CrossRef49
L. Perseu, N. Giagu, S. Satta, M.C. Sollaino, R. Congiu, R. Galanello. (2010) Red cell pyruvate kinase deficiency in Southern Sardinia. Blood Cells, Molecules, and Diseases 45:4, 280-283
CrossRef50
Thomas Winder, Heinz-Josef Lenz. (2010) Molecular predictive and prognostic markers in colon cancer. Cancer Treatment Reviews 36:7, 550-556
CrossRef51
Khushnooma Y. Italia, Farah F. Jijina, Dipty Jain, Rashid Merchant, Anita H. Nadkarni, Malay Mukherjee, Kanjaksha Ghosh, Roshan B. Colah. (2010) The effect of UGT1A1 promoter polymorphism on bilirubin response to hydroxyurea therapy in hemoglobinopathies. Clinical Biochemistry 43:16-17, 1329-1332
CrossRef52
S. D. Richman, G. G. A. Hutchins, M. T. Seymour, P. Quirke. (2010) What can the molecular pathologist offer for optimal decision making?. Annals of Oncology 21:Supplement 7, vii123-vii129
CrossRef53
Christian P. Strassburg. (2010) Hyperbilirubinemia syndromes (Gilbert-Meulengracht, Crigler-Najjar, Dubin-Johnson, and Rotor syndrome). Best Practice & Research Clinical Gastroenterology 24:5, 555-571
CrossRef54
T.-W. Kang, H.-J. Kim, H. Ju, J.-H. Kim, Y.-J. Jeon, H.-C. Lee, K.-K. Kim, J.-W. Kim, S. Lee, J. Y. Kim, S.-Y. Kim, Y. S. Kim. (2010) Genome-wide association of serum bilirubin levels in Korean population. Human Molecular Genetics 19:18, 3672-3678
CrossRef55
Joseph Prandota. (2010) Advances of Molecular Clinical Pharmacology in Gastroenterology and Hepatology. American Journal of Therapeutics 17:5, e137-e162
CrossRef56
Guillermo Gervasini, Julio Benítez, Juan Antonio Carrillo. (2010) Pharmacogenetic testing and therapeutic drug monitoring are complementary tools for optimal individualization of drug therapy. European Journal of Clinical Pharmacology 66:8, 755-774
CrossRef57
Jieming Chen, Yik Ying Teo, Dorothy SL Toh, Cynthia Sung. (2010) Interethnic comparisons of important pharmacology genes using SNP databases: potential application to drug regulatory assessments. Pharmacogenomics 11:8, 1077-1094
CrossRef58
Kleber Yotsumoto Fertrin, Fernando Ferreira Costa. (2010) Genomic polymorphisms in sickle cell disease: implications for clinical diversity and treatment. Expert Review of Hematology 3:4, 443-458
CrossRef59
A. Astier. (2010) Apports récents de la pharmacogénomique dans le traitement des cancers colorectaux. Annales Pharmaceutiques Françaises 68:4, 233-253
CrossRef60
Peter Jatlow, Stephanie S. O’Malley. (2010) Clinical (Nonforensic) Application of Ethyl Glucuronide Measurement: Are We Ready?. Alcoholism: Clinical and Experimental Research 34:6, 968-975
CrossRef61
Michael Kaplan, Cathy Hammerman. (2010) Glucose-6-phosphate dehydrogenase deficiency and severe neonatal hyperbilirubinemia: a complexity of interactions between genes and environment. Seminars in Fetal and Neonatal Medicine 15:3, 148-156
CrossRef62
Jon F. Watchko. (2010) Hyperbilirubinemia in African American neonates: clinical issues and current challenges. Seminars in Fetal and Neonatal Medicine 15:3, 176-182
CrossRef63
K Sikorska, T Romanowski, P Stalke, K Jaskiewicz, K P Bielawski. (2010) Coexistence of HFE and rare UGT1A1 genes mutations in patients with iron overload related liver injury. Advances in Medical Sciences 55:1, 108-110
CrossRef64
Jon F. Watchko, Zhili Lin. (2010) Exploring the genetic architecture of neonatal hyperbilirubinemia. Seminars in Fetal and Neonatal Medicine 15:3, 169-175
CrossRef65
Anastasios Karatzas, Eirini Giannatou, Vassilios Tzortzis, Stavros Gravas, Evangellos Aravantinos, George Moutzouris, Michael Melekos, Aspasia Tsezou. (2010) Genetic polymorphisms in the UDP-glucuronosyltransferase 1A1 (UGT1A1) gene and prostate cancer risk in Caucasian men. Cancer Epidemiology 34:3, 345-349
CrossRef66
Sharon Marsh. 2010. Pharmacogenomic Markers for Cancer Therapy. , 251-274.
CrossRef67
C-F Xu, B H Reck, Z Xue, L Huang, K L Baker, M Chen, E P Chen, H E Ellens, V E Mooser, L R Cardon, C F Spraggs, L Pandite. (2010) Pazopanib-induced hyperbilirubinemia is associated with Gilbert's syndrome UGT1A1 polymorphism. British Journal of Cancer 102:9, 1371-1377
CrossRef68
Jyh-Lurn Chang, Gang Chen, Cornelia M. Ulrich, Jeannette Bigler, Irena B. King, Yvonne Schwarz, Shiuying Li, Lin Li, John D. Potter, Johanna W. Lampe. (2010) DNA Damage and Repair: Fruit and Vegetable Effects in a Feeding Trial. Nutrition and Cancer 62:3, 329-335
CrossRef69
Jacqueline Ramírez, Mark J Ratain, Federico Innocenti. (2010) Uridine 5´-diphospho-glucuronosyltransferase genetic polymorphisms and response to cancer chemotherapy. Future Oncology 6:4, 563-585
CrossRef70
SURINI YUSOFF, ATSUKO TAKEUCHI, CHITOSE ASHI, MASAKO TSUKADA, NUR H. MAʼAMOR, BIN A. ZILFALIL, NARAZAH M. YUSOFF, TSUTOMU NAKAMURA, MIDORI HIRAI, INDRA S.K. HARAHAP, GUNADI, MYEONG J. LEE, NORIYUKI NISHIMURA, YUTAKA TAKAOKA, SATORU MORIKAWA, ICHIRO MORIOKA, NAOKI YOKOYAMA, MASAFUMI MATSUO, HISAHIDE NISHIO, HANS VAN ROSTENBERGHE. (2010) A Polymorphic Mutation, c.-3279T>G, in the UGT1A1 Promoter Is a Risk Factor for Neonatal Jaundice in the Malay Population. Pediatric Research 67:4, 401-406
CrossRef71
R. Fujiwara, N. Nguyen, S. Chen, R. H. Tukey. (2010) Developmental hyperbilirubinemia and CNS toxicity in mice humanized with the UDP glucuronosyltransferase 1 (UGT1) locus. Proceedings of the National Academy of Sciences 107:11, 5024-5029
CrossRef72
Yutaka Fujiwara, Hironobu Minami. (2010) An overview of the recent progress in irinotecan pharmacogenetics. Pharmacogenomics 11:3, 391-406
CrossRef73
Angelo Minucci, Paola Concolino, Bruno Giardina, Cecilia Zuppi, Ettore Capoluongo. (2010) Rapid UGT1A1 (TA)n genotyping by high resolution melting curve analysis for Gilbert's syndrome diagnosis. Clinica Chimica Acta 411:3-4, 246-249
CrossRef74
Susana Rocha, Elísio Costa, Fátima Ferreira, Esmeralda Cleto, José Barbot, Petronila Rocha-Pereira, Alexandre Quintanilha, Luís Belo, Alice Santos-Silva. (2010) Hereditary spherocytosis and the (TA)nTAA polymorphism of UGT1A1 gene promoter region—A comparison of the bilirubin plasmatic levels in the different clinical forms. Blood Cells, Molecules, and Diseases 44:2, 117-119
CrossRef75
Ye-Seul Hong, Jang-Yong Jin, Woo-Ryoung Lee. (2010) A Case of Gilbert's Syndrome with Severe Neonatal Hyperbilirubinemia. Journal of the Korean Society of Neonatology 17:2, 266
CrossRef76
Nina Sneitz, Conny T. Bakker, Robert J. de Knegt, Dicky J.J. Halley, Moshe Finel, Piter J. Bosma. (2010) Crigler-Najjar syndrome in The Netherlands: Identification of four novel UGT1A1 alleles, genotypeâphenotype correlation, and functional analysis of 10 missense mutants. Human Mutation 31:1, 52-59
CrossRef77
Pyoeng Gyun Choe, Wan Beom Park, Jin Su Song, Nak-Hyun Kim, Kyoung-Ho Song, Sang Won Park, Hong Bin Kim, Nam Joong Kim, Myoung-don Oh. (2010) Incidence of Atazanavir-associated Hyperbilirubinemia in Korean HIV Patients: 30 Months Follow-up Results in a Population with Low UDP-glucuronosyltransferase1A1*28 Allele Frequency. Journal of Korean Medical Science 25:10, 1427
CrossRef78
Liewei Wang. (2010) Pharmacogenomics: a systems approach. Wiley Interdisciplinary Reviews: Systems Biology and Medicine 2:1, 3-22
CrossRef79
Michael J. Papez, Chris J. Civalier, Leigh B. Thorne, Margaret L. Gulley. (2009) UGT1A1 Promoter Genotype is not Strongly Associated With Severity of Coronary Artery Disease. Diagnostic Molecular Pathology 18:4, 226-231
CrossRef80
Katrin Borucki, Cornelia Weikert, Eva Fisher, Sibylle Jakubiczka, Claus Luley, Sabine Westphal, Jutta Dierkes. (2009) Haplotypes in the UGT1A1 gene and their role as genetic determinants of bilirubin concentration in healthy German volunteers. Clinical Biochemistry 42:16-17, 1635-1641
CrossRef81
Jing-Ping Lin, Johannes P. Schwaiger, L. Adrienne Cupples, Christopher J. O’Donnell, Gang Zheng, Veit Schoenborn, Steven C. Hunt, Jungnam Joo, Florian Kronenberg. (2009) Conditional linkage and genome-wide association studies identify UGT1A1 as a major gene for anti-atherogenic serum bilirubin levels—The Framingham Heart Study. Atherosclerosis 206:1, 228-233
CrossRef82
Cheng-Hsin Chu, An-Ming Yang, Jia-Horng Kao, Chia-Yuan Liu, Wen-Hsiung Chang, Wei-Shiung Yang. (2009) Uridine diphosphate glucuronosyl transferase 1A1 promoter polymorphism is associated with choledocholithiasis in Taiwanese patients. Journal of Gastroenterology and Hepatology 24:9, 1559-1561
CrossRef83
Angelo Minucci, Paola Concolino, Daniele De Luca, Bruno Giardina, Cecilia Zuppi, Ettore Capoluongo. (2009) A prolonged neonatal jaundice associated with a rare G6PD mutation. Pediatric Blood & Cancer 53:3, 475-478
CrossRef84
Min Kyoung Kim, Hee Soon Cho, Young Kyung Bae, Kyung Hee Lee, Hae-Sun Chung, Soo-Youn Lee, Myung Soo Hyun. (2009) Nilotinib-induced hyperbilirubinemia: Is it a negligible adverse event?. Leukemia Research 33:9, e159-e161
CrossRef85
Peter Zannikos, Gerald Novak, Caiping Yao, Tom Verhaeghe, Monique A. Franc, Bhavna Solanki, Meir Bialer. (2009) Pharmacokinetics of carisbamate (RWJ-333369) in healthy Japanese and Western subjects. Epilepsia 50:8, 1850-1859
CrossRef86
A. D. Johnson, M. Kavousi, A. V. Smith, M.-H. Chen, A. Dehghan, T. Aspelund, J.-P. Lin, C. M. van Duijn, T. B. Harris, L. A. Cupples, A. G. Uitterlinden, L. Launer, A. Hofman, F. Rivadeneira, B. Stricker, Q. Yang, C. J. O'Donnell, V. Gudnason, J. C. Witteman. (2009) Genome-wide association meta-analysis for total serum bilirubin levels. Human Molecular Genetics 18:14, 2700-2710
CrossRef87
Achilleas Attilakos, Alexia Prassouli, George Hadjigeorgiou, Evangelia Lagona, Sofia Kitsiou-Tzeli, Angeliki Galla, Anastasia Stasinopoulou, Themistocles Karpathios. (2009) Acute acalculous cholecystitis in children with Epstein–Barr virus infection: a role for Gilbert's syndrome?. International Journal of Infectious Diseases 13:4, e161-e164
CrossRef88
DA Flockhart, T Skaar, DS Berlin, TE Klein, AT Nguyen. (2009) Clinically Available Pharmacogenomics Tests. Clinical Pharmacology & Therapeutics 86:1, 109-113
CrossRef89
LA Wenning, AS Petry, JT Kost, B Jin, SA Breidinger, I DeLepeleire, EJ Carlini, S Young, T Rushmore, F Wagner, NM Lunde, F Bieberdorf, H Greenberg, JA Stone, JA Wagner, M Iwamoto. (2009) Pharmacokinetics of Raltegravir in Individuals With UGT1A1 Polymorphisms. Clinical Pharmacology & Therapeutics 85:6, 623-627
CrossRef90
L. Fabris, M. Cadamuro, L. Okolicsanyi. (2009) The patient presenting with isolated hyperbilirubinemia. Digestive and Liver Disease 41:6, 375-381
CrossRef91
Jon F. Watchko. (2009) Identification of Neonates at Risk for Hazardous Hyperbilirubinemia: Emerging Clinical Insights. Pediatric Clinics of North America 56:3, 671-687
CrossRef92
Tomasz Romanowski, Katarzyna Sikorska, Krzysztof Piotr Bielawski. (2009) UGT1A1 gene polymorphism as a potential factor inducing iron overload in the pathogenesis of type 1 hereditary hemochromatosis. Hepatology Research 39:5, 469-478
CrossRef93
Elísio Costa, Emília Vieira, Ana Isabel Lopes, Maria Joana Saldanha, Dora Brites, Rosário dos Santos. (2009) Identification of a novel deletion in UDP-glucuronosyltransferase gene in a patient with Crigler–Najjar syndrome type I. Blood Cells, Molecules, and Diseases 42:3, 265-266
CrossRef94
Alexandra Pohl, Georg Lurje, Philipp C. Manegold, Heinz-Josef Lenz. (2009) Pharmacogenomics and -genetics in colorectal cancer. Advanced Drug Delivery Reviews 61:5, 375-380
CrossRef95
Roberta Ferraldeschi, Laura J Minchell, Stephen A Roberts, Simon Tobi, Kristen D Hadfield, Fiona H Blackhall, Saifee Mullamitha, Gregory Wilson, Juan Valle, Mark Saunders, William G Newman. (2009) UGT1A1*28 genotype predicts gastrointestinal toxicity in patients treated with intermediate-dose irinotecan. Pharmacogenomics 10:5, 733-739
CrossRef96
Vincent M
nard, Hugo Girard, Mario Harvey, Louis P
CrossRef97
Rong Lin, Ying Wang, Yi Wang, Wenqing Fu, Dandan Zhang, Hongxiang Zheng, Ting Yu, Ying Wang, Min Shen, Rong Lei, Hong Wu, Aijun Sun, Ruifang Zhang, Xiaofeng Wang, Momiao Xiong, Wei Huang, Li Jin. (2009) Common variants of four bilirubin metabolism genes and their association with serum bilirubin and coronary artery disease in Chinese Han population. Pharmacogenetics and Genomics 19:4, 310-318
CrossRef98
Rong Lin, Xiaofeng Wang, Yi Wang, Feng Zhang, Ying Wang, Wenqing Fu, Ting Yu, Shilin Li, Momiao Xiong, Wei Huang, Li Jin. (2009) Association of polymorphisms in four bilirubin metabolism genes with serum bilirubin in three Asian populations. Human Mutation 30:4, 609-615
CrossRef99
Monica McGrath, Johanie Lepine, I-Min Lee, Lyne Villeneuve, Julie Buring, Chantal Guillemette, Immaculata De Vivo. (2009) Genetic variations in UGT1A1 and UGT2B7 and endometrial cancer risk. Pharmacogenetics and Genomics 19:3, 239-243
CrossRef100
Christine M Walko, Howard McLeod. (2009) Pharmacogenomic progress in individualized dosing of key drugs for cancer patients. Nature Clinical Practice Oncology 6:3, 153-162
CrossRef101
Frédéric Di Fiore, Eric Van Cutsem. (2009) Acute and long-term gastrointestinal consequences of chemotherapy. Best Practice & Research Clinical Gastroenterology 23:1, 113-124
CrossRef102
L. K. Savinkova, M. P. Ponomarenko, P. M. Ponomarenko, I. A. Drachkova, M. V. Lysova, T. V. Arshinova, N. A. Kolchanov. (2009) TATA box polymorphisms in human gene promoters and associated hereditary pathologies. Biochemistry (Moscow) 74:2, 117-129
CrossRef103
Aspasia Tsezou, Maria Tzetis, Eirini Giannatou, Ierotheos Spanos, Eleutheria Roma, Alexandros Fretzayas, Emmanuel Kanavakis, Sofia Kitsiou-Tzeli. (2009) Gilbert Syndrome as a Predisposing Factor for Cholelithiasis Risk in the Greek Adult Population. Genetic Testing and Molecular Biomarkers 13:1, 143-146
CrossRef104
Mitsutaka Shiota, Junko Asada, Hitoshi Nishida, Akira Kumakura, Takakazu Yoshioka, Atsuko Hata, Ken Watanabe, Yoshihiro Maruo, Junko Kato, Hiroshi Ideguchi, Hidekazu Nakanishi, Takashi Sugihara, Daisuke Hata. (2009) Hereditary Spherocytosis in 3 Children Coexisting With UDP-glucuronyl Transferase 1A1 Deficiency. Journal of Pediatric Hematology/Oncology 31:2, 121-123
CrossRef105
Aspasia Tsezou, Maria Tzetis, Eirini Giannatou, Ierotheos Spanos, Eleutheria Roma, Alexandros Fretzayas, Emmanuel Kanavakis, Sofia Kitsiou-Tzeli. (2009) Gilbert Syndrome as a Predisposing Factor for Cholelithiasis Risk in the Greek Adult Population. Genetic Testing 0:0, 090108090224061
CrossRef106
R. Palacios, M. González, J. Ruiz, Jesús Santos. (2008) Efectos adversos de atazanavir. Enfermedades Infecciosas y Microbiología Clínica 26, 41-44
CrossRef107
Luis Parodi, Eve Pickering, Laura A. Cisar, Doug Lee, Raoudha Soufi-Mahjoubi. (2008) Utility of Pretreatment Bilirubin Level and UGT1A1 Polymorphisms in Multivariate Predictive Models of Neutropenia Associated with Irinotecan Treatment in Previously Untreated Patients with Colorectal Cancer. Archives of Drug Information 1:3, 97-106
CrossRef108
Arno Lingenhel, Barbara Kollerits, Johannes P. Schwaiger, Steven C. Hunt, Richard Gress, Paul N. Hopkins, Veit Schoenborn, Iris M. Heid, Florian Kronenberg. (2008) Serum bilirubin levels, UGT1A1 polymorphisms and risk for coronary artery disease. Experimental Gerontology 43:12, 1102-1107
CrossRef109
Ursula Ehmer, Tim O. Lankisch, Thomas J. Erichsen, Sandra Kalthoff, Nicole Freiberg, Michael Wehmeier, Michael P. Manns, Christian P. Strassburg. (2008) Rapid Allelic Discrimination by TaqMan PCR for the Detection of the Gilbert's Syndrome Marker UGT1A1*28. The Journal of Molecular Diagnostics 10:6, 549-552
CrossRef110
Emer Fitzpatrick, Marumbo Mtegha, Anil Dhawan. (2008) Crigler–Najjar syndrome: therapeutic options and consequences of mutations in the UGT1A1 complex. Expert Review of Endocrinology & Metabolism 3:6, 725-737
CrossRef111
Dinemarie Kweekel, Henk-Jan Guchelaar, Hans Gelderblom. (2008) Clinical and pharmacogenetic factors associated with irinotecan toxicity. Cancer Treatment Reviews 34:7, 656-669
CrossRef112
David E. Martin, Hal Galbraith, Jared Schettler, Corey Ellis, Judy Doto. (2008) Pharmacokinetic properties and tolerability of bevirimat and atazanavir in healthy volunteers: An open-label, parallel-group study. Clinical Therapeutics 30:10, 1794-1805
CrossRef113
John F. Deeken, Rebecca Slack, John L. Marshall. (2008) Irinotecan and uridine diphosphate glucuronosyltransferase 1A1 pharmacogenetics. Cancer 113:7, 1502-1510
CrossRef114
Shannon L. Carpenter, Susan Lieff, Thad A. Howard, Barry Eggleston, Russell E. Ware. (2008) UGT1A1 promoter polymorphisms and the development of hyperbilirubinemia and gallbladder disease in children with sickle cell anemia. American Journal of Hematology 83:10, 800-803
CrossRef115
Takuya Kuno, Hiroshi Togawa, Takaharu Mizutani. (2008) Induction of human UGT1A1 by a complex of dexamethasone-GR dependent on proximal site and independent of PBREM. Molecular Biology Reports 35:3, 361-367
CrossRef116
Tim O. Lankisch, Tracey C. Gillman, Thomas J. Erichsen, Ursula Ehmer, Sandra Kalthoff, Nicole Freiberg, Peter A. Munzel, Michael P. Manns, Christian P. Strassburg. (2008) Aryl hydrocarbon receptor-mediated regulation of the human estrogen and bile acid UDP-glucuronosyltransferase 1A3 gene. Archives of Toxicology 82:9, 573-582
CrossRef117
Yang-Yang Huang, May-Jen Huang, Sieng-Sien Yang, Hsiu-Chen Teng, Ching-Shan Huang. (2008) Variations in the UDP-glucuronosyltransferase 1A1 gene for the development of unconjugated hyperbilirubinemia in Taiwanese. Pharmacogenomics 9:9, 1229-1235
CrossRef118
Hiroko Takahashi, Yoshihiro Maruo, Asami Mori, Masaru Iwai, Hiroshi Sato, Yoshihiro Takeuchi. (2008) Effect of D256N and Y483D on Propofol Glucuronidation by Human Uridine 5′-diphosphate Glucuronosyltransferase (UGT1A9). Basic & Clinical Pharmacology & Toxicology 103:2, 131-136
CrossRef119
Dezheng Huo, Hee-Jin Kim, Clement A. Adebamowo, Temidayo O. Ogundiran, Effiong E. Akang, Oladapo Campbell, Adeniyi Adenipekun, Qun Niu, Lise Sveen, James D. Fackenthal, Donna Lee Fackenthal, Soma Das, Nancy Cox, Anna Di Rienzo, Olufunmilayo I. Olopade. (2008) Genetic polymorphisms in uridine diphospho-glucuronosyltransferase 1A1 and breast cancer risk in Africans. Breast Cancer Research and Treatment 110:2, 367-376
CrossRef120
Eric Lévesque, Marie-Odile Benoit-Biancamano, Robert Delage, Félix Couture, Chantal Guillemette. (2008) Pharmacokinetics of mycophenolate mofetil and its glucuronide metabolites in healthy volunteers. Pharmacogenomics 9:7, 869-879
CrossRef121
Thomas J. Erichsen, Ursula Ehmer, Sandra Kalthoff, Tim O. Lankisch, Tordis M. Müller, Peter A. Munzel, Michael P. Manns, Christian P. Strassburg. (2008) Genetic variability of aryl hydrocarbon receptor (AhR)-mediated regulation of the human UDP glucuronosyltransferase (UGT) 1A4 gene. Toxicology and Applied Pharmacology 230:2, 252-260
CrossRef122
Bernadett Faragó, Béla Melegh. (2008) Gilbert-szindróma. Orvosi Hetilap 149:27, 1277-1282
CrossRef123
Christian P. Strassburg, Tim O. Lankisch, Michael P. Manns, Ursula Ehmer. (2008) Family 1 uridine-5′-diphosphate glucuronosyltransferases (UGT1A): from Gilbert’s syndrome to genetic organization and variability. Archives of Toxicology 82:7, 415-433
CrossRef124
Upendra A Argikar, Otito F Iwuchukwu, Swati Nagar. (2008) Update on tools for evaluation of uridine diphosphoglucuronosyltransferase polymorphisms. Expert Opinion on Drug Metabolism & Toxicology 4:7, 879-894
CrossRef125
Angelo Minucci, Paola Concolino, Francesca Vendittelli, Bruno Giardina, Cecilia Zuppi, Ettore Capoluongo. (2008) Glucose-6-phosphate dehydrogenase Buenos Aires: A novel de novo missense mutation associated with severe enzyme deficiency. Clinical Biochemistry 41:9, 742-745
CrossRef126
Junko Sugatani, Kousuke Mizushima, Makoto Osabe, Kasumi Yamakawa, Satoru Kakizaki, Hitoshi Takagi, Masatomo Mori, Akira Ikari, Masao Miwa. (2008) Transcriptional regulation of human UGT1A1 gene expression through distal and proximal promoter motifs: implication of defects in the UGT1A1 gene promoter. Naunyn-Schmiedeberg's Archives of Pharmacology 377:4-6, 597-605
CrossRef127
Christian P Strassburg. (2008) Pharmacogenetics of Gilbert’s syndrome. Pharmacogenomics 9:6, 703-715
CrossRef128
Minoli A Perera, Federico Innocenti, Mark J Ratain. (2008) Pharmacogenetic Testing for Uridine Diphosphate Glucuronosyltransferase 1A1 Polymorphisms: Are We There Yet?. Pharmacotherapy 28:6, 755-768
CrossRef129
Andrew Owen, Saye H Khoo. (2008) Pharmacogenetics of antiretroviral agents. Current Opinion in HIV and AIDS 3:3, 288-295
CrossRef130
Johan Fevery. (2008) Bilirubin in clinical practice: a review. Liver International 28:5, 592-605
CrossRef131
J Ramírez, S Mirkov, W Zhang, P Chen, S Das, W Liu, M J Ratain, F Innocenti. (2008) Hepatocyte nuclear factor-1 alpha is associated with UGT1A1, UGT1A9 and UGT2B7 mRNA expression in human liver. The Pharmacogenomics Journal 8:2, 152-161
CrossRef132
Yoshihiro Maruo, Ishwar Chander Verma, Katsuyuki Matsui, Hiroko Takahashi, Yu Mimura, Yoriko Ota, Asami Mori, Renu Saxena, Hiroshi Sato, Yoshihiro Takeuchi. (2008) Conformational Change of UGT1A1 by a Novel Missense Mutation (p.L131P) Causing Crigler-Najjar Syndrome Type I. Journal of Pediatric Gastroenterology and Nutrition 46:3, 308-311
CrossRef133
Jürgen Brockmöller, Mladen V. Tzvetkov. (2008) Pharmacogenetics: data, concepts and tools to improve drug discovery and drug treatment. European Journal of Clinical Pharmacology 64:2, 133-157
CrossRef134
Nora Nikolac, Ana-Maria Simundic, Elizabeta Topic, Zvonko Jurcic, Mario Stefanovic, Jerka Dumic, Sandra Supraha Goreta. (2008) Rare TA repeats in promoter TATA box of the UDP glucuronosyltranferase ( UGT1A1 ) gene in Croatian subjects. Clinical Chemistry and Laboratory Medicine 46:2, 174-178
CrossRef135
YAHYA BUYUKASIK, UMIT AKMAN, NACIYE S. BUYUKASIK, HAKAN GOKER, ALPARSLAN KILICARSLAN, ALI I. SHORBAGI, GULSEN HASCELIK, IBRAHIM C. HAZNEDAROGLU. (2008) Evidence for Higher Red Blood Cell Mass in Persons With Unconjugated Hyperbilirubinemia and Gilbert’s Syndrome. The American Journal of the Medical Sciences 335:2, 115-119
CrossRef136
A. Telenti, U. M. Zanger. (2008) Pharmacogenetics of Anti-HIV Drugs. Annual Review of Pharmacology and Toxicology 48:1, 227-256
CrossRef137
Sung Su Yea, Sang Seop Lee, Woo-Young Kim, Kwang-Hyeon Liu, Hyojin Kim, Ji-Hong Shon, In-June Cha, Jae-Gook Shin. (2008) Genetic Variations and Haplotypes of UDP-glucuronosyltransferase 1A Locus in a Korean Population. Therapeutic Drug Monitoring 30:1, 23-34
CrossRef138
Steven A. Ringer. 2008. Indirect Hyperbilirubinemia. , 191-205.
CrossRef139
Ana Alfirevic, Munir Pirmohamed. (2008) Adverse drug reactions and pharmacogenomics: recent advances. Personalized Medicine 5:1, 11-23
CrossRef140
Ji Whan Lim, Joon Hyouk Choi, Yang Hoon Nam, In Seok Seo, Seong Min Yoon, Myoung Sook Koo. (2008) A Case of Congenital Hemolytic Anemia of Unknown Cause Combined with Gilbert's Syndrome. The Korean Journal of Hematology 43:1, 58
CrossRef141
Jae Myoung Lee, Young Ji Han, Ji Sook Kim, Eun Ryoung Kim. (2008) The relationship between Gly71Arg and TATA box polymorphism of UGT1A1 gene and prolonged hyperbilirubinemia of breast milk feeding infant in Korean. Korean Journal of Pediatrics 51:2, 150
CrossRef142
Yuichi Maruta, Naoko Okayama, Mikako Hiura, Yutaka Suehiro, Hirohisa Hirai, Yuji Hinoda. (2008) Determination of ancestral allele for possible human cancer-associated polymorphisms. Cancer Genetics and Cytogenetics 180:1, 24-29
CrossRef143
H. J. M. van Kan, L. H. van den Berg, G. J. Groeneveld, R. J. H. M. van der Straaten, P. W. J. van Vught, L. Lie-A-Huen, H.-J. Guchelaar. (2008) Pharmacokinetics of riluzole: evidence for glucuronidation as a major metabolic pathway not associated with UGT1A1 genotype. Biopharmaceutics & Drug Disposition 29:3, 139-144
CrossRef144
MICHAEL KAPLAN, TINA SLUSHER, PAUL RENBAUM, DOMINIC F. ESSIET, SUNDAY PAM, EPHRAT LEVY-LAHAD, CATHY HAMMERMAN. (2008) (TA)n UDP-Glucuronosyltransferase 1A1 Promoter Polymorphism in Nigerian Neonates. Pediatric Research 63:1, 109-111
CrossRef145
DEBORAH S. BARBOUTH, DARCY L. VELAZQUEZ, STANLEY KONOPKA, J JAMES D. WILKINSON, VIRGINIA H. CARVER, LOUIS J. ELSAS. (2007) Screening Newborns for Galactosemia Using Total Body Galactose Oxidation to CO2 in Expired Air. Pediatric Research 62:6, 720-724
CrossRef146
Ge Sun, Mingyuan Wu, Jiang Cao, Lizhong Du. (2007) Cord blood bilirubin level in relation to bilirubin UDP-glucuronosyltransferase gene missense allele in Chinese neonates. Acta Paediatrica 96:11, 1622-1625
CrossRef147
J B Singer, Y Shou, F Giles, H M Kantarjian, Y Hsu, A S Robeva, P Rae, A Weitzman, J M Meyer, M Dugan, O G Ottmann. (2007) UGT1A1 promoter polymorphism increases risk of nilotinib-induced hyperbilirubinemia. Leukemia 21:11, 2311-2315
CrossRef148
Pál Soós. (2007) A hyperbilirubinaemia gyakorisága és a Gilbert-szindróma diagnosztikája munkaköri alkalmassági vizsgálataink során. Orvosi Hetilap 148:45, 2139-2142
CrossRef149
E. Gamelin, M. Boisdron-Celle, A. Morel, O. Capitain. (2007) Pharmacogénétique des anticancéreux. Annales Pharmaceutiques Françaises 65:6, 390-401
CrossRef150
Stephan Niemann, Wendy J. Broom, Robert H. Brown Jr.. (2007) Analysis of a genetic defect in the TATA box of theSOD1 gene in a patient with familial amyotrophic lateral sclerosis. Muscle & Nerve 36:5, 704-707
CrossRef151
Y. Guo, P. Lu, E. Farrell, X. Zhang, P. Weller, M. Monshouwer, J. Wang, G. Liao, Z. Zhang, S. Hu, J. Allard, S. Shafer, J. Usuka, G. Peltz. (2007) In silico and in vitro pharmacogenetic analysis in mice. Proceedings of the National Academy of Sciences 104:45, 17735-17740
CrossRef152
H-C Teng, M-J Huang, K-S Tang, S-S Yang, C-S Tseng, C-S Huang. (2007) Combined UGT1A1 and UGT1A7 variant alleles are associated with increased risk of Gilbert’s syndrome in Taiwanese adults. Clinical Genetics 72:4, 321-328
CrossRef153
Wei Peng Yong, Apurva A. Desai, Federico Innocenti, Jacqueline Ramirez, Dale Shepard, Ken Kobayashi, Larry House, Gini F. Fleming, Nicholas J. Vogelzang, Richard L. Schilsky, Mark J. Ratain. (2007) Pharmacokinetic modulation of oral etoposide by ketoconazole in patients with advanced cancer. Cancer Chemotherapy and Pharmacology 60:6, 811-819
CrossRef154
Philip J Mason, José M Bautista, Florinda Gilsanz. (2007) G6PD deficiency: the genotype-phenotype association. Blood Reviews 21:5, 267-283
CrossRef155
Russell P. Kruzelock, William Short. (2007) Colorectal Cancer Therapeutics and the Challenges of Applied Pharmacogenomics. Current Problems in Cancer 31:5, 315-366
CrossRef156
Christine M Hartford, M Eileen Dolan. (2007) Identifying genetic variants that contribute to chemotherapy-induced cytotoxicity. Pharmacogenomics 8:9, 1159-1168
CrossRef157
Richard C Turkington, Vicky M Coyle, Patrick G Johnston, Martin M Eatock. (2007) Predictive and prognostic markers in colorectal cancer. Personalized Medicine 4:3, 295-306
CrossRef158
KENICHI SUGITA, YOSHIHIRO MARUO, HIDEMITSU KUROSAWA, AKIRA TSUCHIOKA, TOSHIO FUJIWARA, ASAMI MORI, HIROSHI IDEGUCHI, MITSUOKI EGUCHI. (2007) Severe hyperbilirubinemia in a 10-year-old girl with a combined disorder of hereditary spherocytosis and Gilbert syndrome. Pediatrics International 49:4, 540-542
CrossRef159
Ken-ichi Fujita, Yuichi Ando, Fumio Nagashima, Wataru Yamamoto, Hisashi Eodo, Kazuhiro Araki, Keiji Kodama, Toshimichi Miya, Masaru Narabayashi, Yasutsuna Sasaki. (2007) Genetic linkage of UGT1A7 and UGT1A9 polymorphisms to UGT1A1*6 is associated with reduced activity for SN-38 in Japanese patients with cancer. Cancer Chemotherapy and Pharmacology 60:4, 515-522
CrossRef160
Jackie Yao Liu, Kevin Qu, Anthony D. Sferruzza, Richard A. Bender. (2007) Distribution of the UGT1A1*28 polymorphism in Caucasian and Asian populations in the US: a genomic analysis of 138 healthy individuals. Anti-Cancer Drugs 18:6, 693-696
CrossRef161
Nisha Vasavda, Stephan Menzel, Sheila Kondaveeti, Emma Maytham, Moji Awogbade, Sybil Bannister, Juliette Cunningham, Andrew Eichholz, Yvonne Daniel, Iheanyi Okpala, Tony Fulford, Swee Lay Thein. (2007) The linear effects of α -thalassaemia, the UGT1A1 and HMOX1 polymorphisms on cholelithiasis in sickle cell disease. British Journal of Haematology 138:2, 263-270
CrossRef162
Tae Won Kim, Federico Innocenti. (2007) Insights, Challenges, and Future Directions in Irinogenetics. Therapeutic Drug Monitoring 29:3, 265-270
CrossRef163
Paul Lee, Graham Jones, Markus J. Seibel. (2007) Dual polymorphisms in UDP-glucuronosyltransferases 1A1 and 1A6: a novel mechanism for hyperserotoninaemia in Gilbert??s syndrome mimicking carcinoid syndrome?. European Journal of Gastroenterology & Hepatology 19:4, 337-340
CrossRef164
M. Clementi, E. Di Gianantonio, L. Fabris, P. Forabosco, M. Strazzabosco, R. Tenconi, L. Okolicsanyi. (2007) Inheritance of hyperbilirubinemia: Evidence for a major autosomal recessive gene. Digestive and Liver Disease 39:4, 351-355
CrossRef165
Tsai-Yuan Hsieh, Tzu-Yue Shiu, Shih-Ming Huang, Hsuan-Hwai Lin, Tai-Chi Lee, Peng-Jen Chen, Heng-Cheng Chu, Wei-Kuo Chang, King-Song Jeng, Michael M.C. Lai, You-Chen Chao. (2007) Molecular pathogenesis of Gilbert??s syndrome: decreased TATA-binding protein binding affinity of UGT1A1 gene promoter. Pharmacogenetics and Genomics 17:4, 229-236
CrossRef166
Michael S Braun, Philip Quirke, Matthew T Seymour. (2007) Molecular markers of chemotherapeutic response and toxicity in colorectal cancer. Expert Review of Anticancer Therapy 7:4, 489-501
CrossRef167
MICHAEL KAPLAN, PAUL RENBAUM, HENDRIK J. VREMAN, RONALD J. WONG, EPHRAT LEVY-LAHAD, CATHY HAMMERMAN, DAVID K. STEVENSON. (2007) (TA)n UGT 1A1 Promoter Polymorphism: A Crucial Factor in the Pathophysiology of Jaundice in G-6-PD Deficient Neonates. Pediatric Research PAP,
CrossRef168
Marie-Paule Sablin, Christophe Le Tourneau, Sandrine Faivre, Éric Raymond. (2007) Irinotécan et dysfonctions hépatiques. Thérapie 62:2, 111-115
CrossRef169
Chih-Kang Huang, Alina Dulau, Chiao-Ju Su-Rick, Qiulu Pan. (2007) Validation of Rapid Polymerase Chain Reaction-based Detection of All Length Polymorphisms in the UGT 1A1 Gene Promoter. Diagnostic Molecular Pathology 16:1, 50-53
CrossRef170
Barbara Ostanek, Danijela Furlan, Tina Mavec, Jana Lukac-Bajalo. (2007) UGT1A1(TA)n promoter polymorphism—A new case of a (TA)8 allele in Caucasians. Blood Cells, Molecules, and Diseases 38:2, 78-82
CrossRef171
Jun-Hua Yuan, Yan-Qing Li, Xiao-Yun Yang. (2007) Inhibition of Epigallocatechin Gallate on Orthotopic Colon Cancer by Upregulating the Nrf2-UGT1A Signal Pathway in Nude Mice. Pharmacology 80:4, 269-278
CrossRef172
Sonia Rodríguez-Nóvoa, Luz Martín-Carbonero, Pablo Barreiro, Gema González-Pardo, Inmaculada Jiménez-Nácher, Juan González-Lahoz, Vincent Soriano. (2007) Genetic factors influencing atazanavir plasma concentrations and the risk of severe hyperbilirubinemia. AIDS 21:1, 41-46
CrossRef173
R. Origa, M. C. Sollaino, N. Giagu, S. Barella, S. Campus, C. Mandas, P. Bina, L. Perseu, R. Galanello. (2007) Clinical and molecular analysis of haemoglobin H disease in Sardinia: haematological, obstetric and cardiac aspects in patients with different genotypes. British Journal of Haematology 136:2, 326-332
CrossRef174
Eric Lévesque, Hugo Girard, Kim Journault, Johanie Lépine, Chantal Guillemette. (2007) Regulation of the UGT1A1 bilirubin-conjugating pathway: Role of a new splicing event at the UGT1A locus. Hepatology 45:1, 128-138
CrossRef175
Marija Mladenovic, Nedeljko Radlovic, Dragana Ristic, Zoran Lekovic, Petar Radlovic, Momcilo Pavlovic, Milan Gajic, Marijana Puskarevic, Ivana Davidovic, Jelena Djurdjevic. (2007) Arias icterus: Prolonged unconjugated hyperbilirubinemia caused by breast milk. Srpski arhiv za celokupno lekarstvo 135:11-12, 655-658
CrossRef176
F A de Jong, T J Scott-Horton, D L Kroetz, H L McLeod, L E Friberg, R H Mathijssen, J Verweij, S Marsh, A Sparreboom. (2007) Irinotecan-induced Diarrhea: Functional Significance of the Polymorphic ABCC2 Transporter Protein. Clinical Pharmacology & Therapeutics 81:1, 42-49
CrossRef177
Y S Hong, H R Lee, S Park, S C Lee, I G Hwang, B-B Park, J Lee, J S Ahn, M-J Ahn, H Y Lim, K Park. (2006) Three-week schedule of irinotecan plus cisplatin in patients with previously untreated extensive-stage small-cell lung cancer. British Journal of Cancer 95:12, 1648-1652
CrossRef178
MILAN JIRSA, JAN PETRASEK, LIBOR VITEK. (2006) Linkage between A(TA) 7 TAA and ?3279T>G mutations in UGT1A1 is not essential for pathogenesis of Gilbert syndrome. Liver International 26:10, 1302-1303
CrossRef179
Federico Innocenti, Mark J Ratain. (2006) Pharmacogenetics of irinotecan: clinical perspectives on the utility of genotyping. Pharmacogenomics 7:8, 1211-1221
CrossRef180
Stephanie L Van Bebber, Hugh L Keegan, Kathryn A Phillips, Amalia M Issa. (2006) Novel personalized medicine technology: UGT1A1 testing for irinotecan as a case study. Personalized Medicine 3:4, 415-419
CrossRef181
Kazuhiro Araki, Ken-ichi Fujita, Yuichi Ando, Fumio Nagashima, Wataru Yamamoto, Hisashi Endo, Toshimichi Miya, Keiji Kodama, Masaru Narabayashi, Yasutsuna Sasaki. (2006) Pharmacogenetic impact of polymorphisms in the coding region of the UGT1A1 gene on SN-38 glucuronidation in Japanese patients with cancer. Cancer Science 97:11, 1255-1259
CrossRef182
Tim O. Lankisch, Ulrike Moebius, Michael Wehmeier, Georg Behrens, Michael P. Manns, Reinhold E. Schmidt, Christian P. Strassburg. (2006) Gilbert's disease and atazanavir: From phenotype to UDP-glucuronosyltransferase haplotype. Hepatology 44:5, 1324-1332
CrossRef183
Wendell W. Weber, Maureen T. Cronin. 2006. Pharmacogenetic Testing. .
CrossRef184
Michael L. Maitland, Kaveeta Vasisht, Mark J. Ratain. (2006) TPMT, UGT1A1 and DPYD: genotyping to ensure safer cancer therapy?. Trends in Pharmacological Sciences 27:8, 432-437
CrossRef185
Nobumitsu Hanioka, Nobuhiko Obika, Masuhiro Nishimura, Hideto Jinno, Toshiko Tanaka-Kagawa, Keita Saito, Kimio Kiryu, Shinsaku Naito, Shizuo Narimatsu. (2006) Inducibility of UDP-glucuronosyltransferase 1As by β-naphthoflavone in HepG2 cells. Food and Chemical Toxicology 44:8, 1251-1260
CrossRef186
Junichi Kaneko, Yasuhiko Sugawara, Yoshihiro Maruo, Hiroshi Sato, Sumihito Tamura, Hiroshi Imamura, Norihiro Kokudo, Masatoshi Makuuchi. (2006) Liver Transplantation Using Donors With Gilbert Syndrome. Transplantation 82:2, 282-285
CrossRef187
Wei Peng Yong, Federico Innocenti, Mark J. Ratain. (2006) The role of pharmacogenetics in cancer therapeutics. British Journal of Clinical Pharmacology 62:1, 35-46
CrossRef188
B. Lodoso Torrecilla, E. Palomo Atance, C. Camarena Grande, M.ªC. Díaz Fernández, L. Hierro Llanillo, A. de la Vega Bueno, E. Frauca Remacha, G. Muñoz Bartolo, P. Jara Vega. (2006) Síndrome de Crigler-Najjar: diagnóstico y tratamiento. Anales de Pediatría 65:1, 73-78
CrossRef189
Yoshinori Hasegawa, Yuichi Ando, Kaoru Shimokata. (2006) Screening for adverse reactions to irinotecan treatment using the Invader ® UGT1A1 Molecular Assay. Expert Review of Molecular Diagnostics 6:4, 527-533
CrossRef190
Kantarjian, Hagop, Giles, Francis, Wunderle, Lydia, Bhalla, Kapil, O'Brien, Susan, Wassmann, Barbara, Tanaka, Chiaki, Manley, Paul, Rae, Patricia, Mietlowski, William, Bochinski, Kathy, Hochhaus, Andreas, Griffin, James D., Hoelzer, Dieter, Albitar, Maher, Dugan, Margaret, Cortes, Jorge, Alland, Leila, Ottmann, Oliver G., . (2006) Nilotinib in Imatinib-Resistant CML and Philadelphia Chromosome–Positive ALL. New England Journal of Medicine 354:24, 2542-2551
Full Text191
Keiko Wada, Atsuko Takeuchi, Kayoko Saiki, Retno Sutomo, Hans Van Rostenberghe, Narazah Mohd Yusoff, Vichai Laosombat, Ahmad Hamim Sadewa, Norlelawati Abdul Talib, Surini Yusoff, Myeong Jin Lee, Hitoshi Ayaki, Hajime Nakamura, Masafumi Matsuo, Hisahide Nishio. (2006) Evaluation of mutation effects on UGT1A1 activity toward 17β-estradiol using liquid chromatography–tandem mass spectrometry. Journal of Chromatography B 838:1, 9-14
CrossRef192
Toru Usui, Takuya Kuno, Takaharu Mizutani. (2006) Induction of Human UDP-glucuronosyltransferase 1A1 by Cortisol-GR. Molecular Biology Reports 33:2, 91-96
CrossRef193
Alessandro Ferraris, Giovanna D'Amato, Valerio Nobili, Barbara Torres, Matilde Marcellini, Bruno Dallapiccola. (2006) Combined Test for UGT1A1 –3279T→G and A(TA)nTAA Polymorphisms Best Predicts Gilbert's Syndrome in Italian Pediatric Patients. Genetic Testing 10:2, 121-125
CrossRef194
F Petit, V Gajdos, L Capel, F Parisot, A Myara, J Francoual, P Labrune. (2006) Crigler-Najjar type II syndrome may result from several types and combinations of mutations in the UGT1A1 gene. Clinical Genetics 69:6, 525-527
CrossRef195
Laurel S. Thorlacius, George Blakney, John Krahn, Fiona Bamforth, Trefor N. Higgins. (2006) Biochemistry testing associated with pregnancy and the newborn period—A lot has changed since you were a baby!. Clinical Biochemistry 39:5, 519-541
CrossRef196
Mark A. Boyd, Preeyaporn Srasuebkul, Kiat Ruxrungtham, Peter I. Mackenzie, Verawan Uchaipichat, Michael Stek, Joep M.A. Lange, Praphan Phanuphak, David A. Cooper, Wandee Udomuksorn, John O. Miners. (2006) Relationship between hyperbilirubinaemia and UDP-glucuronosyltransferase 1A1 (UGT1A1) polymorphism in adult HIV-infected Thai patients treated with indinavir. Pharmacogenetics and Genomics 16:5, 321-329
CrossRef197
R Hermann, J Borlak, U Munzel, G Niebch, U Fuhr, J Maus, K Erb. (2006) The role of Gilbert's syndrome and frequent NAT2 slow acetylation polymorphisms in the pharmacokinetics of retigabine. The Pharmacogenomics Journal 6:3, 211-219
CrossRef198
Shirley S. Brill, Anna M. Furimsky, Mark N. Ho, Michael J. Furniss, Yi Li, Adam G. Green, Carol E. Green, Lalitha V. Iyer, Wallace W. Bradford, Izet M. Kapetanovic. (2006) Glucuronidation of trans -resveratrol by human liver and intestinal microsomes and UGT isoforms. Journal of Pharmacy and Pharmacology 58:4, 469-479
CrossRef199
Hermann E. Wasmuth, Hildegard Keppeler, Ulrike Herrmann, Ramin Schirin-Sokhan, Michael Barker, Frank Lammert. (2006) Coinheritance of Gilbert syndrome–associatedUGT1A1 mutation increases gallstone risk in cystic fibrosis. Hepatology 43:4, 738-741
CrossRef200
Maciej J. Zamek-Gliszczynski, Keith A. Hoffmaster, Ken-ichi Nezasa, Melanie N. Tallman, Kim L.R. Brouwer. (2006) Integration of hepatic drug transporters and phase II metabolizing enzymes: Mechanisms of hepatic excretion of sulfate, glucuronide, and glutathione metabolites. European Journal of Pharmaceutical Sciences 27:5, 447-486
CrossRef201
Melih O. Babaoglu, Sule Yigit, A. Sukru Aynacioglu, Reinhold Kerb, Murat Yurdakok, Atila Bozkurt. (2006) Neonatal Jaundice and Bilirubin UDP-Glucuronosyl Transferase 1A1 Gene Polymorphism in Turkish Patients. Basic <html_ent glyph="@amp;" ascii="&"/> Clinical Pharmacology <html_ent glyph="@amp;" ascii="&"/> Toxicology 98:4, 377-380
CrossRef202
S Nagar, R P Remmel. (2006) Uridine diphosphoglucuronosyltransferase pharmacogenetics and cancer. Oncogene 25:11, 1659-1672
CrossRef203
Nicola F. Smith, William D. Figg, Alex Sparreboom. (2006) Pharmacogenetics of irinotecan metabolism and transport: An update. Toxicology in Vitro 20:2, 163-175
CrossRef204
Floris A. de Jong, Maja J.A. de Jonge, Jaap Verweij, Ron H.J. Mathijssen. (2006) Role of pharmacogenetics in irinotecan therapy. Cancer Letters 234:1, 90-106
CrossRef205
E. G. Shatalova, V. I. Loginov, E. A. Braga, T. P. Kazubskaja, M. A. Sudomoina, R. L. Blanchard, O. O. Favorova. (2006) Association of SULT1A1 and UGT1A1 polymorphisms with breast cancer risk and phenotypes in Russian women. Molecular Biology 40:2, 228-234
CrossRef206
Yoshihiro Maruo, Ali K Topaloglu, Hiroko Takahashi, Asami Mori, Masaru Iwai, Oznur Duzovali, Kazuo Yamamoto, Katsuyuki Matui, Hiroshi Sato, Yoshihiro Takeuchi. (2006) Crigler-Najjar Syndrome Type II Caused by a Homozygous Triple Mutation [T-3279G, A(TA)7TAA, and H39D] of UGT1A1. Journal of Pediatric Gastroenterology and Nutrition 42:2, 236-239
CrossRef207
Esther F.A. Brandon, Tessa M. Bosch, Maarten J. Deenen, Rianne Levink, Everdina van der Wal, Joyce B.M. van Meerveld, Monique Bijl, Jos H. Beijnen, Jan H.M. Schellens, Irma Meijerman. (2006) Validation of in vitro cell models used in drug metabolism and transport studies; genotyping of cytochrome P450, phase II enzymes and drug transporter polymorphisms in the human hepatoma (HepG2), ovarian carcinoma (IGROV-1) and colon carcinoma (CaCo-2, LS180) cell lines. Toxicology and Applied Pharmacology 211:1, 1-10
CrossRef208
Elísio Costa, Emília Vieira, Marcia Martins, Jorge Saraiva, Eugénia Cancela, Miguel Costa, Roswitha Bauerle, Teresa Freitas, João R. Carvalho, Ermelinda Santos-Silva, José Barbot, Rosário dos Santos. (2006) Analysis of the UDP-glucuronosyltransferase gene in Portuguese patients with a clinical diagnosis of Gilbert and Crigler–Najjar syndromes. Blood Cells, Molecules, and Diseases 36:1, 91-97
CrossRef209
Andrew Fretzayas, Sofia Kitsiou, Aspasia Tsezou, Augustina Alexaki, Polyxeni Nicolaidou. (2006) UGT1A1 promoter polymorphism as a predisposing factor of hyperbilirubinaemia in neonates with acute pyelonephritis. Scandinavian Journal of Infectious Diseases 38:6-7, 537-540
CrossRef210
M L Maitland, C Grimsley, H Kuttab-Boulos, D Witonsky, K E Kasza, L Yang, B A Roe, A Di Rienzo. (2006) Comparative genomics analysis of human sequence variation in the UGT1A gene cluster. The Pharmacogenomics Journal 6:1, 52-62
CrossRef211
Ja Young Kim, Mi Yeoun Kim, Ji Sook Kim, Eun Ryoung Kim, Seo Hyun Yoon, Hee Jae Lee, Joo Ho Chung. (2006) 1828G>A polymorphism of the UDP-glucuronosyltransferase gene (UGT1A1) for neonatal hyperbilirubinemia in Koreans. Korean Journal of Pediatrics 49:1, 34
CrossRef212
Elísio Costa. (2006) Hematologically important mutations: Bilirubin UDP-glucuronosyltransferase gene mutations in Gilbert and Crigler–Najjar syndromes. Blood Cells, Molecules, and Diseases 36:1, 77-80
CrossRef213
Maki Ando, Yoshinori Hasegawa, Yuichi Ando. (2005) Pharmacogenetics of irinotecan: A promoter polymorphism of UGT1A1 gene and severe adverse reactions to irinotecan. Investigational New Drugs 23:6, 539-545
CrossRef214
Sharon Marsh. (2005) Pharmacogenetics of colorectal cancer. Expert Opinion on Pharmacotherapy 6:15, 2607-2616
CrossRef215
LIU HUA, DONGPING SHI, PHYLLIS R. BISHOP, JOHN GOSCHE, WARREN L. MAY, MICHAEL J. NOWICKI. (2005) The Role of UGT1A1*28 Mutation in Jaundiced Infants with Hypertrophic Pyloric Stenosis. Pediatric Research 58:5, 881-884
CrossRef216
Myrna Candelaria, Lucia Taja-Chayeb, Claudia Arce-Salinas, Silvia Vidal-Millan, Alberto Serrano-Olvera, Alfonso Due??as-Gonzalez. (2005) Genetic determinants of cancer drug efficacy and toxicity: practical considerations and perspectives. Anti-Cancer Drugs 16:9, 923-933
CrossRef217
Robert S. Foti, Michael B. Fisher. (2005) Assessment of UDP-glucuronosyltransferase catalyzed formation of ethyl glucuronide in human liver microsomes and recombinant UGTs. Forensic Science International 153:2-3, 109-116
CrossRef218
Syma Iqbal, Heinz-Josef Lenz. (2005) Individualized chemotherapy based on genetic and genomic profiling. Current Colorectal Cancer Reports 1:2, 91-102
CrossRef219
A. Adekile, F. Kutlar, K. McKie, A. Addington, D. Elam, L. Holley, B. Clair, A. Kutlar. (2005) The influence of uridine diphosphate glucuronosyl transferase 1A promoter polymorphisms, betaS-globin gene haplotype, co-inherited alpha-thalassemia trait and Hb F on steady-state serum bilirubin levels in sickle cell anemia. European Journal of Haematology 75:2, 150-155
CrossRef220
Hugo Girard, Jean Thibaudeau, Michael H. Court, Louis-Charles Fortier, Lyne Villeneuve, Patrick Caron, Qin Hao, Lisa L. von Moltke, David J. Greenblatt, Chantal Guillemette. (2005) UGT1A1 polymorphisms are important determinants of dietary carcinogen detoxification in the liver. Hepatology 42:2, 448-457
CrossRef221
Lisa Bomgaars, Howard L. McLeod. (2005) Pharmacogenetics and Pediatric Cancer. The Cancer Journal 11:4, 314-323
CrossRef222
Huiling He, Katie Olesnanik, Rebecca Nagy, Sandya Liyanarachchi, Manju L. Prasad, Constantine A. Stratakis, Richard T. Kloos, Albert de la Chapelle. (2005) Allelic Variation in Gene Expression in Thyroid Tissue. Thyroid 15:7, 660-667
CrossRef223
Dita Cebecauerova, Tomas Jirasek, Lucie Budisova, Vaclav Mandys, Vladimir Volf, Zorka Novotna, Iva Subhanova, Martin Hrebicek, Milan Elleder, Milan Jirsa. (2005) Dual Hereditary Jaundice: Simultaneous Occurrence of Mutations Causing Gilbert’s and Dubin-Johnson Syndrome. Gastroenterology 129:1, 315-320
CrossRef224
Michael Kaplan, Cathy Hammerman. (2005) Understanding severe hyperbilirubinemia and preventing kernicterus: Adjuncts in the interpretation of neonatal serum bilirubin. Clinica Chimica Acta 356:1-2, 9-21
CrossRef225
Jacques Robert, Valérie Le Morvan, Denis Smith, Philippe Pourquier, Jacques Bonnet. (2005) Predicting drug response and toxicity based on gene polymorphisms. Critical Reviews in Oncology/Hematology 54:3, 171-196
CrossRef226
Thierry Dervieux, Brian Meshkin, Bruce Neri. (2005) Pharmacogenetic testing: proofs of principle and pharmacoeconomic implications. Mutation Research/Fundamental and Molecular Mechanisms of Mutagenesis 573:1-2, 180-194
CrossRef227
Igino Rigato, J. Donald Ostrow, Claudio Tiribelli. (2005) Bilirubin and the risk of common non-hepatic diseases. Trends in Molecular Medicine 11:6, 277-283
CrossRef228
Ching-Shan Huang. (2005) Molecular genetics of unconjugated hyperbilirubinemia in Taiwanese. Journal of Biomedical Science 12:3, 445-450
CrossRef229
Michael J. Blake, Lisa Castro, J. Steven Leeder, Gregory L. Kearns. (2005) Ontogeny of drug metabolizing enzymes in the neonate. Seminars in Fetal and Neonatal Medicine 10:2, 123-138
CrossRef230
Simrat P. S. Saini, Ying Mu, Haibiao Gong, David Toma, Hirdesh Uppal, Songrong Ren, Song Li, Samuel M. Poloyac, Wen Xie. (2005) Dual role of orphan nuclear receptor pregnane X receptor in bilirubin detoxification in mice. Hepatology 41:3, 497-505
CrossRef231
Michael A. Malfatti, Rebekah W. Wu, James S. Felton. (2005) The effect of UDP-glucuronosyltransferase 1A1 expression on the mutagenicity and metabolism of the cooked-food carcinogen 2-amino-1-methyl-6-phenylimidazo[4,5-b]pyridine in CHO cells. Mutation Research/Fundamental and Molecular Mechanisms of Mutagenesis 570:2, 205-214
CrossRef232
A. Kindberg Boysen, J. S. Madsen, P. E. Jørgensen. (2005) Procalcitonin as a marker of postoperative complications. Scandinavian Journal of Clinical & Laboratory Investigation 65:5, 387-394
CrossRef233
P. Nicolaidou, S. Kostaridou, A. Mavri, A. Galla, S. Kitsiou, A. Stamoulakatou. (2005) GLUCOSE-6-PHOSPHATE DEHYDROGENASE DEFICIENCY AND GILBERT SYNDROME. Pediatric Hematology-Oncology 22:7, 561-566
CrossRef234
Chiyoe Kitagawa, Maki Ando, Yuichi Ando, Yoshitaka Sekido, Kenji Wakai, Kazuyoshi Imaizumi, Kaoru Shimokata, Yoshinori Hasegawa. (2005) Genetic polymorphism in the phenobarbital-responsive enhancer module of the UDP-glucuronosyltransferase 1A1 gene and irinotecan toxicity. Pharmacogenetics and Genomics 15:1, 35-41
CrossRef235
Ashima Madan, James R. MacMahon, David K. Stevenson. 2005. Neonatal Hyperbilirubinemia. , 1226-1256.
CrossRef236
Hiroyuki YAMANAKA, Miki NAKAJIMA, Yusuke HARA, Miki KATOH, Osamu TACHIBANA, Junkoh YAMASHITA, Tsuyoshi YOKOI. (2005) Urinary Excretion of Phenytoin Metabolites, 5-(4′-hydroxyphenyl)-5-Phenylhydantoin and its O-glucuronide in Humans and Analysis of Genetic Polymorphisms of UDP-glucuronosyltransferases. Drug Metabolism and Pharmacokinetics 20:2, 135-143
CrossRef237
Ching-Shan Huang, May-Jen Huang, Min-Shung Lin, Sien-Sing Yang, Hsiu-Chen Teng, Kung-Sheng Tang. (2005) Genetic factors related to unconjugated hyperbilirubinemia amongst adults. Pharmacogenetics and Genomics 15:1, 43-50
CrossRef238
Pavitra Keshavan, Sandy J. Schwemberger, Darcey L.H. Smith, George F. Babcock, Stephen D. Zucker. (2004) Unconjugated bilirubin induces apoptosis in colon cancer cells by triggering mitochondrial depolarization. International Journal of Cancer 112:3, 433-445
CrossRef239
Yoshihiro Maruo, Carlos D′ Addario, Asami Mori, Masaru Iwai, Hiroko Takahashi, Hiroshi Sato, Yoshihiro Takeuchi. (2004) Two linked polymorphic mutations (A(TA)7TAA and T-3279G) of UGT1A1 as the principal cause of Gilbert syndrome. Human Genetics 115:6, 525-526
CrossRef240
MAY-JEN HUANG, KA-EM KUA, HSIU-CHEN TENG, KUNG-SHENG TANG, HUI-WEN WENG, CHING-SHAN HUANG. (2004) Risk Factors for Severe Hyperbilirubinemia in Neonates. Pediatric Research 56:5, 682-689
CrossRef241
Michael Kaplan, Cathy Hammerman. (2004) Glucose-6-phosphate dehydrogenase deficiency: A hidden risk for kernicterus. Seminars in Perinatology 28:5, 356-364
CrossRef242
Stephen D. Zucker, Paul S. Horn, Kenneth E. Sherman. (2004) Serum bilirubin levels in the U.S. population: Gender effect and inverse correlation with colorectal cancer. Hepatology 40:4, 827-835
CrossRef243
Richard Weinshilboum, Liewei Wang. (2004) Pharmacogenomics: bench to bedside. Nature Reviews Drug Discovery 3:9, 739-748
CrossRef244
TOSHINORI KAMISAKO. (2004) What is Gilbert's syndrome? Lesson from genetic polymorphisms of UGT1A1 in Gilbert's syndrome from Asia. Journal of Gastroenterology and Hepatology 19:9, 955-957
CrossRef245
KEISUKE TAKEUCHI, YOSHINAO KOBAYASHI, SHIGENORI TAMAKI, TOMOAKI ISHIHARA, YOSHIHIRO MARUO, JUN ARAKI, RUMI MIFUJI, TOSHIO ITANI, MAKOTO KURODA, HIROSHI SATO, MASAHIKO KAITO, YUKIHIKO ADACHI. (2004) Genetic polymorphisms of bilirubin uridine diphosphate-glucuronosyltransferase gene in Japanese patients with Crigler-Najjar syndrome or Gilbert's syndrome as well as in healthy Japanese subjects. Journal of Gastroenterology and Hepatology 19:9, 1023-1028
CrossRef246
Matthew P Goetz, Axel Grothey. (2004) Developments in combination chemotherapy for colorectal cancer. Expert Review of Anticancer Therapy 4:4, 627-637
CrossRef247
Weizheng W. Wang, Darcey L. H. Smith, Stephen D. Zucker. (2004) Bilirubin inhibits iNOS expression and NO production in response to endotoxin in rats. Hepatology 40:2, 424-433
CrossRef248
Nicola F. Smith, William D. Figg, Alex Sparreboom. (2004) Recent advances in pharmacogenetic approaches to anticancer drug development. Drug Development Research 62:3, 233-253
CrossRef249
E. Quirk, H. McLeod, W. Powderly. (2004) The Pharmacogenetics of Antiretroviral Therapy: A Review of Studies to Date. Clinical Infectious Diseases 39:1, 98-106
CrossRef250
Mariette Verlaan, Ren?? HM te Morsche, Akos Pap, Robert JF Laheij, Jan BMJ Jansen, Wilbert HM Peters, Joost PH Drenth. (2004) Functional polymorphisms of UDP-glucuronosyltransferases 1A1, 1A6 and 1A8 are not involved in chronic pancreatitis. Pharmacogenetics 14:6, 351-357
CrossRef251
Hiroyuki Yamanaka, Miki Nakajima, Miki Katoh, Yusuke Hara, Osamu Tachibana, Junkoh Yamashita, Howard L McLeod, Tsuyoshi Yokoi. (2004) A novel polymorphism in the promoter region of human UGT1A9 gene (UGT1A9*22) and its effects on the transcriptional activity. Pharmacogenetics 14:5, 329-332
CrossRef252
Delores J. Grant, Ingrid J. Hall, David A. Eastmond, Irene M. Jones, Douglas A. Bell. (2004) Bilirubin UDP-glucuronosyltransferase 1A1 (UGT1A1) gene promoter polymorphisms and HPRT, glycophorin A, and micronuclei mutant frequencies in human blood. Mutation Research/Genetic Toxicology and Environmental Mutagenesis 560:1, 1-10
CrossRef253
Stefan Eber, Samuel E Lux. (2004) Hereditary spherocytosis—defects in proteins that connect the membrane skeleton to the lipid bilayer. Seminars in Hematology 41:2, 118-141
CrossRef254
Jean Delaunay. (2004) The hereditary stomatocytoses: genetic disorders of the red cell membrane permeability to monovalent cations. Seminars in Hematology 41:2, 165-172
CrossRef255
M. Mandala, M. Cremonesi, M. Cazzaniga, C. Rezzani, M. Ghilardi, C. Mary, G. Ferretti, S. Barni. (2004) Gilbert's syndrome and fluorouracil toxicity in colorectal cancer patients: which correlation?. Colorectal Disease 6:2, 129-130
CrossRef256
M. P. Goetz, M. M. Ames, R. M. Weinshilboum. (2004) Primer on Medical Genomics Part XII: Pharmacogenomics--General Principles With Cancer as a Model. Mayo Clinic Proceedings 79:3, 376-384
CrossRef257
Swee Lay Thein. (2004) Genetic insights into the clinical diversity of beta thalassaemia. British Journal of Haematology 124:3, 264-274
CrossRef258
Weizheng W. Wang, Stephen D. Zucker. 2004. Bilirubin and Jaundice. , 219-222.
CrossRef259
Shaija Samuel, Lori R. Bernstein. (2004) Adhesion, migration, transcriptional, interferon-inducible, and other signaling molecules newly implicated in cancer susceptibility and resistance of JB6 cells by cDNA microarray analyses. Molecular Carcinogenesis 39:1, 34-60
CrossRef260
Nicole Fabien, Agnès Desbos, Jacques Bienvenu, Jacques Magdalou. (2004) Autoantibodies directed against the UDP-glucuronosyltransferases in human autoimmune hepatitis. Autoimmunity Reviews 3:1, 1-9
CrossRef261
Ulrike Peters, Rashmi Sinha, Douglas A. Bell, Nathaniel Rothman, Delores J. Grant, Mary A. Watson, Martin Kulldorff, Lance R. Brooks, Sarah H. Warren, David M. DeMarini. (2004) Urinary mutagenesis and fried red meat intake: Influence of cooking temperature, phenotype, and genotype of metabolizing enzymes in a controlled feeding study. Environmental and Molecular Mutagenesis 43:1, 53-74
CrossRef262
J??rn L??tsch, Carsten Skarke, J??rgen Liefhold, Gerd Geisslinger. (2004) Genetic Predictors of the Clinical Response to Opioid Analgesics. Clinical Pharmacokinetics 43:14, 983-1013
CrossRef263
Jan Stoehlmacher, Eray Goekkurt, Heinz-Josef Lenz. (2003) Pharmacogenetic aspects in treatment of colorectal cancer – an update. Pharmacogenomics 4:6, 767-777
CrossRef264
Y Maruo, KK-H Poon, M Ito, M Iwai, H Takahashi, A Mori, H Sato, Y Takeuchi. (2003) Co-occurrence of three different mutations in the bilirubin UDP-glucuronosyltransferase gene in a Chinese family with Crigler-Najjar syndrome type I and Gilbert's syndrome. Clinical Genetics 64:5, 420-423
CrossRef265
Carsten Skarke, Helmut Schmidt, Gerd Geisslinger, Jutta Darimont, Jörn Lötsch. (2003) Pharmacokinetics of morphine are not altered in subjects with Gilbert's syndrome. British Journal of Clinical Pharmacology 56:2, 228-231
CrossRef266
K. Y. Fertrin, M. B. Melo, Â. M. Assis, S. T. O. Saad, F. F. Costa. (2003) UDP-glucuronosyltransferase 1 gene promoter polymorphism is associated with increased serum bilirubin levels and cholecystectomy in patients with sickle cell anemia. Clinical Genetics 64:2, 160-162
CrossRef267
Apurva A Desai, Federico Innocenti, Mark J Ratain. (2003) UGT pharmacogenomics. Pharmacogenetics 13:8, 517-523
CrossRef268
Vassiliki Kalotychou, Katerina Antonatou, Revekka Tzanetea, Evaggelos Terpos, Dimitris Loukopoulos, Yannis Rombos. (2003) Analysis of the A(TA)nTAA configuration in the promoter region of the UGT1 A1 gene in Greek patients with thalassemia intermedia and sickle cell disease. Blood Cells, Molecules, and Diseases 31:1, 38-42
CrossRef269
A Premawardhena, C.A Fisher, Y.T Liu, I.C Verma, S de Silva, M Arambepola, J.B Clegg, D.J Weatherall. (2003) The global distribution of length polymorphisms of the promoters of the glucuronosyltransferase 1 gene (UGT1A1): hematologic and evolutionary implications. Blood Cells, Molecules, and Diseases 31:1, 98-101
CrossRef270
Raymond C Givens, Paul B Watkins. (2003) Pharmacogenetics and clinical gastroenterology. Gastroenterology 125:1, 240-248
CrossRef271
F Ebbesen, BB Mortensen. (2003) Difference in plasma bilirubin concentration between monozygotic and dizygotic newborn twins. Acta Paediatrica 92:5, 569-573
CrossRef272
Jing-Ping Lin, L. Adrienne Cupples, Peter W. F. Wilson, Nancy Heard-Costa, Christopher J. O’Donnell. (2003) Evidence for a Gene Influencing Serum Bilirubin on Chromosome 2q Telomere: A Genomewide Scan in the Framingham Study. The American Journal of Human Genetics 72:4, 1029-1034
CrossRef273
Nikhil K Basu, Labanyamoy Kole, Ida S Owens. (2003) Evidence for phosphorylation requirement for human bilirubin UDP-glucuronosyltransferase (UGT1A1) activity. Biochemical and Biophysical Research Communications 303:1, 98-104
CrossRef274
Guttmacher, Alan E., Collins, Francis S., , Weinshilboum, Richard, . (2003) Inheritance and Drug Response. New England Journal of Medicine 348:6, 529-537
Full Text275
R Pometta, A Colucci M. Fraquelli, A Losco, D Conte. (2003) A puzzling jaundice. Digestive and Liver Disease 35:2, 114-117
CrossRef276
R. Nagasubramanian, F. Innocenti, M. J. Ratain. (2003) Pharmacogenetics in Cancer Treatment. Annual Review of Medicine 54:1, 437-452
CrossRef277
Suoping Zhai, Edward A. Sausville, Adrian M. Senderowicz, Yuichi Ando, Donna Headlee, Richard A. Messmann, Susan Arbuck, Anthony J. Murgo, Giovanni Melillo, Eiichi Fuse, William D. Figg. (2003) Clinical pharmacology and pharmacogenetics of flavopiridol 1-h i.v. infusion in patients with refractory neoplasms. Anti-Cancer Drugs 14:2, 125-135
CrossRef278
Christopher A. Haiman, Susan E. Hankinson, Immaculata De Vivo, Chantal Guillemette, Naoko Ishibe, David J. Hunter, Celia Byrne. (2003) Polymorphisms in Steroid Hormone Pathway Genes and Mammographic Density. Breast Cancer Research and Treatment 77:1, 27-36
CrossRef279
Brian Burchell. (2003) Genetic Variation of Human UDP-Glucuronosyltransferase. American Journal of PharmacoGenomics 3:1, 37-52
CrossRef280
Jan Stoehlmacher, Heinz-Josef Lenz. (2003) Implications of Genetic Testing in the Management of Colorectal Cancer. American Journal of PharmacoGenomics 3:2, 73-88
CrossRef281
John O Miners, Ross A McKinnon, Peter I Mackenzie. (2002) Genetic polymorphisms of UDP-glucuronosyltransferases and their functional significance. Toxicology 181-182, 453-456
CrossRef282
Federico Innocenti, Carrie Grimsley, Soma Das, Jacqueline Ramirez, Cheng Cheng, Hala Kuttab-Boulos, Mark Ratain, Anna Di Rienzo. (2002) Pharmacogenetics 12:9, 725-733
CrossRef283
Philippe Labrune, Anne Myara, Jacqueline Chalas, B
CrossRef284
May-Jen Huang, Yi-Chu Yang, Sien-Sing Yang, Min-Shung Lin, En-Sung Chen, Ching-Shan Huang. (2002) Coinheritance of variant UDP-glucuronosyl transferase 1A1 gene and glucose-6-phosphate dehydrogenase deficiency in adults with hyperbilirubinemia. Pharmacogenetics 12:8, 663-666
CrossRef285
Michael M. Shi, Michael R. Bleavins. 2002. Pharmacogenetics. .
CrossRef286
Jeanne Francoual, Pascale Trioche, Chahnez Mokrani, Hassen Seboui, Na
CrossRef287
CHING-SHAN HUANG, PI-FENG CHANG, MAY-JEN HUANG, EN-SUNG CHEN, KUN-LONG HUNG, AND, KUO-INN TSOU. (2002) Relationship Between Bilirubin UDP-Glucuronosyl Transferase 1A1 Gene and Neonatal Hyperbilirubinemia. Pediatric Research 52:4, 601-605
CrossRef288
Peter J Piliero. (2002) Atazanavir: a novel HIV-1 protease inhibitor. Expert Opinion on Investigational Drugs 11:9, 1295-1301
CrossRef289
Thomas Seufferlein, Bernhard O Boehm. (2002) The impact of pharmacogenomics on gastrointestinal cancer therapy. Pharmacogenomics 3:5, 625-633
CrossRef290
Shigeki Shibahara, Tomomi Kitamuro, Kazuhiro Takahashi. (2002) Heme Degradation and Human Disease: Diversity Is the Soul of Life. Antioxidants & Redox Signaling 4:4, 593-602
CrossRef291
Retno Sutomo, Vichai Laosombat, Ahmad Hamim Sadewa, Naoki Yokoyama, Hajime Nakamura, Masafumi Matsuo, Hisahide Nishio. (2002) Novel missense mutation of the UGT1A1 gene in Thai siblings with Gilbert's syndrome. Pediatrics International 44:4, 427-432
CrossRef292
Jeanne Francoual, Armelle Rivierre, Chahnez Mokrani, Na
CrossRef293
N. Laforgia, M. F. Faienza, A. Rinaldi, G. D'Amato, G. Rinaldi, A. Iolascon. (2002) Neonatal hyperbilirubinemia and Gilbert's syndrome. Journal of Perinatal Medicine 30:2, 166-169
CrossRef294
Swee Lay Thein. (2002) β-Thalassaemia prototype of a single gene disorder with multiple phenotypes. International Journal of Hematology 76:S2, 96-104
CrossRef295
K.Y. Fertrin, M.S. Gon
CrossRef296
Junko Sugatani, Kasumi Yamakawa, Kouich Yoshinari, Takashi Machida, Hitoshi Takagi, Masatomo Mori, Satoru Kakizaki, Tatsuya Sueyoshi, Masahiko Negishi, Masao Miwa. (2002) Identification of a Defect in the UGT1A1 Gene Promoter and Its Association with Hyperbilirubinemia. Biochemical and Biophysical Research Communications 292:2, 492-497
CrossRef297
Yuichi Ando, Hiroshi Ueoka, Toru Sugiyama, Masao Ichiki, Kaoru Shimokata, Yoshinori Hasegawa. (2002) Polymorphisms of UDP-Glucuronosyltransferase and Pharmacokinetics of Irinotecan. Therapeutic Drug Monitoring 24:1, 111-116
CrossRef298
Baljit S. Sappal, Siddhartha S. Ghosh, Benjamin Shneider, Ajit Kadakol, Jayanta Roy Chowdhury, Namita Roy Chowdhury. (2002) A Novel Intronic Mutation Results in the Use of a Cryptic Splice Acceptor Site within the Coding Region of UGT1A1, Causing Crigler-Najjar Syndrome Type 1. Molecular Genetics and Metabolism 75:2, 134-142
CrossRef299
Libor Vı́tek, Milan Jirsa, Marie Brodanová, Milan Kaláb, Zdeněk Mareček, Vilém Danzig, Ladislav Novotný, Petr Kotal. (2002) Gilbert syndrome and ischemic heart disease: a protective effect of elevated bilirubin levels. Atherosclerosis 160:2, 449-456
CrossRef300
Piter Bosma. 2002. Bilirubin Glucuronosyltransferase. .
CrossRef301
N Roy-Chowdhury, B Deocharan, HR Bejjanki, J Roy-Chowdhury, C Koliopoulos, S Petmezaki, T Valaes. (2002) Presence of the genetic marker for Gilbert syndrome is associated with increased level and duration of neonatal jaundice. Acta Paediatrica 91:1, 100-102
CrossRef302
Bernard Agbemadzo, Prasad Rao Koduri. (2002) Co-inheritance of Gilbert's syndrome and sickle cell anemia. American Journal of Hematology 69:1, 86-87
CrossRef303
Eliakym Arámbula, Gerardo Vaca. (2002) Genotyping by “Cold Single-Strand Conformation Polymorphism” of the UGT1A1 Promoter Polymorphism in Mexican Mestizos. Blood Cells, Molecules, and Diseases 28:1, 86-90
CrossRef304
R. Galanello, S. Piras, S. Barella, G. B. Leoni, M. D. Cipollina, L. Perseu, A. Cao. (2001) Cholelithiasis and Gilbert's syndrome in homozygous beta-thalassaemia. British Journal of Haematology 115:4, 926-928
CrossRef305
Rebecca G. Passon, Thad A. Howard, Sherri A. Zimmerman, William H. Schultz, Russell E. Ware. (2001) Influence of Bilirubin Uridine Diphosphate– Glucuronosyltransferase 1A Promoter Polymorphisms on Serum Bilirubin Levels and Cholelithiasis in Children With Sickle Cell Anemia. Journal of Pediatric Hematology/Oncology 23:7, 448-451
CrossRef306
Ching-Shan Huang, Guo-An Luo, May-Jen Huang, En-Sung Chen, Ton-Ho Young, You-Chen Chao. (2001) A novel compound heterozygous variation of the uridine-diphosphoglucuronosyl transferase 1A 1 gene that causes Crigler???Najjar syndrome type II. Pharmacogenetics 11:7, 639-642
CrossRef307
Michael Kaplan, Cathy Hammerman, Paul Renbaum, Ephrat Levy-Lahad, Hendrik J. Vreman, David K. Stevenson. (2001) Differing Pathogenesis of Perinatal Bilirubinemia in Glucose-6-Phosphate Dehydrogenase-Deficient Versus-Normal Neonates. Pediatric Research 50:4, 532-537
CrossRef308
Petra L. M. Zusterzeel, Rene Morsche, Maarten T. M. Raijmakers, Wilbert H. M. Peters, Eric A. P. Steegers. (2001) Gilbert's syndrome is not associated with HELLP syndrome. BJOG: An International Journal of Obstetrics and Gynaecology 108:9, 1003-1004
CrossRef309
A Premawardhena, CA Fisher, F Fathiu, S de Silva, W Perera, TEA Peto, NF Olivieri, DJ Weatherall. (2001) Genetic determinants of jaundice and gallstones in haemoglobin E β thalassaemia. The Lancet 357:9272, 1945-1946
CrossRef310
Tomoaki Ishihara, Masahiko Kaito, Keisuke Takeuchi, Esteban C Gabazza, Yuji Tanaka, Kunihiro Higuchi, Jiro Ikoma, Shozo Watanabe, Hiroshi Sato, Yukihiko Adachi. (2001) Role of UGT1A1 mutation in fasting hyperbilirubinemia. Journal of Gastroenterology and Hepatology 16:6, 678-682
CrossRef311
Pauline L. Lee, Carol Halloran, Ernest Beutler. (2001) Polymorphisms in the Transferrin 5′ Flanking Region Associated with Differences in Total Iron Binding Capacity: Possible Implications in Iron Homeostasis. Blood Cells, Molecules, and Diseases 27:2, 539-548
CrossRef312
Syma Iqbal, Heinz-Josef Lenz. (2001) Determinants of prognosis and response to therapy in colorectal cancer. Current Oncology Reports 3:2, 102-108
CrossRef313
Franck Bourdeaut, Liliana Matei, Philippe Labrune, J. Francoual, Daniel Orbach, Fran
CrossRef314
Wood, Alastair J.J., , Dennery, Phyllis A., Seidman, Daniel S., Stevenson, David K., . (2001) Neonatal Hyperbilirubinemia. New England Journal of Medicine 344:8, 581-590
Full Text315
Steven C Hunt, Florian Kronenberg, John H Eckfeldt, Paul N Hopkins, Richard H Myers, Gerardo Heiss. (2001) Association of plasma bilirubin with coronary heart disease and segregation of bilirubin as a major gene trait: the NHLBI family heart study. Atherosclerosis 154:3, 747-754
CrossRef316
Yoshihiro Maruo, Hiroshi Sato, Noriko Bamba, Masaru Iwai, Hiroko Sawa, Hidetoshi Fujino, Takashi Taga, Shigeru Ota, Morimi Shimada. (2001) Chemotherapy-induced Unconjugated Hyperbilirubinemia Caused by a Mutation of the Bilirubin Uridine-5??-Diphosphate-Glucuronosyltransferase Gene. Journal of Pediatric Hematology/Oncology 23:1, 45-47
CrossRef317
Delores J. Grant, Douglas A. Bell. (2000) Bilirubin UDP-glucuronosyltransferase1A1 gene polymorphisms: Susceptibility to oxidative damage and cancer?. Molecular Carcinogenesis 29:4, 198-204
CrossRef318
Joseph K. Ritter. (2000) Roles of glucuronidation and UDP-glucuronosyltransferases in xenobiotic bioactivation reactions. Chemico-Biological Interactions 129:1-2, 171-193
CrossRef319
Federico Innocenti, Lalitha Iyer, Mark J. Ratain. (2000) Pharmacogenetics. Clinical Pharmacokinetics 39:5, 315-325
CrossRef320
Ajit Kadakol, Siddhartha S. Ghosh, Baljit S. Sappal, Girish Sharma, Jayanta Roy Chowdhury, Namita Roy Chowdhury. (2000) Genetic lesions of bilirubin uridine-diphosphoglucuronate glucuronosyltransferase (UGT1A1) causing Crigler-Najjar and Gilbert syndromes: Correlation of genotype to phenotype. Human Mutation 16:4, 297-306
CrossRef321
Peter I. Mackenzie, John O. Miners, Ross A. McKinnon. (2000) Polymorphisms in UDP Glucuronosyltransferase Genes: Functional Consequences and Clinical Relevance. Clinical Chemistry and Laboratory Medicine 38:9, 889-892
CrossRef322
Pietro Vajro, Anna DeVincenzo, Stefania Lucariello, Fiorella Migliaro, Etienne Sokal, Olivier Bernard, Teresa Vilei, Maurizio Muraca. (2000) Unusual Early Presentation of Gilbert Syndrome in Pediatric Recipients of Liver Transplantation. Journal of Pediatric Gastroenterology and Nutrition 31:3, 238-243
CrossRef323
Michael Kaplan, Cathy Hammerman, Paul Renbaum, Gaya Klein, Ephrat Levy-Lahad. (2000) Gilbert's syndrome and hyperbilirubinaemia in ABO-incompatible neonates. The Lancet 356:9230, 652-653
CrossRef324
Ching-Shan Huang, Guo-An Luo, May-Jen Huang, Shu-Chuan Yu, Sien-Sing Yang. (2000) Variations of the bilirubin uridine-diphosphoglucuronosyl transferase 1A1 gene in healthy Taiwanese. Pharmacogenetics 10:6, 539-544
CrossRef325
Karin Dilger, Peter Meisel, Ute Hofmann, Michel Eichelbaum. (2000) Disposition of Propafenone in a Poor Metabolizer of CYP2D6 With Gilbert's Syndrome. Therapeutic Drug Monitoring 22:3, 366-368
CrossRef326
Helen S. Te, Thomas D. Schiano, Soma Das, Shih Fan Kuan, Kathleen DasGupta, Hari S. Conjeevaram, Alfred L. Baker. (2000) DONOR LIVER URIDINE DIPHOSPHATE (UDP)-GLUCURONOSYLTRANSFERASE-1A1 DEFICIENCY CAUSING GILBERT???S SYNDROME IN LIVER TRANSPLANT RECIPIENTS12. Transplantation 69:9, 1882-1886
CrossRef327
Robert H. Tukey, Christian P. Strassburg. (2000) Human UDP-Glucuronosyltransferases: Metabolism, Expression, and Disease. Annual Review of Pharmacology and Toxicology 40:1, 581-616
CrossRef328
Brian Burchell, Matt Soars, Gemma Monaghan, Andy Cassidy, Debbie Smith, Brian Ethell. (2000) Drug-mediated toxicity caused by genetic deficiency of UDP-glucuronosyltransferases. Toxicology Letters 112-113, 333-340
CrossRef329
Wickramasinghe, Thein, Srichairatanakool, Porter. (1999) Determinants of iron status and bilirubin levels in congenital dyserythropoietic anaemia type I. British Journal of Haematology 107:3, 522-525
CrossRef330
J Delaunay, A Iolascon. (1999) The congenital dyserythropoietic anaemias. Best Practice & Research Clinical Haematology 12:4, 691-705
CrossRef331
W Hardikar. (1999) Genes for jaundice. Journal of Paediatrics and Child Health 35:6, 522-524
CrossRef332
Yukihiko Adachi, Esteban C. Gabazza, Tomoaki Ishihara. (1999) Reply. Gastroenterology 117:5, 1255-1256
CrossRef333
Volker Gürtler, John D. Parkin, Barrie C. Mayall. (1999) Use of double gradient denaturing gradient gel electrophoresis to detect (AT)n polymorphisms in the UDP-glucuronosyltransferase 1 gene promoter associated with Gilbert's syndrome. Electrophoresis 20:14, 2841-2843
CrossRef334
B Burchell, R Hume. (1999) Molecular genetic basis of Gilbert's syndrome. Journal of Gastroenterology and Hepatology 14:10, 960-966
CrossRef335
Joseph K. Ritter, Fay K. Kessler, Melissa T. Thompson, Andrew D. Grove, Diana J. Auyeung, Robert A. Fisher. (1999) Expression and inducibility of the human bilirubin UDP-glucuronosyltransferase UGT1A1 in liver and cultured primary hepatocytes: Evidence for both genetic and environmental influences. Hepatology 30:2, 476-484
CrossRef336
Achille Iolascon, Maria Felicia Faienza, Lucia Giordani, Silverio Perrαtta, Giuseppina Ruggiu, Gian Franco Meloni, Emanuele Miraglia Giudice. (1999) Bilirubin levels in the acute hemolytic crisis of G6PD deficiency are related to Gilbert's syndrome. European Journal of Haematology 62:5, 307-310
CrossRef337
Maria Domenica, cappellini, Franco Martinez, di Montemuros, Maurizio Sampietro, Dario Tavazzi, Gemino Fiorelli. (1999) The interaction between Gilbert's syndrome and G6PD deficiency influences bilirubin levels. British Journal of Haematology 104:4, 928-929
CrossRef338
A. Esteban, M. Pérez-Mateo. (1999) Heterogeneity of paracetamol metabolism in Gilbert’s syndrome. European Journal of Drug Metabolism and Pharmacokinetics 24:1, 9-13
CrossRef339
M Hirano. (1999) A novel missense mutant inactivates GTP cyclohydrolase I in dopa-responsive dystonia. Neuroscience Letters 260:3, 181-184
CrossRef340
T IYANAGI, Y EMI, S IKUSHIRO. (1998) Biochemical and molecular aspects of genetic disorders of bilirubin metabolism. Biochimica et Biophysica Acta (BBA) - Molecular Basis of Disease 1407:3, 173-184
CrossRef341
Makito Hirano, Takehiko Yanagihara, Satoshi Ueno. (1998) Dominant negative effect of GTP cyclohydrolase I mutations in dopa-responsive hereditary progressive dystonia. Annals of Neurology 44:3, 365-371
CrossRef342
Lalitha Iyer, Mark J. Ratain. (1998) Clinical pharmacology of camptothecins. Cancer Chemotherapy and Pharmacology 42:S1, S31-S43
CrossRef343
Irwin M Arias. (1998) New genetics of inheritable jaundice and cholestatic liver disease. The Lancet 352:9122, 82-83
CrossRef344
Fox, Ira J., Chowdhury, Jayanta Roy, Kaufman, Stuart S., Goertzen, Timothy C., Chowdhury, Namita Roy, Warkentin, Phyllis I., Dorko, Kenneth, Sauter, Bernhard V., Strom, Stephen C., . (1998) Treatment of the Crigler–Najjar Syndrome Type I with Hepatocyte Transplantation. New England Journal of Medicine 338:20, 1422-1427
Full Text345
Martín G. Martín. (1998) The Biology of Inherited Disorders of the Gastrointestinal Tract Part II: Pancreatic and Hepatobiliary Disorders. Journal of Pediatric Gastroenterology & Nutrition 26:4, 437-445
CrossRef346
Robyn Meech, Peter I. Mackenzie. (1997) STRUCTURE AND FUNCTION OF URIDINE DIPHOSPHATE GLUCURONOSYLTRANSFERASES. Clinical and Experimental Pharmacology and Physiology 24:12, 907-915
CrossRef347
Douglas J. Clarke, Nabil Moghrabi, Gemma Monaghan, Andrew Cassidy, Maureen Boxer, Robert Hume, Brian Burchell. (1997) Genetic defects of the UDP-glucuronosyltransferase-1 (UGT1) gene that cause familial non-haemolytic unconjugated hyperbilirubinaemias. Clinica Chimica Acta 266:1, 63-74
CrossRef348
J. L. Naiman, E. J. Sugasawara, S. L. Benkosky, E. A. Mailhot. (1996) Icteric plasma suggests Gilbert's syndrome in the blood donor. Transfusion 36:11-12, 974-978
CrossRef349
Mia Wadelius, Torbjörn Karlsson, Claes Wadelius, Anders Rane. (1996) Lamotrigine and toxic epidermal necrolysis. The Lancet 348:9033, 1041
CrossRef350
(1996) The Genetic Basis of Gilbert's Syndrome. New England Journal of Medicine 334:12, 802-803
Full Text351
Hiroshi Sato, Yukihiko Adachi, Osamu Koiwai. (1996) The genetic basis of Gilbert's syndrome. The Lancet 347:9001, 557-558
CrossRef352
G Monaghan, M Ryan, R Hume, B Burchell, R Seddon. (1996) Genetic variation in bilirubin UDP-glucuronosyltransferase gene promoter and Gilbert's syndrome. The Lancet 347:9001, 578-581
CrossRef353
Schmid, Rudi, . (1995) Gilbert's Syndrome — A Legitimate Genetic Anomaly?. New England Journal of Medicine 333:18, 1217-1218
Full Text
- Letters
