Original Article
Brief Report
A Familial Syndrome of Pancreatic Cancer and Melanoma with a Mutation in the CDKN2 Tumor-Suppressor Gene
N Engl J Med 1995; 333:975-977October 12, 1995
- Article
The distinguishing characteristics of familial cancer syndromes are an inherited predisposition to one or more characteristic types of tumors, early age at onset, and multiple synchronous or asynchronous tumors. Recently, the genes responsible for a number of inherited cancers have been identified.1-5
We describe a kindred with an increased risk of pancreatic cancers, melanomas, and possibly additional types of tumors. We provide strong evidence linking the predisposition to cancer in this kindred to an inherited mutation in the cyclin-dependent–kinase inhibitor 2 (CDKN2) tumor-suppressor gene. The results of our study of this family suggest that disruption of the function of CDKN2 contributes to pancreatic tumorigenesis.
Case Reports
Squamous-cell carcinoma of the tongue developed in a 34-year-old woman (the proband). She did not drink alcohol or use tobacco. She was referred for genetic evaluation because of the early age of onset in the absence of known risk factors and a strong family history of pancreatic carcinoma. A detailed family history revealed that two other family members had also had malignant melanomas. The proband's mother (Subject III-3) had died of metastatic pancreatic carcinoma at the age of 57 (Figure 1Figure 1
Pedigree of a Kindred with Pancreatic Cancer and Melanoma.). Pathological examination of the tumor revealed squamous-cell carcinoma, a rare form of pancreatic carcinoma that accounts for approximately 2 percent of all such carcinomas.6 The proband's maternal aunt (Subject III-2) died of metastatic adenocarcinoma of the pancreas at the age of 45. The proband's maternal uncle (Subject III-1) died of metastatic melanoma at the age of 32. Her maternal grandmother (Subject II-2), who had localized spread of melanoma at the age of 70, died of metastatic adenocarcinoma of the pancreas at the age of 73. An experienced pathologist confirmed the diagnosis of pancreatic cancer in these three family members by reviewing representative slides. The proband's father and sisters are healthy.Examination of the pedigree raised the question whether the pancreatic cancer and the melanoma were clinical expressions of a familial cancer syndrome. The unusual finding of a squamous-cell carcinoma of the pancreas in one family member and the early onset of the squamous-cell carcinoma of the tongue in the proband were also consonant with a familial cancer syndrome. A likely candidate gene in this family was CDKN2, which encodes p16. This protein inhibits cyclin-dependent kinase 4, thereby regulating the cell cycle.7
Methods
Preparation of Genomic DNA and Characterization of CDKN2 Sequences
DNA was prepared from formalin-fixed, paraffin-embedded specimens of tumor tissue8 from Subjects II-2, III-2, and III-3 (Figure 1). The only tissue available from Subject II-2 was a transduodenal needle-biopsy specimen of a poorly differentiated pancreatic adenocarcinoma, for which the neoplastic cellularity was estimated as being 40 percent. In the case of Subject III-2, two needle-biopsy specimens of the moderately differentiated pancreatic adenocarcinoma were available. The neoplastic cellularity of the tumor was estimated at only 5 percent in one of the specimens and at 50 percent in the other. The biopsy specimen from Subject III-3 was determined to contain approximately 30 percent neoplastic cells. The DNA prepared from the archival tumor-tissue specimens represented a mixture of normal cellular (constitutional) DNA and cancer-cell DNA. On the basis of the neoplastic-cell content of each of the specimens, the constitutional DNA made up an estimated 60 percent of the specimen from Subject II-2, 95 percent of one of the specimens from Subject III-2, and 70 percent of the specimen from Subject III-3. Thus, there was sufficient constitutional DNA in the tissue specimens to allow us to examine the germ-line CDKN2 gene in the family members. The low neoplastic cellularity of the available tumor-tissue specimens made studies of the loss of heterozygosity and the search for tumor-specific mutations of CDKN2 impractical. No tissue samples were available from Subject I-1, I-2, or III-1. Subject II-1 chose not to participate in the study. DNA was extracted from peripheral-blood samples from Subjects III-4, IV-1, IV-2, and IV-3.9
DNA from family members was evaluated for alterations in CDKN2 by single-strand conformational-variant (SSCV) and DNA-sequence analysis. The primers and conditions used for SSCV analysis were as described previously,10,11 with the following modification. For amplicon B of exon 2, new primers were devised to improve the reliability of the polymerase-chain-reaction (PCR) assay. The forward primer was 5'AACTGCGCCGACCCCGCCACT3', and the reverse primer was 5'TCAGCCAGGTCCACGGGCAGA3'. Variant bands were excised from dried SSCV gels, reamplified, and sequenced directly.11 Sequencing was performed on both DNA strands (sense and antisense), and all reactions were repeated at least twice. For all family members investigated, DNA sequencing was performed for amplicon B of exon 2.
DNA-Marker Genotyping Studies
The (CA)n microsatellite-repeat markers at D9S157 and D9S171 flanking the CDKN2 locus were typed for all members of the kindred as described previously.11
Results
An SSCV variant was identified in exon 2 (amplicon B) of the CDKN2 gene in the constitutional DNA of the proband (Subject IV-1). Direct sequencing of the variant revealed a G→T nucleotide change at position 295, resulting in the substitution of a tryptophan residue for glycine at amino acid position 93 (Gly93Trp) (Figure 2Figure 2
Sequence of CDKN2 in the Constitutional DNA of the Proband.). Sequence analysis of the PCR-amplified CDKN2 gene from three additional family members (Subjects II-2, III-2, and III-3), all of whom had died of pancreatic cancer, showed that they too had the Gly93Trp mutation. In each case, the Gly93Trp mutation was present along with the wild-type (normal) CDKN2 sequence. The proband's unaffected father and two siblings did not carry the CDKN2 mutation. Analysis of the pattern of inheritance of the polymorphic DNA markers D9S171 and D9S157 that are linked to CDKN2 demonstrated that within the kindred the CDKN2 mutation was associated with a single DNA haplotype. All the affected family members shared both the Gly93Trp mutation and specific alleles at D9S171 and D9S157, whereas unaffected family members had neither the CDKN2 mutation nor the pattern of polymorphism at D9S171 and D9S157 that cosegregated with disease (data not shown).Discussion
We studied a family in which a CDKN2 mutation cosegregated with several types of cancer. Several lines of evidence suggest that the CDKN2 mutation is present in the constitutional DNA of all the affected family members. the same Gly93Trp mutation was identified in all affected family members. In each case the mutation coexisted with the normal gene sequence, and the mutation was linked to a specific DNA-marker haplotype common to the affected family members. We believe that the clustering of cancers in this family represents a previously unrecognized familial cancer syndrome that includes pancreatic cancer (perhaps with an increased incidence of squamous-cell pancreatic carcinoma), melanoma, and squamous-cell carcinoma of the oropharynx. Lynch and colleagues12 described a single case of pancreatic cancer among the members of five families with malignant melanoma. It is likely that as additional kindreds are identified, the spectrum of associated tumors will change, and more accurate estimates of the lifetime risk of cancer in these families will be possible. Our results emphasize the importance of obtaining careful family histories, particularly for patients who present with multiple cancers or cancer at an early age.
The cosegregation of a CDKN2 mutation with cancer in this family is further evidence of the role of CDKN2 in tumorigenesis, particularly in melanoma and pancreatic carcinoma. The Gly93Trp mutation has previously been associated with an increased risk of cancer. The mutation was identified in the constitutional DNA of affected members of three kindreds with familial melanoma.10,13 The Gly93Trp variant was also present in 11 family members with melanomas and in 2 with dysplastic nevi. It was not found in 160 unaffected normal subjects, a result that supports the postulate that the Gly93Trp variant is a disease-associated mutation rather than a benign polymorphism. More recently, the Gly93Trp mutation was shown to result in a functionally defective protein that has an impaired ability to inhibit the catalytic activity of complexes of cyclin D1–cyclin-dependent kinase 4 and cyclin D1–cyclin-dependent kinase 6 in vitro.14
Limited studies of CDKN2 in pancreatic cancer suggest that the gene also has a role in the pathogenesis of that cancer. In a study of pancreatic adenocarcinoma cell lines and xenografts, CDKN2 mutations were identified in 79 percent.15 Recently, somatic mutations of CDKN2 were found in 37 percent of patients with primary pancreatic adenocarcinomas.11 Families with a high frequency of pancreatic carcinoma have been described,16-18 but we are not aware of any other report of a germ-line mutation in such families.
The occurrence of a rare squamous-cell carcinoma of the pancreas in this family and of the squamous-cell carcinoma of the tongue in the proband is intriguing. The frequency of CDKN2 mutations in a variety of sporadic squamous-cell tumors has varied. A small proportion of head and neck tumors have mutations,19 whereas CDKN2 mutations were identified in 51 percent of primary esophageal squamous-cell carcinomas.20 Functional studies of native and mutated forms of the p16 protein point to its participation in arresting the G1 phase of the cell cycle.21,22 This function, together with frequent mutations of the CDKN2 gene in cancer, suggests the importance of CDKN2 as a tumor-suppressor gene.
Supported in part by a grant (Ba 1467/1-1) from the Deutsche Forschungsgemeinschaft (to Dr. Bartsch).
We are indebted to the members of the family described in this report for their willingness to participate in these studies and to Doug-las Shevlin, M.D., for his review of the pathological specimens.
Source Information
From the Departments of Medicine and Pediatrics (A.J.W.) and Surgery (D.B., P.J.G.), Washington University School of Medicine, St. Louis, and the Department of Surgery, Philipps University, Marburg, Germany (D.B.).
Address reprint requests to Dr. Goodfellow at Box 8109, 660 S. Euclid, St. Louis, MO 63110.
- References
References
1
Malkin D ,Li FP ,Strong LC , et al. Germ line p53 mutations in a familial syndrome of breast cancer, sarcomas, and other neoplasms. Science 1990;250:1233-1238
CrossRef | Web of Science | Medline2
Kinzler KW ,Nilbert MC ,Su L-K , et al. Identification of FAP locus genes from chromosome 5q21. Science 1991;253:661-665
CrossRef | Web of Science | Medline3
Latif F ,Tory K ,Gnarra J , et al. Identification of the von Hippel-Lindau disease tumor suppressor gene. Science 1993;260:1317-1320
CrossRef | Web of Science | Medline4
Mulligan LM ,Kwok JBJ ,Healey CS , et al. Germ-line mutations of the RET proto-oncogene in multiple endocrine neoplasia type 2A. Nature 1993;363:458-460
CrossRef | Web of Science | Medline5
Miki Y ,Swensen J ,Shattuck-Eidens D , et al. A strong candidate for the breast and ovarian cancer susceptibility gene BRCA1. Science 1994;266:66-71
CrossRef | Web of Science | Medline6
Cubilla AL ,Fitzgerald PJ . Classification of pancreatic cancer (nonendocrine). Mayo Clin Proc 1979;54:449-458
Web of Science | Medline7
Kamb A ,Gruis NA ,Weaver-Feldhaus J , et al. A cell cycle regulator potentially involved in genesis of many tumor types. Science 1994;264:436-440
CrossRef | Web of Science | Medline8
Wright DK, Manos MM. Sample preparation from paraffin-embedded tissues. In: Innis MA, Gelfand DH, Sninsky JJ, White TJ, eds. PCR protocols: a guide to methods and applications. San Diego, Calif.: Academic Press, 1990:153-8.
9
Miller SA ,Dykes DD ,Polesky HF . A simple salting out procedure for extracting DNA from human nucleated cells. Nucleic Acids Res 1988;16:1215-1215
CrossRef | Web of Science | Medline10
Hussussian CJ ,Struewing JP ,Goldstein AM , et al. Germline p16 mutations in familial melanoma. Nat Genet 1994;8:15-21
CrossRef | Web of Science | Medline11
Bartsch D, Shevlin DW, Tung WS, Kisker O, Wells SA Jr, Goodfellow PJ. Frequent mutations in primary pancreatic adenocarcinomas. Genes Chromosom Cancer (in press).
12
Lynch HT ,Frichot BC ,Lynch P ,Lynch J ,Gurigis HA . Family studies of malignant melanoma and associated cancer. Surg Gynecol Obstet 1975;141:517-522
Web of Science | Medline13
Kamb A ,Shattuck-Eidens D ,Eeles R , et al. Analysis of the p16 gene (CDKN2) as a candidate for the chromosome 9p melanoma susceptibility locus. Nat Genet 1994;8:23-26
CrossRef | Web of Science | Medline14
Ranade K ,Hussussian CJ ,Sikorski RS , et al. Mutations associated with familial melanoma impair p16INK4 function. Nat Genet 1995;10:114-116
CrossRef | Web of Science | Medline15
Caldas C ,Hahn SA ,da Costa LT , et al. Frequent somatic mutations and homozygous deletions of the p16 (MTS1) gene in pancreatic adenocarcinoma. Nat Genet 1994;8:27-32[Erratum, Nat Genet 1994;8:410.]
CrossRef | Web of Science | Medline16
Friedman JM ,Fialkow PJ . Familial carcinoma of the pancreas. Clin Genet 1976;9:463-469
CrossRef | Web of Science | Medline17
Reimer RR ,Fraumeni JF Jr ,Ozols RF ,Bender R . Pancreatic cancer in father and son. Lancet 1977;1:911-911
CrossRef | Web of Science | Medline18
Ehrenthal D ,Haeger L ,Griffin T ,Compton C . Familial pancreatic adenocarcinoma in three generations: a case report and a review of the literature. Cancer 1987;59:1661-1664
CrossRef | Web of Science | Medline19
Zhang SY ,Klein-Szanto AJ ,Sauter ER , et al. Higher frequency of alterations in the p16/CDKN2 gene in squamous cell carcinoma cell lines than in primary tumors of the head and neck. Cancer Res 1994;54:5050-5053
Web of Science | Medline20
Mori T ,Miura K ,Aoki T ,Nishihira T ,Mori S ,Nakamura Y . Frequent somatic mutation of the MTS1/CDK4I (multiple tumor suppressor/cyclin-dependent kinase 4 inhibitor) gene in esophageal squamous cell carcinoma. Cancer Res 1994;54:3396-3397
Web of Science | Medline21
Lukas J ,Parry D ,Aagaard L , et al. Retinoblastoma-protein-dependent cell-cycle inhibition by the tumour suppressor p16. Nature 1995;375:503-506
CrossRef | Web of Science | Medline22
Koh J ,Enders GH ,Dynlacht BD ,Harlow E . Tumour-derived p16 alleles encoding proteins defective in cell-cycle inhibition. Nature 1995;375:506-510
CrossRef | Web of Science | Medline
- Citing Articles (93)
Citing Articles
1
Scott E Kern, Chanjuan Shi, Ralph H Hruban. (2011) The complexity of pancreatic ductal cancers and multidimensional strategies for therapeutic targeting. The Journal of Pathology 223:2, 296-307
CrossRef2
Rubén Cabanillas, Aurora Astudillo, Miguel Valle, Jorge de la Rosa, Rebeca Álvarez, Noelia S. Durán, Juan Cadiñanos, Amy Chen. (2011) Novel germline CDKN2A mutation associated with head and neck squamous cell carcinomas and melanomas. Head & Neckn/a-n/a
CrossRef3
Melissa A. Reyes, Daniel B. Eisen. (2010) Inherited syndromes. Dermatologic Therapy 23:6, 606-642
CrossRef4
Virginia Sun. (2010) Update on Pancreatic Cancer Treatment. The Nurse Practitioner 35:8, 16-22
CrossRef5
Joshua P. Spanogle, Christina A. Clarke, Sarah Aroner, Susan M. Swetter. (2010) Risk of second primary malignancies following cutaneous melanoma diagnosis: A population-based study. Journal of the American Academy of Dermatology 62:5, 757-767
CrossRef6
DK Bartsch, P Langer, N Habbe, E Matthäi, B Chaloupka, M Sina, SA Hahn, EP Slater. (2010) Clinical and genetic analysis of 18 pancreatic carcinoma/melanoma-prone families. Clinical Genetics 77:4, 333-341
CrossRef7
Jinyun Chen, Carol J. Etzel, Christopher I. Amos, Qing Zhang, Nancy Viscofsky, Noralane M. Lindor, Patrick M. Lynch, Marsha L. Frazier. (2009) Genetic variants in the cell cycle control pathways contribute to early onset colorectal cancer in Lynch syndrome. Cancer Causes & Control 20:9, 1769-1777
CrossRef8
Vladimir Vinarsky, Robert L. Fine, Adel Assaad, Ying Qian, John A. Chabot, Gloria H. Su, Harold Frucht, Eben L. Rosenthal. (2009) Head and neck squamous cell carcinoma in FAMMM syndrome. Head & Neck 31:11, 1524-1527
CrossRef9
Irma Kluijt, Annemieke Cats, Paul Fockens, Yung Nio, Dirk J. Gouma, Marco J. Bruno. (2009) Atypical Familial Presentation of FAMMM Syndrome With a High Incidence of Pancreatic Cancer. Journal of Clinical Gastroenterology 43:9, 853-857
CrossRef10
Stefano Landi. (2009) Genetic predisposition and environmental risk factors to pancreatic cancer: A review of the literature. Mutation Research/Reviews in Mutation Research 681:2-3, 299-307
CrossRef11
Jinyun Chen, Donghui Li, Ann M. Killary, Subrata Sen, Christopher I. Amos, Douglas B. Evans, James L. Abbruzzese, Marsha L. Frazier. (2009) Polymorphisms of p16, p27, p73, and MDM2 Modulate Response and Survival of Pancreatic Cancer Patients Treated with Preoperative Chemoradiation. Annals of Surgical Oncology 16:2, 431-439
CrossRef12
Haike M. J. van der Velden, Michelle M. van Rossum, Willeke A. M. Blokx, Jan B. M. Boezeman, Marie-Jeanne P. Gerritsen. (2009) Clinical Characteristics of Cutaneous Melanoma and Second Primary Malignancies in a Dutch Hospital-Based Cohort of Cutaneous Melanoma Patients. Dermatology Research and Practice 2009, 1-8
CrossRef13
Jan-Bart M. Koorstra, Anirban Maitra, Folkert H. M. Morsink, Paul Drillenburg, Fiebo J. W. ten Kate, Ralph H. Hruban, Johan A. Offerhaus. (2008) Undifferentiated Carcinoma With Osteoclastic Giant Cells (UCOCGC) of the Pancreas Associated With the Familial Atypical Multiple Mole Melanoma Syndrome (FAMMM). The American Journal of Surgical Pathology 32:12, 1905-1909
CrossRef14
N. Habbe, P. Langer, D.K. Bartsch. (2008) Hereditäres Pankreaskarzinom. Der Chirurg 79:11, 1029-1037
CrossRef15
Tadeusz Dębniak, Thierry van de Wetering, Rodney Scott, Leszek Nagay, Cezary Cybulski, Bohdan Górski, Anna Jakubowska, Jacek Gronwald, Bartłomiej Masojć, Tomasz Huzarski, Tomasz Byrski, Katarzyna Nej-Wołosiak, Józef Kładny, Romuald Maleszka, Jan Lubinski. (2008) Low prevalence of CDKN2A/ARF mutations among early-onset cancers of breast, pancreas and malignant melanoma in Poland. European Journal of Cancer Prevention 17:5, 389-391
CrossRef16
Jae Hee Cho, Seungmin Bang, Seung Woo Park, Jae Bock Chung, Si Young Song. (2008) BRCA2 Mutations as a Universal Risk Factor for Pancreatic Cancer Has a Limited Role in Korean Ethnic Group. Pancreas 36:4, 337-340
CrossRef17
Peter Langer, Emily Slater, Volker Fendrich, Nils Habbe, Detlef K Bartsch. (2007) Familial pancreatic cancer: current status. Expert Opinion on Medical Diagnostics 1:2, 193-201
CrossRef18
Carlos Suárez, Juan Pablo Rodrigo, Alfio Ferlito, Rubén Cabanillas, Ashok R. Shaha, Alessandra Rinaldo. (2006) Tumours of familial origin in the head and neck. Oral Oncology 42:10, 965-978
CrossRef19
Ritva Karhu, Eija Mahlamäki, Anne Kallioniemi. (2006) Pancreatic adenocarcinoma—Genetic portrait from chromosomes to microarrays. Genes, Chromosomes and Cancer 45:8, 721-730
CrossRef20
Tadeusz Dębniak, Rodney J. Scott, Tomasz Huzarski, Tomasz Byrski, Andrzej Rozmiarek, Boguslaw Dębniak, Bohdan Górski, Cezary Cybulski, Krzysztof Mędrek, Marek Mierzejewski, Bartłomiej Masojc, Joanna Matyjasik, Elzbieta Złowocka, Urszula Teodorczyk, Marcin Lener, Ewa Klujszo-Grabowska, Katarzyna Nej-Wołosiak, Ewa Jaworowska, Dorota Oszutowska, Anna Szymańska, Jolanta Szymańska, Jennifer Castaneda, Thierry van de Wetering, Janina Suchy, Grzegorz Kurzawski, Oleg Oszurek, Steven Narod, Jan Lubinski. (2006) CDKN2A common variant and multi-organ cancer risk—a population-based study. International Journal of Cancer 118:12, 3180-3182
CrossRef21
J. Lang, M. Boxer, R.M. MacKie. (2005) CDKN2A mutations in Scottish families with cutaneous melanoma: results from 32 newly identified families. British Journal of Dermatology 153:6, 1121-1125
CrossRef22
Therese M. Becker, Ana L. Ayub, Richard F. Kefford, Graham J. Mann, Helen Rizos. (2005) The melanoma-associated 24 base pair duplication in p16INK4a is functionally impaired. International Journal of Cancer 117:4, 569-573
CrossRef23
T.M. Becker, H. Rizos, A. de la Pena, I.A. Leclercq, S. Woodruff, R.F. Kefford, G.J. Mann. (2005) Impaired inhibition of NF-κB activity by melanoma-associated p16INK4a mutations. Biochemical and Biophysical Research Communications 332:3, 873-879
CrossRef24
Brian Somoano, Kristin Baker Niendorf, Hensin Tsao. (2005) Hereditary cancer syndromes of the skin. Clinics in Dermatology 23:1, 85-106
CrossRef25
N. Alexakis, C. Halloran, M. Raraty, P. Ghaneh, R. Sutton, J. P. Neoptolemos. (2004) Current standards of surgery for pancreatic cancer. British Journal of Surgery 91:11, 1410-1427
CrossRef26
Detlef K. Bartsch, Ralf Kress, Mercedes Sina-Frey, Robert Gr
tzmann, Berthold Gerdes, Christian Pilarsky, Joachim W. Heise, Klaus-Martin Schulte, Mario Colombo-Benkmann, Cristina Schleicher, Helmut Witzigmann, Olaf Prid
CrossRef27
Sven Eisold, Eduard Ryschich, Michael Linnebacher, Thomas Giese, Dirk Nauheimer, Anja Wild, Detlef K. Bartsch, Markus W. B
CrossRef28
K. Nielsen, C. Ingvar, A. Masback, J. Westerdahl, A. Borg, T. Sandberg, N. Jonsson, J. Nagel, H. Olsson. (2004) Melanoma and nonmelanoma skin cancer in patients with multiple tumours-evidence for new syndromes in a population-based study. British Journal of Dermatology 150:3, 531-536
CrossRef29
M Berwick, I Orlow, S Mahabir, P Myskowski, D Coit, M S Brady, P Roy, Y Song, R Canchola, A Barz, A Halpern, J Bolognia, S Eng, A Elahi, C B Begg. (2004) Estimating the relative risk of developing melanoma in INK4A carriers. European Journal of Cancer Prevention 13:1, 65-70
CrossRef30
Donna E. Hansel, Scott E. Kern, Ralph H. Hruban. (2003) M
OLECULAR PATHOGENESIS OF PANCREATIC CANCER . Annual Review of Genomics and Human Genetics 4:1, 237-256
CrossRef31
J Andrew Carlson, Andrzej Slominski, Gerald P Linette, Martin C Mihm Jr, Jeffrey S Ross. (2003) Biomarkers in melanoma: predisposition, screening and diagnosis. Expert Review of Molecular Diagnostics 3:2, 163-184
CrossRef32
S. A. Hahn, B. Greenhalf, I. Ellis, M. Sina-Frey, H. Rieder, B. Korte, B. Gerdes, R. Kress, A. Ziegler, J. A. Raeburn, D. Campra, R. Grutzmann, H. Rehder, M. Rothmund, W. Schmiegel, J. P. Neoptolemos, D. K. Bartsch. (2003) BRCA2 Germline Mutations in Familial Pancreatic Carcinoma. JNCI Journal of the National Cancer Institute 95:3, 214-221
CrossRef33
Detlef K. Bartsch, Mercedes Sina-Frey, Sven Lang, Anja Wild, Berthold Gerdes, Peter Barth, Ralf Kress, Robert Grützmann, Mario Colombo-Benkmann, Andreas Ziegler, Stephan A. Hahn, Matthias Rothmund, Harald Rieder. (2002) CDKN2A Germline Mutations in Familial Pancreatic Cancer. Annals of Surgery 236:6, 730-737
CrossRef34
Wendell G. Yarbrough. (2002) The ARF-p16 Gene Locus in Carcinogenesis and Therapy of Head and Neck Squamous Cell Carcinoma. The Laryngoscope 112:12, 2114-2128
CrossRef35
Kathy K. Yu, Adam M. Zanation, Jonathan R. Moss, Wendell G. Yarbrough. (2002) Familial Head and Neck Cancer: Molecular Analysis of a New Clinical Entity. The Laryngoscope 112:9, 1587-1593
CrossRef36
Roland M. Schmid. (2002) Genetic basis of pancreatic cancer. Best Practice & Research Clinical Gastroenterology 16:3, 421-433
CrossRef37
Michela Mantelli, Monica Barile, Paola Ciotti, Paola Ghiorzo, Francesca Lantieri, Lorenza Pastorino, Caterina Catrical
CrossRef38
Henry T. Lynch, Randall E. Brand, David Hogg, Carolyn A. Deters, Ramon M. Fusaro, Jane F. Lynch, Ling Liu, Joseph Knezetic, Norman J. Lassam, Michael Goggins, Scott Kern. (2002) Phenotypic variation in eight extendedCDKN2A germline mutation familial atypical multiple mole melanoma-pancreatic carcinoma-prone families. Cancer 94:1, 84-96
CrossRef39
Wendell G. Yarbrough, Yue Xiong. 2002. p16 and ARF: Crossroads of Tumorigenesis. , 491-505.
CrossRef40
St
CrossRef41
Fiorella Petronzelli, Danila Sollima, Giuseppe Coppola, Maria Enrica Martini-Neri, Giovanni Neri, Maurizio Genuardi. (2001) CDKN2A germline splicing mutation affecting both p16ink4 and p14arf RNA processing in a melanoma/neurofibroma kindred. Genes, Chromosomes and Cancer 31:4, 398-401
CrossRef42
Nabeel Bardeesy, Norman E. Sharpless, Ronald A. DePinho, Glenn Merlino. (2001) The genetics of pancreatic adenocarcinoma: a roadmap for a mouse model. Seminars in Cancer Biology 11:3, 201-218
CrossRef43
Magdalena Leszczyniecka, Terry Roberts, Paul Dent, Steven Grant, Paul B Fisher. (2001) Differentiation therapy of human cancer: basic science and clinical applications. Pharmacology & Therapeutics 90:2-3, 105-156
CrossRef44
Toshiaki Saida. (2001) Recent advances in melanoma research. Journal of Dermatological Science 26:1, 1-13
CrossRef45
Henry T. Lynch, Randall E. Brand, Carolyn A. Deters, Ramon M. Fusaro. (2001) Update on familial pancreatic cancer. Current Gastroenterology Reports 3:2, 121-128
CrossRef46
Karen White, Karsten R. Held, Bernhard H.F. Weber. (2001) A BRCA2 germ-line mutation in familial pancreatic carcinoma. International Journal of Cancer 91:5, 742-744
CrossRef47
William B. Goggins, Dianne M. Finkelstein, Hensin Tsao. (2001) Evidence for an association between cutaneous melanoma and non-Hodgkin lymphoma. Cancer 91:4, 874-880
CrossRef48
S Jefferies. (2001) Genetic mechanisms in squamous cell carcinoma of the head and neck. Oral Oncology 37:2, 115-126
CrossRef49
N. Al-Rajhi, Y. Khafaga, J. El-Husseiny, M. Saleem, W. Mourad, A. Al-Otieschan, A. Al-Amro. (2000) Early stage carcinoma of oral tongue: prognostic factors for local control and survival. Oral Oncology 36:6, 508-514
CrossRef50
Berthold Gerdes, Detlef K. Bartsch, Annette Ramaswamy, Michael Kersting, Anja Wild, Marcus Schuermann, Mercedes Frey, Matthias Rothmund. (2000) Multiple Primary Tumors as an Indicator for p16INK4a Germline Mutations in Pancreatic Cancer Patients?. Pancreas 21:4, 369-375
CrossRef51
Steven J. Cohen, Wayne H. Pinover, James C. Watson, Neal J. Meropol. (2000) Pancreatic cancer. Current Treatment Options in Oncology 1:5, 375-386
CrossRef52
Paola Ghiorzo, Giovanna Bianchi-Scarrà. (2000) Reply to Fusaro. International Journal of Cancer 87:5, 756-757
CrossRef53
Anton Platz, Ulrik Ringborg, Johan Hansson. (2000) Hereditary cutaneous melanoma. Seminars in Cancer Biology 10:4, 319-326
CrossRef54
P CIOTTI, J STRUEWING, M MANTELLI, A CHOMPRET, M AVRIL, P SANTI, M TUCKER, G BIANCHISCARRA, B BRESSACDEPAILLERETS, A GOLDSTEIN. (2000) A Single Genetic Origin for the G101W CDKN2A Mutation in 20 Melanoma-Prone Families. The American Journal of Human Genetics 67:2, 311-319
CrossRef55
Nicholas Hayward. (2000) New developments in melanoma genetics. Current Oncology Reports 2:4, 300-306
CrossRef56
Teresa A. Brentnall. (2000) CANCER SURVEILLANCE OF PATIENTS FROM FAMILIAL PANCREATIC CANCER KINDREDS. Medical Clinics of North America 84:3, 707-718
CrossRef57
Michael Piepkorn. (2000) Melanoma genetics: An update with focus on the CDKN2A(p16)/ARF tumor suppressors. Journal of the American Academy of Dermatology 42:5, 705-726
CrossRef58
Geeta Lal, Ling Liu, David Hogg, Norman J. Lassam, Mark S. Redston, Steven Gallinger. (2000) Patients with both pancreatic adenocarcinoma and melanoma may harbor germlineCDKN2A mutations. Genes, Chromosomes and Cancer 27:4, 358-361
CrossRef59
G.H. Sakorafas, A.G. Tsiotou, G.G. Tsiotos. (2000) Molecular biology of pancreatic cancer; oncogenes, tumour suppressor genes, growth factors, and their receptors from a clinical perspective. Cancer Treatment Reviews 26:1, 29-52
CrossRef60
Ramon M. Fusaro, Henry T. Lynch. (2000) The FAMMM Syndrome: Epidemiology and Surveillance Strategies. Cancer Investigation 18:7, 670-680
CrossRef61
Mark H. Greene. (1999) The genetics of hereditary melanoma and nevi. Cancer 86:S11, 2464-2477
CrossRef62
Smita Bhatia, Lilian Estrada-Batres, Tamara Maryon, Monica Bogue, David Chu. (1999) Second primary tumors in patients with cutaneous malignant melanoma. Cancer 86:10, 2014-2020
CrossRef63
Paola Ghiorzo, Paola Ciotti, Michela Mantelli, Abdelhamid Heouaine, Paola Queirolo, Maria Luisa Rainero, Carlo Ferrari, Pier Luigi Santi, Roberto De Marchi, Alessandro Farris, Franco Ajmar, Paolo Bruzzi, Giovanna Bianchi-Scarr
CrossRef64
Michael Böhmig, Bertram Wiedenmann, Stefan Rosewicz. (1999) Therapie des Pankreasadenokarzinoms. Medizinische Klinik 94:11, 614-625
CrossRef65
Mark H. Greene. (1999) The genetics of hereditary melanoma and nevi. Cancer 86:S8, 1644-1657
CrossRef66
Werner Hilgers, Scott E. Kern. (1999) Molecular genetic basis of pancreatic adenocarcinoma. Genes, Chromosomes and Cancer 26:1, 1-12
CrossRef67
Elizabeth A. Holland, Helen Schmid, Richard F. Kefford, Graham J. Mann. (1999) CDKN2A (P16INK4a) andCDK4 mutation analysis in 131 Australian melanoma probands: Effect of family history and multiple primary melanomas. Genes, Chromosomes and Cancer 25:4, 339-348
CrossRef68
Christopher R. Herzog, Seong Noh, Laura E. Lantry, Kuan-Liang Guan, Ming You. (1999) Cdkn2a encodes functional variation of p16INK4a but not p14ARF, which confers selection in mouse lung tumorigenesis. Molecular Carcinogenesis 25:2, 92-98
CrossRef69
Jaime F. Modiano, Michelle G. Ritt, John Wojcieszyn. (1999) The Molecular Basis of Canine Melanoma: Pathogenesis and Trends in Diagnosis and Therapy. Journal of Veterinary Internal Medicine 13:3, 163-174
CrossRef70
James G. Herman. (1999) p16INK4: Involvement early and often in gastrointestinal malignancies. Gastroenterology 116:2, 483-485
CrossRef71
Norman E Sharpless, Ronald A DePinho. (1999) The INK4A/ARF locus and its two gene products. Current Opinion in Genetics & Development 9:1, 22-30
CrossRef72
Gloria J Bullock, Judith L Green, Paul L Baron. (1999) Impact of p16 expression on surgical management of malignant melanoma and pancreatic carcinoma. The American Journal of Surgery 177:1, 15-18
CrossRef73
Maria Concetta Fargnoli, Sergio Chimenti, Gisela Keller, Hans Peter Soyer, Vera Dal Pozzo, Heinz Höfler, Ketty Peris. (1998) CDKN2a/p16INK4a Mutations and Lack of p19ARF Involvement in Familial Melanoma Kindreds. Journal of Investigative Dermatology 111:6, 1202-1206
CrossRef74
Margarida Ruas, Gordon Peters. (1998) The p16INK4a/CDKN2A tumor suppressor and its relatives. Biochimica et Biophysica Acta (BBA) - Reviews on Cancer 1378:2, F115-F177
CrossRef75
Maryjean Schenk, Richard K. Severson, Karen S. Pawlish. (1998) The risk of subsequent primary carcinoma of the pancreas in patients with cutaneous malignant melanoma. Cancer 82:9, 1672-1676
CrossRef76
Elysee T. M. Hille, Erik va, Duijn, Nelleke A. Gruis, Frits R. Rosendaal, Wilma Bergman, Jan P. Vandenbroucke. (1998) Excess Cancer Mortality in Six Dutch Pedigrees with the Familial Atypical Multiple Mole-Melanoma Syndrome from 1830 to 1994. Journal of Investigative Dermatology 110:5, 788-792
CrossRef77
Christopher A. Moskaluk, Ralph H. Hruban, Amanda Lietman, Tom Smyrk, Lavonne Fusaro, Ramon Fusaro, Jane Lynch, Charles J. Yeo, Charles E. Jackson, Henry T. Lynch, Scott E. Kern. (1998) Novel germline p16INK4 allele (Asp145Cys) in a family with multiple pancreatic carcinomas. Human Mutation 12:1, 70-70
CrossRef78
Pamela M. Pollock, Nigel Spurr, Tim Bishop, Julia Newton-Bishop, Nelleke Gruis, Pieter A. van der Velden, Alisa M. Goldstein, Margaret A. Tucker, William D. Foulkes, Ray Barnhill, Daniel Haber, Jane Fountain, Nicholas K. Hayward. (1998) Haplotype analysis of two recurrentCDKN2A mutations in 10 melanoma families: Evidence for common founders and independent mutations. Human Mutation 11:6, 424-431
CrossRef79
HENRY T. LYNCH, RAMON M. FUSARO, JANE F. LYNCH. (1997) Cancer Genetics in the New Era of Molecular Biology. Annals of the New York Academy of Sciences 833:1 Cancer, 1-28
CrossRef80
Sophie Sun, Pamela M. Pollock, Ling Liu, Sepideh Karimi, Serge Jothy, Benedict J. Milner, Andrew Renwick, Norman J. Lassam, Nicholas K. Hayward, David Hogg, Steven A. Narod, William D. Foulkes. (1997) CDKN2A mutation in a non-FAMMM kindred with cancers at multiple sites results in a functionally abnormal protein. International Journal of Cancer 73:4, 531-536
CrossRef81
Yoshinori Murakami. (1997) Genetic alterations in human pancreatic cancer. Journal of Hepato-Biliary-Pancreatic Surgery 4:3, 283-290
CrossRef82
Henry T. Lynch, Ramon M. Fusaro, Stephen J. Lemon, Thomas Smyrk, Jane Lynch. (1997) Survey of cancer genetics. Cancer 80:S3, 523-532
CrossRef83
J Howe. (1997) The molecular genetics of pancreatic cancer. Surgical Oncology 6:1, 1-18
CrossRef84
Christopher A. Moskaluk, Ralph H. Hruban, Mieke Schutte, Amanda S. Lietman, Tom Smyrk, Lavonne Fusaro, Ramon Fusaro, Jane Lynch, Charles J. Yeo, Charles E. Jackson, Henry T. Lynch, Scott E. Kern. (1997) Genomic Sequencing of DPC4 in the Analysis of Familial Pancreatic Carcinoma. Diagnostic Molecular Pathology 6:2, 85-90
CrossRef85
Markus J. Maeurer, Michael T. Lotze. (1997) Tumor Recognition by the Cellular Immune System: New Aspects of Tumor Immunology. International Reviews of Immunology 14:2-3, 97-132
CrossRef86
Terry C. Lairmore, Jeffrey A. Norton. (1997) Advances in molecular genetics. The American Journal of Surgery 173:1, 37-41
CrossRef87
Thierry Leblanc. (1997) p16 : At Last a Tumor Suppressor Gene Involved in Childhood Acute Lymphoblastic Leukemias. Pediatric Hematology-Oncology 14:2, iii-viii
CrossRef88
T. Ming Chu. (1997) Molecular diagnosis of pancreas carcinoma. Journal of Clinical Laboratory Analysis 11:4, 225-231
CrossRef89
Jeffrey E. Lee. (1996) Factors associated with melanoma incidence and prognosis. Seminars in Surgical Oncology 12:6, 379-385
CrossRef90
Catherine M. Phelan, Johnathan M. Lancaster, Patricia Tonin, Curtis Gumbs, Charles Cochran, Ron Carter, Parviz Ghadirian, Chantal Perret, Roxana Moslehi, France Dion, Marie-Claude Faucher, Kiran Dole, Sepideh Karimi, Willliam Foulkes, Hafida Lounis, Ellen Warner, Paul Goss, David Anderson, Catharina Larsson, Steven A. Narod, P. Andrew Futreal. (1996) Mutation analysis of the BRCA2 gene in 49 site–specific breast cancer families. Nature Genetics 13:1, 120-122
CrossRef91
Manuel Serrano, Han-Woong Lee, Lynda Chin, Carlos Cordon-Cardo, David Beach, Ronald A DePinho. (1996) Role of the INK4a Locus in Tumor Suppression and Cell Mortality. Cell 85:1, 27-37
CrossRef92
(1996) Familial Melanoma and Pancreatic Cancer. New England Journal of Medicine 334:7, 469-472
Full Text93
Birgitte Smith-Sørensen, Eivind Hovig. (1996) CDKN2A (p16INK4A) somatic and germline mutations. Human Mutation 7:4, 294-303
CrossRef
