Original Article
Mutations in the Gene for the Granulocyte Colony-Stimulating–Factor Receptor in Patients with Acute Myeloid Leukemia Preceded by Severe Congenital Neutropenia
N Engl J Med 1995; 333:487-493August 24, 1995
- Abstract
Background
In severe congenital neutropenia the maturation of myeloid progenitor cells is arrested. The myelodysplastic syndrome and acute myeloid leukemia develop in some patients with severe congenital neutropenia. Abnormalities in the signal-transduction pathways for granulocyte colony-stimulating factor (G-CSF) may play a part in the progression to acute myeloid leukemia.
Methods
We isolated genomic DNA and RNA from hematopoietic cells obtained from two patients with acute myeloid leukemia and histories of severe congenital neutropenia. The nucleotide sequences encoding the cytoplasmic domain of the G-CSF receptor were amplified by means of the polymerase chain reaction and sequenced. Murine myeloid 32D.C10 cells were transfected with complementary DNA encoding the wild-type or mutant G-CSF receptors and tested for their responses to G-CSF.
Results
Point mutations in the gene for the G-CSF receptor were identified in both patients. The mutations, a substitution of thymine for cytosine at the codon for glutamine at position 718 (Gln718) in one patient and at the codon for glutamine at position 731 (Gln731) in the other, caused a truncation of the C-terminal cytoplasmic region of the receptor. Both mutant and wild-type genes for the G-CSF receptor were present in leukemic cells from the two patients. In one patient, the mutation was also found in the neutropenic stage, before the progression to acute myeloid leukemia. The 32D.C10 cells expressing mutant receptors had abnormally high proliferative responses but failed to mature when cultured in G-CSF. The mutant G-CSF receptors also interfered with terminal maturation mediated by the wild-type G-CSF receptor in the 32D.C10 cells that coexpressed the wild-type and mutant receptors.
Conclusions
Mutations in the gene for the G-CSF receptor that interrupt signals required for the maturation of myeloid cells are involved in the pathogenesis of severe congenital neutropenia and associated with the progression to acute myeloid leukemia.
Media in This Article
Figure 1
Mutations in the Gene for the G-CSF Receptor in Patients 1 and 2.Figure 2
Stu I Restriction-Enzyme Analysis of the PCR Product.Article Activity
- Article
Severe congenital neutropenia (Kostmann's syndrome) comprises a heterogeneous group of disorders with variable inheritance whose main features are recurrent bacterial infections and severe neutropenia (fewer than 200 neutrophils per cubic millimeter). The bone marrow almost invariably shows an arrest of granulocytic maturation at the promyelocytic or myelocytic stage.1-6 Patients with severe congenital neutropenia have an increased susceptibility to acute myeloid leukemia.7-10
An abnormal response of granulocytic progenitor cells to granulocyte colony-stimulating factor (G-CSF) may play a part in the pathogenesis of severe congenital neutropenia. The in vitro response to G-CSF of myeloid progenitor cells from patients with this disorder is often reduced.11,12 Pharmacologic doses of G-CSF increase the neutrophil count in the majority of patients with severe congenital neutropenia.12-14
The G-CSF receptor, a single polypeptide containing 813 amino acids,15,16 transduces signals that regulate the proliferation, maturation, and survival of myeloid progenitor cells.17 The cytoplasmic region proximal to the membrane of the receptor transduces proliferative and survival signals, whereas the distal C-terminal region transduces maturation signals and suppresses the receptor's proliferative signals.18-20
A truncated G-CSF receptor, lacking the C-terminal maturation domain as a consequence of a point mutation, has recently been reported in a patient with severe congenital neutropenia.21 We report here on point mutations in the gene for the G-CSF receptor in two patients with acute myeloid leukemia and histories of severe congenital neutropenia. These mutations also truncate the C-terminal cytoplasmic region of the G-CSF receptor. The mutation in one of the patients was already present in the neutropenic phase that preceded the development of acute myeloid leukemia. Our results suggest that the development of acute myeloid leukemia in patients with severe congenital neutropenia may involve a disruption of the maturation-signaling function of the G-CSF receptor.
Case Reports
Patient 1
The clinical and laboratory features of Patient 1 have been described previously.9 In brief, severe congenital neutropenia was diagnosed in this boy when he was two years and nine months old. There was no family history of an increased susceptibility to infection. When the boy was 12 years old, when the infections became more frequent and severe, G-CSF therapy was initiated; the absolute neutrophil count increased to 6000 per cubic millimeter. Eight months later, while the patient was receiving G-CSF therapy, peripheral-blood tests revealed approximately 30 percent blasts. Bone marrow studies consistently showed a predominance of myeloblasts. Analysis revealed a karyotype of 49,XY,+3,+der(5),t(1;5)(q21;q21),+22. The patient died seven months later.
Patient 2
Severe congenital neutropenia was diagnosed in Patient 2 during the first year of life, when he had severe mastoiditis. There was no family history of hematologic disorders or an increased frequency of infections. During the first 20 years of his life, he had frequent episodes of pneumonitis, otitis, tonsillitis, and severe gingivitis. At the age of 20 years, he was enrolled in a phase 1–2 study of G-CSF (Filgrastim) in Hannover, Germany. At that time, bone marrow studies revealed an arrest of myelopoiesis at the promyelocytic or myelocytic stage, with an absence of bands and segmented neutrophils. There were no signs of myelodysplasia, and the cellularity of the bone marrow was normal. Treatment with G-CSF (3 μg per kilogram of body weight per day) increased the neutrophil count to a level above 2000 per cubic millimeter within two weeks. During the next two years, the neutrophil count was maintained at this level with the same dose of G-CSF, and the patient had no severe infections.
Two years after the start of G-CSF treatment, a routine bone marrow examination demonstrated monosomy 7 in the myeloid lineage, but there was no sign of dysplasia or leukemia. G-CSF treatment was immediately discontinued, but it was restarted two months later, at the patient's request, because of severe stomatitis. Eleven months later, the myelodysplastic syndrome (the subtype characterized by refractory anemia and an excess of blasts) and thrombocytopenia developed. After an additional eight months, the patient presented with acute myeloid leukemia (subtype M1 according to the French–American–British classification) and subsequently died.
Methods
Polymerase-Chain-Reaction Amplification
Genomic DNA was isolated from different cellular sources, as described elsewhere.22 Total RNA was isolated from leukemic cells from Patient 2 by the method of Chomczynski and Sacchi.23 RNA was reverse-transcribed into complementary DNA (cDNA) with the use of the reverse transcriptase of Moloney murine leukemia virus (GIBCO-BRL, Breda, the Netherlands). Amplification with the polymerase chain reaction (PCR) was performed as previously described.21 The following primers were used: FW2, 5'tgtgatcatcgtgactccctt3' (forward); FW3, 5'ctgctgttgttaacctgcctc3' (forward); FW4, 5'ccaagagcagtttccacccaggcc3' (forward); FWI16, 5'accctttgtgttccaccaGT3' (forward); RV1, 5'caagatctagtttacaatactgaag3' (reverse); RV2, 5'gtagatcttagtcatgggcttatgg3' (reverse); and RV3, 5'tctcaggggagatagtgccc3' (reverse). The underlined nucleotides indicate the introduced mismatches.
Nucleotide Sequencing
After electrophoresis on agarose gels, PCR fragments were purified with the Geneclean II kit (Bio 101, La Jolla, Calif.) and sequenced directly or after subcloning in the pBluescript vector (Stratagene, La Jolla, Calif.), with the use of the T7 Sequencing Kit (Pharmacia P-L Biochemicals, Milwaukee).
Expression Vectors for G-CSF Receptor
A cDNA encoding a truncated G-CSF receptor (mutant DA18) was cloned at the EcoRI restriction site of the pBabe-puro retroviral expression vector that contains a puromycin-resistance gene,24 giving rise to the pBabe-DA construct. To constitute the full-length cDNA encoding the truncated G-CSF receptors in the two patients, PCR fragments obtained from Patients 1 and 2 with primer sets FWI16–RV1 and FW2–RV1, respectively, were inserted into the HincII restriction site of the pBluescript vector and then cleaved with Cfr10I and XhoI. The resulting Cfr10I and XhoI fragments were used to replace the Cfr10I–SalI fragment of the pBabe-DA construct, thus creating the pBabe-1 and pBabe-2 expression vectors for Patients 1 and 2, respectively. The pLNCX expression vector containing the wild-type G-CSF receptor cDNA (pLNCX-WT) has been described previously.18
Cell-Line and Gene Transfection
A subline of the murine myeloid cell line 32D,25 called 32D.C10, was fully dependent on murine interleukin-3 for proliferation and was unresponsive to G-CSF.18 The 32D.C10 cells were maintained in RPMI medium supplemented with 10 percent fetal-calf serum and 10 ng of interleukin-3 per milliliter. The expression constructs pBabe-1, pBabe-2, and pLNCX-WT were linearized with PvuI and introduced into the 32D.C10 cells by electroporation. After 48 hours of incubation, cells were selected with puromycin (1 μg per milliliter) or G418 (0.8 mg per milliliter) in semisolid culture medium containing 0.9 percent methylcellulose. Single colonies were subsequently expanded in liquid culture for further analyses.
Antibodies to the G-CSF Receptor
Antiserum was raised by immunizing rabbits with a fusion protein consisting of a 6-histidine–residue tag and G-CSF receptor containing the extracellular domain of the receptor from amino acid 17 to amino acid 345. A corresponding BamHI fragment of the G-CSF receptor cDNA was inserted into the BamHI restriction site of the bacteria expressing vector pQE-10 (Qiagen, Düsseldorf, Germany). A purified immunoglobulin fraction was obtained by protein A Sepharose affinity chromatography.
Western Blotting and Assays of Cell Proliferation
Cell lysates were prepared as described elsewhere26 and analyzed by a standard method of Western blotting. Tritium-labeled–thymidine uptake and long-term cell proliferation in response to G-CSF were measured as described elsewhere.18
Morphologic and Cytochemical Analyses
Cells were spun onto glass slides, and the morphologic features were examined after May–Grünwald–Giemsa staining. Myeloperoxidase staining was performed as described elsewhere.27 In each case, at least 400 cells were examined for staining.
Results
Mutations in the Gene for the G-CSF Receptor
The entire exon 17,28 which encodes the 156 amino acids of the C-terminal cytoplasmic region, and part of intron 16 of the G-CSF–receptor gene were amplified by PCR from genomic DNA isolated from bone marrow cells obtained from Patient 1 with primers FWI16 and RV1. The PCR product was subcloned, and a pool of 18 clones was sequenced. This sequence contained a cytosine-to-thymine (C-to-T) transition at nucleotide 2390 of the G-CSF receptor cDNA15 (Figure 1AFigure 1
Mutations in the Gene for the G-CSF Receptor in Patients 1 and 2.). Direct sequencing of PCR products confirmed the presence of the point mutation (data not shown). This mutation changes the CAA codon for glutamine at position 718 (Gln718) to the TAA stop codon, thus truncating a C-terminal region of 96 amino acids, including the conserved box-3 segment of the receptor's cytoplasmic domain30 (Figure 1B).Enzyme-restriction analysis was used to confirm the sequencing data and to examine the ratio of mutant-to-normal genes for the G-CSF receptor in bone marrow cells from Patient 1. A single mismatch was introduced in primer FW4; it created a StuI restriction site in the PCR product if the point mutation was present in the DNA (Figure 2AFigure 2
Stu I Restriction-Enzyme Analysis of the PCR Product.). Analysis of eight individual clones showed that five contained the mutation (Figure 2B). StuI digestion of the PCR product obtained from DNA of bone marrow cells collected at various times during the course of leukemia showed that the mutated gene made up a minor proportion of the DNA. The mutation was not detected in the liver or the spleen by StuI digestion and nucleotide sequencing (data not shown). These results indicate that the mutation did not occur in the germ line.Only RNA samples were available from leukemic cells in peripheral blood obtained from Patient 2. Reverse-transcriptase PCR with primers FW2 and RV1 was used to amplify the entire transmembrane and cytoplasmic domains, as well as part of the extracellular domain, of the G-CSF–receptor cDNA. After subcloning of the PCR product, nucleotide sequencing was performed with a pool of 16 clones. A C-to-T point mutation was identified at nucleotide 2429 (Figure 1A). This mutation, which changes the CAG codon for glutamine at position 731 (Gln731) to the TAG stop codon, deleted the 83 C-terminal amino acids of the G-CSF receptor (Figure 1B). The mutation destroys a PvuII restriction site in the G-CSF receptor cDNA. PvuII digestion of PCR products obtained with primers FW3 and RV2 revealed transcripts of both the normal and mutated G-CSF receptor alleles (Figure 3AFigure 3
Pvu II Restriction-Enzyme Analysis of PCR Products. and Figure 3B). To determine whether the point mutation was present before acute myeloid leukemia developed in Patient 2, DNA was isolated from a bone marrow smear prepared when the patient was in the neutropenic phase, before the acquisition of monosomy 7. A minor proportion of the DNA contained the mutation (Figure 3A and Figure 3B), indicating that it had arisen from a somatic event.Transduction of Proliferative and Maturation Signals by Wild-Type and Mutant G-CSF Receptors
The function of the mutant G-CSF receptors from the two patients was tested in murine myeloid 32D.C10 cells that were transfected with cDNA encoding the wild-type or mutated G-CSF receptors. The expression of the G-CSF–receptor proteins in the transfected 32D.C10 cells was examined by Western blot analysis. The wild-type G-CSF–receptor protein had an apparent molecular weight of 140,000 to 150,000, whereas the mutant proteins from Patients 1 and 2 had a molecular weight of 115,000 to 135,000 and 120,000 to 140,000, respectively (data not shown). These variations in molecular weight were probably due to differences in protein glycosylation.15
The capacities of the G-CSF receptors to transduce proliferative signals were analyzed in assays with tritium-labeled thymidine. The 32D.C10 cells expressing the wild-type receptor (32D.WT) had a dose-dependent response to G-CSF and proliferated most efficiently at the level of 3 ng of G-CSF per milliliter, which is about 75 percent of the response to interleukin-3 (Figure 4AFigure 4
G-CSF–Induced Proliferative Responses of 32D.C10 Clones Expressing Various G-CSF Receptors.). The 32D.C10 cells that expressed the mutant receptors from Patient 1 (32D.1) or Patient 2 (32D.2) had a considerably increased sensitivity to G-CSF, requiring concentrations of the factor that were approximately 10 times lower than the concentrations required by the 32D.WT cells for maximal proliferation. Unlike the cells transfected with the wild-type cDNA, the 32D.1 and 32D.2 cells had maximal responses to G-CSF that were similar to the responses to interleukin-3 (Figure 4A).In long-term cultures, the 32D.WT cells proliferated transiently in medium containing G-CSF. The cells gradually lost viability after 4 to 6 days in the medium (Figure 4B) and died after 12 to 14 days. In contrast, the 32D.1 and 32D.2 cells proliferated continuously and could be maintained in G-CSF–containing culture medium for at least one month.
When cultured in medium containing interleukin-3, the 32D.WT cells had morphologic features that were typical of those of immature myeloid cells, and 50 to 60 percent of the cells displayed weak myeloperoxidase staining. Despite the death of substantial numbers of cells after 8 to 12 days of culture in G-CSF–containing medium, the surviving 32D.WT cells exhibited morphologic features characteristic of terminal granulocytic maturation (Figure 5AFigure 5
Morphologic Features of 32D.C10 Clones Expressing Wild-Type and Mutant G-CSF Receptors (May–Grünwald–Giemsa Stain, ×630).), and nearly all the cells showed strong myeloperoxidase staining. In striking contrast, G-CSF treatment of 32D.1 and 32D.2 cells induced neither morphologic changes indicative of granulocytic maturation nor an increase in the expression of myeloperoxidase protein as indicated by myeloperoxidase staining (data not shown).Effect of Mutant Receptors on Granulocytic Maturation Mediated by the Wild-Type G-CSF Receptor
Because the leukemic cells from both patients expressed not only the mutated genes for the G-CSF receptor but also the normal alleles of the gene, we performed studies to determine whether the mutant receptors interfere with the function of the wild-type receptor. Two 32D.WT clones were transfected with pBabe-puro expression vector carrying the cDNAs of the mutant receptors from Patient 1 and Patient 2 or only empty pBabe-puro vector (the negative control). Expression of the wild-type and mutant G-CSF–receptor proteins in single clones was verified by Western blot analysis, and those that expressed approximately equal levels of the wild-type and mutant G-CSF–receptor proteins were examined. Transfection of 32D.WT cells with the empty vector did not alter G-CSF–induced proliferation and maturation (data not shown). The 32D.WT cells coexpressing the mutant receptor from Patient 1 (32D.WT-1) or Patient 2 (32D.WT-2) had increased proliferative responses to G-CSF (Figure 4A) and proliferated continuously in culture medium containing G-CSF alone (Figure 4B). Both the 32D.WT-1 cells and the 32D.WT-2 cells were unable to mature terminally in response to G-CSF (Figure 5B and Figure 5C). In fact, the responses of the 32D.WT-1 cells and the 32D.WT-2 cells to G-CSF were indistinguishable from the response of the 32D.1 and 32D.2 cells.
Discussion
In this study, we have detected point mutations in the gene for the G-CSF receptor in two patients with acute myeloid leukemia and histories of severe congenital neutropenia. The mutations truncate the C-terminal cytoplasmic region of the receptor that participates in the transduction of maturation signals.18,19 In one patient the mutation was already present in the neutropenic phase, before the progression to acute myeloid leukemia. When expressed in murine 32D.C10 cells, the truncated G-CSF receptors from the two patients transduced stronger proliferative signals than the wild-type receptor but were defective in inducing maturation. Moreover, the mutant receptors blocked granulocytic maturation even in the presence of wild-type G-CSF receptors, presumably by forming heterodimers with the wild-type receptors.31,32 Taken together, our data suggest that disruption of the maturation-signaling function of the G-CSF receptor contributes to leukemogenesis.
Not all patients with severe congenital neutropenia have mutations in the G-CSF receptor.21,33,34 No such mutations corresponding to the cytoplasmic domain were found in three patients with severe congenital neutropenia who were members of the Swedish families in which the disease was originally described (unpublished data). However, a point mutation in the gene for the G-CSF receptor, causing truncation of the C-terminal region, has been identified in a patient with severe congenital neutropenia and monosomy 7 but no signs of the myelodysplastic syndrome or acute myeloid leukemia (unpublished data). The mutation was detected in myeloid cells from this patient but not in B lymphocytes, indicating its acquisition by a committed progenitor cell. Thus far, we have found mutations in the gene for the G-CSF receptor in 4 of 14 patients with severe congenital neutropenia; in all 4, the mutation truncated the C-terminal region. Patients with severe congenital neutropenia and such truncated receptors may represent a subgroup of patients in whom the neutropenia is a preleukemic disorder.
Recombinant human G-CSF, now used frequently in the treatment of severe congenital neutropenia,12-14 can have favorable results. However, acute myeloid leukemia or the myelodysplastic syndrome has developed after the administration of G-CSF in patients with severe congenital neutropenia.35-37 It remains uncertain whether G-CSF therapy contributes to the progression to acute myeloid leukemia in such patients. Analysis of the G-CSF receptor in a large series of patients with severe congenital neutropenia will help elucidate the relation among defective G-CSF–receptor structures, the progression to acute myeloid leukemia, and the contribution of G-CSF therapy to leukemogenesis.
Supported by the Dutch Cancer Society.
We are indebted to Anita Schelen, Marleen van Paassen, and Birgit Teichmann for excellent technical assistance; and to Dr. Hartmut Land (Imperial Cancer Research Fund, London) for the pBabe-puro expression vector.
Source Information
From the Department of Hematology, Dr. Daniel den Hoed Cancer Center and Institute of Hematology, Erasmus University, Rotterdam, the Netherlands (F.D., B.L., I.P.T.); the Department of Clinical Pathology, City of Hope National Medical Center, Duarte, Calif. (R.K.B.); and the Department of Pediatric Hematology and Oncology, Hannover Medical School, Hannover, Germany (N.T., K.W.).
Address reprint requests to Dr. Touw at the Dr. Daniel den Hoed Cancer Center, P.O. Box 5201, 3008 AE Rotterdam, the Netherlands.
- References
References
1
Kostmann R . Infantile genetic agranulocytosis: a new recessive lethal disease in man. Acta Paediatr 1956;105:1-782
Wriedt K ,Kauder E ,Mauer AM . Defective myelopoiesis in congenital neutropenia. N Engl J Med 1970;283:1072-1077
Full Text | Web of Science | Medline3
Rodin AE ,Haggard ME ,Nichols MM ,Gustavson LP . Infantile genetic agranulocytosis: two cases occurring in siblings and one in a distant relative. Am J Dis Child 1973;126:818-821
Web of Science | Medline4
Kostmann R . Infantile genetic agranulocytosis: a review with presentation of ten new cases. Acta Paediatr Scand 1975;64:362-368
CrossRef | Web of Science | Medline5
Amato D ,Freedman MH ,Saunders EF . Granulopoiesis in severe congenital neutropenia. Blood 1976;47:531-538
Web of Science | Medline6
Kawaguchi Y ,Kobayashi M ,Tanabe A , et al. Granulopoiesis in patients with congenital neutropenia. Am J Hematol 1985;20:223-234
CrossRef | Web of Science | Medline7
Gilman PA ,Jackson DP ,Guild HG . Congenital agranulocytosis: prolonged survival and terminal acute leukemia. Blood 1970;36:576-585
Web of Science | Medline8
Rosen RB ,Kang S-J . Congenital agranulocytosis terminating in acute myelomonocytic leukemia. J Pediatr 1979;94:406-408
CrossRef | Web of Science | Medline9
Wong W-Y ,Williams D ,Slovak ML , et al. Terminal acute myelogenous leukemia in a patient with congenital agranulocytosis. Am J Hematol 1993;43:133-138
CrossRef | Web of Science | Medline10
Gillio AP ,Gabrilove JL . Cytokine treatment of inherited bone marrow failure syndromes. Blood 1993;81:1669-1674
Web of Science | Medline11
Kobayashi M ,Yumiba C ,Kawaguchi Y , et al. Abnormal responses of myeloid progenitor cells to recombinant human colony-stimulating factors in congenital neutropenia. Blood 1990;75:2143-2149
Web of Science | Medline12
Welte K ,Zeidler C ,Reiter A , et al. Differential effects of granulocyte-macrophage colony-stimulating factor and granulocyte colony-stimulating factor in children with severe congenital neutropenia. Blood 1990;75:1056-1063
Web of Science | Medline13
Bonilla MA ,Gillio AP ,Ruggeiro M , et al. Effects of recombinant human granulocyte colony-stimulating factor on neutropenia in patients with congenital agranulocytosis. N Engl J Med 1989;320:1574-1580
Full Text | Web of Science | Medline14
Dale DC ,Bonilla MA ,Davis MW , et al. A randomized controlled phase III trial of recombinant human granulocyte colony-stimulating factor (filgrastim) for treatment of severe chronic neutropenia. Blood 1993;81:2496-2502
Web of Science | Medline15
Fukunaga R ,Seto Y ,Mizushima S ,Nagata S . Three different mRNAs encoding human granulocyte colony-stimulating factor receptor. Proc Natl Acad Sci U S A 1990;87:8702-8706
CrossRef | Web of Science | Medline16
Larsen A ,Davis T ,Curtis BM , et al. Expression cloning of a human granulocyte colony-stimulating factor receptor: a structural mosaic of hematopoietin receptor: immunoglobulin, and fibronectin domains. J Exp Med 1990;172:1559-1570
CrossRef | Web of Science | Medline17
Demetri GD ,Griffin JD . Granulocyte colony-stimulating factor and its receptor. Blood 1991;78:2791-2808
Web of Science | Medline18
Dong F ,van Buitenen C ,Pouwels K ,Hoefsloot LH ,Lowenberg B ,Touw IP . Distinct cytoplasmic regions of the human granulocyte colony-stimulating factor receptor involved in induction of proliferation and maturation. Mol Cell Biol 1993;13:7774-7781
Web of Science | Medline19
Fukunaga R ,Ishizaka-Ikeda E ,Nagata S . Growth and differentiation signals mediated by different regions in the cytoplasmic domain of granulocyte colony-stimulating factor receptor. Cell 1993;74:1079-1087
CrossRef | Web of Science | Medline20
Ziegler SF ,Bird TA ,Morella KK ,Mosley B ,Gearing DP ,Baumann H . Distinct regions of the human granulocyte-colony-stimulating factor receptor cytoplasmic domain are required for proliferation and gene induction. Mol Cell Biol 1993;13:2384-2390
Web of Science | Medline21
Dong F ,Hoefsloot LH ,Schelen AM , et al. Identification of a nonsense mutation in the granulocyte-colony-stimulating factor receptor in severe congenital neutropenia. Proc Natl Acad Sci U S A 1994;91:4480-4484
CrossRef | Web of Science | Medline22
Miller SA ,Dykes DD ,Polesky HF . A simple salting out procedure for extracting DNA from human nucleated cells. Nucleic Acids Res 1988;16:1215-1215
CrossRef | Web of Science | Medline23
Chomczynski P ,Sacchi N . Single-step method of RNA isolation by acid guanidinium thiocyanate-phenol-chloroform extraction. Anal Biochem 1987;162:156-159
CrossRef | Web of Science | Medline24
Morgenstern JP ,Land H . Advanced mammalian gene transfer: high titre retroviral vectors with multiple drug selection markers and a complementary helper-free packaging cell line. Nucleic Acids Res 1990;18:3587-3596
CrossRef | Web of Science | Medline25
Greenberger JS ,Sakakeeny MA ,Humphries RK ,Eaves CJ ,Eckner RJ . Demonstration of permanent factor-dependent multipotential (erythroid/neutrophil/basophil) hematopoietic progenitor cell lines. Proc Natl Acad Sci U S A 1983;80:2931-2935
CrossRef | Web of Science | Medline26
Dong F ,van Paassen M ,van Buitenen C ,Hoefsloot LH ,Lowenberg B ,Touw IP . A point mutation in the granulocyte colony-stimulating factor receptor (G-CSF-R) gene in a case of acute myeloid leukemia in the overexpression of a novel G-CSF-R isoform. Blood 1995;85:902-911
Web of Science | Medline27
Hayhoe FGJ, Flemans RJ. Hematological cytology. 3rd ed. London: Wolfe Publishing, 1992:378.
28
Seto Y ,Fukunaga R ,Nagata S . Chromosomal gene organization of the human granulocyte colony-stimulating factor receptor. J Immunol 1992;148:259-266
Web of Science | Medline29
Cosman D . The hematopoietin receptor superfamily. Cytokine 1993;5:95-106
CrossRef | Web of Science | Medline30
Fukunaga R ,Ishizaka-Ikeda E ,Pan C-X ,Seto Y ,Nagata S . Functional domains of the granulocyte colony-stimulating factor receptor. EMBO J 1991;10:2855-2865
Web of Science | Medline31
Heldin C-H . Dimerization of cell surface receptors in signal transduction. Cell 1995;80:213-223
CrossRef | Web of Science | Medline32
Hiraoka O ,Anaguchi H ,Ota Y . Evidence of the ligand-induced conversion from a dimer to a tetramer of the granulocyte colony-stimulating factor receptor. FEBS Lett 1994;356:255-260
CrossRef | Web of Science | Medline33
Guba SC ,Boxer LA ,Emerson SG . G-CSF receptor transmembrane and intracytosolic structure in patients with congenital neutropenia. Blood 1993;82:Suppl 1:23a-23a abstract.
Web of Science34
Sandoval C ,Adams-Graves P ,Parganas E ,Wang W ,Ihle JN . The cytoplasmic portion of the G-CSF receptor is normal in patients with Kostmann syndrome. Blood 1993;82:Suppl 1:185a-185a abstract.
Web of Science35
Bonilla MA ,Dale D ,Zeidler C , et al. Long-term safety of treatment with recombinant human granulocyte colony-stimulating factor (r-metHuG-CSF) in patients with severe congenital neutropenias. Br J Haematol 1994;88:723-730
CrossRef | Web of Science | Medline36
Imashuku S ,Hibi S ,Kataoka-Morimoto Y , et al. Myelodysplasia and acute myeloid leukaemia in cases of aplastic anaemia and congenital neutropenia following G-CSF administration. Br J Haematol 1995;89:188-190
Web of Science | Medline37
Weinblatt ME ,Scimeca P ,James-Herry A ,Sahdev I ,Kochen J . Transformation of congenital neutropenia into monosomy 7 and acute nonlymphoblastic leukemia in a child treated with granulocyte colony-stimulating factor. J Pediatr 1995;126:263-265
CrossRef | Web of Science | Medline
- Citing Articles (106)
Citing Articles
1
James A. Connelly, Sung W. Choi, John E. Levine. (2011) Hematopoietic stem cell transplantation for severe congenital neutropenia. Current Opinion in Hematology1
CrossRef2
Ghada Kunter, Jill R. Woloszynek, Daniel C. Link. (2011) A truncation mutant of Csf3r cooperates with PML-RARα to induce acute myeloid leukemia in mice. Experimental Hematology
CrossRef3
Belinda R. Avalos, Aleksandr Lazaryan, Edward A. Copelan. (2011) Can G-CSF Cause Leukemia in Hematopoietic Stem Cell Donors?. Biology of Blood and Marrow Transplantation
CrossRef4
Esther Vosse, Els M. Verhard, Anton J. T. Tool, Adriëtte W. Visser, Taco W. Kuijpers, Pieter S. Hiemstra, Jaap T. Dissel. (2011) Severe congenital neutropenia in a multigenerational family with a novel neutrophil elastase (ELANE) mutation. Annals of Hematology 90:2, 151-158
CrossRef5
G Bouma, AJ Thrasher. 2011. Disorders of phagocyte function. , 263-272.
CrossRef6
Gerben Bouma, Phil J. Ancliff, Adrian J. Thrasher, Siobhan O. Burns. (2010) Recent advances in the understanding of genetic defects of neutrophil number and function. British Journal of Haematology 151:4, 312-326
CrossRef7
Koichi Oshima, Ryoji Hanada, Ryoji Kobayashi, Koji Kato, Yoshihisa Nagatoshi, Ken Tabuchi, Shunichi Kato, . (2010) Hematopoietic stem cell transplantation in patients with severe congenital neutropenia: An analysis of 18 Japanese cases. Pediatric Transplantation 14:5, 657-663
CrossRef8
R. Beekman, I. P. Touw. (2010) G-CSF and its receptor in myeloid malignancy. Blood 115:25, 5131-5136
CrossRef9
Joonhong Park, Myungshin Kim, Jihyang Lim, Yonggoo Kim, Bin Cho, Yeon-Joon Park, Kyungja Han. (2010) Molecular Analysis of Two Cases of Severe Congenital Neutropenia. The Korean Journal of Laboratory Medicine 30:2, 111
CrossRef10
Andrzej Swierniak, Marek Kimmel, Jaroslaw Smieja. (2009) Mathematical modeling as a tool for planning anticancer therapy. European Journal of Pharmacology 625:1-3, 108-121
CrossRef11
M. Germeshausen, C. P. Kratz, M. Ballmaier, K. Welte. (2009) RAS and CSF3R mutations in severe congenital neutropenia. Blood 114:16, 3504-3505
CrossRef12
Francesco Crea, Elisa Giovannetti, Pier Luigi Zinzani, Romano Danesi. (2009) Pharmacologic rationale for early G-CSF prophylaxis in cancer patients and role of pharmacogenetics in treatment optimization. Critical Reviews in Oncology/Hematology 72:1, 21-44
CrossRef13
M. Akif Yesilipek, Gulsun Tezcan, Manuela Germeshausen, Alphan Kupesiz, Vedat Uygun, Volkan Hazar. (2009) Unrelated cord blood transplantation in children with severe congenital neutropenia. Pediatric Transplantation 13:6, 777-781
CrossRef14
Albert Wölfler, Mahban Irandoust, Annemarie Meenhuis, Judith Gits, Onno Roovers, Ivo P. Touw. (2009) Site-Specific Ubiquitination Determines Lysosomal Sorting and Signal Attenuation of the Granulocyte Colony-Stimulating Factor Receptor. Traffic 10:8, 1168-1179
CrossRef15
Karl Welte, Cornelia Zeidler. (2009) Severe Congenital Neutropenia. Hematology/Oncology Clinics of North America 23:2, 307-320
CrossRef16
Y. UEMURA, T. TAGUCHI, T. KUBOTA, T. SAITO, K. BANDOBASHI, A. YOKOYAMA. (2009) Neutrophil function and cytokine-specific signaling in chronic neutrophilic leukemia. International Journal of Laboratory Hematology 31:1, 36-47
CrossRef17
Cornelia Zeidler, Manuela Germeshausen, Christoph Klein, Karl Welte. (2009) Clinical implications of ELA2 -, HAX1 -, and G-CSF-receptor ( CSF3R ) mutations in severe congenital neutropenia. British Journal of Haematology 144:4, 459-467
CrossRef18
Angela Rivers, William B. Slayton. (2009) Congenital Cytopenias and Bone Marrow Failure Syndromes. Seminars in Perinatology 33:1, 20-28
CrossRef19
Alister C Ward, David C Dale. (2009) Genetic and molecular diagnosis of severe congenital neutropenia. Current Opinion in Hematology 16:1, 9-13
CrossRef20
Nima Rezaei, Kasra Moazzami, Asghar Aghamohammadi, Christoph Klein. (2009) Neutropenia and Primary Immunodeficiency Diseases. International Reviews of Immunology 28:5, 335-366
CrossRef21
Tamila L. Kindwall-Keller, Lawrence J. Druhan, Jing Ai, Melissa G. Hunter, Pam Massullo, Megan Loveland, Belinda R. Avalos. (2008) Role of the proteasome in modulating native G-CSFR expression. Cytokine 43:2, 114-123
CrossRef22
Manuela Germeshausen, Julia Skokowa, Matthias Ballmaier, Cornelia Zeidler, Karl Welte. (2008) G-CSF receptor mutations in patients with congenital neutropenia. Current Opinion in Hematology 15:4, 332-337
CrossRef23
N. Berliner. (2008) Lessons from congenital neutropenia: 50 years of progress in understanding myelopoiesis. Blood 111:12, 5427-5432
CrossRef24
Athanasia D. Panopoulos, Stephanie S. Watowich. (2008) Granulocyte colony-stimulating factor: Molecular mechanisms of action during steady state and ‘emergency’ hematopoiesis. Cytokine 42:3, 277-288
CrossRef25
Christopher J. Gamper, Clifford M. Takemoto, Jeffrey Schowinsky, Michael J. Borowitz, Marshall S. Horwitz, John J. Strouse. (2008) Lymphadenopathy as the primary manifestation of malignant transformation in two patients with severe congenital neutropenia. Pediatric Blood & Cancer 50:5, 1072-1075
CrossRef26
J A McCubrey, L S Steelman, S L Abrams, F E Bertrand, D E Ludwig, J Bäsecke, M Libra, F Stivala, M Milella, A Tafuri, P Lunghi, A Bonati, A M Martelli. (2008) Targeting survival cascades induced by activation of Ras/Raf/MEK/ERK, PI3K/PTEN/Akt/mTOR and Jak/STAT pathways for effective leukemia therapy. Leukemia 22:4, 708-722
CrossRef27
Charlotte Marie Niemeyer, Christian Peter Kratz. (2008) Paediatric myelodysplastic syndromes and juvenile myelomonocytic leukaemia: molecular classification and treatment options. British Journal of Haematology 140:6, 610-624
CrossRef28
Stefan N. Constantinescu, Michael Girardot, Christian Pecquet. (2008) Mining for JAK–STAT mutations in cancer. Trends in Biochemical Sciences 33:3, 122-131
CrossRef29
P. Anderlini, R. E. Champlin. (2008) Biologic and molecular effects of granulocyte colony-stimulating factor in healthy individuals: recent findings and current challenges. Blood 111:4, 1767-1772
CrossRef30
Colin A. Sieff, Eric Nisbet-Brown, David G. Nathan. (2008) Congenital bone marrow failure syndromes. British Journal of Haematology 111:1, 30
CrossRef31
Jun Xia, Daniel C Link. (2008) Severe congenital neutropenia and the unfolded protein response. Current Opinion in Hematology 15:1, 1-7
CrossRef32
Charlotte M. Niemeyer, Irith Baumann. (2008) Myelodysplastic Syndrome in Children and Adolescents. Seminars in Hematology 45:1, 60-70
CrossRef33
Cornelia Zeidler, K. Welte. (2007) Angeborene Störungen der Blutbildung. Bundesgesundheitsblatt - Gesundheitsforschung - Gesundheitsschutz 50:12, 1564-1568
CrossRef34
Alejandro A Schäffer, Christoph Klein. (2007) Genetic heterogeneity in severe congenital neutropenia: how many aberrant pathways can kill a neutrophil?. Current Opinion in Allergy and Clinical Immunology 7:6, 481-494
CrossRef35
D. C. Link, G. Kunter, Y. Kasai, Y. Zhao, T. Miner, M. D. McLellan, R. E. Ries, D. Kapur, R. Nagarajan, D. C. Dale, A. A. Bolyard, L. A. Boxer, K. Welte, C. Zeidler, J. Donadieu, C. Bellanne-Chantelot, J. W. Vardiman, M. A. Caligiuri, C. D. Bloomfield, J. F. DiPersio, M. H. Tomasson, T. A. Graubert, P. Westervelt, M. Watson, W. Shannon, J. Baty, E. R. Mardis, R. K. Wilson, T. J. Ley. (2007) Distinct patterns of mutations occurring in de novo AML versus AML arising in the setting of severe congenital neutropenia. Blood 110:5, 1648-1655
CrossRef36
Nima Rezaei, Mostafa Moin, Zahra Pourpak, Asghar Ramyar, Mina Izadyar, Zahra Chavoshzadeh, Roya Sherkat, Asghar Aghamohammadi, Mehdi Yeganeh, Maryam Mahmoudi, Fatemeh Mahjoub, Manuela Germeshausen, Magda Grudzien, Marshall S. Horwitz, Christoph Klein, Abolhassan Farhoudi. (2007) The Clinical, Immunohematological, and Molecular Study of Iranian Patients with Severe Congenital Neutropenia. Journal of Clinical Immunology 27:5, 525-533
CrossRef37
C C Tigue, J M McKoy, A M Evens, S M Trifilio, M S Tallman, C L Bennett. (2007) Granulocyte-colony stimulating factor administration to healthy individuals and persons with chronic neutropenia or cancer: an overview of safety considerations from the Research on Adverse Drug Events and Reports project. Bone Marrow Transplantation 40:3, 185-192
CrossRef38
Cornelia Zeidler, Karl Welte. (2007) Hematopoietic Growth Factors for the Treatment of Inherited Cytopenias. Seminars in Hematology 44:3, 133-137
CrossRef39
Göran Carlsson, Malin Melin, Niklas Dahl, Kim Göransdotter Ramme, Magnus Nordenskjöld, Jan Palmblad, Jan-Inge Henter, Bengt Fadeel. (2007) Kostmann syndrome or infantile genetic agranulocytosis, part two: understanding the underlying genetic defects in severe congenital neutropenia. Acta Paediatrica 96:6, 813-819
CrossRef40
Lynda A. O'Sullivan, Clifford Liongue, Rowena S. Lewis, Sarah E.M. Stephenson, Alister C. Ward. (2007) Cytokine receptor signaling through the Jak–Stat–Socs pathway in disease. Molecular Immunology 44:10, 2497-2506
CrossRef41
I. P. Touw, M. Bontenbal. (2007) Granulocyte Colony-Stimulating Factor: Key (F)actor or Innocent Bystander in the Development of Secondary Myeloid Malignancy?. JNCI Journal of the National Cancer Institute 99:3, 183-186
CrossRef42
Seth J. Corey, Mark D. Minden, Dwayne L. Barber, Hagop Kantarjian, Jean C. Y. Wang, Aaron D. Schimmer. (2007) Myelodysplastic syndromes: the complexity of stem-cell diseases. Nature Reviews Cancer 7:2, 118-129
CrossRef43
Degui Geng, Sunil K. Joshi, Robert Podolsky, Jin-Xiong She. (2007) GCSF receptor regulates antigen uptake and expression of cytokines and costimulatory molecules in dendritic cells. Molecular Immunology 44:4, 521-529
CrossRef44
Julia Skokowa, Manuela Germeshausen, Cornelia Zeidler, Karl Welte. (2007) Severe congenital neutropenia: inheritance and pathophysiology. Current Opinion in Hematology 14:1, 21-28
CrossRef45
Christoph Klein, Magda Grudzien, Giridharan Appaswamy, Manuela Germeshausen, Inga Sandrock, Alejandro A Schäffer, Chozhavendan Rathinam, Kaan Boztug, Beate Schwinzer, Nima Rezaei, Georg Bohn, Malin Melin, Göran Carlsson, Bengt Fadeel, Niklas Dahl, Jan Palmblad, Jan-Inge Henter, Cornelia Zeidler, Bodo Grimbacher, Karl Welte. (2007) HAX1 deficiency causes autosomal recessive severe congenital neutropenia (Kostmann disease). Nature Genetics 39:1, 86-92
CrossRef46
Chun Chen, Xiaozhu Huang, Amha Atakilit, Quan-Sheng Zhu, Seth J. Corey, Dean Sheppard. (2006) The Integrin α9β1 Contributes to Granulopoiesis by Enhancing Granulocyte Colony-Stimulating Factor Receptor Signaling. Immunity 25:6, 895-906
CrossRef47
J Gits, D van Leeuwen, H P Carroll, I P Touw, A C Ward. (2006) Multiple pathways contribute to the hyperproliferative responses from truncated granulocyte colony-stimulating factor receptors. Leukemia 20:12, 2111-2118
CrossRef48
Charles L. Bennett, Andrew M. Evens, Leslie A. Andritsos, Lakshmi Balasubramanian, Mark Mai, Matthew J. Fisher, Timothy M. Kuzel, Cara Angelotta, June M. McKoy, Julie M. Vose, Philip J. Bierman, David J. Kuter, Steven M. Trifilio, Steven M. Devine, Martin S. Tallman. (2006) Haematological malignancies developing in previously healthy individuals who received haematopoietic growth factors: report from the Research on Adverse Drug Events and Reports (RADAR) project. British Journal of Haematology 135:5, 642-650
CrossRef49
Julia Skokowa, Gunnar Cario, Murat Uenalan, Axel Schambach, Manuela Germeshausen, Karin Battmer, Cornelia Zeidler, Ulrich Lehmann, Matthias Eder, Christopher Baum, Rudolf Grosschedl, Martin Stanulla, Michaela Scherr, Karl Welte. (2006) LEF-1 is crucial for neutrophil granulocytopoiesis and its expression is severely reduced in congenital neutropenia. Nature Medicine 12:10, 1191-1197
CrossRef50
Karl Welte, Cornelia Zeidler, David C. Dale. (2006) Severe Congenital Neutropenia. Seminars in Hematology 43:3, 189-195
CrossRef51
Kaushansky, Kenneth, . (2006) Lineage-Specific Hematopoietic Growth Factors. New England Journal of Medicine 354:19, 2034-2045
Full Text52
Lani Lieberman, Yigal Dror. (2006) Advances in understanding the genetic basis for bone-marrow failure. Current Opinion in Pediatrics 18:1, 15-21
CrossRef53
E. J. Jabbour, E. Estey, H. M. Kantarjian. (2006) Adult Acute Myeloid Leukemia. Mayo Clinic Proceedings 81:2, 247-260
CrossRef54
Björn Steffen, Carsten Müller-Tidow, Joachim Schwäble, Wolfgang E. Berdel, Hubert Serve. (2005) The molecular pathogenesis of acute myeloid leukemia. Critical Reviews in Oncology/Hematology 56:2, 195-221
CrossRef55
Yaling Qiu, Dazhong Zhuang, Alexandra MacRae, Fan Dong. (2005) The G-CSF receptor carboxyl terminus, truncated in AML/SCN, is required for induction of a Stat5 protease activity. Leukemia Research 29:10, 1153-1162
CrossRef56
Cornelia Zeidler. (2005) Congenital neutropenias. Hematology 10:4, 306-311
CrossRef57
Toshihiro Yokoyama, Seiichi Okamura, Yoshinobu Asano, Kenjirou Kamezaki, Akihiko Numata, Haruko Kakumitsu, Koutarou Shide, Hitoshi Nakashima, Taisuke Kanaji, Yuichi Sekine, Yumi Mizuno, Jun Okamura, Tadashi Matsuda, Mine Harada, Yoshiyuki Niho, Kazuya Shimoda. (2005) A Novel Mutation in the Juxtamembrane Intracellular Sequence of the Granulocyte Colony-Stimulating Factor (G-CSF) Receptor Gene in a Patient with Severe Congenital Neutropenia Augments G-CSF Proliferation Activity but Not through the MAP Kinase Cascade. International Journal of Hematology 82:1, 28-34
CrossRef58
M Germeshausen, H Schulze, C Kratz, L Wilkens, R Repp, K Shannon, K Welte, M Ballmaier. (2005) An acquired G-CSF receptor mutation results in increased proliferation of CMML cells from a patient with severe congenital neutropenia. Leukemia
CrossRef59
Scott C. Kogan. 2004. Myeloid Malignancies. .
CrossRef60
Akiro Kimura, Tanvira Afroze Sultana. (2004) Granulocyte Colony-Stimulating Factor Receptors on CD34 ++ Cells in Patients with Myelodysplastic Syndrome (MDS) and MDS-Acute Myeloid Leukemia. Leukemia & Lymphoma 45:10, 1995-2000
CrossRef61
Philip James Ancliff. (2003) Congenital neutropenia. Blood Reviews 17:4, 209-216
CrossRef62
Phil J. Ancliff, Rosemary E. Gale, Ri Liesner, Ian Hann, David C. Linch. (2003) Long-term follow-up of granulocyte colony-stimulating factor receptor mutations in patients with severe congenital neutropenia: implications for leukaemogenesis and therapy. British Journal of Haematology 120:4, 685-690
CrossRef63
David C. Dale, Tammy E. Cottle, Carol J. Fier, Audrey Anna Bolyard, Mary Ann Bonilla, Laurence A. Boxer, Bonnie Cham, Melvin H. Freedman, George Kannourakis, Sally E. Kinsey, Robert Davis, Debra Scarlata, Beate Schwinzer, Cornelia Zeidler, Karl Welte. (2003) Severe chronic neutropenia: Treatment and follow-up of patients in the Severe Chronic Neutropenia International Registry. American Journal of Hematology 72:2, 82-93
CrossRef64
James R Downing, Kevin M Shannon. (2002) Acute leukemia: A pediatric perspective. Cancer Cell 2:6, 437-445
CrossRef65
Maury Pinsk, Jeffrey Burzynski, Margaret Yhap, Robert B. Fraser, Brian Cummings, Micheline Ste-Marie. (2002) Acute Myelogenous Leukemia and Glycogen Storage Disease 1b. Journal of Pediatric Hematology/Oncology 24:9, 756-758
CrossRef66
Norihiro Awaya, Hideo Uchida, Yoshitaka Miyakawa, Kentaro Kinjo, Hiromichi Matsushita, Hideaki Nakajima, Yasuo Ikeda, Masahiro Kizaki. (2002) Novel variant isoform of G-CSF receptor involved in induction of proliferation of FDCP-2 cells: Relevance to the pathogenesis of myelodysplastic syndrome. Journal of Cellular Physiology 191:3, 327-335
CrossRef67
Cornelia Zeidler, Karl Welte. (2002) Kostmann syndrome and severe congenital neutropenia. Seminars in Hematology 39:2, 82-88
CrossRef68
Melvin H. Freedman, Blanche P. Alter. (2002) Risk of myelodysplastic syndrome and acute myeloid leukemia in congenital neutropenias. Seminars in Hematology 39:2, 128-133
CrossRef69
Judith Layton. 2002. Colony-Stimulating Factors. .
CrossRef70
Thomas Lehrnbecher, Karl Welte. (2002) HAEMATOPOIETIC GROWTH FACTORS IN CHILDREN WITH NEUTROPENIA. British Journal of Haematology 116:1, 28-56
CrossRef71
Anuradha Banerjee, Kevin M. Shannon. (2001) Leukemic Transformation in Patients With Severe Congenital Neutropenia. Journal of Pediatric Hematology/Oncology 23:8, 487-495
CrossRef72
Georgina W. Hall. (2001) Childhood myeloid leukaemias. Best Practice & Research Clinical Haematology 14:3, 573-591
CrossRef73
G Carlsson, A Fasth. (2001) Infantile genetic agranulocytosis, morbus Kostmann: Presentation of six cases from the original “Kostmann family” and a review. Acta Paediatrica 90:7, 757-764
CrossRef74
MANUELA GERMESHAUSEN, MATTHIAS BALLMAIER, KARL WELTE. (2001) Implications of Mutations in Hematopoietic Growth Factor Receptor Genes in Congenital Cytopenias. Annals of the New York Academy of Sciences 938:1, 305-321
CrossRef75
M. Ann Smith, J. Graham Smith. (2001) The use of granulocyte colony-stimulating factor for treatment of autoimmune neutropenia. Current Opinion in Hematology 8:3, 165-169
CrossRef76
Peter B. Langmuir, Richard Aplenc, Beverly J. Lange. (2001) Acute myeloid leukaemia in children. Best Practice & Research Clinical Haematology 14:1, 77-93
CrossRef77
Lars M. Wagner, Wayne L. Furman. (2001) Haemopoietic Growth Factors in Paediatric Oncology. Paediatric Drugs 3:3, 195-217
CrossRef78
Colin A. Sieff, Eric Nisbet-Brown, David G. Nathan. (2000) Congenital bone marrow failure syndromes. British Journal of Haematology 111:1, 30-42
CrossRef79
D.F. Stroncek, D.L. Confer, S.F. Leitman. (2000) Peripheral blood progenitor cells for HPC transplants involving unrelated donors. Transfusion 40:6, 731-741
CrossRef80
C. Zeidler, L. Boxer, D. C. Dale, M. H. Freedman, S. Kinsey, K. Welte. (2000) Management of kostmann syndrome in the g-csf era. British Journal of Haematology 109:3, 490-495
CrossRef81
Ivo P Touw, John P De Koning, Alister C Ward, Mirjam H.A Hermans. (2000) Signaling mechanisms of cytokine receptors and their perturbances in disease. Molecular and Cellular Endocrinology 160:1-2, 1-9
CrossRef82
Lowenberg, Bob, Downing, James R., Burnett, Alan, . (1999) Acute Myeloid Leukemia. New England Journal of Medicine 341:14, 1051-1062
Full Text83
Craig L Semerad, Jennifer Poursine-Laurent, Fulu Liu, Daniel C Link. (1999) A Role for G-CSF Receptor Signaling in the Regulation of Hematopoietic Cell Function but Not Lineage Commitment or Differentiation. Immunity 11:2, 153-161
CrossRef84
Rajendra V. Deshpande, Parviz Lalezari, Robert G. Pergolizzi, Malcolm A. S. Moore. (1999) Structural Abnormalities in the G-CSF Receptor in Severe Congenital Neutropenia. Journal of Hematotherapy <html_ent glyph="@amp;" ascii="&"/> Stem Cell Research 8:4, 411-420
CrossRef85
P Grimley. (1999) Stat5a and Stat5b: fraternal twins of signal transduction and transcriptional activation. Cytokine & Growth Factor Reviews 10:2, 131-157
CrossRef86
HOLGER W. AUNER, MICHAEL KLINTSCHAR, RICHARD CREVENNA, CHRISTINE BEHAM-SCHMID, GERALD HOEFLER, GERLINDE MITTERBAUER, WERNER LINKESCH, HEINZ SILL. (1999) Two case studies of chronic idiopathic neutropenia preceding acute myeloid leukaemia. British Journal of Haematology 105:2, 431-433
CrossRef87
Silke Biethahn, Frauke Alves, Sabine Wilde, Wolfgang Hiddemann, Karsten Spiekermann. (1999) Expression of granulocyte colony-stimulating factor– and granulocyte-macrophage colony-stimulating factor–associated signal transduction proteins of the JAK/STAT pathway in normal granulopoiesis and in blast cells of acute myelogenous leukemia. Experimental Hematology 27:5, 885-894
CrossRef88
A. HERBST, M. KOESTER, D. WIRTH, H. HAUSER, K. WELTE. (1999) G-CSF Receptor Mutations in Patients with Severe Congenital Neutropenia Do Not Abrogate Jak2 Activation and Stat1/Stat3 Translocation. Annals of the New York Academy of Sciences 872:1 HEMATOPOIETIC, 320-327
CrossRef89
K. Mark Coggeshall. (1999) Negative signaling in health and disease. Immunologic Research 19:1, 47-64
CrossRef90
Ichiro Noda, Shigeharu Fujieda, Toshio Ohtsubo, Hideaki Tsuzuki, Nobuyuki Tanaka, Hiroshi Sunaga, Hitoshi Saito. (1999) Granulocyte-colony-stimulating factor enhances invasive potential of human head-and-neck-carcinoma cell lines. International Journal of Cancer 80:1, 78-84
CrossRef91
Warren S. Alexander, Nicos A. Nicola. (1998) Hemopoietic growth factor receptor abnormalities in leukemia. Leukemia Research 22:12, 1097-1111
CrossRef92
Pierluigi Strippoli, Anna Savoia, Achille Iolascon, Roberto Tonelli, Maria Savino, Paola Giordano, Michele D'avanzo, Fausta Massolo, Franco Locatelli, Caterina Borgna, Domenico DE Mattia, Leopoldo Zelante, Guido Paolucci, Gian Paolo Bagnara. (1998) Mutational screening of thrombopoietin receptor gene (c-mpl) in patients with congenital thrombocytopenia and absent radii (TAR). British Journal of Haematology 103:2, 311-314
CrossRef93
Leif Stenke, Mikael Sjolinder, Thomas D. Miale, Jan Ake Lindgren. (1998) Novel enzymatic abnormalities in AML and CML in blast crisis: elevated leucocyte leukotriene C4 synthase activity paralleled by deficient leukotriene biosynthesis from endogenous substrate. British Journal of Haematology 101:4, 728-736
CrossRef94
Tanya Bernard, Rosemary E. Gale, Jane P. M. Evans, David C. Linch. (1998) Mutations of the granulocyte-colony stimulating factor receptor in patients with severe congenital neutropenia are not required for transformation to acute myeloid leukaemia and may be a bystander phenomenon. British Journal of Haematology 101:1, 141-149
CrossRef95
Shoichiro Shibata, Yoshinobu Asano, Toshihiro Yokoyama, Kazuya Shimoda, Hitoshi Nakashima, Seiichi Okamura, Yoshiyuki Niho. (1998) Analysis of the granulocyte colony-stimulating factor receptor gene structure using PCR-SSCP in myeloid leukemia and myelodysplastic syndrome. European Journal of Haematology 60:3, 197-201
CrossRef96
Etsuko Yamazaki, Heiwa Kanamori, Jun Taguchi, Hiroshi Harano, Hiroshi Mohri, Takao Okubo. (1997) The Evidence of Clonal Evolution with Monosomy 7 in Aplastic Anemia Following Granulocyte Colony-Stimulating Factor Using the Polymerase Chain Reaction. Blood Cells, Molecules, and Diseases 23:2, 213-218
CrossRef97
Pui, Ching-Hon, Boyett, James M., Hughes, Walter T., Rivera, Gaston K., Hancock, Michael L., Sandlund, John T., Synold, Timothy, Relling, Mary V., Ribeiro, Raul C., Crist, William M., Evans, William E., . (1997) Human Granulocyte Colony-Stimulating Factor after Induction Chemotherapy in Children with Acute Lymphoblastic Leukemia. New England Journal of Medicine 336:25, 1781-1787
Full Text98
Nicola Tidow, Christina Pilz, Brigitte Kasper, Karl Welte. (1997) Frequency of point mutations in the gene for the G‐CSF receptor in patients with chronic neutropenia undergoing G‐CSF therapy. Stem Cells 15:S2, 113-120
CrossRef99
E. Johnson, F.E. Cotter. (1997) Monosomy 7 and 7q- associated with myeloid malignancy. Blood Reviews 11:1, 46-55
CrossRef100
Sylvia Bellucci. (1997) 8 Megakaryocytes and inherited thrombocytopenias. Baillière's Clinical Haematology 10:1, 149-162
CrossRef101
Fulu Liu, Huai Yang Wu, Robin Wesselschmidt, Tad Kornaga, Daniel C Link. (1996) Impaired Production and Increased Apoptosis of Neutrophils in Granulocyte Colony-Stimulating Factor Receptor–Deficient Mice. Immunity 5:5, 491-501
CrossRef102
Stephanie S. Watowich, Hong Wu, Merav Socolovsky, Ursula Klingmuller, Stefan N. Constantinescu, Harvey F. Lodish. (1996) CYTOKINE RECEPTOR SIGNAL TRANSDUCTION AND THE CONTROL OF HEMATOPOIETIC CELL DEVELOPMENT. Annual Review of Cell and Developmental Biology 12:1, 91-128
CrossRef103
Ivo P. Touw, Fan Dong. (1996) Severe congenital neutropenia terminating in acute myeloid leukemia: Disease progression associated with mutations in the granulocyte-colony stimulating factor receptor gene. Leukemia Research 20:8, 629-631
CrossRef104
Eric L. Sievers, David C. Dale. (1996) Non-malignant neutropenia. Blood Reviews 10:2, 95-100
CrossRef105
I.P. Touw, F. Dong. (1996) Hematopoietic Growth Factors in Leukemia. Pathology - Research and Practice 192:7, 734-742
CrossRef106
Naparstek, Elizabeth, . (1995) Granulocyte Colony-Stimulating Factor, Congenital Neutropenia, and Acute Myeloid Leukemia. New England Journal of Medicine 333:8, 516-518
Full Text
