Original Article
Association of a Polymorphism in the β3-Adrenergic–Receptor Gene with Features of the Insulin Resistance Syndrome in Finns
N Engl J Med 1995; 333:348-352August 10, 1995
- Abstract
Background
Because visceral obesity predicts insulin resistance, we studied whether alterations in the gene encoding for the β3-adrenergic receptor in visceral fat are associated with insulin resistance.
Methods
We studied the frequency of a cytosine-to-thymidine mutation that results in the replacement of tryptophan by arginine at position 64 (Trp64Arg) of the β3-adrenergic receptor by restriction-enzyme digestion with BstOI in 335 subjects from western Finland, 207 of whom were nondiabetic and 128 of whom had non-insulin-dependent diabetes mellitus (NIDDM). We also determined the frequency of the mutation in 156 subjects from southern Finland. Sensitivity to insulin was measured by the hyperinsulinemic–euglycemic clamp technique in 66 randomly selected nondiabetic subjects.
Results
In the subjects from western Finland, the frequency of the mutated allele was similar in the nondiabetic subjects and the subjects with NIDDM (12 vs. 11 percent). The mean age of the subjects at the onset of diabetes was lower among those with the mutation than those without it (56 vs. 61 years, P = 0.04). Among the nondiabetic subjects, those with the mutation had a higher ratio of waist to hip circumference (P = 0.02), a greater increase in the serum insulin response after the oral administration of glucose (P = 0.05), a higher diastolic blood pressure (82 vs. 78 mm Hg, P = 0.01), and a lower rate of glucose disposal during the clamp study (5.3 vs. 6.5 mg [29 vs. 36 μmol] per kilogram of body weight per minute; P = 0.04) than the subjects without the mutated allele. In an analysis of sibling pairs, the siblings with the mutation generally had higher waist:hip ratios (P = 0.05) and higher responses of blood glucose and serum insulin after the oral administration of glucose than their siblings without the mutation (P = 0.02 and P = 0.005, respectively).
Conclusions
The Trp64Arg allele of the β3-adrenergic receptor is associated with abdominal obesity and resistance to insulin and may contribute to the early onset of NIDDM.
Media in This Article
Figure 2
Differences between Siblings in the Ratio of the Waist to the Hip Circumference and in the Area under the Curve for the Serum Insulin Concentration 120 Minutes after the Oral Administration of Glucose.Figure 1
Detection of Trp64Arg Polymorphism of the β3-Adrenergic Receptor by PCR and Analysis of Restriction-Fragment–Length Polymorphism.Article Activity
- Article
Resistance to insulin in skeletal muscle has often been attributed to concomitant obesity, particularly abdominal obesity,1-5 and associated with glucose intolerance, hypertension, and dyslipidemia.6 Whether abdominal obesity leads to insulin resistance or the reverse, or whether both conditions are a consequence of a third factor, possibly genetic, is not known. The theory of a genetic basis is supported by findings of insulin resistance and increased abdominal obesity in first-degree family members of patients with non-insulin-dependent diabetes mellitus (NIDDM)7 (and unpublished data). There are several putative candidates for this genetic factor, including the recently cloned ob gene,8 tumor necrosis factor-α,9 and the β3-adrenergic–receptor gene.10
The β3-adrenergic receptor is expressed in visceral fat in humans11 and is considered responsible for increases in lipolysis and the delivery of free fatty acid into the portal vein.12 An increase in visceral fat mass, in turn, correlates with resistance to insulin in skeletal muscle.13 An abnormality in the β3-adrenergic receptor could therefore explain the link between abdominal obesity and insulin resistance. To test this hypothesis, we studied nondiabetic subjects and subjects with NIDDM to detect polymorphism in the gene for the β3-adrenergic receptor, which is described by Walston et al. in this issue of the Journal, 14 and related the receptor genotypes to estimates of insulin sensitivity and abdominal obesity.
Methods
Study Subjects
All the subjects were participants in the ongoing Bothnia Study in western Finland, which began in 1990 with the goal of identifying early metabolic defects and genetic alterations in families with NIDDM. In this study, 128 subjects with NIDDM (67 women and 61 men) among whom there were no first-degree relationships and 207 similarly unrelated nondiabetic subjects (108 women and 99 men) were randomly selected from the population of western Finland. We studied the polymorphism of the β3-adrenergic receptor that results in the replacement of tryptophan with arginine at position 64 (Trp64Arg) in 17 normoglycemic pairs of siblings of the same sex, one of each pair being homozygous for the Trp64 allele and the other being heterozygous for the mutation, and compared the effect of the polymorphism on obesity and glucose metabolism within each pair. The allelic frequencies associated with the β3-adrenergic receptor were also determined in a group of 79 subjects with NIDDM and 77 nondiabetic subjects, all from southern Finland. The study was approved by the local ethics committees, and all subjects gave their informed consent.
Metabolic Characterization of the Subjects
Glucose tolerance was assessed by administering 75 g of glucose orally after an overnight fast. Venous-blood samples were drawn 10 minutes before the glucose ingestion, at the time of the ingestion, and 30, 60, and 120 minutes thereafter for the determination of blood glucose and serum insulin concentrations. Fat-free mass was measured by infrared spectroscopy of the outer layer of the biceps on the dominant arm with a Futrex 5000 device (Futrex, Gaithersburg, Md.). The subject's waist was measured with a soft tape midway between the lowest rib and the iliac crest. The hip circumference was measured at the widest part of the gluteal region. Blood pressure was measured in the right arm after 30 minutes of rest, with the subject seated. A subgroup of subjects randomly selected from the group from western Finland were studied by the hyperinsulinemic–euglycemic clamp technique (in which the insulin concentration was raised by 80 μU per milliliter), as described elsewhere.7
Assays
Blood glucose concentrations after oral glucose administration were measured by a hexokinase method (Boehringer–Mannheim, Mannheim, Germany). Plasma glucose concentrations during the clamp study were measured by a glucose oxidase method (Beckman Glucose Analyzer II, Beckman Instruments, Fullerton, Calif.). Serum insulin concentrations were measured by a radioimmunoassay (Pharmacia, Uppsala, Sweden) with an interassay coefficient of variation of 7.5 percent. The increased area under the curve for the concentrations of glucose and insulin was calculated by the trapezoidal rule. Serum concentrations of total cholesterol, high-density lipoprotein (HDL) cholesterol (after precipitation), and triglycerides were measured with a Cobas Mira analyzer (Hoffmann–LaRoche, Basel, Switzerland).
Detection of the Trp64Arg Polymorphism
The polymerase chain reaction (PCR) was carried out in a volume of 15 μl containing 25 ng of genomic DNA from leukocytes; 10 pmol each of the primers BSTNUP (5'CGCCCAATACCGCCAACAC) and BSTNDOWN (5'CCACCAGGAGTCCCATCACC); 200 μM each of deoxyadenosine triphosphate, deoxycytidine triphosphate, deoxyguanosine triphosphate, and deoxythymidine triphosphate, in 1.5 mM magnesium chloride; 10 mM TRIS–hydrochloric acid (pH 9.0); 50 mM potassium chloride; 0.1 percent Triton ×-100; 4 percent formamide (pH 8.0); and 0.5 unit of Taq polymerase (Promega, Madison, Wis.). The PCR reactions (Perkin-Elmer 9600, Norwalk, Conn.) began with denaturation at 94°C for 5 minutes, followed by 35 cycles of denaturation at 94°C for 30 seconds, annealing at 61°C for 30 seconds, extension at 72°C for 30 seconds, with a final extension at 72°C for 10 minutes.
The amplified PCR products were digested with the addition of 5 μl of a mixture containing 30 mM TRIS–hydrochloric acid (pH 7.9), 30 mM magnesium chloride, 150 mM sodium chloride, and 5 units of BstOI, a restriction enzyme specific for the sequence CC(A/T)GG (Promega); this mixture was incubated at 60°C for two hours. The digested samples were separated by electrophoresis through a 3 percent agarose gel (Multipurpose agarose, Appligene, Illkirch, France) and visualized by staining with ethidium bromide.
Statistical Analysis
The results are presented as means ±SD. Differences between group means were tested by Student's t-test, and for variables that were not normally distributed, by the Mann–Whitney U test. The chi-square test was used to compare frequencies. Differences between sibling pairs were tested by the nonparametric Wilcoxon's test. Correlations were calculated with Spearman's rank-correlation test.
Results
Frequency of the Trp64Arg Polymorphism among β3-Adrenergic–Receptor Alleles
Digestion of the 210-base-pair (bp) PCR product with BstOI produced fragments of the following sizes: 99, 62, 30, 12, and 7 bp in Trp64 homozygotes; 161, 99, 62, 30, 12, and 7 bp in Trp64/Arg64 heterozygotes; and 161, 30, 12, and 7 bp in Arg64 homozygotes (Figure 1Figure 1
Detection of Trp64Arg Polymorphism of the β3-Adrenergic Receptor by PCR and Analysis of Restriction-Fragment–Length Polymorphism.). The smallest of these fragments (30, 12, and 7 bp) were too small to be resolved on the gel. There was no difference between the diabetic and nondiabetic subjects in the frequency of the Trp64 and Arg64 alleles (Table 1Table 1
Frequency of the Trp64 and Arg64 Alleles among Nondiabetic Subjects and Subjects with NIDDM in Two Areas of Finland.). Two nondiabetic subjects from western Finland were homozygous for Arg64, as were two diabetic subjects from southern Finland.Association between the Trp64Arg Polymorphism, Sensitivity to Insulin, and Obesity
Nondiabetic subjects with the Arg64 allele generally had higher ratios of waist to hip circumference than nondiabetic Trp64 homozygotes (P = 0.02), despite similar values for body-mass index (the weight in kilograms divided by the square of the height in meters) and fat mass (Table 2Table 2
Clinical Characteristics of Nondiabetic Subjects and Subjects with NIDDM, According to the Presence of the Arg64 Mutation.). This difference was primarily due to differences among women. Nondiabetic subjects with the Arg64 mutation also had higher concentrations of blood glucose and serum insulin two hours after the oral ingestion of glucose than did the nondiabetic Trp64 homozygotes and had higher diastolic blood pressures than the Trp64 homozygotes (P = 0.01). Sensitivity to insulin was assessed in 66 randomly selected nondiabetic subjects, 16 of whom were heterozygotes and 50 of whom were Trp64 homozygotes. The rate of insulin-stimulated glucose disposal was 18 percent less in the subjects with the Arg64 allele than in the Trp64 homozygotes (mean [±SD], 5.3±2.3 vs. 6.5±2.5 mg [29±13 vs. 36±14 μmol] per kilogram of body weight per minute; P = 0.04).The onset of diabetes occurred at an earlier age in the subjects with NIDDM who had the Arg64 allele than in those who did not have that allele (P = 0.04). The two groups were similar with respect to body-mass index, fat mass, and waist:hip ratio (Table 2).
In the analysis of sibling pairs, the heterozygotes tended to be more obese than the Trp64 homozygotes (mean difference in weight, 6 kg; in body-mass index, 2.3; P = 0.18 and P = 0.20, respectively). The ratio of waist to hip circumference was generally higher in the member of each pair who had the Arg64 allele than in the one who did not (mean difference, 0.04; P = 0.05) (Figure 2Figure 2
Differences between Siblings in the Ratio of the Waist to the Hip Circumference and in the Area under the Curve for the Serum Insulin Concentration 120 Minutes after the Oral Administration of Glucose.). In addition, the areas under the curves for both the blood glucose and the serum insulin concentrations 120 minutes after the ingestion of glucose were larger for the siblings who had the Arg64 allele than for those who did not (mean difference for glucose, 2124 mg per deciliter [118 mmol per liter]; for insulin, 4071 mU per liter [24,430 pmol per liter]; P = 0.02 and P = 0.005, respectively) (Figure 2).Discussion
The nondiabetic subjects with the Arg64 mutation of the gene for the β3-adrenergic receptor had several characteristics of the insulin resistance syndrome6 — increased ratio of waist to hip circumference, glucose intolerance, hyperinsulinemia, and elevated blood pressure. The presence of insulin resistance was further established by measuring insulin sensitivity directly in a subgroup of the subjects. The findings of an increased ratio of waist to hip circumference and a decreased sensitivity to insulin were confirmed by an analysis of sibling pairs.
How could the β3-adrenergic receptor be pathogenically involved in the development of insulin resistance in muscle? Increased deposits of abdominal fat could provide more free fatty acids for the synthesis of very-low-density lipoproteins in the liver, which could result in changes in the fatty-acid composition of skeletal-muscle membranes15 or higher concentrations of triglycerides in muscle. In rats, the accumulation of triglycerides in muscle is related to the impaired action of insulin.16 In humans, visceral obesity is associated with the enhanced sensitivity of visceral fat to catecholamine-induced lipolysis,12 primarily mediated through effects on the β3-adrenergic receptor. Visceral obesity is also associated with decreased uptake of free fatty acid by muscle and with insulin resistance in skeletal muscle — in particular, impaired synthesis of insulin-stimulated glycogen.13 The putative role of the β3-adrenergic receptor in this scenario remains to be elucidated.
Insulin resistance is a major predictor of NIDDM.17 In the subjects with NIDDM who had the Arg64 allele, the onset of diabetes was significantly earlier than in the subjects who did not have this allele. These findings are consistent with those in Pima Indians, although diabetes had its onset about 20 years earlier in the Pima Indians than in our subjects.14 In contrast to the nondiabetic subjects, the diabetic subjects were not found to differ in the ratio of waist to hip circumference according to the genotype of the β3-adrenergic receptor. Possibly, potential differences among these patients were masked by their concomitant hyperglycemia and its treatment.
The Arg64 allele could have been expected to be more frequent in subjects with NIDDM than in nondiabetic subjects. This was not the case, however, either in this study or in the study of the Pima Indians.14 If anything, the Arg64 allele was underrepresented among the subjects with diabetes, especially the men (risk ratio, 0.6; P = 0.23). In the Pima Indians, there was an age-dependent decrease in the frequency of the Arg64 allele among men.14 One explanation for this finding is that insulin resistance is associated with increased mortality from cardiovascular causes in men with NIDDM.
In conclusion, the presence of the Arg64 allele in the first intracellular loop of the β3-adrenergic–receptor gene may predispose patients to abdominal obesity, which may in turn predispose them to insulin resistance and the earlier onset of NIDDM. Determining the molecular mechanisms by which this change in amino acids in the β3-adrenergic receptor exerts this action should provide important insights into the genetic basis of abdominal obesity and insulin resistance.
Supported by a grant (10858) from the Swedish Medical Research Council and by the Sigrid Juselius Foundation, the Novo Nordisk Foundation, the Crafoord Foundation, the Medical Society of Finland, the Påhlsson Foundation, and the Perklén Foundation.
We are indebted to the research team of the Bothnia Study for their skillful assistance.
Source Information
From the Department of Endocrinology, University of Lund, Lund, Sweden (E.W., M.L., T.K., L.C.G.); the Fourth Department of Medicine, Helsinki University Hospital, Helsinki, Finland (E.W.); and the Division of Geriatric Medicine and Gerontology, Johns Hopkins University School of Medicine, Baltimore (J.W., A.R.S.).
Address reprint requests to Dr. Groop at the Department of Endocrinology, Malmö University Hospital, 205 02 Malmö, Sweden.
- References
References
1
DeFronzo RA . The triumvirate: β-cell, muscle, liver: a collusion responsible for NIDDM. Diabetes 1988;37:667-687
Web of Science | Medline2
Ferrannini E ,Haffner SM ,Mitchell BD ,Stern MP . Hyperinsulinaemia: the key feature of a cardiovascular and metabolic syndrome. Diabetologia 1991;34:416-422
CrossRef | Web of Science | Medline3
Caro JF . Insulin resistance in obese and nonobese man. J Clin Endocrinol Metab 1991;73:691-695
CrossRef | Web of Science | Medline4
Marin P ,Andersson B ,Ottosson M , et al. The morphology and metabolism of intraabdominal adipose tissue in men. Metabolism 1992;41:1242-1248
CrossRef | Web of Science | Medline5
Pouliot M-C ,Despres J-P ,Nadeau A , et al. Visceral obesity in men: associations with glucose tolerance, plasma insulin, and lipoprotein levels. Diabetes 1992;41:826-834
CrossRef | Web of Science | Medline6
Reaven GM . Role of insulin resistance in human disease. Diabetes 1988;37:1595-1607
CrossRef | Web of Science | Medline7
Eriksson J ,Franssila-Kallunki A ,Ekstrand A , et al. Early metabolic defects in persons at increased risk for non-insulin-dependent diabetes mellitus. N Engl J Med 1989;321:337-343
Full Text | Web of Science | Medline8
Zhang Y ,Proenca R ,Maffei M ,Barone M ,Leopold L ,Friedman JM . Positional cloning of the mouse obese gene and its human homologue. Nature 1994;372:425-432
CrossRef | Web of Science | Medline9
Hotamisligil GS ,Shargill NS ,Spiegelman BM . Adipose expression of tumor necrosis factor-α: direct role in obesity-linked insulin resistance. Science 1993;259:87-91
CrossRef | Web of Science | Medline10
Emorine LJ ,Marullo S ,Briend-Sutren M-M , et al. Molecular characterization of the human β3-adrenergic receptor. Science 1989;245:1118-1121
CrossRef | Web of Science | Medline11
Krief S ,Lonnqvist F ,Raimbault S , et al. Tissue distribution of β3-adrenergic receptor mRNA in man. J Clin Invest 1993;91:344-349
CrossRef | Web of Science | Medline12
Lonnqvist F ,Thorne A ,Nilsell K ,Hoffstedt J ,Arner P . A pathogenetic role of visceral fat β3-adrenoreceptors in obesity. J Clin Invest 1995;95:1109-1116
CrossRef | Web of Science | Medline13
Colberg SR ,Simoneau J-A ,Thaete FL ,Kelley DE . Skeletal muscle utilization of free fatty acids in women with visceral obesity. J Clin Invest 1995;95:1846-1853
CrossRef | Web of Science | Medline14
Walston J ,Silver K ,Bogardus C , et al. Time of onset of non-insulin-dependent diabetes mellitus and genetic variation in the β3-adrenergic-receptor gene. N Engl J Med 1995;333:343-347
Full Text | Web of Science | Medline15
Borkman M ,Storlien LH ,Pan DA ,Jenkins AB ,Chisholm DJ ,Campbell LV . The relationship between insulin sensitivity and the fatty-acid composition of skeletal-muscle phospholipids. N Engl J Med 1993;328:238-244
Full Text | Web of Science | Medline16
Storlien LH ,Jenkins AB ,Chisholm DJ ,Pascoe WS ,Khouri S ,Kraegen EW . Influence of dietary fat composition on development of insulin resistance in rats: relationship to muscle triglyceride and ω-3 fatty acids in muscle phospholipid. Diabetes 1991;40:280-289
CrossRef | Web of Science | Medline17
Martin BC ,Warram JH ,Krolewski AS ,Bergman RN ,Soeldner JS ,Kahn CR . Role of glucose and insulin resistance in development of type 2 diabetes mellitus: results of a 25-year follow-up study. Lancet 1992;340:925-929
CrossRef | Web of Science | Medline
- Citing Articles (187)
Citing Articles
1
Peter von Homeyer, Debra A. Schwinn. (2011) Pharmacogenomics of β-Adrenergic Receptor Physiology and Response to β-Blockade. Anesthesia & Analgesia1
CrossRef2
Guo Yang, Jon G.H. Hickford, Huitong Zhou, Qian Fang, Rachel H. Forrest. (2011) Extended Haplotype Analysis of Ovine ADRB3 Using Polymerase Chain Reaction Single Strand Conformational Polymorphism on Two Regions of the Gene. DNA and Cell Biology 30:7, 445-448
CrossRef3
Aya Tahara, Yoneatsu Osaki, Takuji Kishimoto. (2011) Influence of beta 3-adrenergic receptor Trp64Arg polymorphism on the improvement of metabolic syndrome by exercise-based intervention in Japanese middle-aged males. Obesity Research & Clinical Practice 5:2, e109-e117
CrossRef4
Safarina G Malik, Made R Saraswati, Ketut Suastika, Hidayat Trimarsanto, Sukma Oktavianthi, Herawati Sudoyo. (2011) Association of beta3-adrenergic receptor (ADRB3) Trp64Arg gene polymorphism with obesity and metabolic syndrome in the Balinese: a pilot study. BMC Research Notes 4:1, 167
CrossRef5
Aibek E Mirrakhimov, Alina S Kerimkulova, Olga S Lunegova, Cholpon B Moldokeeva, Yulia V Zalesskaya, Samai S Abilova, Nurmira A Sovhozova, Almaz A Aldashev, Erkin M Mirrakhimov. (2011) An association between TRP64ARG polymorphism of the B3 adrenoreceptor gene and some metabolic disturbances. Cardiovascular Diabetology 10:1, 89
CrossRef6
Aya Tahara, Yoneatsu Osaki, Takuji Kishimoto. (2010) Effect of the β3-adrenergic receptor gene polymorphism Trp64Arg on BMI reduction associated with an exercise-based intervention program in Japanese middle-aged males. Environmental Health and Preventive Medicine 15:6, 392-397
CrossRef7
Jiang Hu, Huitong Zhou, Anna Smyth, Yuzhu Luo, Jon G. H. Hickford. (2010) Polymorphism of the bovine ADRB3 gene. Molecular Biology Reports 37:7, 3389-3392
CrossRef8
S. Colagiuri. (2010) Diabesity: therapeutic options. Diabetes, Obesity and Metabolism 12:6, 463-473
CrossRef9
Y. Wang, A. O. Y. Luk, R. C. W. Ma, W. Y. So, C. H. T. Tam, M. C. Y. Ng, X. Yang, L. Baum, V. Lam, P. C. Y. Tong, J. C. N. Chan. (2010) Independent predictive roles of eotaxin Ala23Thr, paraoxonase 2 Ser311Cys and β 3 -adrenergic receptor Trp64Arg polymorphisms on cardiac disease in Type 2 Diabetes-an 8-year prospective cohort analysis of 1297 patients. Diabetic Medicine 27:4, 376-383
CrossRef10
Jun-jing Jia, Yun-bo Tian, Zhen-hui Cao, Lin-li Tao, Xi Zhang, Si-zhen Gao, Chang-rong Ge, Qiu-Ye Lin, M. Jois. (2010) The polymorphisms of UCP1 genes associated with fat metabolism, obesity and diabetes. Molecular Biology Reports 37:3, 1513-1522
CrossRef11
Karani S. Vimaleswaran, Ruth J.F. Loos. (2010) Progress in the genetics of common obesity and type 2 diabetes. Expert Reviews in Molecular Medicine 12,
CrossRef12
Kazuko Masuo. (2010) Roles of Beta2- and Beta3-Adrenoceptor Polymorphisms in Hypertension and Metabolic Syndrome. International Journal of Hypertension 2010, 1-12
CrossRef13
Mitsuya Yamakita, Daisuke Ando, Sa Tang, Zentaro Yamagata. (2010) The Trp64Arg Polymorphism of the β3-adrenergic Receptor Gene is Associated with Weight Changes in obese Japanese Men: A 4-year Follow-up Study. Journal of PHYSIOLOGICAL ANTHROPOLOGY 29:4, 133-139
CrossRef14
Ruth J. F. Loos. (2009) Recent progress in the genetics of common obesity. British Journal of Clinical Pharmacology 68:6, 811-829
CrossRef15
Rachele Cagliani, Matteo Fumagalli, Uberto Pozzoli, Stefania Riva, Giacomo P. Comi, Federica Torri, Fabio Macciardi, Nereo Bresolin, Manuela Sironi. (2009) Diverse Evolutionary Histories for β-adrenoreceptor Genes in Humans. The American Journal of Human Genetics 85:1, 64-75
CrossRef16
(2009) Association of β3-Adrenergic Receptor Polymorphisms and High-Density Lipoprotein Cholesterol. Journal of Life Science 19:5, 664-670
CrossRef17
Aneta Stefanidis, Aaron N.A. Verty, Andrew M. Allen, Neil C. Owens, Michael A. Cowley, Brian J. Oldfield. (2009) The Role of Thermogenesis in Antipsychotic Drug-induced Weight Gain. Obesity 17:1, 16-24
CrossRef18
Emiko Morita, Hiroshi Taniguchi, Motoyoshi Sakaue. (2009) Trp64Arg Polymorphism in Beta3-Adrenergic Receptor Gene Is Associated with Decreased Fat Oxidation Both in Resting and Aerobic Exercise in the Japanese Male. Experimental Diabetes Research 2009, 1-5
CrossRef19
T H Lan, E W Loh, M S Wu, T M Hu, P Chou, T Y Lan, H-J Chiu. (2008) Performance of a neuro-fuzzy model in predicting weight changes of chronic schizophrenic patients exposed to antipsychotics. Molecular Psychiatry 13:12, 1129-1137
CrossRef20
M. Sjögren, V. Lyssenko, A. Jonsson, G. Berglund, P. Nilsson, L. Groop, M. Orho-Melander. (2008) The search for putative unifying genetic factors for components of the metabolic syndrome. Diabetologia 51:12, 2242-2251
CrossRef21
Shinichi Kuriyama, Taichi Shimazu, Atsushi Hozawa, Shigeo Kure, Naoyuki Kurokawa, Masako Kakizaki, Toshimasa Sone, Kaori Matsuda-Ohmori, Naoki Nakaya, Hiroshi Satoh, Ichiro Tsuji. (2008) No effect of the Trp64Arg variant of the β3-adrenergic receptor gene on weight loss by diet and exercise intervention among Japanese adults. Metabolism 57:11, 1570-1575
CrossRef22
Barbara Zanone Poma, Agostino Riva, Milena Nasi, Paola Cicconi, Valentina Broggini, Alessandro Cozzi Lepri, Daniela Mologni, Francesco Mazzotta, Antonella DʼArminio Monforte, Cristina Mussini, Andrea Cossarizza, Massimo Galli. (2008) Genetic polymorphisms differently influencing the emergence of atrophy and fat accumulation in HIV-related lipodystrophy. AIDS 22:14, 1769-1778
CrossRef23
N Kurokawa, E H Young, Y Oka, H Satoh, N J Wareham, M S Sandhu, R J F Loos. (2008) The ADRB3 Trp64Arg variant and BMI: a meta-analysis of 44 833 individuals. International Journal of Obesity 32:8, 1240-1249
CrossRef24
A.P. Gjesing, G. Andersen, K. Borch-Johnsen, T. Jørgensen, T. Hansen, O. Pedersen. (2008) Association of the β3-adrenergic receptor Trp64Arg polymorphism with common metabolic traits: Studies of 7605 middle-aged white people. Molecular Genetics and Metabolism 94:1, 90-97
CrossRef25
Ki-Ok Shin, Hyun-Jun Kim, Sung-Hwun Kang. (2008) Alterations of Heart Rate Variability upon β3-Adrenergic Receptor Polymorphism and Combined Capsaicin, Sesamin, and L-Carnitine in Humans. Journal of Life Science 18:3, 291-297
CrossRef26
M. H. Zafarmand, Y. T. Van Der Schouw, D. E. Grobbee, P. W. De Leeuw, M. L. Bots. (2008) T64A polymorphism in β3-adrenergic receptor gene (ADRB3) and coronary heart disease: a case-cohort study and meta-analysis. Journal of Internal Medicine 263:1, 79-89
CrossRef27
Taku Hamada, Kazuhiko Kotani, Akane Higashi, Junko Ikeda, Emi Tagaki, Aiko Igarashi, Chikanobu Matsubara, Toshihide Yoshida, Naoki Sakane. (2008) Lack of Association of the Trp64Arg Polymorphism of β3-Adrenergic Receptor Gene with Energy Expenditure in Response to Caffeine Among Young Healthy Women. The Tohoku Journal of Experimental Medicine 214:4, 365-370
CrossRef28
Arizumi Kikuchi, Yuko Kuramoto, Nobuyasu Noritake, Hiroshi Murase, Osami Daimaru, Takeo Nakakita, Shinichi Itoh. (2007) Rapid Genotyping Using Real-time Fluorescent PCR of the Trp64Arg Polymorphism of the β3-adrenergic Receptor Gene and the −3826 A to G Variant of the Uncoupling Protein-1 Gene. Biochemical Genetics 45:11-12, 769-773
CrossRef29
D.A. de Luis, M. Gonzalez Sagrado, R. Aller, O. Izaola, R. Conde. (2007) Influence of the Trp64Arg polymorphism in the beta 3 adrenoreceptor gene on insulin resistance, adipocytokine response, and weight loss secondary to lifestyle modification in obese patients. European Journal of Internal Medicine 18:8, 587-592
CrossRef30
Kokoro Tsuzaki, Kazuhiko Kotani, Shinji Fujiwara, Yoshiko Sano, Yukiyo Matsuoka, Masayuki Domichi, Taku Hamada, Akira Shimatsu, Naoki Sakane. (2007) The Trp64Arg polymorphism of the β3-adrenergic receptor gene is associated with increased small dense low-density lipoprotein in a rural Japanese population: the Mima study. Metabolism 56:12, 1689-1693
CrossRef31
Dietmar M. Klass, Nadine Lauer, Birgit Hay, Wolfgang Kratzer, Michael Fuchs, . (2007) Arg 64 Variant of the ß 3 -Adrenergic Receptor is Associated With Gallstone Formation. The American Journal of Gastroenterology 102:11, 2482-2487
CrossRef32
R Bracale, F Pasanisi, G Labruna, C Finelli, C Nardelli, P Buono, G Salvatori, L Sacchetti, F Contaldo, G Oriani. (2007) Metabolic syndrome and ADRB3 gene polymorphism in severely obese patients from South Italy. European Journal of Clinical Nutrition 61:10, 1213-1219
CrossRef33
R H Podolsky, P Barbeau, H-S Kang, H Zhu, F A Treiber, H Snieder. (2007) Candidate genes and growth curves for adiposity in African- and European-American youth. International Journal of Obesity 31:10, 1491-1499
CrossRef34
Ki-Jun Ko, Ki-Ok Shin. (2007) Alterations of Human Autonomic Nervous System Activity on Capsaicin Ingestion, and Variants of UCP1 and β 3 - -adrenergic Receptor Polymorphism. Journal of Life Science 17:8, 1075-1081
CrossRef35
R McKean-Cowdin, X Li, L Bernstein, A McTiernan, R Ballard-Barbash, W J Gauderman, F Gilliland. (2007) The ADRB3 Trp64Arg variant and obesity in African-American breast cancer cases. International Journal of Obesity 31:7, 1110-1118
CrossRef36
Young Hee Rho, Seong Jae Choi, Young Ho Lee, Jong Dae Ji, Gwan Gyu Song. (2007) The association between hyperuricemia and the Trp64Arg polymorphism of the beta-3 adrenergic receptor. Rheumatology International 27:9, 835-839
CrossRef37
Kazuaki TANAKA, Yoshiatsu IWAKI, Tatsuya TAKIZAWA, Masaru MURAKAMI, Hideyuki MANNEN, Yoshizane MAEDA, Yaetsu KUROSAWA, Vu-Binh DANG, Loan CHHUM PHITH, Bounthong BOUAHOM, Yoshio YAMAMOTO, Than DAING, Takao NAMIKAWA. (2007) The novel polymorphism of the beta 3-adrenergic receptor gene and its distribution in domestic pigs and wild boars in Asia. Animal Science Journal 78:3, 243-250
CrossRef38
N. Shaat, Å. Lernmark, E. Karlsson, S. Ivarsson, H. Parikh, K. Berntorp, L. Groop. (2007) A variant in the transcription factor 7-like 2 (TCF7L2) gene is associated with an increased risk of gestational diabetes mellitus. Diabetologia 50:5, 972-979
CrossRef39
Franco Fallucca, Maria Grazia Dalfrà, Ernesta Sciullo, Michela Masin, Angela Maria Buongiorno, Angela Napoli, Domenico Fedele, Annunziata Lapolla. (2006) Polymorphisms of insulin receptor substrate 1 and β3-adrenergic receptor genes in gestational diabetes and normal pregnancy. Metabolism 55:11, 1451-1456
CrossRef40
Akira Furuta, Catherine A. Thomas, Masahide Higaki, Michael B. Chancellor, Naoki Yoshimura, Osamu Yamaguchi. (2006) The Promise of β3-adrenoceptor Agonists to Treat the Overactive Bladder. Urologic Clinics of North America 33:4, 539-543
CrossRef41
Dunstan Cooke, Steve Bloom. (2006) The obesity pipeline: current strategies in the development of anti-obesity drugs. Nature Reviews Drug Discovery 5:11, 919-931
CrossRef42
Dominic S. Ng. 2006. Insulin Resistance, Diabetes and its Complications. .
CrossRef43
Koichiro Yasuda, Tetsuro Matsunaga, Tetsuya Adachi, Norihiko Aoki, Gozoh Tsujimoto, Kinsuke Tsuda. (2006) Adrenergic receptor polymorphisms and autonomic nervous system function in human obesity. Trends in Endocrinology & Metabolism 17:7, 269-275
CrossRef44
Kerri L. Palamara, Harriette R. Mogul, Stephen J. Peterson, William H. Frishman. (2006) Obesity. Cardiology in Review 14:5, 238-258
CrossRef45
Yasuto Takakura, Toshihide Yoshida, Keiji Yoshioka, Tsunekazu Umekawa, Akinori Kogure, Hitoshi Toda, Keizo Kagawa, Susumu Fukui, Toshikazu Yoshikawa. (2006) Angiotensinogen gene polymorphism (Met235Thr) influences visceral obesity and insulin resistance in obese Japanese women. Metabolism 55:6, 819-824
CrossRef46
K. Hojlund, C. Christiansen, K. S. Bjornsbo, P. Poulsen, L. Bathum, J. E. Henriksen, O. Lammert, H. Beck-Nielsen. (2006) Energy expenditure, body composition and insulin response to glucose in male twins discordant for the Trp64Arg polymorphism of the beta3-adrenergic receptor gene. Diabetes, Obesity and Metabolism 8:3, 322-330
CrossRef47
Tuomo Rankinen, Aamir Zuberi, Yvon C. Chagnon, S. John Weisnagel, George Argyropoulos, Brandon Walts, Louis Pérusse, Claude Bouchard. (2006) The Human Obesity Gene Map: The 2005 Update. Obesity 14:4, 529-644
CrossRef48
Jung Su Lee, Kiyoshi Kawakubo, Shuji Inoue, Akira Akabayashi. (2006) Effect of β3-adrenergic receptor gene polymorphism on body weight change in middle-aged, overweight women. Environmental Health and Preventive Medicine 11:2, 69-74
CrossRef49
Naoko Miura, Ayako Ikezaki, Saika Iwama, Hisafumi Matsuoka, Keiko Ito, Shigetaka Sugihara. (2006) Genetic factors and clinical significance of acanthosis nigricans in obese Japanese children and adolescents. Acta Paediatrica 95:2, 170-175
CrossRef50
Kijin KIM, Seungno LEE, Sunjang LEE, Kiwon LIM, Wookwang CHEUN, Nayoung AHN, Yoonjung SHIN, Jusik PARK, Changbae HONG, Sanghyun KIM. (2006) Comparison of Body Fat Distribution and Blood Lipid Profiles according to Trp64Arg Polymorphism for the .BETA.3-Adrenergic Receptor Gene in Korean Middle-Aged Women. Journal of Nutritional Science and Vitaminology 52:4, 281-286
CrossRef51
Narumi NAGAI, Naoki SAKANE, Toshio MORITANI. (2006) Impact of Aging and .BETA.3-Adrenergic-Receptor Polymorphism on Thermic and Sympathetic Responses to a High-Fat Meal. Journal of Nutritional Science and Vitaminology 52:5, 352-359
CrossRef52
É Erhardt, M Czakó, K Csernus, D Molnár, Gy Kosztolányi. (2005) The frequency of Trp64Arg polymorphism of the β3-adrenergic receptor gene in healthy and obese Hungarian children and its association with cardiovascular risk factors. European Journal of Clinical Nutrition 59:8, 955-959
CrossRef53
I. Barroso. (2005) Genetics of Type 2 diabetes. Diabetic Medicine 22:5, 517-535
CrossRef54
Lars Hansen, Oluf Pedersen. (2005) Genetics of type 2 diabetes mellitus: status and perspectives. Diabetes, Obesity and Metabolism 7:2, 122-135
CrossRef55
Christopher G. Bell, Andrew J. Walley, Philippe Froguel. (2005) The genetics of human obesity. Nature Reviews Genetics 6:3, 221-234
CrossRef56
Alessandra L. Gasparetti, Fernanda Alvarez-Rojas, Eliana P. Araujo, Aparecida E. Hirata, M
rio J. A. Saad, L
CrossRef57
Francisco Perez-Bravo, Barbara Echiburu, Manuel Maliqueo, Jose Luis Santos, Teresa Sir-Petermann. (2005) Tryptophan 64 arginine polymorphism of beta-3-adrenergic receptor in Chilean women with polycystic ovary syndrome. Clinical Endocrinology 62:2, 126-131
CrossRef58
Yasuto Takakura, Keiji Yoshioka, Tsunekazu Umekawa, Akinori Kogure, Hitoshi Toda, Toshikazu Yoshikawa, Toshihide Yoshida. (2005) Thr54 allele of the FABP2 gene affects resting metabolic rate and visceral obesity. Diabetes Research and Clinical Practice 67:1, 36-42
CrossRef59
G Iaccarino, V Trimarco, F Lanni, E Cipolletta, R Izzo, O Arcucci, N De Luca, G Di Renzo. (2005) β-Blockade and increased dyslipidemia in patients bearing Glu27 variant of β2 adrenergic receptor gene. The Pharmacogenomics Journal 5:5, 292-297
CrossRef60
, FINN EDLER EYBEN, JENS PETER KROUSTRUP, JENS FROMHOLT LARSEN, JULIO CELIS. (2004) Comparison of Gene Expression in Intra-Abdominal and Subcutaneous Fat: A Study of Men with Morbid Obesity and Nonobese Men Using Microarray and Proteomics. Annals of the New York Academy of Sciences 1030:1, 508-536
CrossRef61
(2004) Common variants in β2- and β3-adrenergic receptor genes and uncoupling protein 1 as predictors of the risk for type 2 diabetes and body weight changes.
The Finnish Diabetes Prevention Study. Clinical Genetics 66:4, 365-367
CrossRef62
Chizuko Hioki, Kanji Yoshimoto, Toshihide Yoshida. (2004) Efficacy of Bofu-tsusho-san, an oriental herbal medicine, in obese Japanese women with impaired glucose tolerance. Clinical and Experimental Pharmacology and Physiology 31:9, 614-619
CrossRef63
Po-Jung Tsai, Su-Chen Ho, Li-Ping Tsai, Yu-Hsiang Lee, Shih-Penn Hsu, Su-Pan Yang, Chun-Hong Chu, Chun-Hsien Yu. (2004) Lack of relationship between β3-adrenergic receptor gene polymorphism and gestational diabetes mellitus in a Taiwanese population. Metabolism 53:9, 1136-1139
CrossRef64
D.Michael Hallman, Sathanur R. Srinivasan, Wei Chen, Eric Boerwinkle, Gerald S. Berenson. (2004) The β2-adrenergic receptor Arg16-gly polymorphism and interactions involving β2- and β3-adrenergic receptor polymorphisms are associated with variations in longitudinal serum lipid profiles: The Bogalusa Heart Study. Metabolism 53:9, 1184-1191
CrossRef65
Yasuko Nozaki, Toshiji Saibara, Yoshihisa Nemoto, Masafumi Ono, Naoaki Akisawa, Shinji Iwasaki, Yoshihiro Hayashi, Makoto Hiroi, Hideaki Enzan, Saburo Onishi. (2004) Polymorphisms of Interleukin-1beta and beta3-Adrenergic Receptor in Japanese Patients With Nonalcoholic Steatohepatitis. Alcoholism: Clinical and Experimental Research 28:s2, 106S-110S
CrossRef66
Yasuko Nozaki, Toshiji Saibara, Yoshihisa Nemoto, Masafumi Ono, Naoaki Akisawa, Shinji Iwasaki, Yoshihiro Hayashi, Makoto Hiroi, Hideaki Enzan, Saburo Onishi. (2004) Polymorphisms of Interleukin-1?? and ??3-Adrenergic Receptor in Japanese Patients With Nonalcoholic Steatohepatitis. Alcoholism: Clinical & Experimental Research 28:Supplement, 106S-110S
CrossRef67
Philippe Froguel, Philippe Boutin. 2004. Genetics of Obesity. , 53-67.
CrossRef68
Toshio Kahara, Tetsuo Hayakawa, Yukihiro Nagai, Akiko Shimizu, Toshinari Takamura. (2004) Gln27Glu polymorphism of the β2 adrenergic receptor gene in healthy Japanese men is associated with the change of fructosamine level caused by exercise. Diabetes Research and Clinical Practice 64:3, 207-212
CrossRef69
Andrea Natali, Ele Ferrannini. (2004) Hypertension, insulin resistance, and the metabolic syndrome. Endocrinology & Metabolism Clinics of North America 33:2, 417-429
CrossRef70
PATRICIA IN??S PORTO, SILVIA IN??S GARC??A, GUILLERMO DIEUZEIDE, CLAUDIO GONZ??LEZ, MAR??A SILVINA LANDA, CARLOS JOS?? PIROLA. (2004) Clinical Features of the Metabolic Syndrome in Adolescents: Minor Role of the Trp64Arg ??3-Adrenergic Receptor Gene Variant. Pediatric Research 55:5, 836-841
CrossRef71
Amanda N Malina, Hannele M Laivuori, Patricia K Agatisa, Lynn A Collura, William R Crombleholme, Cynthia J Sims, James M Roberts. (2004) The Trp64Arg polymorphism of the β3-adrenergic receptor is not increased in women with preeclampsia. American Journal of Obstetrics and Gynecology 190:3, 779-783
CrossRef72
Leif Groop, Martin Ridderstr��le. 2004. Molecular Genetics of Type 2 Diabetes-Candidate Genes. .
CrossRef73
(2004) Effects of β3-Adrenergic Receptor Polymorphism on the Hyperglycemia in Korean Subjects. Journal of the Korean Society of Food Science and Nutrition 33:1, 83-90
CrossRef74
Coleen M Damcott, Paul Sack, Alan R Shuldiner. (2003) The genetics of obesity. Endocrinology & Metabolism Clinics of North America 32:4, 761-786
CrossRef75
R. J. F. Loos, C. Bouchard. (2003) Obesity - is it a genetic disorder?. Journal of Internal Medicine 254:5, 401-425
CrossRef76
George L. Bakris, Nauman Tarif, Henry R. Black. 2003. Arterial Hypertension in Diabetes: Etiology and Treatment. .
CrossRef77
Chisato Murata, Tetsu Watanabe, Hiroyuki Furuya, Yoshihiko Sugioka, Hajime Mikurube, Akira Yokoyama, Yoshihito Atsumi, Kempei Matsuoka, Isao Okazaki. (2003) Aldehyde dehydrogenase 2 and β3-adrenergic receptor gene polymorphisms: their association with elevated liver enzymes and metabolic syndrome. Metabolism 52:9, 1096-1101
CrossRef78
Masaaki Ochi, Haruhiko Osawa, Hiroshi Onuma, Akiko Murakami, Tatsuya Nishimiya, Fumio Shimada, Kenichi Kato, Ikki Shimizu, Koji Shishino, Mitsuharu Murase, Yasuhisa Fujii, Jun Ohashi, Hideichi Makino. (2003) The absence of evidence for major effects of the frequent SNP +299G>A in the resistin gene on susceptibility to insulin resistance syndrome associated with Japanese type 2 diabetes. Diabetes Research and Clinical Practice 61:3, 191-198
CrossRef79
Claude Bouchard, Louis P��russe. 2003. The Genetics of Human Obesity. .
CrossRef80
Philippe Froguel. 2003. Do our genes make us fat?. , 25-39.
CrossRef81
Hiroshi Matsushita, Takumi Kurabayashi, Masatoshi Tomita, Nozomi Kato, Kenichi Tanaka. (2003) Effects of uncoupling protein 1 and ß3-adrenergic receptor gene polymorphisms on body size and serum lipid concentrations in Japanese women. Maturitas 45:1, 39-45
CrossRef82
Rina Arashiro, Keisuke Katsuren, Shigeru Fukuyama, Takao Ohta. (2003) Effect of Trp64Arg mutation of the beta3-adrenergic receptor gene and C161T substitution of the peroxisome proliferator activated receptor gamma gene on obesity in Japanese children. Pediatrics International 45:2, 135-141
CrossRef83
Alan R. Shuldiner, Kashif M. Munir. (2003) Genetics of obesity: More complicated than initially thought. Lipids 38:2, 97-101
CrossRef84
Shigeru Sassa. (2003) Gene-environmental interactions: Lessons from porphyria. Environmental Health and Preventive Medicine 7:6, 254-263
CrossRef85
A. Marti, M. S. Corbalan, M. A. Martinez-Gonzalez, J. A. Martinez. (2002) TRP64ARG polymorphism of the beta3-adrenergic receptor gene and obesity risk: effect modification by a sedentary lifestyle. Diabetes, Obesity and Metabolism 4:6, 428-430
CrossRef86
Sumito Ogawa, Mitsuru Emi, Masataka Shiraki, Takayuki Hosoi, Hajime Orimo, Yasuyoshi Ouchi, Satoshi Inoue. (2002) Association of amino acid variation (Trp64Arg) in the beta3-adrenergic receptor gene with bone mineral density. Geriatrics and Gerontology International 2:3, 138-142
CrossRef87
Toshio Kahara, Toshinari Takamura, Tetsuo Hayakawa, Yukihiro Nagai, Hiromi Yamaguchi, Tatsuo Katsuki, Ken-ichi Katsuki, Michio Katsuki, Ken-ichi Kobayashi. (2002) Prediction of exercise-mediated changes in metabolic markers by gene polymorphism. Diabetes Research and Clinical Practice 57:2, 105-110
CrossRef88
Osamu Yamaguchi. (2002) β3-adrenoceptors in human detrusor muscle. Urology 59:5, 25-29
CrossRef89
Maria M. Mercado, John C. McLenithan, Kristi D. Silver, Alan R. Shuldiner. (2002) Genetics of insulin resistance. Current Diabetes Reports 2:1, 83-95
CrossRef90
Karine Clement, Philippe Boutin, Philippe Froguel. (2002) Genetics of Obesity. American Journal of PharmacoGenomics 2:3, 177-187
CrossRef91
Junko YAMAMOTO, Shigeru KAGEYAMA, Masami NEMOTO, Takashi SASAKI, Tatsuya SAKURAI, Ken-ichi ISHIBASHI, Akira MIMURA, Kuninobu YOKOTA, Naoko TAJIMA. (2002) PPARγ2 Pro12Ala Polymorphism and Insulin Resistance in Japanese Hypertensive Patients. Hypertension Research 25:1, 25-29
CrossRef92
Masafumi Isogaya, Taku Nagao, Hitoshi Kurose. (2002) Enhanced cAMP Response of Naturally Occurring Mutant of Human β3-Adrenergic Receptor. The Japanese Journal of Pharmacology 88:3, 314-318
CrossRef93
HISAFUMI MATSUOKA, SAIKA IWAMA, NAOKO MIURA, AYAKO IKEZAKI, SHIGETAKA SUGIHARA. (2002) Impact of Polymorphisms of Human .BETA.-Adrenergic Receptor Gene on Changes in Height during Growth Hormone Treatment.. Endocrine Journal 49:1, 21-28
CrossRef94
Noriyuki Iwamoto, Yoko Ogawa, Susumu Kajihara, Akitaka Hisatomi, Tsutomu Yasutake, Toru Yoshimura, Toshihiko Mizuta, Toshiya Hara, Iwata Ozaki, Kyosuke Yamamoto. (2001) Gln27Glu β2-adrenergic receptor variant is associated with hypertriglyceridemia and the development of fatty liver. Clinica Chimica Acta 314:1-2, 85-91
CrossRef95
JEAN HARVEY-BERINO, ELIZABETH CASEY GOLD, DELIA SMITH WEST, ALAN R SHULDINER, JEREMY WALSTON, RAYMOND D STARLING, AMY NOLAN, KRISTI SILVER, ERIC T POEHLMAN. (2001) Does Genetic Testing for Obesity Influence Confidence in the Ability to Lose Weight? A Pilot Investigation. Journal of the American Dietetic Association 101:11, 1351-1353
CrossRef96
Chikara Ishii, Kiyoaki lnoue, Kiyohiko Negishi, Nobuyoshi Tane, Takuya Awata, Shigehiro Katayama. (2001) Diabetic ketoacidosis in a case of pheochromocytoma. Diabetes Research and Clinical Practice 54:2, 137-142
CrossRef97
D. Corella, M. Guillén, O. Portolés, J. V. Sorlí, V. Alonso, J. Folch, C. Sáiz. (2001) Gender specific associations of the Trp64Arg mutation in the β3-adrenergic receptor gene with obesity-related phenotypes in a Mediterranean population: interaction with a common lipoprotein lipase gene variation. Journal of Internal Medicine 250:4, 348-360
CrossRef98
D. Corella, M. Guillen, O. Portoles, J. V. Sorli, V. Alonso, J. Folch, C. Saiz. (2001) Gender specific associations of the Trp64Arg mutation in the beta3-adrenergic receptor gene with obesity-related phenotypes in a Mediterranean population: interaction with a common lipoprotein lipase gene variation. Journal of Internal Medicine 250:4, 348-360
CrossRef99
CP Busch, RA Hegele. (2001) Genetic determinants of type 2 diabetes mellitus. Clinical Genetics 60:4, 243-254
CrossRef100
Tomokazu Kawamura, Genshi Egusa, Rumi Fujikawa, Masamichi Okubo. (2001) β3-adrenergic receptor gene variant is associated with upper body obesity only in obese Japanese-American men but not in women. Diabetes Research and Clinical Practice 54:1, 49-55
CrossRef101
Philippe Boutin, Philippe Froguel. (2001) Genetics of human obesity. Best Practice & Research Clinical Endocrinology & Metabolism 15:3, 391-404
CrossRef102
J.E. Olson, L.D. Atwood, D.M. Grabrick, C.M. Vachon, T.A. Sellers. (2001) Evidence for a major gene influence on abdominal fat distribution: The Minnesota breast cancer family study. Genetic Epidemiology 20:4, 458-478
CrossRef103
Emily M. Garland, Italo Biaggioni. (2001) Genetic polymorphisms of adrenergic receptors. Clinical Autonomic Research 11:2, 67-78
CrossRef104
Pasquale Strazzullo, Roberto Iacone, Alfonso Siani, Francesco P. Cappuccio, Ornella Russo, Gianvincenzo Barba, Antonio Barbato, Lanfranco D'Elia, Maurizio Trevisan, Eduardo Farinaro. (2001) Relationship of the Trp64Arg polymorphism of the beta3-adrenoceptor gene to central adiposity and high blood pressure: interaction with age. Cross-sectional and longitudinal findings of the Olivetti Prospective Heart Study. Journal of Hypertension 19:3, 399-406
CrossRef105
Yoshiko Yanagisawa, Kyoko Hasegawa, Gregory J. Dever, Caleb Tyn.O. Otto, Mitsuru Sakuma, Shigeo Shibata, Shigeji Miyagi, Yoshinori Kaneko, Yasuo Kagawa. (2001) Uncoupling Protein 3 and Peroxisome Proliferator-Activated Receptor γ2 Contribute to Obesity and Diabetes in Palauans. Biochemical and Biophysical Research Communications 281:3, 772-778
CrossRef106
M. A. van Baak. (2001) The peripheral sympathetic nervous system in human obesity. Obesity Reviews 2:1, 3-14
CrossRef107
N. Barzilai, A. R. Shuldiner. (2001) Searching for Human Longevity Genes: The Future History of Gerontology in the Post-genomic Era. The Journals of Gerontology Series A: Biological Sciences and Medical Sciences 56:2, M83-M87
CrossRef108
Yasuto TAKAKURA, Toshihide YOSHIDA. (2001) .BETA.3-Adrenergic receptor agonists. Past, present and future.. Folia Pharmacologica Japonica 118:5, 315-320
CrossRef109
Joon‐Seol Bae, Byung‐Yong Kang, Ki‐Tae Kim, Jung‐Hee Shin, Chung‐Choo Lee. (2001) Genetic variations in six candidate genes for insulin resistance in Korean essential hypertensives. Korean Journal of Biological Sciences 5:4, 341-346
CrossRef110
Anke Hinney, Helmut Remschmidt, Johannes Hebebrand. (2000) Candidate gene polymorphisms in eating disorders. European Journal of Pharmacology 410:2-3, 147-159
CrossRef111
Frances S. Chew. (2000) Talking about race in a scientific context. Science and Engineering Ethics 6:4, 485-494
CrossRef112
Steven C. Elbein. (2000) Genetics of Type 2 Diabetes: An Overview for the Millennium. Diabetes Technology & Therapeutics 2:3, 391-400
CrossRef113
M. Del Mar Gonzalez-Barroso, D. Ricquier, A.-M. Cassard-Doulcier. (2000) The human uncoupling protein-1 gene (UCP1): present status and perspectives in obesity research. Obesity Reviews 1:2, 61-72
CrossRef114
Francesco S. Celi, Carlo Negri, Keith Tanner, Nina Raben, Flora De Pablo, Adela Rovira, Luis F. Pallardo, Pilar Martin-Vaquero, Michael P. Stern, Braxton D. Mitchell, Alan R. Shuldiner. (2000) Molecular scanning for mutations in the insulin receptor substrate-1 (IRS-1) gene in Mexican Americans with Type 2 diabetes mellitus. Diabetes/Metabolism Research and Reviews 16:5, 370-377
CrossRef115
Jonathan Webber, Ian A. Macdonald. (2000) Signalling in body-weight homeostasis: neuroendocrine efferent signals. Proceedings of the Nutrition Society 59:03, 397-404
CrossRef116
Ilse L. Mertens, Luc F. Van Gaal. (2000) Promising New Approaches to the Management of Obesity. Drugs 60:1, 1-9
CrossRef117
Leif Groop. (2000) Genetics of the metabolic syndrome. British Journal of Nutrition 83:S1,
CrossRef118
N Katsilambros. (2000) New developments in obesity. European Journal of Internal Medicine 11:2, 65-74
CrossRef119
Selma F. Witchel, Julian Fagerli, Jessica Siegel, Rhonda Smith, Mohamed Farouk Mitwally, Vered Lewy, Silva Arslanian, Peter A. Lee. (2000) No association between body mass index and β3-adrenergic receptor variant (W64R) in children with premature pubarche and adolescent girls with hyperandrogenism. Fertility and Sterility 73:3, 509-515
CrossRef120
Masaya Tadokoro, Chubun Sato, Noriaki Takeda, Shigeru Suna, Fumiyuki Asakawa, Fumihiko Jitsunari. (2000) Analysis of beta3 adrenergic receptor gene polymorphism using noninvasive samples obtained at scheduled infant health checkups.. Environmental Health and Preventive Medicine 4:4, 190-198
CrossRef121
Tomokazu Kawamura, Genshi Egusa, Masamichi Okubo, Michinori Imazu, Michio Yamakido. (1999) Association of β3-Adrenergic receptor gene polymorphism with insulin resistance in Japanese-American men. Metabolism 48:11, 1367-1370
CrossRef122
C. Christiansen, P. Poulsen, H. Beck-Nielsen. (1999) The Trp64Arg mutation of the adrenergic beta-3 receptor gene impairs insulin secretion: a twin study. Diabetic Medicine 16:10, 835-840
CrossRef123
Michelle L Rose, Mark A Paulik, James M Lenhard. (1999) Therapeutic approaches to Type 2 diabetes mellitus. Expert Opinion on Therapeutic Patents 9:9, 1223-1236
CrossRef124
Alison G. Hoppin, Lee M. Kaplan. (1999) The Leptin Era: New Insight Into the Mechanisms of Body Weight Homeostasis. Journal of Pediatric Gastroenterology & Nutrition 29:3, 250-264
CrossRef125
Robert A Hegele, Matthew R Ban, Christopher P Busch, Samuel Ramsewak, D.Dan Ramdath. (1999) Lipoprotein-genotype associations in Trinidadian neonates. Clinical Biochemistry 32:6, 429-437
CrossRef126
Arto Pulkkinen, Anu Kareinen, Laura Saarinen, Sami Heikkinen, Seppo Lehto, Markku Laakso. (1999) The codon 64 polymorphism of the β3-adrenergic receptor gene is not associated with coronary heart disease or insulin resistance in nondiabetic subjects and non-insulin-dependent diabetic patients. Metabolism 48:7, 853-856
CrossRef127
P. Arner, J. Hoffstedt. (1999) Adrenoceptor genes in human obesity. Journal of Internal Medicine 245:6, 667-672
CrossRef128
S. M. Echwald. (1999) Genetics of human obesity: lessons from mouse models and candidate genes. Journal of Internal Medicine 245:6, 653-666
CrossRef129
Kristi Silver, Jeremy Walston, Yufeng Yang, Richard Pratley, Eric Ravussin, Nina Raben, Alan R. Shuldiner. (1999) Molecular scanning of the beta-3-adrenergic receptor gene in Pima Indians and Caucasians. Diabetes/Metabolism Research and Reviews 15:3, 175-180
CrossRef130
Keiji Tanaka, Tatsumi Moriya, Akira Kanamori, Yoshitada Yajima. (1999) Analysis and a long-term follow up of ketosis-onset Japanese NIDDM patients. Diabetes Research and Clinical Practice 44:2, 137-146
CrossRef131
Wayne Huey-Herng Sheu, Wen-Jane Lee, Ying-Erh Yao, Chii-Yeng Jeng, Mason Mao-Shin Young, Ying-Tsung Chen. (1999) Lack of association between genetic variation in the β3-adrenergic receptor gene and insulin resistance in patients with coronary heart disease. Metabolism 48:5, 651-654
CrossRef132
Boonsong Ongphiphadhanakul, Rajata Rajatanavin, Suwannee Chanprasertyothin, Noppawan Piaseu, Laor Chailurkit, Surat Komindr, Pongamorn Bunnag, Gobchai Puavilai. (1999) Relation of β3-adrenergic receptor gene mutation to total body fat but not percent body fat and insulin levels in Thais. Metabolism 48:5, 564-567
CrossRef133
Tetsuo Hayakawa, Yukihiro Nagai, Masayuki Taniguchi, Haruhisa Yamashita, Toshinari Takamura, Toshio Abe, Gakuji Nomura, Ken-ichi Kobayashi. (1999) Phenotypic characterization of the β3-adrenergic receptor mutation and the uncoupling protein 1 polymorphism in Japanese men. Metabolism 48:5, 636-640
CrossRef134
L. C. Groop. (1999) Insulin resistance: the fundamental trigger of type 2 diabetes. Diabetes, Obesity and Metabolism 1:s1, 1-7
CrossRef135
Antti Virkamäki, Kohjiro Ueki, C. Ronald Kahn. (1999) Protein–protein interaction in insulin signaling and the molecular mechanisms of insulin resistance. Journal of Clinical Investigation 103:7, 931-943
CrossRef136
Keiko Yanagisawa, Naoko Iwasaki, Mayumi Sanaka, Satomi Minei, Masao Kanamori, Yasue Omori, Yasuhiko Iwamoto. (1999) Polymorphism of the β3-adrenergic receptor gene and weight gain in pregnant diabetic women. Diabetes Research and Clinical Practice 44:1, 41-47
CrossRef137
Hee-Sook Jun, Hak Yeon Bae, Byoung Rai Lee, Kwang Sam Koh, Young Soo Kim, Kwan Woo Lee, Hyun-man Kim, Ji-Won Yoon. (1999) Pathogenesis of non-insulin-dependent (type II) diabetes mellitus (NIDDM) – genetic predisposition and metabolic abnormalities. Advanced Drug Delivery Reviews 35:2-3, 157-177
CrossRef138
Giancarlo Tonolo, Maria G. Melis, Giannina Secchi, Maria M. Atzeni, Maria F. Angius, Antonello Carboni, Milco Ciccarese, Antonello Malavasi, Mario Maioli. (1999) Association of Trp64Arg β3-adrenergic-receptor gene polymorphism with essential hypertension in the Sardinian population. Journal of Hypertension 17:1, 33-38
CrossRef139
Søren Snitker, Margery Nicolson, Alan R. Shuldiner, Kristi Silver, Eric Ravussin. (1998) No effect of Trp64Arg β3-adrenoceptor polymorphism on the plasma leptin concentration in Pima Indians. Metabolism 47:12, 1525-1527
CrossRef140
Kuninori Shiwaku, Tong Qiang Gao, Akio Isobe, Tetsuhito Fukushima, Yosuke Yamane. (1998) A Trp 64 Arg mutation in the β3-adrenergic receptor gene is not associated with moderate overweight in Japanese workers. Metabolism 47:12, 1528-1530
CrossRef141
Vendrell, Gutierrez, Broch, Fernandez-Real, Aguilar, Richart. (1998) beta3-adrenoreceptor gene polymorphism and leptin. Lack of relationship in type 2 diabetic patients. Clinical Endocrinology 49:5, 679-683
CrossRef142
Jussi Pihlajamäki, Johanna Rissanen, Raisa Valve, Sami Heikkinen, Leena Karjalainen, Markku Laakso. (1998) Different regulation of free fatty acid levels and glucose oxidation by the Trp64Arg polymorphism of the β3-adrenergic receptor gene and the promoter variant (A-3826G) of the uncoupling protein 1 gene in familial combined hyperlipidemia. Metabolism 47:11, 1397-1402
CrossRef143
J. A. M. J. L. Janssen, J. W. Koper, R. P. Stolk, P. Englaro, A. G. Uitterlinden, Q. Huang, J. P. T. M. van Leeuwen, W. F. Blum, A. M. F. Attanasio, H. A. P. Pols, D. E. Grobbee, F. H. de Jong, S. W. J. Lamberts. (1998) Lack of associations between serum leptin, a polymorphism in the gene for the beta3-adrenergic receptor and glucose tolerance in the Dutch population.. Clinical Endocrinology 49:2, 229-234
CrossRef144
Antoinette Maassen VanDenBrink, Monique N. Vergouwe, Roel A. Ophoff, Susan L. Naylor, Hans G. Dauwerse, Pramod R. Saxena, Michel D. Ferrari, Rune R. Frants. (1998) Chromosomal localization of the 5-HT1F receptor gene: No evidence for involvement in response to sumatriptan in migraine patients. American Journal of Medical Genetics 77:5, 415-420
CrossRef145
Yukio Shima, Toshihiko Tsukada, Koji Nakanishi, Hidehiko Ohta. (1998) Association of the Trp64Arg mutation of the β3-adrenergic receptor with fatty liver and mild glucose intolerance in Japanese subjects. Clinica Chimica Acta 274:2, 167-176
CrossRef146
Norma McFarlane-Anderson, Franklyn Bennett, Rainford Wilks, Sharon Howell, Cavelle Newsome, Kennedy Cruickshank, Terrence Forrester. (1998) The Trp64Arg mutation of the β3-adrenergic receptor is associated with hyperglycemia and current body mass index in Jamaican women. Metabolism 47:5, 617-621
CrossRef147
L. Groop. (1998) Genetics of visceral obesity and insulin resistance: relationship to non-insulin-dependent diabetes mellitus. Growth Hormone & IGF Research 8, 9-14
CrossRef148
Nobuyuki Azuma, Yasunao Yoshimasa, Haruo Nishimura, Yuji Yamamoto, Hiroaki Masuzaki, Junko Suga, Michika Shigemoto, Naoki Matsuoka, Tokuji Tanaka, Noriko Satoh, Toshio Igaki, Yoshihiro Miyamoto, Hiroshi Itoh, Takaaki Yoshimasa, Kiminori Hosoda, Shigeo Nishi, Kazuwa Nakao. (1998) The significance of the Trp 64 Arg mutation of the β3-adrenergic receptor gene in impaired glucose tolerance, non—insulin-dependent diabetes mellitus, and insulin resistance in Japanese subjects. Metabolism 47:4, 456-460
CrossRef149
Pavel Hamet, Zdenka Pausova, Viacheslav Adarichev, Kira Adaricheva, Johanne Tremblay. (1998) Hypertension. Journal of Hypertension 16:4, 397-418
CrossRef150
Richard Donnelly, Xianqin Qu. (1998) MECHANISMS OF INSULIN RESISTANCE AND NEW PHARMACOLOGICAL APPROACHES TO METABOLISM AND DIABETIC COMPLICATIONS. Clinical and Experimental Pharmacology and Physiology 25:2, 79-87
CrossRef151
Robert L Dow. (1997) β3-adrenergic agonists: potential therapeutics for obesity. Expert Opinion on Investigational Drugs 6:12, 1811-1825
CrossRef152
J.M. Walters, G.M. Ward, J. Barton, R. Arackal, R.C. Boston, J.D. Best, F.P. Alford. (1997) The effect of norepinephrine on insulin secretion and glucose effectiveness in non—insulin-dependent diabetes. Metabolism 46:12, 1448-1453
CrossRef153
A.D. Strosberg. (1997) Association of β3-adrenoceptor polymorphism with obesity and diabetes: current status. Trends in Pharmacological Sciences 18:12, 449-454
CrossRef154
Andreas Pfeiffer. (1997) Update Diabetes 1997. Medizinische Klinik 92:11, 655-662
CrossRef155
Cheryl L. Jeyasingam, Janet M. Bryson, Ian D. Caterson, Dennis K. Yue, Richard Donnelly. (1997) SHORT COMMUNICATION EXPRESSION OF THE 0 3 -ADRENOCEPTOR GENE POLYMORPHISM (Trp64Arg) IN OBESE DIABETIC AND NON-DIABETIC SUBJECTS. Clinical and Experimental Pharmacology and Physiology 24:9-10, 733-735
CrossRef156
Sandra J. Hasstedt, Michael Hoffman, Mark F. Leppert, Steven C. Elbein. (1997) Recessive Inheritance of Obesity in Familial Non—Insulin-Dependent Diabetes Mellitus, and Lack of Linkage to Nine Candidate Genes. The American Journal of Human Genetics 61:3, 668-677
CrossRef157
B. BENDLOVÁ, I. MAZURA, J. VČELÁK, J. PERUŠIČOVÁ, D. PALYZOVÁ, I. KLIMEŠ, E. ŠEBÖKOVÁ. (1997) Is a Mutation of the ?3-Adrenergic Receptor Gene Related to Non-Insulin-dependent Diabetes Mellitus and Juvenile Hypertension in the Czech Population?. Annals of the New York Academy of Sciences 827:1 Lipids and Sy, 135-143
CrossRef158
France Pietri-Rouxel, Brian John Manning, Jerome Gros, A. Donny Strosberg. (1997) The Biochemical Effect of the Naturally Occurring Trp644Arg Mutation on Human beta3-Adrenoceptor Activity. European Journal of Biochemistry 247:3, 1174-1179
CrossRef159
Eric Jéquier, Luc Tappy. (1997) Obesity. Molecular Aspects of Medicine 18:4, 247-305
CrossRef160
Xiaohong Yuan, Kentaro Yamada, Ken-ichi Koyama, Fumi Ichikawa, Satomi Ishiyama, Atsuko Koyanagi, Wasaku Koyama, Kyohei Nonaka. (1997) β3-adrenergic receptor gene polymorphism is not a major genetic determinant of obesity and diabetes in Japanese general population. Diabetes Research and Clinical Practice 37:1, 1-7
CrossRef161
Jeffrey M. Stadel, Shelagh Wilson, Derk J. Bergsma. (1997) Orphan G protein-coupled receptors: a neglected opportunity for pioneer drug discovery. Trends in Pharmacological Sciences 18:4, 430-437
CrossRef162
A.Donny Strosberg. (1997) Association of β3-adrenoceptor polymorphism with obesity and diabetes: current status. Trends in Pharmacological Sciences 18:4, 449-454
CrossRef163
DJ Goldstein, ME Trautmann. (1997) Treatments for obesity. Expert Opinion on Emerging Drugs 2:1, 1-28
CrossRef164
A. Donny Strosberg. (1997) STRUCTURE AND FUNCTION OF THE β 3 -ADRENERGIC RECEPTOR. Annual Review of Pharmacology and Toxicology 37:1, 421-450
CrossRef165
Ann-Katrin Karlsson, Mikael Elam, Peter Friberg, Fin Biering-Sörensen, Lars Sullivan, Peter Lönnroth. (1997) Regulation of lipolysis by the sympathetic nervous system: A microdialysis study in normal and spinal cord—injured subjects. Metabolism 46:4, 388-394
CrossRef166
Kenji Higashi, Toshitsugu Ishikawa, Toshimitsu Ito, Atsushi Yonemura, Hideki Shige, Haruo Nakamura. (1997) Association of a Genetic Variation in the β3-Adrenergic Receptor Gene with Coronary Heart Disease among Japanese. Biochemical and Biophysical Research Communications 232:3, 728-730
CrossRef167
Susan B. Roberts. (1997) Human obesity genes. Nutrition 13:3, 236-238
CrossRef168
B. B. Lowell, MD, PhD, J. S. Flier, MD. (1997) BROWN ADIPOSE TISSUE, β3-ADRENERGIC RECEPTORS, AND OBESITY. Annual Review of Medicine 48:1, 307-316
CrossRef169
Kohei Ueda, Yukio Tanizawa, Yasuharu Oota, Hirohumi Inoue, Nobuaki Kizuki, Hiroshi Inoue, Katsunori Tsukuda, Tomoichiro Asano, Yoshitomo Oka. (1997) Prevalence of the Trp64Arg missense mutation of the β3-adrenergic receptor gene in Japanese subjects. Metabolism 46:2, 199-202
CrossRef170
Leif C. Groop, Tiinamaija Tuomi. (1997) Non-insulin-dependent Diabetes Mellitus - A Collision between Thrifty Genes and an Affluent Society. Annals of Medicine 29:1, 37-53
CrossRef171
Claude Bouchard. (1997) Human Variation in Body Mass: Evidence for a Role of the Genes. Nutrition Reviews 55:1, S21-S27
CrossRef172
Frank L. Greenway. (1996) SURGERY FOR OBESITY. Endocrinology & Metabolism Clinics of North America 25:4, 1005-1027
CrossRef173
F. Barbetti. (1996) Pathophysiology of non-insulin-dependent diabetes and the search for candidate genes: dangerous liaisons?. Acta Diabetologica 33:4, 257-262
CrossRef174
Bruce M Spiegelman, Jeffrey S Flier. (1996) Adipogenesis and Obesity: Rounding Out the Big Picture. Cell 87:3, 377-389
CrossRef175
Charlotte A. Pratt, Cornelius B. Pratt, Scarlett N. Montague, Juliane C. Salazar, Mary C. Graves. (1996) Do popular magazines promote weight‐control messages? Implications of weight‐control advertisements for the health of African American women. Howard Journal of Communications 7:4, 349-364
CrossRef176
A.Donny Strosberg, France Pietri-Rouxel. (1996) Function and regulation of the β3-adrenoceptor. Trends in Pharmacological Sciences 17:10, 373-381
CrossRef177
J. Hoffstedt, H. Wahrenberg, A. Thörne, F. Lönnqvist. (1996) The metabolic syndrome is related to β3-adrenoceptor sensitivity in visceral adipose tissue. Diabetologia 39:7, 838-860
CrossRef178
C.L. Hanis, E. Boerwinkle, R. Chakraborty, D.L. Ellsworth, P. Concannon, B. Stirling, V.A. Morrison, B. Wapelhorst, R.S. Spielman, K.J. Gogolin-Ewens, J.M. Shephard, S.R. Williams, N. Risch, D. Hinds, N. Iwasaki, M. Ogata, Y. Omori, C. Petzold, H. Rietzsch, H.-E. Schröder, J. Schulze, N.J. Cox, S. Menzel, V.V. Boriraj, X. Chen, L.R. Lim, T. Lindner, L.E. Mereu, Y.-Q. Wang, K. Xiang, K. Yamagata, Y. Yang, G.I. Bell. (1996) A genome–wide search for human non–insulin–dependent (type 2) diabetes genes reveals a major susceptibility locus on chromosome 2. Nature Genetics 13:2, 161-166
CrossRef179
T. Fujisawa, H. Ikegami, E. Yamato, K. Takekawa, Y. Nakagawa, Y. Hamada, T. Oga, H. Ueda, M. Shintani, M. Fukuda, T. Ogihara. (1996) Association of Trp64Arg mutation of the ?3-adrenergic-receptor with NIDDM and body weight gain. Diabetologia 39:3, 349-352
CrossRef180
Nicholas C. Turner. (1996) New therapeutic agents for the treatment of insulin resistance and NIDDM. Drug Discovery Today 1:3, 103-108
CrossRef181
Flier, Jeffrey S., Underhill, Lisa H., Insel, Paul A., . (1996) Adrenergic Receptors — Evolving Concepts and Clinical Implications. New England Journal of Medicine 334:9, 580-585
Full Text182
Susan B. Roberts, Andrew S. Greenberg. (1996) The New Obesity Genes. Nutrition Reviews 54:2, 41-49
CrossRef183
Ping H Wang, Murray Korc. (1995) Searching for the Holy Grail: the cause of diabetes. The Lancet 346, S4
CrossRef184
Toshihide Yoshida, Naoki Sakane, Tunekazu Umekawa, Mayumi Sakai, Toshihiro Takahashi, Motoharu Kondo. (1995) Mutation of β3-adrenergic-receptor gene and response to treatment of obesity. The Lancet 346:8987, 1433-1434
CrossRef185
(1995) The obsession with obesity. Nature Genetics 11:1, 1-2
CrossRef186
Arner, Peter, . (1995) The β3-Adrenergic Receptor — A Cause and Cure of Obesity?. New England Journal of Medicine 333:6, 382-383
Full Text187
Walston, Jeremy, Silver, Kristi, Bogardus, Clifton, Knowler, William C., Celi, Francesco S., Austin, Sharon, Manning, Brian, Strosberg, A. Donny, Stern, Michael P., Raben, Nina, Sorkin, John D., Roth, Jesse, Shuldiner, Alan R., . (1995) Time of Onset of Non-Insulin-Dependent Diabetes Mellitus and Genetic Variation in the β3-Adrenergic–Receptor Gene. New England Journal of Medicine 333:6, 343-347
Full Text
