Original Article
Time of Onset of Non-Insulin-Dependent Diabetes Mellitus and Genetic Variation in the β3-Adrenergic–Receptor Gene
N Engl J Med 1995; 333:343-347August 10, 1995
- Abstract
Background
The β3-adrenergic receptor is expressed in visceral adipose tissue and is thought to contribute to the regulation of the resting metabolic rate and lipolysis.
Methods
To investigate whether mutations in the gene for the β3-adrenergic receptor predispose patients to obesity and non-insulin-dependent diabetes mellitus (NIDDM), we studied this gene in 10 Pima Indians by analysis of single-stranded conformational polymorphisms and dideoxy sequence analysis. Association studies were performed in 642 Pima subjects (390 with NIDDM and 252 without NIDDM).
Results
A missense mutation was identified in the gene for the β3-adrenergic receptor that results in the replacement of tryptophan by arginine (Trp64Arg) in the first intracellular loop of the receptor. This mutation was detected with allelic frequencies of 0.31 in Pima Indians, 0.13 in 62 Mexican Americans, 0.12 in 49 blacks, and 0.08 in 48 whites in the United States. Among Pimas, the frequency of the Trp64Arg mutation was similar in nondiabetic and diabetic subjects. However, in subjects homozygous for the mutation the mean (±SD) age at the onset of NIDDM was significantly lower (36±10 years) than in Trp64Arg heterozygotes (40±10 years) or normal homozygotes (41±11 years; P = 0.02). Furthermore, subjects with the mutation tended to have a lower adjusted resting metabolic rate (P = 0.14 by analysis of covariance).
Conclusions
Pima subjects homozygous for the Trp64Arg β3-adrenergic–receptor mutation have an earlier onset of NIDDM and tend to have a lower resting metabolic rate. This mutation may accelerate the onset of NIDDM by altering the balance of energy metabolism in visceral adipose tissue.
Media in This Article
Figure 4
Detection of Mutated and Normal β3-Adrenergic Receptors by Hybridization with Allele-Specific Oligonucleotides.Figure 2
Diagram of the β3-Adrenergic Receptor.Article Activity
- Article
Non-insulin-dependent diabetes mellitus (NIDDM) is one of the most common inherited diseases, with an estimated prevalence of 8 to 10 percent among whites.1 Although most forms of the disease do not have a simple mendelian pattern of inheritance, the contribution of heredity is well recognized.2 It is likely that the common forms of NIDDM are complex and heterogeneous and that they result when a pool of mutant genes, each contributing in a small and subtle way, interact with one another and with environmental, aging, and behavioral influences to lead to the expression of the disease.2-4
Obesity is a known risk factor for the development of NIDDM5,6 and, like NIDDM, has clear genetic determinants.7,8 In humans, resting metabolic rate is a familial trait,9,10 and a low resting metabolic rate is a risk factor for weight gain and obesity.11,12 In rodents, resting metabolic rate is regulated by the sympathetic nervous system and acts through the modulation of lipolysis and thermogenesis in brown adipose tissue.13,14 Although adult humans do not have anatomically distinct deposits of brown adipose tissue, the identification of uncoupling protein, a marker widely regarded as specific for such tissue, suggests that modulation of thermogenesis may also be important in human adipose tissue.15
The β3-adrenergic receptor crosses the cell membrane seven times, is coupled to guanine-nucleotide–binding (G) proteins, and is localized in adipose tissue. Stimulation of the receptor by β-adrenergic agonists activates adenylate cyclase, which increases intracellular concentrations of cyclic AMP (cAMP) and results in increased lipolysis and thermogenesis.16-18 There is evidence that molecular abnormalities in the β3-adrenergic receptor may lead to obesity and NIDDM. Expression of the receptor is markedly decreased in rodent models of obesity19,20; mice with knockout (disruption) of the gene for the receptor have marked reductions in lipolysis stimulated by β-agonists,21 and β3-specific agonists have potent antiobesity and antidiabetic effects in both animals22,23 and humans.23,24 To examine further the potential role of inherited defects in this gene as contributors to obesity and NIDDM, we evaluated a group of Pima Indians, an ethnic group with a very high prevalence of these disorders, for the presence of mutations in the β3-adrenergic–receptor gene.
Methods
Study Subjects
All protocols were approved by the ethics committees of the National Institute of Diabetes and Digestive and Kidney Diseases, the Indian Health Service, and the tribal council of the Gila River Indian Community and were performed after written informed consent was obtained from the subjects. The 642 subjects (390 with NIDDM and 252 without NIDDM) who participated in the main study were full-blooded Pima or Tohono O'odham Indians (or a mixture of these two closely related tribes) 35 to 87 years of age. The selection of subjects was not based on their familial relationship to any other subject or to the presence of diabetes. NIDDM was diagnosed on the basis of the classification system of the World Health Organization.25 Anthropometric measurements and measurements of body composition were made by standard methods.26 The relations among the β3-adrenergic–receptor genotype, the resting metabolic rate (which was measured by indirect calorimetry with the subject in a respiratory chamber), plasma concentrations of glucose and insulin after oral glucose administration, and sensitivity to insulin (as determined by the hyperinsulinemic–euglycemic clamp technique) were studied in a separate group of 210 nondiabetic Pima Indians.9,26 For the estimation of allelic frequencies, β3-adrenergic–receptor genotypes were also determined in 62 Mexican Americans from San Antonio, Texas,27 and in 49 blacks and 48 whites from the Baltimore metropolitan area.
Analysis of Single-Stranded Conformational Polymorphisms of the β3-Adrenergic–Receptor Gene
Genomic DNA was prepared from leukocytes or immortalized cell lines by established methods. Genomic DNA was amplified by the polymerase chain reaction (PCR) as described elsewhere.28 Ten pairs of primers were used to generate 10 overlapping PCR products encompassing the entire coding region, the 5' untranslated region, the exon–intron splice junctions, and 521 base pairs (bp) of the regulatory region of the β3-adrenergic–receptor gene17,20,29 (and data deposited with the National Auxiliary Publications Service, NAPS). For the analysis of single-stranded conformational polymorphisms, the PCR products were radiolabeled by the addition of [α-32P]deoxycytidine triphosphate to the reaction mixture. Denatured PCR products were loaded onto a polyacrylamide gel (MDE, AT Biochemicals, Malvern, Pa.), and subjected to electrophoresis at 4 to 6 W for 18 to 20 hours under four gel conditions: with and without 10 percent glycerol at 4°C and at 25°C.30 The gel was vacuum-dried, and autoradiography was performed.
Dideoxy Sequence Analysis
Variants detected by analysis of single-stranded conformational polymorphisms were subjected to direct dideoxy sequence analysis with asymmetric PCR28 and Sequenase Version 2.0 kits (United States Biochemicals, Cleveland). Changes in bases were confirmed by the sequencing of the opposite strands and by digestion with restriction enzymes.
Detection of the Mutated Receptor by Hybridization with Allele-Specific Oligonucleotides
A 367-bp fragment of the β3-adrenergic–receptor gene encompassing the mutation site was amplified by PCR with primers 5'TTCCTTCTTTCCCTACCGCCC3' and 5'GCAGCCAGTGGCGCCCAACGG3'. The PCR products were blotted in duplicate onto nylon membranes. Hybridization was accomplished with 32P-radiolabeled oligonucleotides corresponding to either the normal sequence of the β3-adrenergic–receptor gene (5'CATCGCCTGGACTCCGA3'; the probe for Trp64) or the sequence of the Trp64Arg β3-adrenergic–receptor gene (5'CATCGCCCGGACTCCGA3'; the probe for Arg64).31 The membranes were then washed twice in 2× sodium chloride–sodium phosphate–EDTA (SSPE) (1× SSPE is 150 mM sodium chloride, 10 mM sodium phosphate, and 1.25 mM EDTA; pH 7.4) and 0.05 percent sodium dodecyl sulfate at 60°C (the Trp64 probe) or 62°C (the Arg64 probe) for 15 minutes, and autoradiography was performed.
Statistical Analysis
In the studies of the association of variables with genotype, chi-square tests were performed. In the analysis of quantitative traits, an analysis of variance was used and, where appropriate, covariates were included in the models.
Results
Analysis of Single-Stranded Conformational Polymorphisms
Ten Pima Indians with obesity and NIDDM, none of whom were first-degree relatives of each other, were initially screened for variation in the β3-adrenergic–receptor gene. Analysis of single-stranded conformational polymorphisms revealed two variant patterns in the coding region. Dideoxy sequence analysis of one variant (present in 2 of the 10 Pimas) revealed a silent replacement of cytosine (C) by thymidine (T) at nucleotide position 381 (codon 127; i.e., ACCThr→ACTThr). Sequence analysis of the second variant (present in 5 of the 10 Pimas) revealed a heterozygous pattern with a replacement of thymidine (T) by cytosine (C) at nucleotide position 190 (Figure 1AFigure 1
Identification of the Trp64Arg Mutation of the β3-Adrenergic–Receptor Gene. and Figure 1B). This change in bases predicted a replacement of tryptophan (TGG) by arginine (CGG) at position 64 (Trp64Arg), an amino acid in the first of the three intracellular loops of the receptor (Figure 2Figure 2Diagram of the β3-Adrenergic Receptor.). This change in bases was confirmed by restriction-enzyme digestion with BstNI (Figure 3AFigure 3
Use of Restriction-Enzyme Digestion to Confirm the Presence of the Trp64Arg Mutation. and Figure 3B). To screen for mutations that may have been missed in the analysis of single-stranded conformational polymorphisms, the entire coding region of the β3-adrenergic–receptor gene was sequenced in two additional Pima Indians with NIDDM. No new base changes were identified.Allelic Frequencies of the Trp64Arg Mutation in Pima Indians and Other Subjects
Genomic DNA from 642 Pima Indians (390 subjects with NIDDM and 252 without NIDDM) was subjected to genotyping for the Trp64Arg missense mutation in the β3-adrenergic receptor by hybridization with allele-specific oligonucleotides (Figure 4Figure 4
Detection of Mutated and Normal β3-Adrenergic Receptors by Hybridization with Allele-Specific Oligonucleotides.). The frequency of the Trp64Arg allele was 0.31. Nine percent of the subjects were homozygous for the mutation, 45 percent were heterozygous, and 46 percent lacked the mutation. When the genotypes were analyzed according to the subjects' age and sex, there was a statistically significant underrepresentation of Trp64Arg homozygotes among men 45 or older (P = 0.02) (Table 1Table 1
Frequency of Homozygosity for the Trp64Arg Mutation of the b3-Adrenergic–Receptor Gene among the Pima Indians Studied, According to Age.).The frequency of the Trp64Arg allele among the 62 Mexican Americans (with 124 alleles) was 0.13. Among the 49 blacks (with 98 alleles) it was 0.12, and among the 48 whites (with 96 alleles) it was 0.08.
The Trp64Arg Genotype, NIDDM, and Obesity
Diabetes was not significantly associated with the Trp64Arg genotype in the 642 Pima Indians; the prevalence of NIDDM was 72 percent, 60 percent, and 60 percent, respectively, among Trp64Arg homozygotes, Trp64Arg heterozygotes, and normal homozygotes (P = 0.19). From these data we concluded that the prevalence of NIDDM was slightly but not significantly higher among Trp64Arg homozygotes than among the Pima subjects with the other two genotypes (prevalence-rate ratio, 1.2; 95 percent confidence interval, 1.0 to 1.5). The mean age of the Trp64Arg homozygotes at the onset of NIDDM was significantly lower than that of the heterozygotes and the normal homozygotes (P = 0.02) (Table 2Table 2
Characteristics of 642 Pima Indians According to Genotype of the b3-Adrenergic Receptor.). In view of this finding, we also examined the prevalence of diabetes that was diagnosed before the age of 25 years. Overall, this prevalence did not differ significantly between the three groups (P = 0.11), although our data showed that the prevalence of diabetes diagnosed before the age of 25 years was higher among Trp64Arg homozygotes than among subjects with either of the other two genotypes (prevalence-rate ratio, 2.7; 95 percent confidence interval, 1.1 to 6.8).There was a trend toward a higher mean (±SD) body-mass index (the weight in kilograms divided by the square of the height in meters) among the subjects homozygous for the Trp64Arg mutation (35.2±8.0) than among subjects heterozygous for the mutation (34.1±7.9) or the normal homozygotes (33.9±7.5) (Table 2). Although this trend persisted after adjustment for age and sex, the differences were not statistically significant; nor were there significant differences in the ratio of the waist to the hip circumference.
The Trp64Arg Mutation and the Resting Metabolic Rate
When we studied the separate group of 210 Pima Indians, we found a trend toward a lower resting metabolic rate in subjects with the Trp64Arg mutation of the β3-adrenergic receptor (Table 2). After we adjusted for known covariates of the resting metabolic rate (fat-free mass, fat mass, and sex), the 22 subjects homozygous for the mutation expended an average of 82 kcal per day less than the 82 normal homozygotes; in the 106 heterozygotes, the average resting metabolic rate (36 kcal per day less than that of the normal homozygotes) was intermediate between the values for the two other groups (P = 0.14 by analysis of covariance). There were no significant associations of genotype with plasma concentrations of glucose or insulin during an oral glucose-tolerance test or with sensitivity to insulin as measured by the hyperinsulinemic–euglycemic clamp technique in this group.
Discussion
We have identified a mutation in the β3-adrenergic–receptor gene that, although not in itself associated with NIDDM, was associated with the onset of NIDDM at an earlier age among Pima Indians homozygous for the mutation. This finding suggests that the mutation is not a major determinant of NIDDM in these subjects, but rather acts to accelerate the course of the disease. The underrepresentation in the study sample of men 45 or older who were homozygous for the mutation may indicate early mortality, perhaps due to the long-term complications of diabetes that would be expected if the disease had an earlier onset.
Very small decrements in the resting metabolic rate can lead to excess accumulation of energy, weight gain, and obesity. In prospective studies of adult Pima Indians, a small daily difference in the metabolic rate (70 kcal) was a risk factor for weight gain and obesity.12 Indeed, subjects with the Trp64Arg mutation in the gene for the β3-adrenergic receptor tended to have lower resting metabolic rates but were no more obese than normal subjects. Prospective measures of weight gain in younger subjects and association studies in subjects less genetically predisposed to obesity will be needed to define further the influence of this mutation on low energy expenditure and the development of obesity and NIDDM. Indeed, data from Widén and Clément and their colleagues,32,33 in addition to our own studies of Mexican Americans (unpublished data), implicate this mutation, even in its heterozygous form, as a contributor to central obesity and weight gain, as well as to insulin resistance and NIDDM with an accelerated onset. These studies provide additional evidence that this missense mutation contributes to the genetic basis of the common forms of obesity, insulin resistance, and NIDDM.
The Trp64Arg mutation appears at the beginning of the first intracellular loop of the β3-adrenergic receptor (Figure 2). On the basis of studies of the related β2-adrenergic receptor34 and rhodopsin,35 the first intracellular loop is thought to be important for the proper movement of the receptor to the cell surface and possibly also for its coupling to G proteins. Defective expression at the cell surface or impaired signaling may lead to decreased lipolysis and thermogenesis in visceral fat tissue that may contribute to central obesity, insulin resistance, and NIDDM.
Supported by a grant (NIA 5T32AG00120) from the National Institutes of Health and by grants from the Mallinckrodt Foundation (to Dr. Shuldiner), the American Federation of Aging Research (to Dr. Shuldiner), the Chesapeake Education and Research Trust (to Drs. Walston, Silver, Austin, and Shuldiner), the Robert Wood Johnson Foundation (to Dr. Austin), and the Hartford Foundation (to Drs. Walston and Austin). Dr. Walston was supported by a Pfizer–American Geriatrics Society postdoctoral fellowship.
NAPS See NAPS document no. 05233 for one page of supplementary material. To order, contact NAPS c/o Microfiche Publications, 248 Hempstead Tpk., West Hempstead, NY 11552.
We are indebted to Drs. John Burton and Philip Zieve for their support; to Drs. Reubin Andres, Terri Beaty, and Chahrzad Rafizadeh-Montrose for their advice and helpful comments; and to Mr. Keith Tanner and Ms. Amy Patterson for their assistance.
Source Information
From the Divisions of Geriatric Medicine and Gerontology (J.W., F.S.C., S.A., J.R., A.R.S.) and Endocrinology and Metabolism (K.S.), Johns Hopkins University School of Medicine, Baltimore; the Clinical Diabetes and Nutrition Section (C.B.) and the Diabetes and Arthritis Epidemiology Section (W.C.K.), National Institute of Diabetes and Digestive and Kidney Diseases, Phoenix, Ariz.; the Laboratory of Clinical Physiology, National Institute on Aging, Baltimore (F.S.C., J.D.S.); the Arthritis and Rheumatism Branch, National Institute of Arthritis and Musculoskeletal and Skin Diseases, Bethesda, Md. (N.R.); the Laboratoire d'Immunopharmacologie Moléculaire, Institut Cochin de Génétique Moléculaire, Paris (B.M., A.D.S.); and the Department of Medicine, Division of Clinical Epidemiology, University of Texas Health Science Center, San Antonio (M.P.S.).
Address reprint requests to Dr. Shuldiner at the Johns Hopkins University School of Medicine, 5501 Bayview Cir., Rm. 5A42, Baltimore, MD 21224.
- References
References
1
Harris MI ,Hadden WC ,Knowler WC ,Bennett PH . Prevalence of diabetes and impaired glucose tolerance and plasma glucose levels in U.S. population aged 20-74 yr. Diabetes 1987;36:523-534
CrossRef | Web of Science | Medline2
Rotter JI, Vadheim CM, Rimoin DL. Genetics of diabetes mellitus. In: Rifkin H, Porte D Jr, eds. Ellenberg and Rifkin's diabetes mellitus: theory and practice. 4th ed. New York: Elsevier, 1990:378-413.
3
Elbein SC ,Hoffman MD ,Bragg KL ,Mayorga RA . The genetics of NIDDM: an update. Diabetes Care 1994;17:1523-1533
Web of Science | Medline4
Turner RC ,Hattersley AT ,Shaw JTE ,Levy JC . Type II diabetes: clinical aspects of molecular biological studies. Diabetes 1995;44:1-10
CrossRef | Web of Science | Medline5
Barrett-Connor E . Epidemiology, obesity, and non-insulin-dependent diabetes mellitus. Epidemiol Rev 1989;11:172-181
Web of Science | Medline6
Knowler WC ,Pettitt D ,Saad M , et al. Obesity in the Pima Indians: its magnitude and relationship with diabetes. Am J Clin Nutr 1991;53:Suppl:1543S-1551S
Web of Science | Medline7
Bouchard C . Genetics of obesity and its prevention. World Rev Nutr Diet 1993;72:68-77
Medline8
Stunkard AJ ,Sorensen TIA ,Hanis C , et al. An adoption study of human obesity. N Engl J Med 1986;314:193-198
Full Text | Web of Science | Medline9
Bogardus C ,Lillioja S ,Ravussin E , et al. Familial dependence of the resting metabolic rate. N Engl J Med 1986;315:96-100
Full Text | Web of Science | Medline10
Bouchard C ,Tremblay A ,Nadeau A , et al. Genetic effect in resting and exercise metabolic rates. Metabolism 1989;38:364-370
CrossRef | Web of Science | Medline11
Ravussin E ,Lillioja S ,Knowler WC , et al. Reduced rate of energy expenditure as a risk factor for body-weight gain. N Engl J Med 1988;318:467-472
Full Text | Web of Science | Medline12
Griffiths M ,Payne PR ,Stunkard AJ ,Rivers JP ,Cox M . Metabolic rate and physical development in children at risk of obesity. Lancet 1990;336:76-78
CrossRef | Web of Science | Medline13
Rothwell NJ ,Stock MJ . A role for brown adipose tissue in diet-induced thermogenesis. Nature 1979;281:31-35
CrossRef | Web of Science | Medline14
Trayhurn P ,Mercer SW . Brown adipose tissue thermogenesis in obese animals. Biochem Soc Trans 1986;14:236-239
Web of Science | Medline15
Cassard AM ,Bouillaud F ,Mattei MG , et al. Human uncoupling protein gene: structure, comparison with rat gene, and assignment to the long arm of chromosome 4. J Cell Biochem 1990;43:255-264
CrossRef | Web of Science | Medline16
Emorine LJ ,Marullo S ,Briend-Sutren M-M , et al. Molecular characterization of the human β3-adrenergic receptor. Science 1989;245:1118-1121
CrossRef | Web of Science | Medline17
van Spronsen A ,Nahmias C ,Krief S ,Briend-Sutren MM ,Strosberg AD ,Emorine LJ . The promoter and intron/exon structure of the human and mouse β3-adrenergic-receptor genes. Eur J Biochem 1993;213:1117-1124
CrossRef | Medline18
Krief S ,Lonnqvist F ,Raimbault S , et al. Tissue distribution of β3-adrenergic receptor mRNA in man. J Clin Invest 1993;91:344-349
CrossRef | Web of Science | Medline19
Collins S ,Daniel KW ,Rohlfs EM ,Ramkumar V ,Taylor IL ,Gettys TW . Impaired expression and functional activity of the β3- and β1-adrenergic receptors in adipose tissue of congenitally obese (C57BL/6J ob/ob) mice. Mol Endocrinol 1994;8:518-527
CrossRef | Web of Science | Medline20
Muzzin P ,Revelli J-P ,Kuhne F , et al. An adipose tissue-specific β-adrenergic receptor: molecular cloning and down-regulation in obesity. J Biol Chem 1991;266:24053-24058
Web of Science | Medline21
Susulic S, Frederich RC, Lawitts JA, et al. Knockout of the β3-adrenergic receptor gene. In: Program and abstracts of the 77th annual meeting of the Endocrine Society, June 14-17, 1995, Bethesda, Md.: Endocrine Society, 1995:36. abstract.
22
Himms-Hagen J ,Cui J ,Danforth E Jr , et al. Effect of CL-316,243, a thermogenic β3-agonist, on energy balance and brown and white adipose tissues in rats. Am J Physiol 1994;266:R1371-R1382
Web of Science | Medline23
Connacher AA ,Bennet WM ,Jung RT . Clinical studies with the β-adrenoreceptor agonist BRL 26830A. Am J Clin Nutr 1992;55:Suppl:258S-261S
Web of Science | Medline24
Mitchell TH ,Ellis RD ,Smith SA ,Robb G ,Cawthorne MA . Effects of BRL 35135, a β-adrenoreceptor agonist with novel selectivity, on glucose tolerance and insulin sensitivity in obese subjects. Int J Obes 1989;13:757-766
Web of Science | Medline25
Diabetes mellitus: report of a WHO study groupWorld Health Organ Tech Rep Ser 1985;727:7-113
26
Prochazka M ,Lillioja S ,Tait JF , et al. Linkage of chromosomal markers on 4q with a putative gene determining maximal insulin action in Pima Indians. Diabetes 1993;42:514-519
CrossRef | Web of Science | Medline27
Mitchell BD ,Kammerer CM ,Reinhart LJ ,Stern MP . NIDDM in Mexican-American families: heterogeneity by age of onset. Diabetes Care 1994;17:567-573
CrossRef | Web of Science | Medline28
Shuldiner AR, Perfetti R. The polymerase chain reaction: applications to endocrine research. In: de Pablo F, Scanes CG, eds. Handbook of endocrine research techniques. San Diego, Calif.: Academic Press, 1993:457-86.
29
Liggett SB ,Schwinn DA . Multiple potential regulatory elements in the 5' flanking region of the β3-adrenergic receptor. DNA Seq 1992;2:61-63
CrossRef30
Orita M ,Suzuki Y ,Sekiya T ,Hayashi K . Rapid and sensitive detection of point mutations and DNA polymorphisms using the polymerase chain reaction. Genomics 1989;5:874-879
CrossRef | Web of Science | Medline31
Lyons J. Analysis of ras gene point mutations by PCR and oligonucleotide hybridization. In: Innis MA, Gelfand DH, Sninsky JJ, White TJ, eds. PCR protocols: a guide to methods and applications. San Diego, Calif.: Academic Press, 1990.
32
Widen E ,Lehto M ,Kanninen T ,Walston J ,Shuldiner AR ,Groop LC . Association of a polymorphism in the β3-adrenergic-receptor gene with features of the insulin resistance syndrome in Finns. N Engl J Med 1995;333:348-351
Full Text | Web of Science | Medline33
Clement K ,Vaisse C ,Manning BSJ , et al. Genetic variation in the β3-adrenergic receptor and an increased capacity to gain weight in patients with morbid obesity. N Engl J Med 1995;333:352-354
Full Text | Web of Science | Medline34
Ostrowski J ,Kjelsberg MA ,Caron MG ,Lefkowitz RJ . Mutagenesis of the β2-adrenergic receptor: how structure elucidates function. Annu Rev Pharmacol Toxicol 1992;32:167-183
CrossRef | Web of Science | Medline35
Sung CH ,Davenport CM ,Nathans J . Rhodopsin mutations responsible for autosomal dominant retinitis pigmentosa: clustering of functional classes along the polypeptide chain. J Biol Chem 1993;268:26645-26649
Web of Science | Medline
- Citing Articles (204)
Citing Articles
1
Saraswathy Nair, Yunhua Li Muller, Emilio Ortega, Sayuko Kobes, Clifton Bogardus, Leslie J. Baier. (2012) Association Analyses of Variants in the DIO2 Gene with Early-Onset Type 2 Diabetes Mellitus in Pima Indians. Thyroid 22:1, 80-87
CrossRef2
Chin Cheng, Hsien-Jane Chiu, El-Wui Loh, Chin-Hong Chan, Tzong-Ming Hwu, Yun-Ru Liu, Tsuo-Hung Lan. (2011) Association of the ADRA1A gene and the severity of metabolic abnormalities in patients with schizophrenia. Progress in Neuro-Psychopharmacology and Biological Psychiatry
CrossRef3
Alexander L. Berlin. 2011. Physiology, pathophysiology, and aging. , 14-34.
CrossRef4
Guo Yang, Jon G.H. Hickford, Huitong Zhou, Qian Fang, Rachel H. Forrest. (2011) Extended Haplotype Analysis of Ovine ADRB3 Using Polymerase Chain Reaction Single Strand Conformational Polymorphism on Two Regions of the Gene. DNA and Cell Biology 30:7, 445-448
CrossRef5
Heidi M. Sleister, Maria Gabriela Valdovinos. (2011) Why Research On the Pharmacogenetics of Atypical Antipsychotic-Induced Weight Gain in Individuals With Intellectual Disabilities Is Warranted. Journal of Mental Health Research in Intellectual Disabilities 4:2, 65-78
CrossRef6
Mark Stephens, Marian Ludgate, D. Aled Rees. (2011) Brown fat and obesity: the next big thing?. Clinical Endocrinology 74:6, 661-670
CrossRef7
Aya Tahara, Yoneatsu Osaki, Takuji Kishimoto. (2011) Influence of beta 3-adrenergic receptor Trp64Arg polymorphism on the improvement of metabolic syndrome by exercise-based intervention in Japanese middle-aged males. Obesity Research & Clinical Practice 5:2, e109-e117
CrossRef8
Safarina G Malik, Made R Saraswati, Ketut Suastika, Hidayat Trimarsanto, Sukma Oktavianthi, Herawati Sudoyo. (2011) Association of beta3-adrenergic receptor (ADRB3) Trp64Arg gene polymorphism with obesity and metabolic syndrome in the Balinese: a pilot study. BMC Research Notes 4:1, 167
CrossRef9
Kazuko Masuo, Gavin W. Lambert. (2011) Relationships of Adrenoceptor Polymorphisms with Obesity. Journal of Obesity 2011, 1-10
CrossRef10
Aibek E Mirrakhimov, Alina S Kerimkulova, Olga S Lunegova, Cholpon B Moldokeeva, Yulia V Zalesskaya, Samai S Abilova, Nurmira A Sovhozova, Almaz A Aldashev, Erkin M Mirrakhimov. (2011) An association between TRP64ARG polymorphism of the B3 adrenoreceptor gene and some metabolic disturbances. Cardiovascular Diabetology 10:1, 89
CrossRef11
Aya Tahara, Yoneatsu Osaki, Takuji Kishimoto. (2010) Effect of the β3-adrenergic receptor gene polymorphism Trp64Arg on BMI reduction associated with an exercise-based intervention program in Japanese middle-aged males. Environmental Health and Preventive Medicine 15:6, 392-397
CrossRef12
Jiang Hu, Huitong Zhou, Anna Smyth, Yuzhu Luo, Jon G. H. Hickford. (2010) Polymorphism of the bovine ADRB3 gene. Molecular Biology Reports 37:7, 3389-3392
CrossRef13
2010. References. , 663-715.
CrossRef14
Y. Wang, A. O. Y. Luk, R. C. W. Ma, W. Y. So, C. H. T. Tam, M. C. Y. Ng, X. Yang, L. Baum, V. Lam, P. C. Y. Tong, J. C. N. Chan. (2010) Independent predictive roles of eotaxin Ala23Thr, paraoxonase 2 Ser311Cys and β 3 -adrenergic receptor Trp64Arg polymorphisms on cardiac disease in Type 2 Diabetes-an 8-year prospective cohort analysis of 1297 patients. Diabetic Medicine 27:4, 376-383
CrossRef15
Jun-jing Jia, Yun-bo Tian, Zhen-hui Cao, Lin-li Tao, Xi Zhang, Si-zhen Gao, Chang-rong Ge, Qiu-Ye Lin, M. Jois. (2010) The polymorphisms of UCP1 genes associated with fat metabolism, obesity and diabetes. Molecular Biology Reports 37:3, 1513-1522
CrossRef16
Karani S. Vimaleswaran, Ruth J.F. Loos. (2010) Progress in the genetics of common obesity and type 2 diabetes. Expert Reviews in Molecular Medicine 12,
CrossRef17
Kazuko Masuo. (2010) Roles of Beta2- and Beta3-Adrenoceptor Polymorphisms in Hypertension and Metabolic Syndrome. International Journal of Hypertension 2010, 1-12
CrossRef18
Ruth J. F. Loos. (2009) Recent progress in the genetics of common obesity. British Journal of Clinical Pharmacology 68:6, 811-829
CrossRef19
X. Y. Song, S. Y. Lee, R. C. W. Ma, W. Y. So, J. H. Cai, C. Tam, V. Lam, W. Ying, M. C. Y. Ng, J. C. N. Chan. (2009) Phenotype–genotype interactions on renal function in type 2 diabetes: an analysis using structural equation modelling. Diabetologia 52:8, 1543-1553
CrossRef20
Min Yang, Qiong Huang, Jing Wu, Ji-Ye Yin, Hong Sun, Hai-Ling Liu, Hong-Hao Zhou, Zhao-Qian Liu. (2009) Effects of UCP2 -866 G/A and ADRB3 Trp64Arg on rosiglitazone response in Chinese patients with Type 2 diabetes. British Journal of Clinical Pharmacology 68:1, 14-22
CrossRef21
Rachele Cagliani, Matteo Fumagalli, Uberto Pozzoli, Stefania Riva, Giacomo P. Comi, Federica Torri, Fabio Macciardi, Nereo Bresolin, Manuela Sironi. (2009) Diverse Evolutionary Histories for β-adrenoreceptor Genes in Humans. The American Journal of Human Genetics 85:1, 64-75
CrossRef22
(2009) Association of β3-Adrenergic Receptor Polymorphisms and High-Density Lipoprotein Cholesterol. Journal of Life Science 19:5, 664-670
CrossRef23
Kozue Sakamoto, Youichi Sato, Toshikatsu Shinka, Masako Sei, Isoko Nomura, Mayumi Umeno, Ashraf A. Ewis, Yutaka Nakahori. (2009) Proteasome Subunits mRNA Expressions Correlate With Male BMI: Implications for a Role in Obesity. Obesity 17:5, 1044-1049
CrossRef24
Wim Vrydag, Astrid E. Alewijnse, Martin C. Michel. (2009) Do gene polymorphisms alone or in combination affect the function of human β 3 -adrenoceptors?. British Journal of Pharmacology 156:1, 127-134
CrossRef25
Aneta Stefanidis, Aaron N.A. Verty, Andrew M. Allen, Neil C. Owens, Michael A. Cowley, Brian J. Oldfield. (2009) The Role of Thermogenesis in Antipsychotic Drug-induced Weight Gain. Obesity 17:1, 16-24
CrossRef26
Amira Peco-Antic. (2009) Hypertension in obese children and adolescents. Srpski arhiv za celokupno lekarstvo 137:1-2, 91-97
CrossRef27
Shinichi Kuriyama, Taichi Shimazu, Atsushi Hozawa, Shigeo Kure, Naoyuki Kurokawa, Masako Kakizaki, Toshimasa Sone, Kaori Matsuda-Ohmori, Naoki Nakaya, Hiroshi Satoh, Ichiro Tsuji. (2008) No effect of the Trp64Arg variant of the β3-adrenergic receptor gene on weight loss by diet and exercise intervention among Japanese adults. Metabolism 57:11, 1570-1575
CrossRef28
Barbara Zanone Poma, Agostino Riva, Milena Nasi, Paola Cicconi, Valentina Broggini, Alessandro Cozzi Lepri, Daniela Mologni, Francesco Mazzotta, Antonella DʼArminio Monforte, Cristina Mussini, Andrea Cossarizza, Massimo Galli. (2008) Genetic polymorphisms differently influencing the emergence of atrophy and fat accumulation in HIV-related lipodystrophy. AIDS 22:14, 1769-1778
CrossRef29
N Kurokawa, E H Young, Y Oka, H Satoh, N J Wareham, M S Sandhu, R J F Loos. (2008) The ADRB3 Trp64Arg variant and BMI: a meta-analysis of 44 833 individuals. International Journal of Obesity 32:8, 1240-1249
CrossRef30
Tomokazu Awaya, Yasuyuki Yokosaki, Kiminori Yamane, Hiroshi Usui, Nobuoki Kohno, Akira Eboshida. (2008) Gene-environment Association of an ITGB2 Sequence Variant With Obesity in Ethnic Japanese. Obesity 16:6, 1463-1466
CrossRef31
A.P. Gjesing, G. Andersen, K. Borch-Johnsen, T. Jørgensen, T. Hansen, O. Pedersen. (2008) Association of the β3-adrenergic receptor Trp64Arg polymorphism with common metabolic traits: Studies of 7605 middle-aged white people. Molecular Genetics and Metabolism 94:1, 90-97
CrossRef32
Julie Robitaille, Althea M. Grant. (2008) The genetics of gestational diabetes mellitus: evidence for relationship with type 2 diabetes mellitus. Genetics in Medicine 10:4, 240-250
CrossRef33
Ki-Ok Shin, Hyun-Jun Kim, Sung-Hwun Kang. (2008) Alterations of Heart Rate Variability upon β3-Adrenergic Receptor Polymorphism and Combined Capsaicin, Sesamin, and L-Carnitine in Humans. Journal of Life Science 18:3, 291-297
CrossRef34
M. H. Zafarmand, Y. T. Van Der Schouw, D. E. Grobbee, P. W. De Leeuw, M. L. Bots. (2008) T64A polymorphism in β3-adrenergic receptor gene (ADRB3) and coronary heart disease: a case-cohort study and meta-analysis. Journal of Internal Medicine 263:1, 79-89
CrossRef35
Sonsoles Morcillo, Fernando Cardona, Gemma Rojo-Martínez, M Cruz Almaraz, Isabel Esteva, María Soledad Ruiz-De-Adana, Gabriel Olveira, Eduardo García-Fuentes, Juan Miguel Gómez-Zumaquero, Federico Soriguer. (2008) Effect of the combination of the variants -75G/A APOA1 and Trp64Arg ADRB3 on the risk of type 2 diabetes (DM2). Clinical Endocrinology 68:1, 102-107
CrossRef36
Taku Hamada, Kazuhiko Kotani, Akane Higashi, Junko Ikeda, Emi Tagaki, Aiko Igarashi, Chikanobu Matsubara, Toshihide Yoshida, Naoki Sakane. (2008) Lack of Association of the Trp64Arg Polymorphism of β3-Adrenergic Receptor Gene with Energy Expenditure in Response to Caffeine Among Young Healthy Women. The Tohoku Journal of Experimental Medicine 214:4, 365-370
CrossRef37
Shinpei Nonen, Isamu Yamamoto, Jianmin Liu, Makiko Maeda, Takashi Motomura, Tsuyoshi Igarashi, Yasushi Fujio, Junichi Azuma. (2008) Adrenergic β1 Receptor Polymorphism (Ser49Gly) Is Associated with Obesity in Type II Diabetic Patients. Biological & Pharmaceutical Bulletin 31:2, 295-298
CrossRef38
Arizumi Kikuchi, Yuko Kuramoto, Nobuyasu Noritake, Hiroshi Murase, Osami Daimaru, Takeo Nakakita, Shinichi Itoh. (2007) Rapid Genotyping Using Real-time Fluorescent PCR of the Trp64Arg Polymorphism of the β3-adrenergic Receptor Gene and the −3826 A to G Variant of the Uncoupling Protein-1 Gene. Biochemical Genetics 45:11-12, 769-773
CrossRef39
Kokoro Tsuzaki, Kazuhiko Kotani, Shinji Fujiwara, Yoshiko Sano, Yukiyo Matsuoka, Masayuki Domichi, Taku Hamada, Akira Shimatsu, Naoki Sakane. (2007) The Trp64Arg polymorphism of the β3-adrenergic receptor gene is associated with increased small dense low-density lipoprotein in a rural Japanese population: the Mima study. Metabolism 56:12, 1689-1693
CrossRef40
Dietmar M. Klass, Nadine Lauer, Birgit Hay, Wolfgang Kratzer, Michael Fuchs, . (2007) Arg 64 Variant of the ß 3 -Adrenergic Receptor is Associated With Gallstone Formation. The American Journal of Gastroenterology 102:11, 2482-2487
CrossRef41
Xin Zhao, Min-Yu Hu, Qiong Huang, Zhong-Yang Tang, Xing-Ping Dai, Ji-Ye Yin, Feng Zhang, Hong-Hao Zhou, Zhao-Qian Liu. (2007) Impact of rosiglitazone on the expression of β 3 -AR in the stable cell lines expressed β 3 -AR gene. Clinical Chemistry and Laboratory Medicine 45:11, 1511-1516
CrossRef42
R Bracale, F Pasanisi, G Labruna, C Finelli, C Nardelli, P Buono, G Salvatori, L Sacchetti, F Contaldo, G Oriani. (2007) Metabolic syndrome and ADRB3 gene polymorphism in severely obese patients from South Italy. European Journal of Clinical Nutrition 61:10, 1213-1219
CrossRef43
Julie Robitaille, Louis Pérusse, Claude Bouchard, Marie-Claude Vohl. (2007) Genes, Fat Intake, and Cardiovascular Disease Risk Factors in the Quebec Family Study*. Obesity 15:9, 2336-2347
CrossRef44
Ki-Jun Ko, Ki-Ok Shin. (2007) Alterations of Human Autonomic Nervous System Activity on Capsaicin Ingestion, and Variants of UCP1 and β 3 - -adrenergic Receptor Polymorphism. Journal of Life Science 17:8, 1075-1081
CrossRef45
Richard Baumgartner, Chenxi Wang, David Allison. 2007. Genetics of Human Obesity. , 833-745.
CrossRef46
R McKean-Cowdin, X Li, L Bernstein, A McTiernan, R Ballard-Barbash, W J Gauderman, F Gilliland. (2007) The ADRB3 Trp64Arg variant and obesity in African-American breast cancer cases. International Journal of Obesity 31:7, 1110-1118
CrossRef47
Young Hee Rho, Seong Jae Choi, Young Ho Lee, Jong Dae Ji, Gwan Gyu Song. (2007) The association between hyperuricemia and the Trp64Arg polymorphism of the beta-3 adrenergic receptor. Rheumatology International 27:9, 835-839
CrossRef48
N. Shaat, Å. Lernmark, E. Karlsson, S. Ivarsson, H. Parikh, K. Berntorp, L. Groop. (2007) A variant in the transcription factor 7-like 2 (TCF7L2) gene is associated with an increased risk of gestational diabetes mellitus. Diabetologia 50:5, 972-979
CrossRef49
TOMOE KINOSHITA, KEIICHI HANAKI, JUN-ICHI NAGAISHI, YUKI KAWASHIMA, KAORI ADACHI, EIJI NANBA, SUSUMU KANZAKI. (2007) Variation analysis of ? 3 -adrenergic receptor and melanocortin-4 receptor genes in childhood obesity. Pediatrics International 49:2, 133-137
CrossRef50
Kristi B. Adamo, Frédérique Tesson. (2007) Genotype-specific weight loss treatment advice: how close are we?. Applied Physiology, Nutrition, and Metabolism 32:3, 351-366
CrossRef51
Yasumasa Mitani, Alexander Lezhava, Yuki Kawai, Takeshi Kikuchi, Atsuko Oguchi-Katayama, Yasushi Kogo, Masayoshi Itoh, Toru Miyagi, Hideki Takakura, Kanako Hoshi, Chiaki Kato, Takahiro Arakawa, Kazuhiro Shibata, Kenji Fukui, Ryoji Masui, Seiki Kuramitsu, Kazuma Kiyotani, Alistair Chalk, Katsuhiko Tsunekawa, Masami Murakami, Tetsuya Kamataki, Takanori Oka, Hiroshi Shimada, Paul E Cizdziel, Yoshihide Hayashizaki. (2007) Rapid SNP diagnostics using asymmetric isothermal amplification and a new mismatch-suppression technology. Nature Methods 4:3, 257-262
CrossRef52
Paul W. Franks, Jose-Luis Mesa, Anne Helen Harding, Nicholas J. Wareham. (2007) Gene–lifestyle interaction on risk of type 2 diabetes. Nutrition, Metabolism and Cardiovascular Diseases 17:2, 104-124
CrossRef53
Margarita Terán-García, Claude Bouchard. (2007) Genetics of the metabolic syndrome. Applied Physiology, Nutrition, and Metabolism 32:1, 89-114
CrossRef54
M R G Taylor. (2007) Pharmacogenetics of the human beta-adrenergic receptors. The Pharmacogenomics Journal 7:1, 29-37
CrossRef55
Franco Fallucca, Maria Grazia Dalfrà, Ernesta Sciullo, Michela Masin, Angela Maria Buongiorno, Angela Napoli, Domenico Fedele, Annunziata Lapolla. (2006) Polymorphisms of insulin receptor substrate 1 and β3-adrenergic receptor genes in gestational diabetes and normal pregnancy. Metabolism 55:11, 1451-1456
CrossRef56
Dunstan Cooke, Steve Bloom. (2006) The obesity pipeline: current strategies in the development of anti-obesity drugs. Nature Reviews Drug Discovery 5:11, 919-931
CrossRef57
Agustín Muñoz-Sanz, Francisco F. Rodríguez-Vidigal, Pere Domingo. (2006) Patogenia de la lipodistrofia y de las alteraciones metabólicas asociadas a la infección por el VIH. Medicina Clínica 127:12, 465-474
CrossRef58
Koichiro Yasuda, Tetsuro Matsunaga, Tetsuya Adachi, Norihiko Aoki, Gozoh Tsujimoto, Kinsuke Tsuda. (2006) Adrenergic receptor polymorphisms and autonomic nervous system function in human obesity. Trends in Endocrinology & Metabolism 17:7, 269-275
CrossRef59
Kerri L. Palamara, Harriette R. Mogul, Stephen J. Peterson, William H. Frishman. (2006) Obesity. Cardiology in Review 14:5, 238-258
CrossRef60
Marcio C Mancini, Alfredo Halpern. (2006) Investigational therapies in the treatment of obesity. Expert Opinion on Investigational Drugs 15:8, 897-915
CrossRef61
Donna M. Lehman, Jeanette Hamlington, Kelly J. Hunt, Robin J. Leach, Rector Arya, Hanna Abboud, Ravindranath Duggirala, John Blangero, Harald H. H. Göring, Michael P. Stern. (2006) A novel missense mutation in ADRB3 increases risk for type 2 diabetes in a Mexican American family. Diabetes/Metabolism Research and Reviews 22:4, 331-336
CrossRef62
K. Hojlund, C. Christiansen, K. S. Bjornsbo, P. Poulsen, L. Bathum, J. E. Henriksen, O. Lammert, H. Beck-Nielsen. (2006) Energy expenditure, body composition and insulin response to glucose in male twins discordant for the Trp64Arg polymorphism of the beta3-adrenergic receptor gene. Diabetes, Obesity and Metabolism 8:3, 322-330
CrossRef63
Jung Su Lee, Kiyoshi Kawakubo, Shuji Inoue, Akira Akabayashi. (2006) Effect of β3-adrenergic receptor gene polymorphism on body weight change in middle-aged, overweight women. Environmental Health and Preventive Medicine 11:2, 69-74
CrossRef64
Naoko Miura, Ayako Ikezaki, Saika Iwama, Hisafumi Matsuoka, Keiko Ito, Shigetaka Sugihara. (2006) Genetic factors and clinical significance of acanthosis nigricans in obese Japanese children and adolescents. Acta Paediatrica 95:2, 170-175
CrossRef65
Kijin KIM, Seungno LEE, Sunjang LEE, Kiwon LIM, Wookwang CHEUN, Nayoung AHN, Yoonjung SHIN, Jusik PARK, Changbae HONG, Sanghyun KIM. (2006) Comparison of Body Fat Distribution and Blood Lipid Profiles according to Trp64Arg Polymorphism for the .BETA.3-Adrenergic Receptor Gene in Korean Middle-Aged Women. Journal of Nutritional Science and Vitaminology 52:4, 281-286
CrossRef66
Narumi NAGAI, Naoki SAKANE, Toshio MORITANI. (2006) Impact of Aging and .BETA.3-Adrenergic-Receptor Polymorphism on Thermic and Sympathetic Responses to a High-Fat Meal. Journal of Nutritional Science and Vitaminology 52:5, 352-359
CrossRef67
R. Ian Freshney. 2005. Culture of Specific Cell Types. .
CrossRef68
É Erhardt, M Czakó, K Csernus, D Molnár, Gy Kosztolányi. (2005) The frequency of Trp64Arg polymorphism of the β3-adrenergic receptor gene in healthy and obese Hungarian children and its association with cardiovascular risk factors. European Journal of Clinical Nutrition 59:8, 955-959
CrossRef69
A. Chidakel, D. Mentuccia, F.S. Celi. (2005) Peripheral Metabolism of Thyroid Hormone and Glucose Homeostasis. Thyroid 15:8, 899-903
CrossRef70
Hye Soon Park, Younyoung Kim, Chaeyoung Lee. (2005) Single nucleotide variants in the β2-adrenergic and β3-adrenergic receptor genes explained 18.3% of adolescent obesity variation. Journal of Human Genetics 50:7, 365-369
CrossRef71
Toshio Moritani, Tetsuya Kimura, Taku Hamada, Narumi Nagai. (2005) Electrophysiology and kinesiology for health and disease. Journal of Electromyography and Kinesiology 15:3, 240-255
CrossRef72
Francisco Perez-Bravo, Barbara Echiburu, Manuel Maliqueo, Jose Luis Santos, Teresa Sir-Petermann. (2005) Tryptophan 64 arginine polymorphism of beta-3-adrenergic receptor in Chilean women with polycystic ovary syndrome. Clinical Endocrinology 62:2, 126-131
CrossRef73
Philippe H. Jais. (2005) How frequent is altered gene expression among susceptibility genes to human complex disorders?. Genetics in Medicine 7:2, 83-96
CrossRef74
Joana Maria Ramis, José Luis González-Sánchez, Ana Marı́a Proenza, Marı́a Teresa Martı́nez-Larrad, Cristina Fernández-Pérez, Andreu Palou, Manuel Serrano-Rı́os. (2004) The Arg64 allele of the β3-adrenoceptor gene but not the −3826G allele of the uncoupling protein 1 gene is associated with increased leptin levels in the Spanish population. Metabolism 53:11, 1411-1416
CrossRef75
Jesse Roth, Xiaoling Qiang, Sharon Lee Marbán, Henry Redelt, Barbara C. Lowell. (2004) The Obesity Pandemic: Where Have We Been and Where Are We Going?. Obesity 12, 88S-101S
CrossRef76
C Flordellis, H Paris, A Karabinis, A Lymperopoulos. (2004) Pharmacogenomics of adrenoceptors. Pharmacogenomics 5:7, 803-817
CrossRef77
(2004) Common variants in β2- and β3-adrenergic receptor genes and uncoupling protein 1 as predictors of the risk for type 2 diabetes and body weight changes.
The Finnish Diabetes Prevention Study. Clinical Genetics 66:4, 365-367
CrossRef78
Po-Jung Tsai, Su-Chen Ho, Li-Ping Tsai, Yu-Hsiang Lee, Shih-Penn Hsu, Su-Pan Yang, Chun-Hong Chu, Chun-Hsien Yu. (2004) Lack of relationship between β3-adrenergic receptor gene polymorphism and gestational diabetes mellitus in a Taiwanese population. Metabolism 53:9, 1136-1139
CrossRef79
Hyun Hee Oh, Kil Soo Kim, Sun Mi Choi, Hyun Sung Yang, Yoosik Yoon. (2004) The effects of uncoupling protein-1 genotype on lipoprotein cholesterol level in Korean obese subjects. Metabolism 53:8, 1054-1059
CrossRef80
Yasuko Nozaki, Toshiji Saibara, Yoshihisa Nemoto, Masafumi Ono, Naoaki Akisawa, Shinji Iwasaki, Yoshihiro Hayashi, Makoto Hiroi, Hideaki Enzan, Saburo Onishi. (2004) Polymorphisms of Interleukin-1beta and beta3-Adrenergic Receptor in Japanese Patients With Nonalcoholic Steatohepatitis. Alcoholism: Clinical and Experimental Research 28:s2, 106S-110S
CrossRef81
Yasuko Nozaki, Toshiji Saibara, Yoshihisa Nemoto, Masafumi Ono, Naoaki Akisawa, Shinji Iwasaki, Yoshihiro Hayashi, Makoto Hiroi, Hideaki Enzan, Saburo Onishi. (2004) Polymorphisms of Interleukin-1?? and ??3-Adrenergic Receptor in Japanese Patients With Nonalcoholic Steatohepatitis. Alcoholism: Clinical & Experimental Research 28:Supplement, 106S-110S
CrossRef82
Philippe Froguel, Philippe Boutin. 2004. Genetics of Obesity. , 53-67.
CrossRef83
PATRICIA IN??S PORTO, SILVIA IN??S GARC??A, GUILLERMO DIEUZEIDE, CLAUDIO GONZ??LEZ, MAR??A SILVINA LANDA, CARLOS JOS?? PIROLA. (2004) Clinical Features of the Metabolic Syndrome in Adolescents: Minor Role of the Trp64Arg ??3-Adrenergic Receptor Gene Variant. Pediatric Research 55:5, 836-841
CrossRef84
Gerd Schmitz, Susanne Heimerl, Thomas Langmann. (2004) Zinc finger protein ZNF202 structure and function in transcriptional control of HDL metabolism. Current Opinion in Lipidology 15:2, 199-208
CrossRef85
Amanda N Malina, Hannele M Laivuori, Patricia K Agatisa, Lynn A Collura, William R Crombleholme, Cynthia J Sims, James M Roberts. (2004) The Trp64Arg polymorphism of the β3-adrenergic receptor is not increased in women with preeclampsia. American Journal of Obstetrics and Gynecology 190:3, 779-783
CrossRef86
Leif Groop, Martin Ridderstr��le. 2004. Molecular Genetics of Type 2 Diabetes-Candidate Genes. .
CrossRef87
(2004) Effects of β3-Adrenergic Receptor Polymorphism on the Hyperglycemia in Korean Subjects. Journal of the Korean Society of Food Science and Nutrition 33:1, 83-90
CrossRef88
David H St-Pierre, Varghese George, Rémi Rabasa-Lhoret, Eric T Poehlman. (2004) Genetic variation and statistical considerations in relation to overfeeding and underfeeding in humans. Nutrition 20:1, 145-154
CrossRef89
Coleen M Damcott, Paul Sack, Alan R Shuldiner. (2003) The genetics of obesity. Endocrinology & Metabolism Clinics of North America 32:4, 761-786
CrossRef90
R. J. F. Loos, C. Bouchard. (2003) Obesity - is it a genetic disorder?. Journal of Internal Medicine 254:5, 401-425
CrossRef91
Chisato Murata, Tetsu Watanabe, Hiroyuki Furuya, Yoshihiko Sugioka, Hajime Mikurube, Akira Yokoyama, Yoshihito Atsumi, Kempei Matsuoka, Isao Okazaki. (2003) Aldehyde dehydrogenase 2 and β3-adrenergic receptor gene polymorphisms: their association with elevated liver enzymes and metabolic syndrome. Metabolism 52:9, 1096-1101
CrossRef92
Misako Aoyama, Yoshihiro Shidoji, Mari Saimei, Noriaki Tsunawake, Makoto Ichinose. (2003) Phenotypic linkage between single-nucleotide polymorphisms of β3-adrenergic receptor gene and NADH dehydrogenase subunit-2 gene, with special reference to eating behavior. Biochemical and Biophysical Research Communications 309:1, 261-265
CrossRef93
Philippe Froguel. 2003. Do our genes make us fat?. , 25-39.
CrossRef94
Hiroshi Matsushita, Takumi Kurabayashi, Masatoshi Tomita, Nozomi Kato, Kenichi Tanaka. (2003) Effects of uncoupling protein 1 and ß3-adrenergic receptor gene polymorphisms on body size and serum lipid concentrations in Japanese women. Maturitas 45:1, 39-45
CrossRef95
Rina Arashiro, Keisuke Katsuren, Shigeru Fukuyama, Takao Ohta. (2003) Effect of Trp64Arg mutation of the beta3-adrenergic receptor gene and C161T substitution of the peroxisome proliferator activated receptor gamma gene on obesity in Japanese children. Pediatrics International 45:2, 135-141
CrossRef96
Alan R. Shuldiner, Kashif M. Munir. (2003) Genetics of obesity: More complicated than initially thought. Lipids 38:2, 97-101
CrossRef97
Naoyuki Kurokawa, Kunihiko Nakai, Satomi Kameo, Zhong-Min Liu, Hiroshi Satoh. (2003) Relationship between the .BETA.3-Adrenoceptor Gene Variant and Body Fat in Japanese Children. The Tohoku Journal of Experimental Medicine 201:4, 271-276
CrossRef98
Masao Kanazawa, Nobuo Yoshiike, Toshimasa Osaka, Yoshio Numba, Paul Zimmet, Shuji Inoue. (2002) Criteria and classification of obesity in Japan and Asia-Oceania. Asia Pacific Journal of Clinical Nutrition 11:s8, S732-S737
CrossRef99
Sumito Ogawa, Mitsuru Emi, Masataka Shiraki, Takayuki Hosoi, Hajime Orimo, Yasuyoshi Ouchi, Satoshi Inoue. (2002) Association of amino acid variation (Trp64Arg) in the beta3-adrenergic receptor gene with bone mineral density. Geriatrics and Gerontology International 2:3, 138-142
CrossRef100
Ellen B Sanders, Christopher E Aston, Robert E Ferrell, Selma F Witchel. (2002) Inter- and intrafamilial variability in premature pubarche and polycystic ovary syndrome. Fertility and Sterility 78:3, 473-478
CrossRef101
Koustubh Ranade, Eric Jorgenson, Wayne H.-H. Sheu, Dee Pei, Chao Agnes Hsiung, Fu-tien Chiang, Yii-der I. Chen, Richard Pratt, Richard A. Olshen, David Curb, David R. Cox, David Botstein, Neil Risch. (2002) A Polymorphism in the β1 Adrenergic Receptor Is Associated with Resting Heart Rate. The American Journal of Human Genetics 70:4, 935-942
CrossRef102
José Luis Santos, Francisco Pérez-Bravo, J.A Martı́nez, Domingo Montalvo, Cecilia Albala, Elena Carrasco. (2002) No evidence for an association between genetic polymorphisms of β2- and β3-adrenergic receptor genes with body mass index in Aymara natives from Chile. Nutrition 18:3, 255-258
CrossRef103
Junko YAMAMOTO, Shigeru KAGEYAMA, Masami NEMOTO, Takashi SASAKI, Tatsuya SAKURAI, Ken-ichi ISHIBASHI, Akira MIMURA, Kuninobu YOKOTA, Naoko TAJIMA. (2002) PPARγ2 Pro12Ala Polymorphism and Insulin Resistance in Japanese Hypertensive Patients. Hypertension Research 25:1, 25-29
CrossRef104
Maria M. Mercado, John C. McLenithan, Kristi D. Silver, Alan R. Shuldiner. (2002) Genetics of insulin resistance. Current Diabetes Reports 2:1, 83-95
CrossRef105
Karine Clement, Philippe Boutin, Philippe Froguel. (2002) Genetics of Obesity. American Journal of PharmacoGenomics 2:3, 177-187
CrossRef106
Masafumi Isogaya, Taku Nagao, Hitoshi Kurose. (2002) Enhanced cAMP Response of Naturally Occurring Mutant of Human β3-Adrenergic Receptor. The Japanese Journal of Pharmacology 88:3, 314-318
CrossRef107
Noriyuki Iwamoto, Yoko Ogawa, Susumu Kajihara, Akitaka Hisatomi, Tsutomu Yasutake, Toru Yoshimura, Toshihiko Mizuta, Toshiya Hara, Iwata Ozaki, Kyosuke Yamamoto. (2001) Gln27Glu β2-adrenergic receptor variant is associated with hypertriglyceridemia and the development of fatty liver. Clinica Chimica Acta 314:1-2, 85-91
CrossRef108
Chikara Ishii, Kiyoaki lnoue, Kiyohiko Negishi, Nobuyoshi Tane, Takuya Awata, Shigehiro Katayama. (2001) Diabetic ketoacidosis in a case of pheochromocytoma. Diabetes Research and Clinical Practice 54:2, 137-142
CrossRef109
W Xinli, T Xiaomei, P Meihua, L Song. (2001) Association of a mutation in the β3-adrenergic receptor gene with obesity and response to dietary intervention in Chinese children. Acta Paediatrica 90:11, 1233-1237
CrossRef110
T. Pischon, A. M. Sharma. (2001) Use of beta-blockers in obesity hypertension: potential role of weight gain. Obesity Reviews 2:4, 275-280
CrossRef111
D. Corella, M. Guillén, O. Portolés, J. V. Sorlí, V. Alonso, J. Folch, C. Sáiz. (2001) Gender specific associations of the Trp64Arg mutation in the β3-adrenergic receptor gene with obesity-related phenotypes in a Mediterranean population: interaction with a common lipoprotein lipase gene variation. Journal of Internal Medicine 250:4, 348-360
CrossRef112
D. Corella, M. Guillen, O. Portoles, J. V. Sorli, V. Alonso, J. Folch, C. Saiz. (2001) Gender specific associations of the Trp64Arg mutation in the beta3-adrenergic receptor gene with obesity-related phenotypes in a Mediterranean population: interaction with a common lipoprotein lipase gene variation. Journal of Internal Medicine 250:4, 348-360
CrossRef113
Tomokazu Kawamura, Genshi Egusa, Rumi Fujikawa, Masamichi Okubo. (2001) β3-adrenergic receptor gene variant is associated with upper body obesity only in obese Japanese-American men but not in women. Diabetes Research and Clinical Practice 54:1, 49-55
CrossRef114
Ojistoh K Horn, Gilles Paradis, Louise Potvin, Ann C Macaulay, Serge Desrosiers. (2001) Correlates and Predictors of Adiposity among Mohawk Children. Preventive Medicine 33:4, 274-281
CrossRef115
CP Busch, RA Hegele. (2001) Genetic determinants of type 2 diabetes mellitus. Clinical Genetics 60:4, 243-254
CrossRef116
Philippe Boutin, Philippe Froguel. (2001) Genetics of human obesity. Best Practice & Research Clinical Endocrinology & Metabolism 15:3, 391-404
CrossRef117
Anna L. Gloyn, Mark I. McCarthy. (2001) The genetics of type 2 diabetes. Best Practice & Research Clinical Endocrinology & Metabolism 15:3, 293-308
CrossRef118
Baihua Hu, John Ellingboe, Stella Han, Elwood Largis, Kitae Lim, Michael Malamas, Ruth Mulvey, Chuansheng Niu, Alexander Oliphant, Jeffrey Pelletier, Thiruvikraman Singanallore, Fuk-Wah Sum, Jeff Tillett, Victoria Wong. (2001) Novel (4-Piperidin-1-yl)-phenyl Sulfonamides as Potent and Selective Human β3 Agonists. Bioorganic & Medicinal Chemistry 9:8, 2045-2059
CrossRef119
Emily M. Garland, Italo Biaggioni. (2001) Genetic polymorphisms of adrenergic receptors. Clinical Autonomic Research 11:2, 67-78
CrossRef120
M. A. van Baak. (2001) The peripheral sympathetic nervous system in human obesity. Obesity Reviews 2:1, 3-14
CrossRef121
N. Barzilai, A. R. Shuldiner. (2001) Searching for Human Longevity Genes: The Future History of Gerontology in the Post-genomic Era. The Journals of Gerontology Series A: Biological Sciences and Medical Sciences 56:2, M83-M87
CrossRef122
Joon‐Seol Bae, Byung‐Yong Kang, Ki‐Tae Kim, Jung‐Hee Shin, Chung‐Choo Lee. (2001) Genetic variations in six candidate genes for insulin resistance in Korean essential hypertensives. Korean Journal of Biological Sciences 5:4, 341-346
CrossRef123
Yasuto TAKAKURA, Toshihide YOSHIDA. (2001) .BETA.3-Adrenergic receptor agonists. Past, present and future.. Folia Pharmacologica Japonica 118:5, 315-320
CrossRef124
Daniel C. Benyshek, John F. Martin, Carol S. Johnston. (2001) A reconsideration of the origins of the type 2 diabetes epidemic among native Americans and the implications for intervention policy. Medical Anthropology 20:1, 25-64
CrossRef125
Anke Hinney, Helmut Remschmidt, Johannes Hebebrand. (2000) Candidate gene polymorphisms in eating disorders. European Journal of Pharmacology 410:2-3, 147-159
CrossRef126
Frances S. Chew. (2000) Talking about race in a scientific context. Science and Engineering Ethics 6:4, 485-494
CrossRef127
Christian Weyer, Christopher J. de Souza. (2000) Development of ?3-adrenoceptor agonists as antiobesity and antidiabetes drugs in humans: Current status and future prospects. Drug Development Research 51:2, 80-93
CrossRef128
M. Del Mar Gonzalez-Barroso, D. Ricquier, A.-M. Cassard-Doulcier. (2000) The human uncoupling protein-1 gene (UCP1): present status and perspectives in obesity research. Obesity Reviews 1:2, 61-72
CrossRef129
Steven C. Elbein. (2000) Genetics of Type 2 Diabetes: An Overview for the Millennium. Diabetes Technology & Therapeutics 2:3, 391-400
CrossRef130
Francesco S. Celi, Carlo Negri, Keith Tanner, Nina Raben, Flora De Pablo, Adela Rovira, Luis F. Pallardo, Pilar Martin-Vaquero, Michael P. Stern, Braxton D. Mitchell, Alan R. Shuldiner. (2000) Molecular scanning for mutations in the insulin receptor substrate-1 (IRS-1) gene in Mexican Americans with Type 2 diabetes mellitus. Diabetes/Metabolism Research and Reviews 16:5, 370-377
CrossRef131
Jonathan Webber, Ian A. Macdonald. (2000) Signalling in body-weight homeostasis: neuroendocrine efferent signals. Proceedings of the Nutrition Society 59:03, 397-404
CrossRef132
Harald E. Vonkeman, Chris H. H. ten Napel, Arletta M. van Oeveren-Dybicz, Istvan Vermes. (2000) ??3-Adrenergic receptor polymorphism and the antiretroviral therapy-related lipodystrophy syndrome. AIDS 14:10, 1463-1464
CrossRef133
Ilse L. Mertens, Luc F. Van Gaal. (2000) Promising New Approaches to the Management of Obesity. Drugs 60:1, 1-9
CrossRef134
Leif Groop. (2000) Genetics of the metabolic syndrome. British Journal of Nutrition 83:S1,
CrossRef135
Selma F. Witchel, Julian Fagerli, Jessica Siegel, Rhonda Smith, Mohamed Farouk Mitwally, Vered Lewy, Silva Arslanian, Peter A. Lee. (2000) No association between body mass index and β3-adrenergic receptor variant (W64R) in children with premature pubarche and adolescent girls with hyperandrogenism. Fertility and Sterility 73:3, 509-515
CrossRef136
E García-Rubi. (1999) Insulin Resistance and Type 2 Diabetes Mellitus Its Relationship with the β3-Adrenergic Receptor. Archives of Medical Research 30:6, 459-464
CrossRef137
Tomokazu Kawamura, Genshi Egusa, Masamichi Okubo, Michinori Imazu, Michio Yamakido. (1999) Association of β3-Adrenergic receptor gene polymorphism with insulin resistance in Japanese-American men. Metabolism 48:11, 1367-1370
CrossRef138
C. Christiansen, P. Poulsen, H. Beck-Nielsen. (1999) The Trp64Arg mutation of the adrenergic beta-3 receptor gene impairs insulin secretion: a twin study. Diabetic Medicine 16:10, 835-840
CrossRef139
Michelle L Rose, Mark A Paulik, James M Lenhard. (1999) Therapeutic approaches to Type 2 diabetes mellitus. Expert Opinion on Therapeutic Patents 9:9, 1223-1236
CrossRef140
Robert A Hegele, Matthew R Ban, Christopher P Busch, Samuel Ramsewak, D.Dan Ramdath. (1999) Lipoprotein-genotype associations in Trinidadian neonates. Clinical Biochemistry 32:6, 429-437
CrossRef141
Arto Pulkkinen, Anu Kareinen, Laura Saarinen, Sami Heikkinen, Seppo Lehto, Markku Laakso. (1999) The codon 64 polymorphism of the β3-adrenergic receptor gene is not associated with coronary heart disease or insulin resistance in nondiabetic subjects and non-insulin-dependent diabetic patients. Metabolism 48:7, 853-856
CrossRef142
S. M. Echwald. (1999) Genetics of human obesity: lessons from mouse models and candidate genes. Journal of Internal Medicine 245:6, 653-666
CrossRef143
P. Arner, J. Hoffstedt. (1999) Adrenoceptor genes in human obesity. Journal of Internal Medicine 245:6, 667-672
CrossRef144
Kristi Silver, Jeremy Walston, Yufeng Yang, Richard Pratley, Eric Ravussin, Nina Raben, Alan R. Shuldiner. (1999) Molecular scanning of the beta-3-adrenergic receptor gene in Pima Indians and Caucasians. Diabetes/Metabolism Research and Reviews 15:3, 175-180
CrossRef145
Wayne Huey-Herng Sheu, Wen-Jane Lee, Ying-Erh Yao, Chii-Yeng Jeng, Mason Mao-Shin Young, Ying-Tsung Chen. (1999) Lack of association between genetic variation in the β3-adrenergic receptor gene and insulin resistance in patients with coronary heart disease. Metabolism 48:5, 651-654
CrossRef146
Tetsuo Hayakawa, Yukihiro Nagai, Masayuki Taniguchi, Haruhisa Yamashita, Toshinari Takamura, Toshio Abe, Gakuji Nomura, Ken-ichi Kobayashi. (1999) Phenotypic characterization of the β3-adrenergic receptor mutation and the uncoupling protein 1 polymorphism in Japanese men. Metabolism 48:5, 636-640
CrossRef147
Boonsong Ongphiphadhanakul, Rajata Rajatanavin, Suwannee Chanprasertyothin, Noppawan Piaseu, Laor Chailurkit, Surat Komindr, Pongamorn Bunnag, Gobchai Puavilai. (1999) Relation of β3-adrenergic receptor gene mutation to total body fat but not percent body fat and insulin levels in Thais. Metabolism 48:5, 564-567
CrossRef148
Yasumichi Mori, Hoon Kim-Motoyama, Yoichi Ito, Tomiyoshi Katakura, Kazuki Yasuda, Satomi Ishiyama-Shigemoto, Kentaro Yamada, Yasuo Akanuma, Yasuo Ohashi, Satoshi Kimura, Yoshio Yazaki, Takashi Kadowaki. (1999) The Gln27Glu β2-Adrenergic Receptor Variant Is Associated with Obesity Due to Subcutaneous Fat Accumulation in Japanese Men. Biochemical and Biophysical Research Communications 258:1, 138-140
CrossRef149
Keiko Yanagisawa, Naoko Iwasaki, Mayumi Sanaka, Satomi Minei, Masao Kanamori, Yasue Omori, Yasuhiko Iwamoto. (1999) Polymorphism of the β3-adrenergic receptor gene and weight gain in pregnant diabetic women. Diabetes Research and Clinical Practice 44:1, 41-47
CrossRef150
Rainer Büscher, Volker Herrmann, Paul A Insel. (1999) Human adrenoceptor polymorphisms: evolving recognition of clinical importance. Trends in Pharmacological Sciences 20:3, 94-99
CrossRef151
C COLKER, D KAIMAN, G TORINA, T PERLIS, C STREET. (1999) Effects of extract, caffeine, and St. John's Wort on body fat loss, lipid levels, and mood states in overweight healthy adults. Current Therapeutic Research 60:3, 145-153
CrossRef152
Hee-Sook Jun, Hak Yeon Bae, Byoung Rai Lee, Kwang Sam Koh, Young Soo Kim, Kwan Woo Lee, Hyun-man Kim, Ji-Won Yoon. (1999) Pathogenesis of non-insulin-dependent (type II) diabetes mellitus (NIDDM) – genetic predisposition and metabolic abnormalities. Advanced Drug Delivery Reviews 35:2-3, 157-177
CrossRef153
Russel Lawrence Barsh. (1999) Chronic health effects of dispossession and dietary change: Lessons from North American hunter‐gatherers. Medical Anthropology 18:2, 135-161
CrossRef154
Gérard Emilien, Jean-Marie Maloteaux, Michel Ponchon. (1999) Pharmacological Management of Diabetes. Pharmacology & Therapeutics 81:1, 37-51
CrossRef155
Giancarlo Tonolo, Maria G. Melis, Giannina Secchi, Maria M. Atzeni, Maria F. Angius, Antonello Carboni, Milco Ciccarese, Antonello Malavasi, Mario Maioli. (1999) Association of Trp64Arg β3-adrenergic-receptor gene polymorphism with essential hypertension in the Sardinian population. Journal of Hypertension 17:1, 33-38
CrossRef156
Søren Snitker, Margery Nicolson, Alan R. Shuldiner, Kristi Silver, Eric Ravussin. (1998) No effect of Trp64Arg β3-adrenoceptor polymorphism on the plasma leptin concentration in Pima Indians. Metabolism 47:12, 1525-1527
CrossRef157
Kuninori Shiwaku, Tong Qiang Gao, Akio Isobe, Tetsuhito Fukushima, Yosuke Yamane. (1998) A Trp 64 Arg mutation in the β3-adrenergic receptor gene is not associated with moderate overweight in Japanese workers. Metabolism 47:12, 1528-1530
CrossRef158
Vendrell, Gutierrez, Broch, Fernandez-Real, Aguilar, Richart. (1998) beta3-adrenoreceptor gene polymorphism and leptin. Lack of relationship in type 2 diabetic patients. Clinical Endocrinology 49:5, 679-683
CrossRef159
Rainer Büscher, Volker Herrmann, Paul A. Insel. (1998) PCR-Based Methods for Identifying Genetic Variations in Human α1B- and β2-Adrenergic Receptors. Molecular Genetics and Metabolism 64:4, 266-270
CrossRef160
J. A. M. J. L. Janssen, J. W. Koper, R. P. Stolk, P. Englaro, A. G. Uitterlinden, Q. Huang, J. P. T. M. van Leeuwen, W. F. Blum, A. M. F. Attanasio, H. A. P. Pols, D. E. Grobbee, F. H. de Jong, S. W. J. Lamberts. (1998) Lack of associations between serum leptin, a polymorphism in the gene for the beta3-adrenergic receptor and glucose tolerance in the Dutch population.. Clinical Endocrinology 49:2, 229-234
CrossRef161
Yukio Shima, Toshihiko Tsukada, Koji Nakanishi, Hidehiko Ohta. (1998) Association of the Trp64Arg mutation of the β3-adrenergic receptor with fatty liver and mild glucose intolerance in Japanese subjects. Clinica Chimica Acta 274:2, 167-176
CrossRef162
Norma McFarlane-Anderson, Franklyn Bennett, Rainford Wilks, Sharon Howell, Cavelle Newsome, Kennedy Cruickshank, Terrence Forrester. (1998) The Trp64Arg mutation of the β3-adrenergic receptor is associated with hyperglycemia and current body mass index in Jamaican women. Metabolism 47:5, 617-621
CrossRef163
L. Groop. (1998) Genetics of visceral obesity and insulin resistance: relationship to non-insulin-dependent diabetes mellitus. Growth Hormone & IGF Research 8, 9-14
CrossRef164
Nobuyuki Azuma, Yasunao Yoshimasa, Haruo Nishimura, Yuji Yamamoto, Hiroaki Masuzaki, Junko Suga, Michika Shigemoto, Naoki Matsuoka, Tokuji Tanaka, Noriko Satoh, Toshio Igaki, Yoshihiro Miyamoto, Hiroshi Itoh, Takaaki Yoshimasa, Kiminori Hosoda, Shigeo Nishi, Kazuwa Nakao. (1998) The significance of the Trp 64 Arg mutation of the β3-adrenergic receptor gene in impaired glucose tolerance, non—insulin-dependent diabetes mellitus, and insulin resistance in Japanese subjects. Metabolism 47:4, 456-460
CrossRef165
R.A. Norman, P.A. Tataranni, R. Pratley, D.B. Thompson, R.L. Hanson, M. Prochazka, L. Baier, M.G. Ehm, H. Sakul, T. Foroud, W.T. Garvey, D. Burns, W.C. Knowler, P.H. Bennett, C. Bogardus, E. Ravussin. (1998) Autosomal Genomic Scan for Loci Linked to Obesity and Energy Metabolism in Pima Indians. The American Journal of Human Genetics 62:3, 659-668
CrossRef166
Richard Donnelly, Xianqin Qu. (1998) MECHANISMS OF INSULIN RESISTANCE AND NEW PHARMACOLOGICAL APPROACHES TO METABOLISM AND DIABETIC COMPLICATIONS. Clinical and Experimental Pharmacology and Physiology 25:2, 79-87
CrossRef167
David B. Allison, Mark Beasley. (1998) Method and computer program for controlling the family-wise alpha rate in gene association studies involving multiple phenotypes. Genetic Epidemiology 15:1, 87-101
CrossRef168
Robert L Dow. (1997) β3-adrenergic agonists: potential therapeutics for obesity. Expert Opinion on Investigational Drugs 6:12, 1811-1825
CrossRef169
A.D. Strosberg. (1997) Association of β3-adrenoceptor polymorphism with obesity and diabetes: current status. Trends in Pharmacological Sciences 18:12, 449-454
CrossRef170
Andreas Pfeiffer. (1997) Update Diabetes 1997. Medizinische Klinik 92:11, 655-662
CrossRef171
Cheryl L. Jeyasingam, Janet M. Bryson, Ian D. Caterson, Dennis K. Yue, Richard Donnelly. (1997) SHORT COMMUNICATION EXPRESSION OF THE 0 3 -ADRENOCEPTOR GENE POLYMORPHISM (Trp64Arg) IN OBESE DIABETIC AND NON-DIABETIC SUBJECTS. Clinical and Experimental Pharmacology and Physiology 24:9-10, 733-735
CrossRef172
Sandra J. Hasstedt, Michael Hoffman, Mark F. Leppert, Steven C. Elbein. (1997) Recessive Inheritance of Obesity in Familial Non—Insulin-Dependent Diabetes Mellitus, and Lack of Linkage to Nine Candidate Genes. The American Journal of Human Genetics 61:3, 668-677
CrossRef173
B. BENDLOVÁ, I. MAZURA, J. VČELÁK, J. PERUŠIČOVÁ, D. PALYZOVÁ, I. KLIMEŠ, E. ŠEBÖKOVÁ. (1997) Is a Mutation of the ?3-Adrenergic Receptor Gene Related to Non-Insulin-dependent Diabetes Mellitus and Juvenile Hypertension in the Czech Population?. Annals of the New York Academy of Sciences 827:1 Lipids and Sy, 135-143
CrossRef174
Eric Jéquier, Luc Tappy. (1997) Obesity. Molecular Aspects of Medicine 18:4, 247-305
CrossRef175
France Pietri-Rouxel, Brian John Manning, Jerome Gros, A. Donny Strosberg. (1997) The Biochemical Effect of the Naturally Occurring Trp644Arg Mutation on Human beta3-Adrenoceptor Activity. European Journal of Biochemistry 247:3, 1174-1179
CrossRef176
Jeffrey M. Stadel, Shelagh Wilson, Derk J. Bergsma. (1997) Orphan G protein-coupled receptors: a neglected opportunity for pioneer drug discovery. Trends in Pharmacological Sciences 18:4, 430-437
CrossRef177
A.Donny Strosberg. (1997) Association of β3-adrenoceptor polymorphism with obesity and diabetes: current status. Trends in Pharmacological Sciences 18:4, 449-454
CrossRef178
Xiaohong Yuan, Kentaro Yamada, Ken-ichi Koyama, Fumi Ichikawa, Satomi Ishiyama, Atsuko Koyanagi, Wasaku Koyama, Kyohei Nonaka. (1997) β3-adrenergic receptor gene polymorphism is not a major genetic determinant of obesity and diabetes in Japanese general population. Diabetes Research and Clinical Practice 37:1, 1-7
CrossRef179
DJ Goldstein, ME Trautmann. (1997) Treatments for obesity. Expert Opinion on Emerging Drugs 2:1, 1-28
CrossRef180
A. Donny Strosberg. (1997) STRUCTURE AND FUNCTION OF THE β 3 -ADRENERGIC RECEPTOR. Annual Review of Pharmacology and Toxicology 37:1, 421-450
CrossRef181
Ann-Katrin Karlsson, Mikael Elam, Peter Friberg, Fin Biering-Sörensen, Lars Sullivan, Peter Lönnroth. (1997) Regulation of lipolysis by the sympathetic nervous system: A microdialysis study in normal and spinal cord—injured subjects. Metabolism 46:4, 388-394
CrossRef182
Kenji Higashi, Toshitsugu Ishikawa, Toshimitsu Ito, Atsushi Yonemura, Hideki Shige, Haruo Nakamura. (1997) Association of a Genetic Variation in the β3-Adrenergic Receptor Gene with Coronary Heart Disease among Japanese. Biochemical and Biophysical Research Communications 232:3, 728-730
CrossRef183
Susan B. Roberts. (1997) Human obesity genes. Nutrition 13:3, 236-238
CrossRef184
Kohei Ueda, Yukio Tanizawa, Yasuharu Oota, Hirohumi Inoue, Nobuaki Kizuki, Hiroshi Inoue, Katsunori Tsukuda, Tomoichiro Asano, Yoshitomo Oka. (1997) Prevalence of the Trp64Arg missense mutation of the β3-adrenergic receptor gene in Japanese subjects. Metabolism 46:2, 199-202
CrossRef185
B. B. Lowell, MD, PhD, J. S. Flier, MD. (1997) BROWN ADIPOSE TISSUE, β3-ADRENERGIC RECEPTORS, AND OBESITY. Annual Review of Medicine 48:1, 307-316
CrossRef186
Claude Bouchard. (1997) Human Variation in Body Mass: Evidence for a Role of the Genes. Nutrition Reviews 55:1, S21-S27
CrossRef187
Sue M. Cummings, G.Kenneth Goodrick, John P. Foreyt. (1997) Position of The American Dietetic Association. Journal of the American Dietetic Association 97:1, 71-74
CrossRef188
Leif C. Groop, Tiinamaija Tuomi. (1997) Non-insulin-dependent Diabetes Mellitus - A Collision between Thrifty Genes and an Affluent Society. Annals of Medicine 29:1, 37-53
CrossRef189
Frank L. Greenway. (1996) SURGERY FOR OBESITY. Endocrinology & Metabolism Clinics of North America 25:4, 1005-1027
CrossRef190
F. Barbetti. (1996) Pathophysiology of non-insulin-dependent diabetes and the search for candidate genes: dangerous liaisons?. Acta Diabetologica 33:4, 257-262
CrossRef191
Charlotte A. Pratt, Cornelius B. Pratt, Scarlett N. Montague, Juliane C. Salazar, Mary C. Graves. (1996) Do popular magazines promote weight‐control messages? Implications of weight‐control advertisements for the health of African American women. Howard Journal of Communications 7:4, 349-364
CrossRef192
A.Donny Strosberg, France Pietri-Rouxel. (1996) Function and regulation of the β3-adrenoceptor. Trends in Pharmacological Sciences 17:10, 373-381
CrossRef193
J. Hoffstedt, H. Wahrenberg, A. Thörne, F. Lönnqvist. (1996) The metabolic syndrome is related to β3-adrenoceptor sensitivity in visceral adipose tissue. Diabetologia 39:7, 838-860
CrossRef194
C.L. Hanis, E. Boerwinkle, R. Chakraborty, D.L. Ellsworth, P. Concannon, B. Stirling, V.A. Morrison, B. Wapelhorst, R.S. Spielman, K.J. Gogolin-Ewens, J.M. Shephard, S.R. Williams, N. Risch, D. Hinds, N. Iwasaki, M. Ogata, Y. Omori, C. Petzold, H. Rietzsch, H.-E. Schröder, J. Schulze, N.J. Cox, S. Menzel, V.V. Boriraj, X. Chen, L.R. Lim, T. Lindner, L.E. Mereu, Y.-Q. Wang, K. Xiang, K. Yamagata, Y. Yang, G.I. Bell. (1996) A genome–wide search for human non–insulin–dependent (type 2) diabetes genes reveals a major susceptibility locus on chromosome 2. Nature Genetics 13:2, 161-166
CrossRef195
T. Fujisawa, H. Ikegami, E. Yamato, K. Takekawa, Y. Nakagawa, Y. Hamada, T. Oga, H. Ueda, M. Shintani, M. Fukuda, T. Ogihara. (1996) Association of Trp64Arg mutation of the ?3-adrenergic-receptor with NIDDM and body weight gain. Diabetologia 39:3, 349-352
CrossRef196
Nicholas C. Turner. (1996) New therapeutic agents for the treatment of insulin resistance and NIDDM. Drug Discovery Today 1:3, 103-108
CrossRef197
Flier, Jeffrey S., Underhill, Lisa H., Insel, Paul A., . (1996) Adrenergic Receptors — Evolving Concepts and Clinical Implications. New England Journal of Medicine 334:9, 580-585
Full Text198
Susan B. Roberts, Andrew S. Greenberg. (1996) The New Obesity Genes. Nutrition Reviews 54:2, 41-49
CrossRef199
Ping H Wang, Murray Korc. (1995) Searching for the Holy Grail: the cause of diabetes. The Lancet 346, S4
CrossRef200
Toshihide Yoshida, Naoki Sakane, Tunekazu Umekawa, Mayumi Sakai, Toshihiro Takahashi, Motoharu Kondo. (1995) Mutation of β3-adrenergic-receptor gene and response to treatment of obesity. The Lancet 346:8987, 1433-1434
CrossRef201
(1995) The obsession with obesity. Nature Genetics 11:1, 1-2
CrossRef202
Arner, Peter, . (1995) The β3-Adrenergic Receptor — A Cause and Cure of Obesity?. New England Journal of Medicine 333:6, 382-383
Full Text203
Clément, Karine, Vaisse, Christian, Manning, Brian St. J., Basdevant, Arnaud, Guy-Grand, Bernard, Ruiz, Juan, Silver, Kristi D., Shuldiner, Alan R., Froguel, Philippe, Strosberg, A. Donny, . (1995) Genetic Variation in the β3-Adrenergic Receptor and an Increased Capacity to Gain Weight in Patients with Morbid Obesity. New England Journal of Medicine 333:6, 352-354
Full Text204
Widén, Elisabeth, Lehto, Markku, Kanninen, Timo, Walston, Jeremy, Shuldiner, Alan R., Groop, Leif C., . (1995) Association of a Polymorphism in the β3-Adrenergic–Receptor Gene with Features of the Insulin Resistance Syndrome in Finns. New England Journal of Medicine 333:6, 348-352
Full Text
