Original Article
Mutations in the Cystic Fibrosis Gene in Patients with Congenital Absence of the Vas Deferens
N Engl J Med 1995; 332:1475-1480June 1, 1995
- Abstract
Background
Congenital bilateral absence of the vas deferens (CBAVD) is a form of male infertility in which mutations in the cystic fibrosis transmembrane conductance regulator (CFTR) gene have been identified. The molecular basis of CBAVD is not completely understood. Although patients with cystic fibrosis have mutations in both copies of the CFTR gene, most patients with CBAVD have mutations in only one copy of the gene.
Methods
To investigate CBAVD at the molecular level, we have characterized the mutations in the CFTR gene in 102 patients with this condition. None had clinical manifestations of cystic fibrosis. We also analyzed a DNA variant (the 5T allele) in a noncoding region of CFTR that causes reduced levels of the normal CFTR protein. Parents of patients with cystic fibrosis, patients with types of infertility other than CBAVD, and normal subjects were studied as controls.
Results
Nineteen of the 102 patients with CBAVD had mutations in both copies of the CFTR gene, and none of them had the 5T allele. Fifty-four patients had a mutation in one copy of CFTR, and 34 of them (63 percent) had the 5T allele in the other CFTR gene. In 29 patients no CFTR mutations were found, but 7 of them (24 percent) had the 5T allele. In contrast, the frequency of this allele in the general population was about 5 percent.
Conclusions
Most patients with CBAVD have mutations in the CFTR gene. The combination of the 5T allele in one copy of the CFTR gene with a cystic fibrosis mutation in the other copy is the most common cause of CBAVD. The 5T allele mutation has a wide range of clinical presentations, occurring in patients with CBAVD or moderate forms of cystic fibrosis and in fertile men.
Media in This Article
Figure 3
Comparison of Percentages of Normal CFTR mRNA, Clinical Phenotypes, and CFTR Genotypes.Figure 1
DNA Variants in Intron 8 of the CFTR Gene and Their Effects at the mRNA Level.Article Activity
- Article
Congenital bilateral absence of the vas deferens (CBAVD) accounts for at least 6 percent of cases of obstructive azoospermia and is responsible for 1 to 2 percent of cases of infertility in men.1 CBAVD is also present in about 95 percent of male patients with cystic fibrosis, a disorder characterized by chronic pulmonary disease, pancreatic exocrine insufficiency, and elevated concentrations of electrolytes in sweat.2
Mutations in the cystic fibrosis transmembrane conductance regulator (CFTR) gene, which encodes a cyclic AMP–regulated chloride channel,3,4 have been found in patients with cystic fibrosis.5,6 Patients with the classic form of cystic fibrosis have severe mutations in each copy of the CFTR gene, whereas patients with a less severe phenotype (i.e., with normal pancreatic function and mild lung disease) have a severe mutation in one copy of CFTR and a mild mutation in the other, or mild mutations in both copies.7
Mutations in the CFTR gene have also been identified in patients with CBAVD, which suggests that this condition is a primarily genital form of cystic fibrosis.8-12 Thus, patients with CBAVD would be expected, like all patients with cystic fibrosis, to have two CFTR mutations. However, few patients with CBAVD have mutations in both copies of the CFTR gene; in the majority of cases, only one mutation has been found, and in about a third no mutations have been detected. The inability of investigators to identify two CFTR mutations in these patients, even after analyzing the entire coding sequence, is not well understood, but it could be explained by the presence of mutations in noncoding regions of the gene. Such mutations would produce abnormally low levels of CFTR protein, which may cause obstruction of the vas deferens, but there may be sufficient protein to prevent disease in other organs normally affected by cystic fibrosis.
Low levels of the CFTR protein could be due to a decreased proportion of the normal messenger RNA (mRNA) of CFTR. Studies of CFTR mRNA in tissue from normal persons have identified various mRNA molecules that lack exon 4, 9, or 12.13-17 Whether or not CFTR mRNA contains exon 9 depends on the variable length of a DNA sequence of thymines in intron 8 of CFTR (Figure 1Figure 1
DNA Variants in Intron 8 of the CFTR Gene and Their Effects at the mRNA Level.).18 This sequence, known as a polyT sequence, contains five, seven, or nine thymines (the 5T, 7T, and 9T alleles, respectively). Since the 5T allele causes reduced levels of normal CFTR mRNA,18 this DNA variant would appear likely to be involved in the pathogenesis of CBAVD.To understand the molecular genetics of CBAVD better, we have characterized the CFTR mutations in patients with this condition and studied the putative involvement of the 5T allele in CBAVD and other types of male infertility.
Methods
Patients
We studied 102 unrelated men with azoospermia and CBAVD, as diagnosed on the basis of scrotal exploration and analysis of semen (volume and pH of semen, sperm count, and concentrations of fructose and citrate). The patients came from Belgium, France, Spain, and the United States.12,19,20 None had pulmonary or gastrointestinal manifestations of cystic fibrosis. The results of sweat chloride analysis and additional clinical data on these patients have already been presented.12,19,20 The diagnoses of CBAVD were initially suggested by the clinical observation of impalpable vasa in the patients and were subsequently confirmed by analyses of semen and transrectal and abdominal ultrasonography. Each patient had a sperm count of zero.
Control Subjects
We studied 186 fathers and 44 mothers of patients with cystic fibrosis, each of whom carried a known CFTR mutation,21 and 46 normal subjects from the general population in Spain. We also studied 12 patients with congenital unilateral absence of the vas deferens (CUAVD) and 10 patients with obstructive azoospermia not due to CBAVD or CUAVD. The patients with azoospermia but without CBAVD were in the care of the Andrology Department of the Institute of Urology, Nephrology, and Andrology in Barcelona, Spain, because of infertility; those with CUAVD were seen because of infertility or prostate problems or because they had requested vasectomy. The mean sperm concentration in the patients with CUAVD was 10.6 × 106 per milliliter (range, 0 to 90 × 106).
Analysis of CFTR Mutations
DNA was isolated from peripheral-blood lymphocytes according to standard protocols.22 Genomic DNA from the patients with CBAVD was first analyzed for the most common cystic fibrosis mutation, ΔF508.5 To identify other cystic fibrosis mutations in these patients, each of the 27 exons of the CFTR gene and their flanking sequences were amplified by the polymerase chain reaction (PCR). After PCR, all exons were studied by denaturing gradient-gel electrophoresis or by single-strand conformation analysis, as previously described.23,24
The 5T Allele of Intron 8 of CFTR
We analyzed the frequency of the 5T allele (the sequence of five thymines mainly responsible for the absence of exon 9 in CFTR mRNA) in the general population (i.e., in apparently normal chromosomes), fathers and mothers of patients with cystic fibrosis (who carry one chromosome with the cystic fibrosis mutation and one normal chromosome), and men with CBAVD. To evaluate the incidence of the 5T allele of intron 8 in CBAVD and infertility, we studied the frequency of heterozygosity for the allele in patients with CBAVD, patients with CUAVD, patients with azoospermia but not CBAVD, and the general population.
Exon 9 was first amplified with primers 9i-5 and 9i-3.25 The PCR conditions were as follows: denaturation at 95°C for 30 seconds, annealing at 54°C for 30 seconds, and extension at 74°C for 40 seconds, for 25 cycles. The reaction mixture contained 5 μl of PCR buffer (N808-0006, Perkin-Elmer Cetus); 200 μM each of deoxyadenosine triphosphate, deoxycytidine triphosphate, deoxyguanosine triphosphate, and deoxythymidine triphosphate; 20 pmol of each primer; and 1 unit of Taq DNA polymerase in a final volume of 50 μl, containing 100 ng of genomic DNA. To amplify the polypyrimidine sequence while avoiding the adjacent dinucleotide repeat (GT)n,13 we performed a nested PCR with primers I9D9 (5'CCGCCGCTGTGTGTGTGTGTGTGTTTTT3') and E9R2 (5'GGATCCAGCAACCGCCAACA3'). The conditions of the nested PCR were as described above except that 1 μl from the first PCR was used, but for 35 cycles. The final PCR products were digested with XmnI and visualized on an 8 percent nondenaturing polyacrylamide gel after electrophoresis for four to five hours at 180 V (Figure 2Figure 2
PCR Analysis of Alleles in the polyT Sequence of Intron 8 of the CFTR Gene.).Statistical Analysis
Differences between proportions were tested by the chi-square statistic.26 Yates' correction for continuity was used in the two-by-two tables. Relative risks were calculated for the comparison of the patients with CBAVD with the normal patients. All P values were based on two-sided comparisons. P values of less than 0.05 were considered to indicate statistical significance.
Results
CFTR Mutations in CBAVD
We studied a group of 102 patients with CBAVD from Europe and the United States with regard to mutations in the CFTR gene. The analysis of the entire coding sequence allowed us to identify 28 different mutations (Table 1Table 1
CFTR and polyT Genotypes of 102 Patients with CBAVD.). Most of the mutations have been described previously in patients with cystic fibrosis, but others have been detected specifically in patients with CBAVD. Nineteen patients had mutations in both copies of CFTR (one severe and one mild mutation in 16 patients, and two mild mutations in 3), and 54 patients had mutations in only one CFTR allele. In 29 patients, after comprehensive screening, we were unable to find any mutations in the coding or splice regions of CFTR. 12,19,20 Frequencies of the 5T Allele DNA Variant of Intron 8 of CFTR
In the Spanish population, the frequency of the 5T allele, which is responsible for abnormal CFTR mRNA, was similar (5.4 percent) to that previously reported in other populations (5.2 percent)27-29 (P = 0.98), and the populations were pooled for comparative analyses (frequency of the 5T allele in the general population, 5.2 percent). The frequency of the 5T allele in the normal chromosomes of mothers of patients with cystic fibrosis (the non–cystic fibrosis chromosomes) was similar (4.5 percent) to that in the general population (P = 0.87), but the frequency was lower in the normal chromosomes of fathers of patients with cystic fibrosis (2.1 percent) (P = 0.12). In contrast, the 5T allele was significantly more frequent in the chromosomes of patients with CBAVD (21.1 percent) than in the general population (chi-square = 39.3, P<0.001) (Table 2Table 2
Frequencies of the polyT Alleles in Intron 8 of CFTR in Members of the General Population and Subjects with CBAVD, and in the Non–Cystic Fibrosis Chromosomes of Parents of Patients with Cystic Fibrosis.).The 5T Allele and Infertility
We evaluated the incidence of the 5T allele in men with various types of infertility. Table 3Table 3
Frequency of Heterozygosity for the CFTR 5T Allele among Patients with CBAVD, CUAVD, or Azoospermia but No CBAVD and Members of the General Population. shows that the percentage of patients with CBAVD who had this allele was significantly higher than that of the general population (40.2 vs. 10.9 percent) (chi-square = 11.4, P<0.001, relative risk = 5.1), whereas the proportion of patients with CUAVD who had the 5T allele (25 percent) was lower than, but not significantly different from, the proportion among patients with CBAVD (P = 0.48). On the other hand, the proportion of patients with azoospermia but without CBAVD who had the 5T allele was similar to that of the general population (P = 0.71).CFTR Mutations and the 5T Allele in Patients with Cbavd
In most patients with CBAVD, the 5T allele was strongly associated with the presence of a cystic fibrosis mutation in the other copy of the CFTR gene (chi-square = 9.9, P = 0.0016), but none of the patients with CBAVD who had two CFTR mutations carried this allele (Table 4Table 4
Classification of 102 Patients with CBAVD According to the Presence or Absence of the CFTR Mutation and of a polyT Allele at Intron 8.). Two patients were each found to have two 5T alleles. In one patient one of the alleles was associated with a mild cystic fibrosis mutation,19 whereas in the other patient no CFTR mutations were identified.The association between the various CFTR mutations and the 5T allele in the patients with CBAVD was analyzed by studying the transmission of the mutations within families (Table 1). Only one CFTR mutation (A800G) was associated with the 5T allele, whereas all the others were associated with the 7T or the 9T allele, confirming that in each patient with CBAVD the 5T allele corresponded to the chromosome that did not carry the CFTR mutation.
Discussion
The main objectives of this study were to determine whether patients with CBAVD had mutations in the CFTR gene and to explore whether noncoding sequences that produce low levels of CFTR mRNA (the 5T allele) were responsible for CBAVD.
Most patients with CBAVD in this study (72 percent) had a mutation in at least one of their CFTR genes, but only 19 percent had mutations on both chromosomes, with at least one of the two mutations being mild.12,19,20 Inability to identify the second mutation in most patients with CBAVD, even after all 27 CFTR exons were analyzed, suggests that mutations could be located elsewhere in the noncoding regions of CFTR. These mutations may result in a CFTR protein with a normal structure but low levels of expression,10 which may cause disease only in the organs most sensitive to CFTR dysfunction, such as the vas deferens.30,31
The reduced levels of normal CFTR mRNA due to the deletion of exon 9 depend on the presence of the 5T allele sequence in intron 8. This nonfunctional CFTR mRNA accounts for up to 92 percent of the total mRNA when both CFTR genes have the 5T allele.18 We have found a significant proportion of men with CBAVD who have the 5T allele, as compared with men in the general population, which suggests that this allele functions as a disease mutation in CBAVD. Similarly, the proportion of men with CUAVD who have the 5T allele was higher than in the general population, but lower than among men with CBAVD. Because CFTR mutations have also been found in patients with CUAVD,12,19 that condition could be an incomplete form of CBAVD. In contrast, the proportion of men with azoospermia but without CBAVD who had the 5T allele was similar to that in the general population, suggesting that azoospermia not due to CBAVD or CUAVD is unrelated to CFTR.
The particular combination of the two CFTR alleles in a given person (the genotype) results in specific levels of normal CFTR mRNA and in a specific clinical phenotype (Figure 3Figure 3
Comparison of Percentages of Normal CFTR mRNA, Clinical Phenotypes, and CFTR Genotypes.). It has been shown that if normal CFTR mRNA is present at a level of less than 1 to 3 percent, a severe cystic fibrosis phenotype results32; if the level is above 8 to 12 percent, the phenotype is normal18; and at intermediate levels, the phenotype is one of mild cystic fibrosis.33 Thus, patients with one cystic fibrosis mutation on one chromosome and the 5T allele on the other should have abnormally low levels of normal CFTR mRNA.The study performed here allows patients with CBAVD to be classified in five categories (Table 4): patients with two CFTR mutations (group 1a, 19 percent of patients with CBAVD); patients with one CFTR mutation and the 5T allele (group 1b, 33 percent); patients with only one CFTR mutation (group 2a, 20 percent); patients with only the 5T allele (group 2b, 7 percent); and patients without CFTR mutations (group 3, 21 percent). Group 1 is completely characterized if the 5T allele is a mutation in patients with CBAVD, whereas in group 2 other, as yet unknown, mutations in the CFTR gene may be involved. Finally, in group 3, a gene or genes other than CFTR may be responsible for CBAVD.
Parents of patients with cystic fibrosis have one normal CFTR gene and one gene with a cystic fibrosis mutation. Since fathers of patients with cystic fibrosis are not infertile, if the 5T allele was involved in CBAVD, it would be expected to be present at a low frequency in these subjects. Our data show that the frequency of the 5T allele in fathers who carry the cystic fibrosis mutation is slightly lower than that in both the general population and mothers who carry the mutation (2.1 percent vs. 5.2 percent and 4.5 percent), reinforcing the hypothesis that the 5T allele has a role in CBAVD (Table 2).
Four fathers who were carriers of cystic fibrosis had one CFTR gene with the 5T allele and the other with a severe cystic fibrosis mutation (G542X, N1303K, 1812-1G→A, or 936delTA). Although these genotypes should have been associated with CBAVD, these men had offspring and are clinically normal. Three hypotheses could explain the strong but not complete correlation between the appearance of the 5T allele and CBAVD. First, there could be a nonrandom association between the 5T allele and CBAVD, with the allele segregating with the CBAVD phenotype but not being its cause. Second, there could be a partially causal role for the 5T allele, together with additional mutations in other parts of the CFTR gene. Third, the 5T allele could have a causal role in CBAVD, with other factors accounting for these exceptional men without CBAVD (the four fathers bearing the cystic fibrosis mutation). The work presented here argues convincingly against the first two hypotheses. Nonrandom association is not the case, since the analysis of several DNA markers within CFTR in the four fathers and in patients with CBAVD showed that several haplotypes (combinations of alleles on the same chromosome) were associated with the 5T allele (data not shown). The presence of another mutation in the same CFTR gene as the 5T allele is also excluded, since CFTR was thoroughly analyzed in all patients with CBAVD and it is extremely unlikely that all patients with the 5T allele had mutations outside the CFTR coding region. These data and the association of the 5T allele with low levels of normal CFTR mRNA18 strongly support the concept that the 5T mutation generally causes CBAVD when it is associated with a cystic fibrosis mutation on the other chromosome.
Additional information about the importance of the 5T mutation was obtained by screening 120 patients with cystic fibrosis. We identified three adults with the Δ F508/5T genotype who had mild lung disease starting in their 30s and CBAVD, but no pancreatic disease. Three other patients, 8, 12, and 14 years of age with the genotypes E585X/5T and K710X/5T (two were siblings), had a diagnosis of cystic fibrosis due to elevated concentrations of electrolytes in sweat (>60 mmol per liter) and episodes of dehydration, but no other clinical features. Since persons with a cystic fibrosis mutation and the 5T allele may have levels of normal CFTR mRNA below the range of 8 to 12 percent (the minimal level for a normal phenotype18) but above the range of 1 to 3 percent (the level below which severe cystic fibrosis occurs31), a wide clinical variation is expected in them, depending on the variability of levels of normal CFTR mRNA. These clinical forms should include CBAVD, moderate cystic fibrosis, and the absence of fertility problems (Figure 3).
In summary, we report the following findings: First, that the 5T allele in intron 8 of CFTR has clinical effects related to male infertility. Second, that in 33 percent of cases the CBAVD phenotype results from the combined action of the 5T allele and a cystic fibrosis mutation on the other chromosome. In addition, 19 percent of cases of CBAVD are due to the presence of two CFTR mutations other than the 5T allele. Moreover, the presence of only one CFTR mutation (without the 5T allele) in 20 percent of patients suggests that other undetected changes in CFTR may be involved in CBAVD. Furthermore, the relatively high proportion of patients with CBAVD who do not have CFTR mutations (22 percent) allows us to propose that another gene or genes could be responsible for CBAVD. Finally, CUAVD could be an incomplete form of CBAVD.
A large number of cystic fibrosis mutations have been discovered during the past five years, and it seems that we are now better prepared to understand how mutations combine to cause disease. The combination of the 5T allele with a cystic fibrosis mutation in the other CFTR gene is the most common cause of CBAVD, but it also has other clinical presentations. Our report on CFTR mutations in patients with CBAVD indicates that CBAVD and cystic fibrosis are extreme forms of a wide nosologic spectrum of conditions that have a common molecular basis.
Supported by a grant (93/0202E) from the Fondo de Investigaciones Sanitarias de la Seguridad Social and by grants from the Institut Català de la Salut (Generalitat de Catalunya) and the Association Française de Lutte contre la Mucoviscidose.
We are indebted to Drs. M. Pritchard and F. Cardellach for useful suggestions and comments, to H. Kruyer for assistance with the manuscript, and to J. Giménez, M.D. Ramos, and M. Miranda for technical assistance.
Source Information
From the Cancer Research Institute, Molecular Genetics Department, Hospital Duran i Reynals, L'Hospitalet de Llobregat, Barcelona, Spain (M. Chillón, T.C., V.N., X.E.); the Centre de Biogénétique, University Hospital, Brest, France (B.M., C.V., C.F.); the Andrology Department, Institute of Urology, Nephrology, and Andrology, Fundació Puigvert, Barcelona (L.B., J.R.-R.); the Department of Medical Genetics, Vrije Universiteit, Brussels, Belgium (W.L.); the Department of Urology and Microsurgery, St. Luke's Hospital, St. Louis (S.S.); the Laboratoire de Biochimie Génétique, Institut de Biologie, Montpellier, France (M.-C.R., M. Claustres); and the Genetics Service, Hospital Clinic, Barcelona (X.E.).
Address reprint requests to Dr. Estivill at the Cancer Research Institute, Hospital Duran i Reynals, Avia. Castelldefels Km 2.7, 08907 L'Hospitalet de Llobregat, Barcelona, Catalonia, Spain.
- References
References
1
Jequier AM ,Ansell ID ,Bullimore NJ . Congenital absence of the vasa deferentia presenting with infertility. J Androl 1985;6:15-19
Web of Science | Medline2
Boat TF, Welsh MJ, Beaudet AL. Cystic fibrosis. In: Scriver CR, Beaudet AL, Sly WS, Valle D, eds. The metabolic basis of inherited disease. 6th ed. Vol. 2. New York: McGraw-Hill, 1989:2649-80.
3
Riordan JR ,Rommens JM ,Kerem B , et al. Identification of the cystic fibrosis gene: cloning and characterization of complementary DNA. Science 1989;245:1066-1073[Erratum, Science 1989;245:1437.]
CrossRef | Web of Science | Medline4
Anderson MP ,Berger HA ,Rich DP ,Gregory RJ ,Smith AE ,Welsh MJ . Nucleoside triphosphates are required to open the CFTR chloride channel. Cell 1991;67:775-784
CrossRef | Web of Science | Medline5
Kerem BS ,Rommens JM ,Buchanan JA , et al. Identification of the cystic fibrosis gene: genetic analysis. Science 1989;245:1073-1080
CrossRef | Web of Science | Medline6
Tsui L-C . The spectrum of cystic fibrosis mutations. Trends Genet 1992;8:392-398
CrossRef | Web of Science | Medline7
The Cystic Fibrosis Genotype-Phenotype Consortium
Full Text | Web of Science | Medline8
Dumur V ,Gervais R ,Rigot JM , et al. Abnormal distribution of CF ΔF508 allele in azoospermic men with congenital aplasia of epididymis and vas deferens. Lancet 1990;336:512-512
CrossRef | Web of Science | Medline9
Anguiano A ,Oates RD ,Amos JA , et al. Congenital bilateral absence of the vas deferens: a primary genital form of cystic fibrosis. JAMA 1992;267:1794-1797
CrossRef | Web of Science | Medline10
Osborne LR ,Lynch M ,Middleton PG , et al. Nasal epithelial ion transport and genetic analysis of infertile men with congenital bilateral absence of the vas deferens. Hum Mol Genet 1993;2:1605-1609[Erratum, Hum Mol Genet 1993;2:1990.]
CrossRef | Web of Science | Medline11
Gervais R ,Dumur V ,Rigot JM , et al. High frequency of the R117H cystic fibrosis mutation in patients with congenital absence of the vas deferens. N Engl J Med 1993;328:446-447
Full Text | Web of Science | Medline12
Culard JF ,Desgeorges M ,Costa P , et al. Analysis of the whole CFTR coding regions and splice junctions in azoospermic men with congenital bilateral aplasia of epididymis or vas deferens. Hum Genet 1994;93:467-470
CrossRef | Web of Science | Medline13
Chu CS ,Trapnell BC ,Murtagh JJ Jr , et al. Variable deletion of exon 9 coding sequences in cystic fibrosis transmembrane conductance regulator gene mRNA transcripts in normal bronchial epithelium. EMBO J 1991;10:1355-1363
Web of Science | Medline14
Bremer S ,Hoof T ,Wilke M , et al. Quantitative expression patterns of multidrug-resistance P-glycoprotein (MDR1) and differentially spliced cystic-fibrosis transmembrane-conductance regulator mRNA transcripts in human epithelia. Eur J Biochem 1992;206:137-149
CrossRef | Medline15
Slomski R ,Schloesser M ,Berg LP , et al. Omission of exon 12 in cystic fibrosis transmembrane conductance regulator (CFTR) gene transcripts. Hum Genet 1992;89:615-619
Web of Science | Medline16
Delaney SJ ,Rich DP ,Thomson SA , et al. Cystic fibrosis transmembrane conductance regulator splice variants are not conserved and fail to produce chloride channels. Nat Genet 1993;4:426-431
CrossRef | Web of Science | Medline17
Strong TV ,Wilkinson DJ ,Mansoura MK , et al. Expression of an abundant alternatively spliced form of the cystic fibrosis transmembrane conductance regulator (CFTR) gene is not associated with a cAMP-activated chloride conductance. Hum Mol Genet 1993;2:225-230
CrossRef | Web of Science | Medline18
Chu CS ,Trapnell BC ,Curristin S ,Cutting GR ,Crystal RG . Genetic basis of variable exon 9 skipping in cystic fibrosis transmembrane conductance regulator mRNA. Nat Genet 1993;3:151-156
CrossRef | Web of Science | Medline19
Casals T ,Bassas LL ,Ruiz-Romero J , et al. Extensive analysis of 40 infertile patients with congenital absence of the vas deferens: in 50% of cases only one CFTR allele could be detected. Hum Genet 1995;95:205-211
CrossRef | Web of Science | Medline20
Mercier B ,Verlingue C ,Lissens W , et al. Is congenital bilateral absence of vas deferens a primary form of cystic fibrosis? Analyses of the CFTR gene in 67 patients. Am J Hum Genet 1995;56:272-277
Web of Science | Medline21
Chillon M ,Casals T ,Gimenez J , et al. Analysis of the CFTR gene confirms the high genetic heterogeneity of the Spanish population: 43 mutations account for only 78% of CF chromosomes. Hum Genet 1994;93:447-451
CrossRef | Web of Science | Medline22
Miller SA ,Dykes DD ,Polesky HF . A simple salting out procedure for extracting DNA from human nucleated cells. Nucleic Acids Res 1988;16:1215-1215
CrossRef | Web of Science | Medline23
Audrezet MP ,Mercier B ,Guillermit H , et al. Identification of 12 novel mutations in the CFTR gene. Hum Mol Genet 1993;2:51-54[Erratum, Hum Mol Genet 1993;2:496.]
CrossRef | Web of Science | Medline24
Chillon M ,Casals T ,Gimenez J ,Nunes V ,Estivill X . Analysis of the CFTR gene in the Spanish population: SSCP-screening for 60 known mutations and identification of four new mutations (Q30X, A120T, 1812-1 G →A, and 3667del4). Hum Mutat 1994;3:223-230
CrossRef | Web of Science | Medline25
Zielenski J ,Rozmahel R ,Bozon D , et al. Genomic DNA sequence of the cystic fibrosis transmembrane regulator (CFTR) gene. Genomics 1991;10:214-228
CrossRef | Web of Science | Medline26
Fleiss JL. Statistical methods for rates and proportions. 2nd ed. New York: John Wiley, 1981.
27
Kiesewetter S ,Macek M Jr ,Davis C , et al. A mutation in CFTR produces different phenotypes depending on chromosomal background. Nat Genet 1993;5:274-278
CrossRef | Web of Science | Medline28
Dork T ,Fislage R ,Neumann T ,Wulf B ,Tummler B . Exon 9 of the CFTR gene: splice site haplotypes and cystic fibrosis mutations. Hum Genet 1994;93:67-73
CrossRef | Web of Science | Medline29
Cuppens H ,Teng H ,Raeymaekers P ,De Boeck C ,Cassiman JJ . CFTR haplotype backgrounds on normal and mutant CFTR genes. Hum Mol Genet 1994;3:607-614
CrossRef | Web of Science | Medline30
Trezise AE ,Chambers JA ,Wardle CJ ,Gould S ,Harris A . Expression of cystic fibrosis gene in human foetal tissues. Hum Mol Genet 1993;2:213-218
CrossRef | Web of Science | Medline31
Tizzano EF ,Chitayat D ,Buchwald M . Cell-specific localization of CFTR mRNA shows developmentally regulated expression in human fetal tissues. Hum Mol Genet 1993;2:219-224
CrossRef | Web of Science | Medline32
Chillon M ,Dork T ,Casals T , et al. A novel donor splice site in intron 11 of the CFTR gene, created by mutation 1811+1.6kbA→ G, produces a new exon: high frequency in Spanish cystic fibrosis chromosomes and association with severe phenotype. Am J Hum Genet 1995;56:623-629
Web of Science | Medline33
Highsmith WE ,Burch LH ,Zhou Z , et al. A novel mutation in the cystic fibrosis gene in patients with pulmonary disease but normal sweat chloride concentrations. N Engl J Med 1994;331:974-980
Full Text | Web of Science | Medline
- Citing Articles (250)
Citing Articles
1
Pascale Marcorelles, Danièle Gillet, Gaëlle Friocourt, Françoise Ledé, Laura Samaison, Geneviève Huguen, Claude Ferec. (2012) Cystic fibrosis transmembrane conductance regulator protein expression in the male excretory duct system during development. Human Pathology 43:3, 390-397
CrossRef2
PETER J. STAHL, DORON S. STEMBER, PETER N. SCHLEGEL. (2011) Interpretation of the Semen Analysis and Initial Male Factor Management. Clinical Obstetrics and Gynecology 54:4, 656-665
CrossRef3
Yolanda Saldaña-Alvarez, Silvia Jiménez-Morales, Mirna Echevarría-Sánchez, Juan Luis Jiménez-Ruíz, Ricardo García-Cavazos, Rafael Velázquez-Cruz, Alessandra Carnevale, Lorena Orozco. (2011) Molecular Screening of CFTR Gene in Mexican Patients with Congenital Absence of Vas Deferens. Genetic Testing and Molecular Biomarkers111121121944008
CrossRef4
J. Yu, Z. Chen, Y. Ni, Z. Li. (2011) CFTR mutations in men with congenital bilateral absence of the vas deferens (CBAVD): a systemic review and meta-analysis. Human Reproduction
CrossRef5
Ritesh Agarwal, Ajmal Khan, Ashutosh N. Aggarwal, Dheeraj Gupta. (2011) Link between CFTR mutations and ABPA: a systematic review and meta-analysis. Mycosesno-no
CrossRef6
J. Yu, Z. Chen, T. Zhang, Z. Li, Y. Ni, Z. Li. (2011) Association of genetic variants in CFTR gene, IVS8 c.1210-12T[5_9] and c.1210-35_1210-12GT[8_12], with spermatogenetic failure: case-control study and meta-analysis. Molecular Human Reproduction 17:9, 594-603
CrossRef7
Rossella Tomaiuolo, Marsia Fausto, Ausilia Elce, Ida Strina, Antonio Ranieri, Felice Amato, Giuseppe Castaldo, Giuseppe De Placido, Carlo Alviggi. (2011) Enhanced frequency of CFTR gene variants in couples who are candidates for assisted reproductive technology treatment. Clinical Chemistry and Laboratory Medicine 49:8, 1289-1293
CrossRef8
Bernhard Steiner, Jonas Rosendahl, Heiko Witt, Niels Teich, Volker Keim, Hans-Ulrich Schulz, Roland Pfützer, Matthias Lühr, Thomas M. Gress, Renate Nickel, Olfert Landt, Monika Koudova, Milan Macek, Antoni Farre, Teresa Casals, Marie-Claire Desax, Sabina Gallati, Macarena Gomez-Lira, Marie Pierre Audrezet, Claude Férec, Marie des Georges, Mireille Claustres, Kaspar Truninger. (2011) Common CFTR haplotypes and susceptibility to chronic pancreatitis and congenital bilateral absence of the vas deferens. Human Mutation 32:8, 912-920
CrossRef9
M. Ghorbel, S. Baklouti-Gargouri, R. Keskes, A. Sellami-Ben Hamida, N. Feki-Chakroun, A. Bahloul, F. Fakhfakh, L. Ammar-Keskes. (2011) Screening of ΔF508 mutation and IVS8-poly T polymorphism in CFTR gene in Tunisian infertile men without CBAVD. Andrologiano-no
CrossRef10
Paolo Giovanni Artini, Francesca Papini, Maria Ruggiero, Gabriella Bartalini, Vincenzo De Leo, Giulia Scaravelli, Paola Piomboni, Vito Cela. (2011) Genetic screening in Italian infertile couples undergoing intrauterine insemination and in vitro fertilization techniques: a multicentric study. Gynecological Endocrinology 27:7, 453-457
CrossRef11
C. Coat, A. Perrin, M. Talagas, R. Tetefort, J. Amice, A. Valéri, M. De Braekeleer, V. Amice. (2011) Azoospermie : prise en charge et résultats. À propos de 90 cas. Progrès en Urologie
CrossRef12
C. Bombieri, M. Claustres, K. De Boeck, N. Derichs, J. Dodge, E. Girodon, I. Sermet, M. Schwarz, M. Tzetis, M. Wilschanski, C. Bareil, D. Bilton, C. Castellani, H. Cuppens, G.R. Cutting, P. Drevínek, P. Farrell, J.S. Elborn, K. Jarvi, B. Kerem, E. Kerem, M. Knowles, M. Macek, A. Munck, D. Radojkovic, M. Seia, D.N. Sheppard, K.W. Southern, M. Stuhrmann, E. Tullis, J. Zielenski, P.F. Pignatti, C. Ferec. (2011) Recommendations for the classification of diseases as CFTR-related disorders. Journal of Cystic Fibrosis 10, S86-S102
CrossRef13
Kabir Sachdeva, Renu Saxena, Abha Majumdar, Sudhir Chadha, Ishwar Chander Verma. (2011) Mutation Studies in the CFTR Gene in Asian Indian Subjects with Congenital Bilateral Absence of Vas Deferens: Report of Two Novel Mutations and Four Novel Variants. Genetic Testing and Molecular Biomarkers 15:5, 307-312
CrossRef14
Wenming Xu, Chen Hui, Sidney Siu Bun Yu, Chen Jing, Hsiao Chang Chan. (2011) MicroRNAs and cystic fibrosis – an epigenetic perspective. Cell Biology International 35:5, 463-466
CrossRef15
T. M. Hussein, N. H. Zakaria, A. M. Zahran. (2011) Clinical, laboratory and genetic assessment of patients with congenital bilateral absent vas deferens. Andrologia 43:1, 16-22
CrossRef16
Marc Goldstein. (2011) Male Infertility. Annual Review of Medicine 63:1, 110301100719093
CrossRef17
Bryan Corrin, Andrew G. Nicholson. 2011. Development of the lungs; perinatal and developmental lung disease. , 39-90.
CrossRef18
Kathleen Hwang, Alexander N. Yatsenko, Carolina J. Jorgez, Sarmistha Mukherjee, Roopa Lata Nalam, Martin M. Matzuk, Dolores J. Lamb. (2010) Mendelian genetics of male infertility. Annals of the New York Academy of Sciences 1214:1, E1-E17
CrossRef19
G. Dujardin, E. Buratti, N. Charlet-Berguerand, M. Martins de Araujo, A. Mbopda, C. Le Jossic-Corcos, F. Pagani, C. Ferec, L. Corcos. (2010) CELF proteins regulate CFTR pre-mRNA splicing: essential role of the divergent domain of ETR-3. Nucleic Acids Research 38:20, 7273-7285
CrossRef20
Rossella Giuliani, Ivana Antonucci, Isabella Torrente, Paola Grammatico, Giandomenico Palka, Liborio Stuppia. (2010) Identification of the second CFTR mutation in patients with congenital bilateral absence of vas deferens undergoing ART protocols. Asian Journal of Andrology 12:6, 819-826
CrossRef21
2010. Mendelian Inheritance. , 22-65.
CrossRef22
Ruth W. Muchekehu, Paul M. Quinton. (2010) A new role for bicarbonate secretion in cervico-uterine mucus release. The Journal of Physiology 588:13, 2329-2342
CrossRef23
Howard C. Smith. (2010) Fertility in Men with Cystic Fibrosis Assessment, investigations and management. Paediatric Respiratory Reviews 11:2, 80-83
CrossRef24
V. B. Chernykh, A. A. Stepanova, T. S. Beskorovainaya, T. M. Sorokina, L. V. Shileiko, L. F. Kurilo, A. V. Polyakov. (2010) The frequency and spectrum of mutations and the IVS8-T polymorphism of the CFTR gene in Russian infertile men. Russian Journal of Genetics 46:6, 750-757
CrossRef25
Carlo Castellani, Milan Macek, Jean-Jacques Cassiman, Alistair Duff, John Massie, Leo P. ten Kate, David Barton, Garry Cutting, Bruno Dallapiccola, Elisabeth Dequeker, Emmanuelle Girodon, Wayne Grody, Edward W. Highsmith, Helenal Kääriäinen, Stephan Kruip, Michael Morris, Pier Franco Pignatti, Ulrike Pypops, Martin Schwarz, Maria Soller, Manfred Stuhrman, Harry Cuppens. (2010) Benchmarks for Cystic Fibrosis carrier screening: A European consensus document. Journal of Cystic Fibrosis 9:3, 165-178
CrossRef26
Valeria Faa′, Alessandra Coiana, Federica Incani, Lucy Costantino, Antonio Cao, Maria Cristina Rosatelli. (2010) A Synonymous Mutation in the CFTR Gene Causes Aberrant Splicing in an Italian Patient Affected by a Mild Form of Cystic Fibrosis. The Journal of Molecular Diagnostics 12:3, 380-383
CrossRef27
Julia J. Wirth, Renée S. Mijal. (2010) Adverse Effects of Low Level Heavy Metal Exposure on Male Reproductive Function. Systems Biology in Reproductive Medicine 56:2, 147-167
CrossRef28
P-R Burgel, I Fajac, D Hubert, D Grenet, N Stremler, M Roussey, D Siret, J Languepin, L Mely, A Fanton, A Labbé, P Domblides, P Vic, M Dagorne, M Reynaud-Gaubert, F Counil, F Varaigne, T Bienvenu, G Bellis, D Dusser. (2010) Non-classic cystic fibrosis associated with D1152H CFTR mutation. Clinical Genetics 77:4, 355-364
CrossRef29
Alexander N. Yatsenko, Svetlana A. Yatsenko, John W. Weedin, Amy E. Lawrence, Ankita Patel, Sandra Peacock, Martin M. Matzuk, Dolores J. Lamb, Sau Wai Cheung, Larry I. Lipshultz. (2010) Comprehensive 5-Year Study of Cytogenetic Aberrations in 668 Infertile Men. The Journal of Urology 183:4, 1636-1642
CrossRef30
Jeffrey S. Dungan. (2010) Carrier Screening for Cystic Fibrosis. Obstetrics and Gynecology Clinics of North America 37:1, 47-59
CrossRef31
Javier Sanz, Thomas von Känel, Mircea Schneider, Bernhard Steiner, André Schaller, Sabina Gallati. (2010) The CFTR frameshift mutation 3905insT and its effect at transcript and protein level. European Journal of Human Genetics 18:2, 212-217
CrossRef32
Luigi Picci, Marilena Cameran, Oriana Marangon, Diana Marzenta, Stefano Ferrari, Anna Chiara Frigo, Maurizio Scarpa. (2010) A 10-year large-scale cystic fibrosis carrier screening in the Italian population. Journal of Cystic Fibrosis 9:1, 29-35
CrossRef33
Howard H. Kim, Peter N. Schlegel, Marc Goldstein. 2010. InfertilityThe Male. , 366-380.
CrossRef34
Sabina Gallati, Simone Hess, Dorothea Galié-Wunder, Elisabeth Berger-Menz, Dominik Böhlen. (2009) Cystic fibrosis transmembrane conductance regulator mutations in azoospermic and oligospermic men and their partners. Reproductive BioMedicine Online 19:5, 685-694
CrossRef35
H-S Chiang, J-F Lu, C-H Liu, Y-N Wu, C-C Wu. (2009) CFTR (TG)m(T)n polymorphism in patients with CBAVD in a population expressing low incidence of cystic fibrosis. Clinical Genetics 76:3, 282-286
CrossRef36
Abul Kalam Azad, Robert Rauh, François Vermeulen, Martine Jaspers, Judit Korbmacher, Brigitte Boissier, Laurence Bassinet, Yann Fichou, Marie des Georges, Frauke Stanke, Kris De Boeck, Lieven Dupont, Miroslava BalasÌcÌáková, Lena Hjelte, Patrick Lebecque, Dragica Radojkovic, Carlo Castellani, Marianne Schwartz, Manfred Stuhrmann, Martin Schwarz, Veronika Skalicka, Isabelle de Monestrol, Emmanuelle Girodon, Claude Férec, Mireille Claustres, Burkhard Tümmler, Jean-Jacques Cassiman, Christoph Korbmacher, Harry Cuppens. (2009) Mutations in the amiloride-sensitive epithelial sodium channel in patients with cystic fibrosis-like disease. Human Mutation 30:7, 1093-1103
CrossRef37
Karen M. Schwartz, Lisa L. Pike-Buchanan, Kasinathan Muralidharan, Joy B. Redman, Jean Amos Wilson, Michael Jarvis, M. Grace Cura, Victoria M. Pratt. (2009) Identification of Cystic Fibrosis Variants by Polymerase Chain Reaction/Oligonucleotide Ligation Assay. The Journal of Molecular Diagnostics 11:3, 211-215
CrossRef38
Marie-Alexandra H. Lambot, Fernando Mendive, Patrick Laurent, Gregory Van Schoore, Jean-Christophe Noël, Pierre Vanderhaeghen, Gilbert Vassart. (2009) Three-Dimensional Reconstruction of Efferent Ducts in Wild-Type and Lgr4 Knock-Out Mice. The Anatomical Record: Advances in Integrative Anatomy and Evolutionary Biology 292:4, 595-603
CrossRef39
N. Sharma, N. Acharya, S.K. Singh, M. Singh, U. Sharma, R. Prasad. (2009) Heterogenous spectrum of CFTR gene mutations in Indian patients with congenital absence of vas deferens. Human Reproduction 24:5, 1229-1236
CrossRef40
Els Dequeker, Manfred Stuhrmann, Michael A Morris, Teresa Casals, Carlo Castellani, Mireille Claustres, Harry Cuppens, Marie des Georges, Claude Ferec, Milan Macek, Pier-Franco Pignatti, Hans Scheffer, Marianne Schwartz, Michal Witt, Martin Schwarz, Emmanuelle Girodon. (2009) Best practice guidelines for molecular genetic diagnosis of cystic fibrosis and CFTR-related disorders – updated European recommendations. European Journal of Human Genetics 17:1, 51-65
CrossRef41
Robert R. McWilliams, Gloria M. Petersen, Kari G. Rabe, Leonard M. Holtegaard, Pamela J. Lynch, Michele D. Bishop, W. Edward Highsmith. (2009) Cystic fibrosis transmembrane conductance regulator ( CFTR ) gene mutations and risk for pancreatic adenocarcinoma. CancerNA-NA
CrossRef42
Viktoria Havasi, Steven Keiles, Tina Hambuch, Eric J. Sorscher, Anja Kammesheidt. (2008) The role of the F508C mutation in congenital bilateral absence of the vas deferens. Genetics in Medicine 10:12, 910-914
CrossRef43
Jayant M. Pinto, M Geoffrey Hayes, Daniel Schneider, Robert M. Naclerio, Carole Ober. (2008) A Genomewide Screen for Chronic Rhinosinusitis Genes Identifies a Locus on Chromosome 7q. The Laryngoscope 118:11, 2067-2072
CrossRef44
(2008) Evaluation of the azoospermic male. Fertility and Sterility 90:5, S74-S77
CrossRef45
I. Durieu, R. Nove Josserand. (2008) La mucoviscidose en 2008. La Revue de Médecine Interne 29:11, 901-907
CrossRef46
Martin M Matzuk, Dolores J Lamb. (2008) The biology of infertility: research advances and clinical challenges. Nature Medicine 14:11, 1197-1213
CrossRef47
Kristina V. Krasnov, Maria Tzetis, Jie Cheng, William B. Guggino, Garry R. Cutting. (2008) Localization studies of rare missense mutations in cystic fibrosis transmembrane conductance regulator (CFTR) facilitate interpretation of genotype-phenotype relationships. Human Mutation 29:11, 1364-1372
CrossRef48
DJ Kaufman, SH Katsanis, GH Javitt, JA Murphy, JA Scott, KL Hudson. (2008) Carrier screening for cystic fibrosis in US genetic testing laboratories: a survey of laboratory directors. Clinical Genetics 74:4, 367-373
CrossRef49
Katherine D. Schoyer, Fred Gilbert, Zev Rosenwaks. (2008) Infertility and abnormal cervical mucus in two sisters who are compound heterozygotes for the cystic fibrosis (CF) ΔF508 and R117H/7T mutations. Fertility and Sterility 90:4, 1201.e19-1201.e22
CrossRef50
Ilham Ratbi, Emmanuelle Génin, Marie Legendre, Annick Le Floch, Catherine Costa, Souad Cherkaoui-Deqqaqi, Michel Goossens, Abdelaziz Sefiani, Emmanuelle Girodon. (2008) Cystic fibrosis carrier frequency and estimated prevalence of the disease in Morocco. Journal of Cystic Fibrosis 7:5, 440-443
CrossRef51
F. Alghisi, A. Angioni, A.C. Tomaiuolo, M.R. D'Apice, S. Bella, G. Novelli, V. Lucidi. (2008) Diagnosis of atypical CF: A case-report to reflect. Journal of Cystic Fibrosis 7:4, 292-294
CrossRef52
Di Qiao, Long Yi, Lixin Hua, Zheng Xu, Yi Ding, Dongquan Shi, Ligang Ni, Ninghong Song, Yong Wang, Hongfei Wu. (2008) Cystic fibrosis transmembrane conductance regulator (CFTR) gene 5T allele may protect against prostate cancer: A case-control study in Chinese Han population. Journal of Cystic Fibrosis 7:3, 210-214
CrossRef53
M. Esther Farez-Vidal, M. Amelia Gómez-Llorente, Carolina Gómez-Llorente, Sonia Blanco, Francisco Casas-Maldonado, Cristina Campoy, JoséAntonio Gómez-Capilla. (2008) A Family with Atypical Cystic Fibrosis: Brother and Sister with Heterozygosity for Both G542X and R117H. Pediatric and Developmental Pathology 11:3, 213-219
CrossRef54
C. Castellani, H. Cuppens, M. Macek, J.J. Cassiman, E. Kerem, P. Durie, E. Tullis, B.M. Assael, C. Bombieri, A. Brown, T. Casals, M. Claustres, G.R. Cutting, E. Dequeker, J. Dodge, I. Doull, P. Farrell, C. Ferec, E. Girodon, M. Johannesson, B. Kerem, M. Knowles, A. Munck, P.F. Pignatti, D. Radojkovic, P. Rizzotti, M. Schwarz, M. Stuhrmann, M. Tzetis, J. Zielenski, J.S. Elborn. (2008) Consensus on the use and interpretation of cystic fibrosis mutation analysis in clinical practice. Journal of Cystic Fibrosis 7:3, 179-196
CrossRef55
Alessandra Riccaboni, Faustina Lalatta, Ilaria Caliari, Silvia Bonetti, Edgardo Somigliana, Guido Ragni. (2008) Genetic screening in 2,710 infertile candidate couples for assisted reproductive techniques: results of application of Italian guidelines for the appropriate use of genetic tests. Fertility and Sterility 89:4, 800-808
CrossRef56
Kari Danziger Kaplan, Monica Brown, Mary S. Croughan, Paul J. Turek. (2008) The Relative Accuracy of a Questionnaire Compared With Pedigree Analysis in Genetic Risk Assessment for Infertility. The Journal of Urology 179:4, 1499-1505
CrossRef57
Anne-Marie Madore, Claude Prévost, Ruslan Dorfman, Chelsea Taylor, Peter Durie, Julian Zielenski, Catherine Laprise. (2008) Distribution of CFTR mutations in Saguenay– Lac-Saint-Jean: proposal of a panel of mutations for population screening. Genetics in Medicine 10:3, 201-206
CrossRef58
Hideo Sakamoto, Takatoshi Yajima, Kohta Suzuki, Yoshio Ogawa. (2008) Cystic fibrosis transmembrane conductance regulator (CFTR) gene mutation associated with a congenital bilateral absence of vas deferens. International Journal of Urology 15:3, 270-271
CrossRef59
Arie Augarten, Amir Ben Tov, Igal Madgar, Asher Barak, Hanna Akons, Joseph Laufer, Ori Efrati, Micha Aviram, Lea Bentur, Hannah Blau, Gideon Paret, Michael Wilschanski, Bat-Sheva Kerem, Yaakov Yahav. (2008) The changing face of the exocrine pancreas in cystic fibrosis: the correlation between pancreatic status, pancreatitis and cystic fibrosis genotype. European Journal of Gastroenterology & Hepatology 20:3, 164-168
CrossRef60
O. Loumi, C. Ferec, B. Mercier, J. Creff, B. Fercot, R. Denine, J.P. Grangaud. (2008) CFTR mutations in the Algerian population. Journal of Cystic Fibrosis 7:1, 54-59
CrossRef61
L Tamburino, A Guglielmino, E Venti, S Chamayou. (2008) Molecular analysis of mutations and polymorphisms in the CFTR gene in male infertility. Reproductive BioMedicine Online 17:1, 27-35
CrossRef62
C. Damas, A. Amorim, I. Gomes, V.P. Hespanhol. (2008) Fibrose quística: Revisão. Revista Portuguesa de Pneumologia (English Edition) 14:1, 89-112
CrossRef63
Corinne Bareil, Caroline Guittard, Jean-Pierre Altieri, Carine Templin, Mireille Claustres, Marie des Georges. (2007) Comprehensive and Rapid Genotyping of Mutations and Haplotypes in Congenital Bilateral Absence of the Vas Deferens and Other Cystic Fibrosis Transmembrane Conductance Regulator-Related Disorders. The Journal of Molecular Diagnostics 9:5, 582-588
CrossRef64
Harpreet Pall, Julian Zielenski, Maureen M. Jonas, Deborah A. DaSilva, Kimberly M. Potvin, Xiao-Wei Yuan, Qiuju Huang, Steven D. Freedman. (2007) Primary Sclerosing Cholangitis in Childhood is Associated with Abnormalities in Cystic Fibrosis–Mediated Chloride Channel Function. The Journal of Pediatrics 151:3, 255-259
CrossRef65
Heinz Zoller, Margit Egg, Ivo Graziadei, Marc Creus, Andreas R. Janecke, Judith Löffler-Ragg, Wolfgang Vogel. (2007) CFTR gene mutations in pancreatitis: Frequency and clinical manifestations in an Austrian patient cohort. Wiener klinische Wochenschrift 119:17-18, 527-533
CrossRef66
Kathelijn Keymolen, Veerle Goossens, Martine De rycke, Karen Sermon, Kristel Boelaert, Maryse Bonduelle, André Van Steirteghem, Inge Liebaers. (2007) Clinical outcome of preimplantation genetic diagnosis for cystic fibrosis: the Brussels' experience. European Journal of Human Genetics 15:7, 752-758
CrossRef67
L Narzi, G Ferraguti, A Stamato, F Narzi, SB Valentini, A Lelli, I Delaroche, M Lucarelli, R Strom, S Quattrucci. (2007) Does cystic fibrosis neonatal screening detect atypical CF forms? Extended genetic characterization and 4-year clinical follow-up. Clinical Genetics 72:1, 39-46
CrossRef68
Viranuj Sueblinvong, Laurie A. Whittaker. (2007) Fertility and Pregnancy: Common Concerns of the Aging Cystic Fibrosis Population. Clinics in Chest Medicine 28:2, 433-443
CrossRef69
Edward Karpman, Daniel H. Williams, Sidney Wilberforce, Larry I. Lipshultz. (2007) Compound genetic abnormalities in patients with cystic fibrosis transmembrane regulator gene mutation. Fertility and Sterility 87:6, 1468.e5-1468.e8
CrossRef70
Kim Van Hoorenbeeck, Katrien Storm, Jenneke van den Ende, Martine Biervliet, Kristine N. Desager. (2007) N1303K and IVS8-5T, clinical presentation within a family with atypical cystic fibrosis. Journal of Cystic Fibrosis 6:3, 220-222
CrossRef71
Roger V. Lebo, Wayne W. Grody. (2007) Variable Penetrance And Expressivity of The Splice Altering 5T Sequence in The Cystic Fibrosis Gene. Genetic Testing 11:1, 32-44
CrossRef72
Andrea L. Gropman, David R. Adams. (2007) Atypical Patterns of Inheritance. Seminars in Pediatric Neurology 14:1, 34-45
CrossRef73
Ana Grangeia, Ros??lia S??, Filipa Carvalho, Josiane Martin, Emmanuelle Girodon, Joaquina Silva, Lu??s Ferr??z, Alberto Barros, M??rio Sousa. (2007) Molecular characterization of the cystic fibrosis transmembrane conductance regulator gene in congenital absence of the vas deferens. Genetics in Medicine 9:3, 163-172
CrossRef74
André Schaller, Thomas von Känel, Benedikt Gehr, Javier Sanz, Sabina Gallati. (2007) Rapid and reliable genotyping of polymorphic loci modifying correct splicing of CFTR pre-mRNA using mass spectrometry. European Journal of Human Genetics 15:1, 53-61
CrossRef75
Inge Tarnow, Alan D. Michelson, Andrew L. Frelinger, Matthew D. Linden, Youfu Li, Marsha L. Fox, Marc R. Barnard, Brian P. O'Sullivan. (2007) Cystic fibrosis heterozygotes do not have increased platelet activation. Thrombosis Research 121:2, 159-162
CrossRef76
Kevin W. Southern. (2007) Cystic Fibrosis and Formes Frustes of CFTR-Related Disease. Respiration 74:3, 241-251
CrossRef77
Valeria Faà, Pietro Pellegrini Bettoli, Maria Demurtas, Maurizio Zanda, Vincenzina Ferri, Antonio Cao, Maria Cristina Rosatelli. (2006) A New Insertion/Deletion of the Cystic Fibrosis Transmembrane Conductance Regulator Gene Accounts for 3.4% of Cystic Fibrosis Mutations in Sardinia: Implications for Population Screening. The Journal of Molecular Diagnostics 8:4, 499-503
CrossRef78
Agnieszka Sobczy??ska-Tomaszewska, Daniel B??k, Beata Oralewska, Grzegorz Oracz, Aleksandra Norek, Kamila Czerska, Tadeusz Mazurczak, Miko??aj Teisseyre, Jerzy Socha, Marek Zagulski, Jerzy Bal. (2006) Analysis of CFTR, SPINK1, PRSS1 and AAT Mutations in Children With Acute or Chronic Pancreatitis. Journal of Pediatric Gastroenterology and Nutrition 43:3, 299-306
CrossRef79
Rita Padoan, Carlo Corbetta, Alessandra Bassotti, Manuela Seia. (2006) Identification of the 5T-12TG allele of the cystic fibrosis transmembrane conductance regulator gene in hypertrypsinaemic newborns. Acta Paediatrica 95:7, 871-873
CrossRef80
Rafet Gazvani, Iwan Lewis-Jones. (2006) Cystic fibrosis screening in assisted reproduction. Current Opinion in Obstetrics and Gynecology 18:3, 268-272
CrossRef81
H. Scheffer. (2006) Fenotype-genotype correlaties bij cystische fibrose. Tijdschrift voor kindergeneeskunde 74:2, 84-89
CrossRef82
Sainan Wei, Gerald L. Feldman, Kristin G. Monaghan. (2006) Cystic Fibrosis testing among Arab-Americans. Genetics in Medicine 8:4, 255-258
CrossRef83
Toan D. Nguyen, Ug-Sung Kim, Susan P. Perrine. (2006) Novel short chain fatty acids restore chloride secretion in cystic fibrosis. Biochemical and Biophysical Research Communications 342:1, 245-252
CrossRef84
Jerry A Nick, David M Rodman. (2006) Manifestations of cystic fibrosis diagnosed in adulthood. Current Opinion in Internal Medicine 5:1, 68-73
CrossRef85
Feras M. Hantash, Aubrey Milunsky, Zhenyuan Wang, Ben Anderson, Weimin Sun, Arturo Anguiano, Charles M. Strom. (2006) A large deletion in the CFTR gene in CBAVD. Genetics in Medicine 8:2, 93-95
CrossRef86
Daniel Kobler, Hemanshu Modi, Barbara Goldman. (2006) Identification of an 11T allele in the polypyrimidine tract of intron 8 of the CFTR gene. Genetics in Medicine 8:2, 125-128
CrossRef87
Ahmad S Teebi, Shelley J Kennedy. 2006. Autosomal Recessive Traits and Diseases. .
CrossRef88
Eitan Kerem. (2006) Atypical CF and CF related diseases. Paediatric Respiratory Reviews 7, S144-S146
CrossRef89
Carmen Sílvia Bertuzzo, Walter Pinto. (2006) Molecular screening of CFTR gene in Brazilian men with bilateral agenesis of the vas deferens. Human Fertility 9:1, 53-56
CrossRef90
Kris De Boeck. (2006) Diagnostische Verfahren, klinische Merkmale und Beratung bei Mukoviszidose (cystischer Fibrose, CF). Annales Nestlé (Deutsche Ausg.) 64:3, 121-132
CrossRef91
H. Samli, M. M. Samli, E. Yilmaz, N. Imirzalioglu. (2006) CLINICAL, ANDROLOGICAL AND GENETIC CHARACTERISTICS OF PATIENTS WITH CONGENITAL BILATERAL ABSENCE OF VAS DEFERENS (CBAVD). Systems Biology in Reproductive Medicine 52:6, 471-477
CrossRef92
Bruce R Korf. (2005) Genetics training in the genomic era. Current Opinion in Pediatrics 17:6, 747-750
CrossRef93
Pietro Stanziale, Maria Savino, Patrizia De Bonis, Matteo Granatiero, Leopoldo Zelante, Luigi Bisceglia. (2005) Indirect CFTR Mutation Identification by PCR/OLA Anomalous Electropherograms. Genetic Testing 9:4, 285-291
CrossRef94
Michele D. Bishop, Steven D. Freedman, Julian Zielenski, Najma Ahmed, Annie Dupuis, Sheelagh Martin, Lynda Ellis, Julie Shea, Isobel Hopper, Mary Corey, Paul Kortan, Gregory Haber, Christine Ross, John Tzountzouris, Leslie Steele, Peter N. Ray, Lap-Chee Tsui, Peter R. Durie. (2005) The cystic fibrosis transmembrane conductance regulator gene and ion channel function in patients with idiopathic pancreatitis. Human Genetics 118:3-4, 372-381
CrossRef95
Jonathan A. Cohn, John P. Neoptolemos, Jinong Feng, Jin Yan, Zefei Jiang, William Greenhalf, Christopher McFaul, Roger Mountford, Steve S. Sommer. (2005) Increased risk of idiopathic chronic pancreatitis in cystic fibrosis carriers. Human Mutation 26:4, 303-307
CrossRef96
S. LARRIBA, S. BONACHE, J. SARQUELLA, M. D. RAMOS, J. GIMENEZ, L. BASSAS, T. CASALS. (2005) Molecular evaluation of CFTR sequence variants in male infertility of testicular origin. International Journal of Andrology 28:5, 284-290
CrossRef97
Garry R Cutting. (2005) MODIFIER GENETICS: Cystic Fibrosis. Annual Review of Genomics and Human Genetics 6:1, 237-260
CrossRef98
Samuel M. Moskowitz, Ronald L. Gibson, Eric L. Effmann. (2005) Cystic fibrosis lung disease: genetic influences, microbial interactions, and radiological assessment. Pediatric Radiology 35:8, 739-757
CrossRef99
Iris Schrijver, Eneli Oitmaa, Andres Metspalu, Phyllis Gardner. (2005) Genotyping Microarray for the Detection of More Than 200 CFTR Mutations in Ethnically Diverse Populations. The Journal of Molecular Diagnostics 7:3, 375-387
CrossRef100
Liborio Stuppia, Ivana Antonucci, Francesco Binni, Alessandra Brandi, Nicoletta Grifone, Alessia Colosimo, Mariella De Santo, Valentina Gatta, Gianfranco Gelli, Valentina Guida, Silvia Majore, Giuseppe Calabrese, Chiara Palka, Anna Ravani, Rosanna Rinaldi, Gian Mario Tiboni, Enzo Ballone, Anna Venturoli, Alessandra Ferlini, Isabella Torrente, Paola Grammatico, Elisa Calzolari, Bruno Dallapiccola. (2005) Screening of mutations in the CFTR gene in 1195 couples entering assisted reproduction technique programs. European Journal of Human Genetics 13:8, 959-964
CrossRef101
Mai H. Nam, Minako Hijikata, Le A. Tuan, Luu T. Lien, Junko Shojima, Toru Horie, Koh Nakata, Ikumi Matsushita, Jun Ohashi, Katsushi Tokunaga, Naoto Keicho. (2005) Variations of theCFTR gene in the Hanoi-Vietnamese. American Journal of Medical Genetics Part A 136A:3, 249-253
CrossRef102
Frédérique Maire. (2005) Quand demander un bilan génétique devant une pancréatite aiguë ou une pancréatite chronique ?. Gastroentérologie Clinique et Biologique 29:6-7, 715-723
CrossRef103
Howard Clark, Lucy Side Clark. (2005) The genetics of neonatal respiratory disease. Seminars in Fetal and Neonatal Medicine 10:3, 271-282
CrossRef104
Rowe, Steven M., Miller, Stacey, Sorscher, Eric J., . (2005) Cystic Fibrosis. New England Journal of Medicine 352:19, 1992-2001
Full Text105
Iris Schrijver, Sudha Ramalingam, Ramalingam Sankaran, Steve Swanson, Charles L.M. Dunlop, Steven Keiles, Richard B. Moss, John Oehlert, Phyllis Gardner, E. Robert Wassman, Anja Kammesheidt. (2005) Diagnostic Testing by CFTR Gene Mutation Analysis in a Large Group of Hispanics. The Journal of Molecular Diagnostics 7:2, 289-299
CrossRef106
Jonathan A Cohn. (2005) Reduced CFTR Function and the Pathobiology of Idiopathic Pancreatitis. Journal of Clinical Gastroenterology 39:Supplement 2, S70-S77
CrossRef107
Eitan Kerem, Steven Conway, Stuart Elborn, Harry Heijerman. (2005) Standards of care for patients with cystic fibrosis: a European consensus. Journal of Cystic Fibrosis 4:1, 7-26
CrossRef108
Elinor Langfelder-Schwind, Edward Kloza, Elaine Sugarman, Barbara Pettersen, , Trisha Brown, Kim Jensen, Seth Marcus, Joy Redman. (2005) Cystic Fibrosis Prenatal Screening in Genetic Counseling Practice: Recommendations of the National Society of Genetic Counselors. Journal of Genetic Counseling 14:1, 1-15
CrossRef109
Ana Grangeia, Filipa Carvalho, Susana Fernandes, Joaquina Silva, Mário Sousa, Alberto Barros. (2005) A novel missense mutation P1290S at exon-20 of the CFTR gene in a Portuguese patient with congenital bilateral absence of the vas deferens. Fertility and Sterility 83:2, 448-451
CrossRef110
Antoine Disset, Carine Michot, Ann Harris, Emanuele Buratti, Mireille Claustres, Sylvie Tuffery-Giraud. (2005) A T3 allele in theCFTR gene exacerbates exon 9 skipping in vas deferens and epididymal cell lines and is associated with Congenital Bilateral Absence of Vas Deferens (CBAVD). Human Mutation 25:1, 72-81
CrossRef111
Mireille Claustres. (2005) Molecular pathology of the CFTR locus in male infertility. Reproductive BioMedicine Online 10:1, 14-41
CrossRef112
K. Mennicke, R. D. Klingenberg, M. Bals-Pratsch, K. Diedrich, E. Schwinger. (2005) Rational approach to genetic testing of cystic fibrosis (CF) in infertile men. Andrologia 37:1, 1-9
CrossRef113
Michael Ludwig. (2005) Is there an increased risk of malformations after assisted reproductive technologies?. Reproductive BioMedicine Online 10, 83-89
CrossRef114
Jonathan A. Cohn, R. Michael Mitchell, Paul S. Jowell. (2004) The role of cystic fibrosis gene mutations in determining susceptibility to chronic pancreatitis. Gastroenterology Clinics of North America 33:4, 817-837
CrossRef115
Tiziana Rossi, Francesco Grandoni, Fernando Mazzilli, Serena Quattrucci, Mariano Antonelli, Roberto Strom, Marco Lucarelli. (2004) High frequency of (TG)mTn variant tracts in the cystic fibrosis transmembrane conductance regulator gene in men with high semen viscosity. Fertility and Sterility 82:5, 1316-1322
CrossRef116
Andrew G. Hadd, Walairat Laosinchai-Wolf, Chris R. Novak, Marty R. Badgett, Lesley A. Isgur, Marianna Goldrick, Cindy R. WalkerPeach. (2004) Microsphere Bead Arrays and Sequence Validation of 5/7/9T Genotypes for Multiplex Screening of Cystic Fibrosis Polymorphisms. The Journal of Molecular Diagnostics 6:4, 348-355
CrossRef117
Harry Cuppens, Jean-Jacques Cassiman. (2004) CFTR mutations and polymorphisms in male infertility. International Journal of Andrology 27:5, 251-256
CrossRef118
Federica Sangiuolo, Maria Rosaria D’Apice, Stefano Gambardella, Nicola Di Daniele, Giuseppe Novelli. (2004) Toward the pharmacogenomics of cystic fibrosis – an update. Pharmacogenomics 5:7, 861-878
CrossRef119
Pamela B. Davis, Mitchell L. Drumm. (2004) Some like it hot: curcumin and CFTR. Trends in Molecular Medicine 10:10, 473-475
CrossRef120
(2004) Report on evaluation of the azoospermic male. Fertility and Sterility 82, 131-136
CrossRef121
(2004) Information on commonly asked questions about genetic evaluation and counseling for infertile couples. Fertility and Sterility 82, 97-101
CrossRef122
Elizabeth M. Rohlfs, Vivian J. Weinblatt, Karen J. Treat, Elaine A. Sugarman. (2004) Analysis of 3208 cystic fibrosis prenatal diagnoses: Impact of carrier screening guidelines on distribution of indications for CFTR mutation and IVS-8 poly(T) analyses. Genetics in Medicine 6:5, 400-404
CrossRef123
Bernhard Steiner, Kaspar Truninger, Javier Sanz, Andr
Schaller, Sabina Gallati. (2004) The role of common single-nucleotide polymorphisms on exon 9 and exon 12 skipping in nonmutatedCFTR Alleles. Human Mutation 24:2, 120-129
CrossRef124
T Casals, J De-Gracia, M Gallego, J Dorca, B Rodríguez-Sanchón, MD Ramos, J Giménez, A Cisteró-Bahima, C Olveira, X Estivill. (2004) Bronchiectasis in adult patients: an expression of heterozygosity for CFTR gene mutations?. Clinical Genetics 65:6, 490-495
CrossRef125
Xavier Dray, Thierry Bienvenu, Nadine Desmazes—dufeu, Daniel Dusser, Philippe Marteau, Dominique Hubert. (2004) Distal intestinal obstruction syndrome in adults with cystic fibrosis. Clinical Gastroenterology and Hepatology 2:6, 498-503
CrossRef126
Franco Pagani, Francisco E. Baralle. (2004) Opinion: Genomic variants in exons and introns: identifying the splicing spoilers. Nature Reviews Genetics 5:5, 389-396
CrossRef127
Charles M. Strom, Beryl Crossley, Joy B. Redman, Arlene Buller, Franklin Quan, Mei Peng, Matthew McGinnis, Weimin Sun. (2004) Cystic fibrosis screening: Lessons learned from the first 320,000 patients. Genetics in Medicine 6:3, 136-140
CrossRef128
Kristin G. Monaghan, Denise Bluhm, Michelle Phillips, Gerald L. Feldman. (2004) Preconception and prenatal cystic fibrosis carrier screening of African Americans reveals unanticipated frequencies for specific mutations. Genetics in Medicine 6:3, 141-144
CrossRef129
Satoru Naruse, Hiroshi Ishiguro, Yasufumi Suzuki, Kotoyo Fujiki, Shigeru B.H. Ko, Nobumasa Mizuno, Toshihiro Takemura, Akiko Yamamoto, Toshiyuki Yoshikawa, Chunxiang Jin, Ryujiro Suzuki, Motoji Kitagawa, Takao Tsuda, Takaharu Kondo, Tetsuo Hayakawa. (2004) A Finger Sweat Chloride Test for the Detection of a High-Risk Group of Chronic Pancreatitis. Pancreas 28:3, e80-e85
CrossRef130
Dominique Hubert, Isabelle Fajac, Thierry Bienvenu, Nadine Desmazes-Dufeu, Madiha Ellaffi, Josette Dall'Ava-Santucci, Daniel Dusser. (2004) Diagnosis of cystic fibrosis in adults with diffuse bronchiectasis. Journal of Cystic Fibrosis 3:1, 15-22
CrossRef131
R. Gazvani, D. I. Lewis-Jones. (2004) Cystic fibrosis mutation screening before assisted reproduction. International Journal of Andrology 27:1, 1-4
CrossRef132
J GROMAN, T HEFFERON, T CASALS, L BASSAS, X ESTIVILL, M DESGEORGES, C GUITTARD, M KOUDOVA, M FALLIN, K NEMETH. (2004) Variation in a Repeat Sequence Determines Whether a Common Variant of the Cystic Fibrosis Transmembrane Conductance Regulator Gene Is Pathogenic or Benign. The American Journal of Human Genetics 74:1, 176-179
CrossRef133
Raffaele Pezzilli, Antonio Maria Morselli-Labate, Vilma Mantovani, Elisabetta Romboli, Paola Selva, Marina Migliori, Roberto Corinaldesi, Lucio Gullo. (2003) Mutations of the CFTR Gene in Pancreatic Disease. Pancreas 27:4, 332-336
CrossRef134
Michael Dean. (2003) Approaches to identify genes for complex human diseases: Lessons from Mendelian disorders. Human Mutation 22:4, 261-274
CrossRef135
Véronique Morinville, Jean Perrault. (2003) Genetic disorders of the pancreas. Gastroenterology Clinics of North America 32:3, 763-787
CrossRef136
Lawrence C Layman. (2003) Genetic causes of human infertility. Endocrinology & Metabolism Clinics of North America 32:3, 549-572
CrossRef137
DG Cruger, I Agerholm, L Byriel, J Fedder, G Bruun-Petersen. (2003) Genetic analysis of males from intracytoplasmic sperm injection couples. Clinical Genetics 64:3, 198-203
CrossRef138
Lorna S. Timmreck, Mark R. Gray, Barbara Handelin, Bernice Allito, Elizabeth Rohlfs, Ann J. Davis, Gita Gidwani, Richard H. Reindollar. (2003) Analysis of cystic fibrosis transmembrane conductance regulator gene mutations in patients with congenital absence of the uterus and vagina. American Journal of Medical Genetics 120A:1, 72-76
CrossRef139
Beryl J. Rosenstein. (2003) Nonclassic cystic fibrosis: A clinical conundrum. Pediatric Pulmonology 36:1, 10-12
CrossRef140
Véronique Drouineaud, Paul Sagot, Laurence Faivre, Frédéric Michel, Clément Jimenez. (2003) Birth after intracytoplasmic injection of epididymal sperm from a man with congenital bilateral absence of the vas deferens who had a robertsonian translocation. Fertility and Sterility 79, 1649-1651
CrossRef141
RMS Mitchell, MF Byrne, J Baillie. (2003) Pancreatitis. The Lancet 361:9367, 1447-1455
CrossRef142
L Frulloni, C Castellani, P Bovo, B Vaona, B Calore, C Liani, G Mastella, G Cavallini. (2003) Natural history of pancreatitis associated with cystic fibrosis gene mutations. Digestive and Liver Disease 35:3, 179-185
CrossRef143
J Devaney, M Glennon, G Farrell, M Ruttledge, T Smith, JA Houghton, M Maher. (2003) Cystic fibrosis mutation frequencies in an Irish population. Clinical Genetics 63:2, 121-125
CrossRef144
Lucas L. Kulczycki, Marzena Kostuch, Joseph A. Bellanti. (2003) A clinical perspective of cystic fibrosis and new genetic findings: Relationship of CFTR mutations to genotype-phenotype manifestations. American Journal of Medical Genetics 116A:3, 262-267
CrossRef145
Raymonda Varon, Claudia Schoch, André Reis, Wolfgang Hiddemann, Karl Sperling, Susanne Schnittger. (2003) Mutation Analysis of the Nijmegen Breakage Syndrome Gene (<emph type="2">NBS1</emph>) in Nineteen Patients with Acute Myeloid Leukemia with Complex Karyotypes. Leukemia & Lymphoma 44:11, 1931-1934
CrossRef146
Steven P. Conway, Daniel G. Peckham, Carol E. Chu, Lucy A. Ellis, Mushtaq Ahmed, Graham R. Taylor. (2002) Cystic fibrosis presenting as acute pancreatitis and obstructive azoospermia in a young adult male with a novel mutation in the CFTR gene. Pediatric Pulmonology 34:6, 491-495
CrossRef147
Mehmet Okyay K?l?n
CrossRef148
Hiroyasu Tsukaguchi, Akulapalli Sudhakar, Tu Cam Le, Trang Nguyen, Jun Yao, Joshua A. Schwimmer, Asher D. Schachter, Esteban Poch, Patricia F. Abreu, Gerald B. Appel, Aparecido B. Pereira, Raghu Kalluri, Martin R. Pollak. (2002) NPHS2 mutations in late-onset focal segmental glomerulosclerosis: R229Q is a common disease-associated allele. Journal of Clinical Investigation 110:11, 1659-1666
CrossRef149
Carolyn Sue Richards, Linda A. Bradley, Jean Amos, Bernice Allitto, Wayne W. Grody, Anne Maddalena, Matthew J. McGinnis, Thomas W. Prior, Bradley W. Popovich, Michael S. Watson. (2002) Standards and Guidelines for CFTR Mutation Testing. Genetics in Medicine 4:5, 379-391
CrossRef150
Knowles, Michael R., , Durie, Peter R., . (2002) What Is Cystic Fibrosis?. New England Journal of Medicine 347:6, 439-442
Full Text151
Timothy W. Hefferon, Fiona C. Broackes-Carter, Ann Harris, Garry R. Cutting. (2002) Atypical 5′ Splice Sites Cause CFTR Exon 9 To Be Vulnerable to Skipping. The American Journal of Human Genetics 71:2, 294-303
CrossRef152
Francesco Salvatore, Olga Scudiero, Giuseppe Castaldo. (2002) Genotype-phenotype correlation in cystic fibrosis: The role of modifier genes. American Journal of Medical Genetics 111:1, 88-95
CrossRef153
J Andrieux, MP Audrézet, I Frachon, C Leroyer, C Roge, V Scotet, C Férec. (2002) Quantification of CFTR splice variants in adults with disseminated bronchiectasis, using the TaqMan fluorogenic detection system. Clinical Genetics 62:1, 60-67
CrossRef154
Michael O. Stormon, Peter R. Durie. (2002) Pathophysiologic Basis of Exocrine Pancreatic Dysfunction in Childhood. Journal of Pediatric Gastroenterology and Nutrition 35:1, 8-21
CrossRef155
Charles M. Strom, Donghui Huang, Arlene Buller, Joy Redman, Beryl Crossley, Ben Anderson, Tom Entwistle, Weimin Sun. (2002) Cystic fibrosis screening using the College panel:. Genetics in Medicine 4:4, 289-296
CrossRef156
C. Schaedel, I. de Monestrol, L. Hjelte, M. Johannesson, R. Kornf
CrossRef157
JONATHAN P. JAROW, IRA D. SHARLIP, ARNOLD M. BELKER, LARRY I. LIPSHULTZ, MARK SIGMAN, ANTHONY J. THOMAS, PETER N. SCHLEGEL, STUART S. HOWARDS, AJAY NEHRA, MARIAN D. DAMEWOOD, JAMES W. OVERSTREET, RICHARD SADOVSKY. (2002) Best Practice Policies for Male Infertility. The Journal of Urology2138-2144
CrossRef158
François Robert, Faı̈za Bey-Omar, Jacques Rollet, Jean-François Lapray, Yves Morel. (2002) Relation between the anatomical genital phenotype and cystic fibrosis transmembrane conductance regulator gene mutations in the absence of the vas deferens. Fertility and Sterility 77:5, 889-896
CrossRef159
Antony E Shrimpton. (2002) Molecular diagnosis of cystic fibrosis. Expert Review of Molecular Diagnostics 2:3, 240-256
CrossRef160
Ira D Sharlip, Jonathan P Jarow, Arnold M Belker, Larry I Lipshultz, Mark Sigman, Anthony J Thomas, Peter N Schlegel, Stuart S Howards, Ajay Nehra, Marian D Damewood, James W Overstreet, Richard Sadovsky. (2002) Best practice policies for male infertility. Fertility and Sterility 77:5, 873-882
CrossRef161
JONATHAN P. JAROW, IRA D. SHARLIP, ARNOLD M. BELKER, LARRY I. LIPSHULTZ, MARK SIGMAN, ANTHONY J. THOMAS, PETER N. SCHLEGEL, STUART S. HOWARDS, AJAY NEHRA, MARIAN D. DAMEWOOD, JAMES W. OVERSTREET, RICHARD SADOVSKY. (2002) Best Practice Policies for Male Infertility. The Journal of Urology 167:5, 2138-2144
CrossRef162
T. E. Eaton, P. Weiner Miller, J. E. Garrett, G. R. Cutting. (2002) Cystic fibrosis transmembrane conductance regulator gene mutations: do they play a role in the aetiology of allergic bronchopulmonary aspergillosis?. Clinical <html_ent glyph="@amp;" ascii="&"/> Experimental Allergy 32:5, 756-761
CrossRef163
(2002) Classification of cystic fibrosis and related disorders. Journal of Cystic Fibrosis 1:1, 5-8
CrossRef164
Beryl J. Rosenstein. (2002) Cystic fibrosis diagnosis: New dilemmas for an old disorder. Pediatric Pulmonology 33:2, 83-84
CrossRef165
Jelena Kusic, Dragica Radojkovic, Vinka Maletic-Vukotic, Snezana Brankovic, Ana Savic. (2002) Screening of mutations and polymorphism in CFRT gene in men infertile due to oligo- or azospermia. Srpski arhiv za celokupno lekarstvo 130:1-2, 1-6
CrossRef166
M. Claustres. (2001) Les génotypes responsables de mucoviscidose ou d’absence bilatérale des canaux déférents ABCD. Andrologie 11:4, 195-203
CrossRef167
Peadar G. Noone, Zhaoqing Zhou, Lawrence M. Silverman, Paul S. Jowell, Michael R. Knowles, Jonathan A. Cohn. (2001) Cystic fibrosis gene mutations and pancreatitis risk: Relation to epithelial ion transport and trypsin inhibitor gene mutations. Gastroenterology 121:6, 1310-1319
CrossRef168
Rebecca Z. Sokol. (2001) Infertility in men with cystic fibrosis. Current Opinion in Pulmonary Medicine 7:6, 421-426
CrossRef169
David M. Nudell, Larry I. Lipshultz. (2001) Is intracytoplasmic sperm injection safe? Current status and future concerns. Current Urology Reports 2:6, 423-431
CrossRef170
Ania Manson, Clare Huxley. (2001) Skipping of Exon 9 of Human CFTR in YAC-Transgenic Mice. Genomics 77:3, 127-134
CrossRef171
C. Castellani, C. Quinzii, S. Altieri, G. Mastella, B.M. Assael. (2001) A Pilot Survey of Cystic Fibrosis Clinical Manifestations in CFTR Mutation Heterozygotes. Genetic Testing 5:3, 249-254
CrossRef172
M. Ravnik-Glavač, N. Svetina, B. Zorn, B. Peterlin, D. Glavač. (2001) Involvement of CFTR Gene Alterations in Obstructive and Nonobstructive Infertility in Men. Genetic Testing 5:3, 243-247
CrossRef173
F. Robert, F. Bey-Omar, J. Rollet, J. F. Lapray, Y. Morel. (2001) Absence de corrélation génotype-phénotype dans les absences de canaux déférents. Andrologie 11:2, 21-32
CrossRef174
Tiziana Attardo, Enzo Vicari, Florindo Mollica, Caterina Grazioso, Nunziatina Burrello, Maria R. Garofalo, Maria N. Lizzio, Gabriella Garigali, Matteo Cannizzaro, Giovanni Ruvolo, Rosario D'Agata, Aldo E. Calogero. (2001) Genetic, andrological and clinical characteristics of patients with congenital bilateral absence of the vas deferens. International Journal of Andrology 24:2, 73-79
CrossRef175
Wayne W. Grody, Robert J. Desnick. (2001) Cystic fibrosis population carrier screening: Here at last???Are we ready?. Genetics in Medicine 3:2, 87-90
CrossRef176
Wayne W. Grody, Garry R. Cutting, Katherine W. Klinger, Carolyn Sue Richards, Michael S. Watson, Robert J. Desnick. (2001) Laboratory standards and guidelines for population-based cystic fibrosis carrier screening. Genetics in Medicine 3:2, 149-154
CrossRef177
M. V. Meng. (2001) Impaired spermatogenesis in men with congenital absence of the vas deferens. Human Reproduction 16:3, 529-533
CrossRef178
K.G. Monaghan, G.L. Feldman, G.M. Barbarotto, S. Manji, T.K. Desai, K. Snow. (2000) Frequency and clinical significance of the S1235R mutation in the cystic fibrosis transmembrane conductance regulator gene: Results from a collaborative study. American Journal of Medical Genetics 95:4, 361-365
CrossRef179
Myriam Daudin, Eric Bieth, Louis Bujan, Gérard Massat, Francis Pontonnier, Roger Mieusset. (2000) Congenital bilateral absence of the vas deferens: clinical characteristics, biological parameters, cystic fibrosis transmembrane conductance regulator gene mutations, and implications for genetic counseling. Fertility and Sterility 74:6, 1164-1174
CrossRef180
C HOGENAUER, C SANTAANA, J PORTER, M MILLARD, A GELFAND, R ROSENBLATT, C PRESTIDGE, J FORDTRAN. (2000) Active Intestinal Chloride Secretion in Human Carriers of Cystic Fibrosis Mutations: An Evaluation of the Hypothesis That Heterozygotes Have Subnormal Active Intestinal Chloride Secretion. The American Journal of Human Genetics 67:6, 1422-1427
CrossRef181
L LAYMAN. (2000) ESSENTIAL GENETICS FOR THE OBSTETRICIAN/GYNECOLOGIST. Obstetrics and Gynecology Clinics of North America 27:3, 555-566
CrossRef182
Mireille Claustres, Caroline Guittard, Dominique Bozon, Fran
CrossRef183
Andrew Bush, Colin Wallis. (2000) Time to think again: Cystic fibrosis is not an ?all or none? disease. Pediatric Pulmonology 30:2, 139-144
CrossRef184
C. Arduino, E. Gaia. (2000) Genetics of chronic pancreatitis. Biomedicine & Pharmacotherapy 54:7, 394-399
CrossRef185
Sigrid von Eckardstein, Trevor G Cooper, Kai Rutscha, Dieter Meschede, Jürgen Horst, Eberhard Nieschlag. (2000) Seminal plasma characteristics as indicators of cystic fibrosis transmembrane conductance regulator (CFTR) gene mutations in men with obstructive azoospermia. Fertility and Sterility 73:6, 1226-1231
CrossRef186
Timothy B Hargreave. (2000) Genetics and male infertility. Current Opinion in Obstetrics and Gynecology 12:3, 207-219
CrossRef187
John E. Mickle, Garry R. Cutting. (2000) GENOTYPE-PHENOTYPE RELATIONSHIPS IN CYSTIC FIBROSIS. Medical Clinics of North America 84:3, 597-607
CrossRef188
Jonathan A. Cohn, Jeffrey D. Bornstein, Paul S. Jowell. (2000) CYSTIC FIBROSIS MUTATIONS AND GENETIC PREDISPOSITION TO IDIOPATHIC CHRONIC PANCREATITIS. Medical Clinics of North America 84:3, 621-631
CrossRef189
John E. Mickle, MichałI. Milewski, Milan Macek, Garry R. Cutting. (2000) Effects of Cystic Fibrosis and Congenital Bilateral Absence of the Vas Deferens–Associated Mutations on Cystic Fibrosis Transmembrane Conductance Regulator–Mediated Regulation of Separate Channels. The American Journal of Human Genetics 66:5, 1485-1495
CrossRef190
de Kretser, O'Bryan, Cram, McLachlan. (2000) Expanding our understanding of spermatogenesis: the future genetic tests for infertility. International Journal of Andrology 23:S2, 30-33
CrossRef191
M. Stuhrmann, T. Dork. (2000) CFTR gene mutations and male infertility. Andrologia 32:2, 71-83
CrossRef192
Emmanuelle Girodon-Boulandet, C
CrossRef193
Ingrid Reynaert, Bernadette Van Der Schueren, Gis
CrossRef194
W.-H. Weiske, N. Salzler, I. Schroeder-Printzen, W. Weidner. (2000) Clinical findings in congenital absence of the vasa deferentia. Andrologia 32:1, 13-18
CrossRef195
Conxi L
CrossRef196
C. Castellani, A. Bonizzato, U. Pradal, M. Filicori, C. Foresta, G.B. La Sala, G. Mastella. (1999) Evidence of mild respiratory disease in men with congential absence of the vas deferens. Respiratory Medicine 93:12, 869-875
CrossRef197
C Arduino, M Gallo, A Brusco, S Garnerone, Mr Piana, S Di Maggio, G Gerbino Promis, M Ferrone, A Angeli, E Gaia. (1999) Polyvariant mutant CFTR genes in patients with chronic pancreatitis. Clinical Genetics 56:5, 401-405
CrossRef198
Begoña Aran, Joan Blanco, Francesca Vidal, Josep Ma Vendrell, Susana Egozcue, Pere N Barri, Josep Egozcue, Anna Veiga. (1999) Screening for abnormalities of chromosomes X, Y, and 18 and for diploidy in spermatozoa from infertile men participating in an in vitro fertilization-intracytoplasmic sperm injection program. Fertility and Sterility 72:4, 696-701
CrossRef199
Suresh T. Chari, Eugene P. DiMagno. (1999) Chronic pancreatitis. Current Opinion in Gastroenterology 15:5, 398
CrossRef200
C.P. Choudari, Glen A. Lehman, Stuart Sherman. (1999) PANCREATITIS AND CYSTIC FIBROSIS GENE MUTATIONS. Gastroenterology Clinics of North America 28:3, 543-549
CrossRef201
Peter A. Merkel. (1999) Rheumatic disease and cystic fibrosis. Arthritis & Rheumatism 42:8, 1563-1571
CrossRef202
Claude Danan, Damien Sternberg, André Van Steirteghem, Cécile Cazeneuve, Philippe Duquesnoy, Claude Besmond, Michel Goossens, Willy Lissens, Serge Amselem. (1999) Evaluation of Parental Mitochondrial Inheritance in Neonates Born after Intracytoplasmic Sperm Injection. The American Journal of Human Genetics 65:2, 463-473
CrossRef203
Jonathan A. Cohn, Paul S. Jowell. (1999) ARE MUTATIONS IN THE CYSTIC FIBROSIS GENE IMPORTANT IN CHRONIC PANCREATITIS?. Surgical Clinics of North America 79:4, 723-731
CrossRef204
C. Castellani, A. Bonizzato, R. Rolfini, L. Frulloni, G. C. Cavallini, G. Mastella. (1999) Increased Prevalence of Mutations of the Cystic Fibrosis Gene in Idiopathic Chronic and Recurrent Pancreatitis. The American Journal of Gastroenterology 94:7, 1993-1995
CrossRef205
(1999) Correction: Mutations of the Cystic Fibrosis Gene in Patients with Chronic Pancreatitis. New England Journal of Medicine 340:20, 1592-1593
Full Text206
Jeffrey D. Bornstein, Jonathan A. Cohn. (1999) Cystic fibrosis in the pancreas: Recent advances provide new insights. Current Gastroenterology Reports 1:2, 161-165
CrossRef207
HIROSHI OKADA, KUNIHIKO YOSHIMURA, HITOSHI FUJIOKA, NOBORU TATSUMI, AKINOBU GOTOH, MASATO FUJISAWA, KAZUO GOHJI, SOICHI ARAKAWA, HIROSHI KATO, SHIN-ICHIRO KOBAYASHI, SHINZO ISOJIMA, MITSUNOBU KOSHIDA, SADAO KAMIDONO. (1999) ASSISTED REPRODUCTION TECHNOLOGY FOR PATIENTS WITH CONGENITAL BILATERAL ABSENCE OF VAS DEFERENS. The Journal of Urology 161:4, 1157-1162
CrossRef208
Paul S. Haber, Murray D. Norris, Minoti V. Apte, Sally C. Rodgers, Ian D. Norton, Romano C. Pirola, Ian C. Roberts-Thomson, Jeremy S. Wilson. (1999) Alcoholic Pancreatitis and Polymorphisms of the Variable Length Polythymidine Tract in the Cystic Fibrosis Gene. Alcoholism: Clinical and Experimental Research 23:3, 509-512
CrossRef209
Ana Gafanovich, Nili Ramu, Svetlana Krichevsky, Jakob Pe'er, Gail Amir, Dina Ben-Yehuda. (1999) Microsatellite instability and p53 mutations in pediatric secondary malignant neoplasms. Cancer 85:2, 504-510
CrossRef210
S. Castellv
CrossRef211
Tuncer Onay, Hulya Kayserili, Memnune Yuksel Apak, Betul Kirdar. (1999) Analysis of infertile brothers with congenital bilateral absence of vas deferens for mutations in the CFTR gene. Clinical Genetics 55:1, 63-64
CrossRef212
C. Castellani, M.G. Benetazzo, A. Bonizzato, P.F. Pignatti, G. Mastella. (1999) Cystic Fibrosis Mutations in Heterozygous Newborns with Hypertrypsinemia and Low Sweat Chloride. The American Journal of Human Genetics 64:1, 303-304
CrossRef213
Edward D. Kim, Farideh Z. Bischoff, Larry I. Lipshultz, Dolores J. Lamb. (1998) Genetic concerns for the subfertile male in the era of ICSI. Prenatal Diagnosis 18:13, 1349-1365
CrossRef214
B.F.J. Thielemans, C. Spiessens, T. D'Hooghe, D. Vanderschueren, E. Legius. (1998) Genetic abnormalities and male infertility. A comprehensive review.. European Journal of Obstetrics & Gynecology and Reproductive Biology 81:2, 217-225
CrossRef215
Timothy Bruce Hargreave, Chhanda Ghosh, Howard Cooke. (1998) Genetics of male infertility. Molecular and Cellular Endocrinology 145:1-2, 143-151
CrossRef216
Keith Jarvi, Stewart McCallum, Julian Zielenski, Peter Durie, Elizabeth Tullis, Michael Wilchanski, Myles Margolis, Murray Asch, Brian Ginzburg, Sheelagh Martin, Martin B Buckspan, Lap-Chee Tsui. (1998) Heterogeneity of reproductive tract abnormalities in men with absence of the vas deferens: role of cystic fibrosis transmembrane conductance regulator gene mutations. Fertility and Sterility 70:4, 724-728
CrossRef217
Cohn, Jonathan A., Friedman, Kenneth J., Noone, Peadar G., Knowles, Michael R., Silverman, Lawrence M., Jowell, Paul S., . (1998) Relation between Mutations of the Cystic Fibrosis Gene and Idiopathic Pancreatitis. New England Journal of Medicine 339:10, 653-658
Full Text218
Sharer, Nicholas, Schwarz, Martin, Malone, Geraldine, Howarth, Andrea, Painter, John, Super, Maurice, Braganza, Joan, . (1998) Mutations of the Cystic Fibrosis Gene in Patients with Chronic Pancreatitis. New England Journal of Medicine 339:10, 645-652
Full Text219
Beryl J. Rosenstein. (1998) WHAT IS A CYSTIC FIBROSIS DIAGNOSIS?. Clinics in Chest Medicine 19:3, 423-441
CrossRef220
John E. Mickle, Garry R. Cutting. (1998) CLINICAL IMPLICATIONS OF CYSTIC FIBROSIS TRANSMEMBRANE CONDUCTANCE REGULATOR MUTATIONS. Clinics in Chest Medicine 19:3, 443-458
CrossRef221
D Meschede, B Dworniczak, E Nieschlag, J Horst. (1998) Genetic diseases of the seminal ducts. Biomedicine & Pharmacotherapy 52:5, 197-203
CrossRef222
C. Schaedel, A-M Andersson, A-C Kristoffersson, R. Kornfält, L. Lannefors, L. Holmberg. (1998) Mild cystic fibrosis mutations in Southern Sweden with special reference to S549I and T338I. Clinical Genetics 53:5, 383-386
CrossRef223
Wayne W. Grody, Robert J. Desnick, Nancy J. Carpenter, Walter W. Noll. (1998) Diversity of Cystic Fibrosis Mutation-Screening Practices. The American Journal of Human Genetics 62:5, 1252-1254
CrossRef224
Morten Dahl, Anne Tybjærg-Hansen, Hans H Wittrup, Peter Lange, Børge G Nordestgaard. (1998) Cystic Fibrosis ΔF508 Heterozygotes, Smoking, and Reproduction: Studies of 9141 Individuals from a General Population Sample. Genomics 50:1, 89-96
CrossRef225
C. Arduino, M. Ferrone, A. Brusco, S. Garnerone, D. Fontana, L. Rolle, AO Carbonara. (1998) Congenital bilateral absence of vas deferens with a new missense mutation (P499A) in the CFTR gene. Clinical Genetics 53:3, 202-204
CrossRef226
Anne de Meeus, Caroline Guittard, Marie Desgeorges, Soukeyna Carles, Jacques Demaille, Mireille Claustres. (1998) Genetic findings in congenital bilateral aplasia of vas deferens patients and identification of six novel mutations. Human Mutation 11:6, 480-480
CrossRef227
Peter K. Rogan, Brian M. Faux, Thomas D. Schneider. (1998) Information analysis of human splice site mutations. Human Mutation 12:3, 153-171
CrossRef228
Beryl J Rosenstein, Pamela L Zeitlin. (1998) Cystic fibrosis. The Lancet 351:9098, 277-282
CrossRef229
Bettina C Hilman. (1997) Genetic and Immunologic Aspects of Cystic Fibrosis. Annals of Allergy, Asthma & Immunology 79:5, 379-394
CrossRef230
David Shin, Fred Gilbert, Marc Goldstein, Peter N. Schlegel. (1997) CONGENITAL ABSENCE OF THE VAS DEFERENS: INCOMPLETE PENETRANCE OF CYSTIC FIBROSIS GENE MUTATIONS. The Journal of Urology 158:5, 1794-1799
CrossRef231
Dominique A. Gaillard, Frederique Carre-Pigeon, Aude Lallemand. (1997) NORMAL VAS DEFERENS IN FETUSES WITH CYSTIC FIBROSIS. The Journal of Urology 158:4, 1549-1552
CrossRef232
Dominique A. Gaillard, Frederique Carre-Pigeon, Aude Lallemand. (1997) NORMAL VAS DEFERENS IN FETUSES WITH CYSTIC FIBROSIS. The Journal of Urology1549-1552
CrossRef233
P. Wieacker, S. Jakubiczka. (1997) Genetic causes of male infertility. Andrologia 29:2, 63-69
CrossRef234
DM de Kretser. (1997) Male infertility. The Lancet 349:9054, 787-790
CrossRef235
Stern, Robert C., . (1997) The Diagnosis of Cystic Fibrosis. New England Journal of Medicine 336:7, 487-491
Full Text236
I Durieu, F Bey-Omar, J Rollet, D Boggio, G Bellon, Y Morel, D Vital Durand. (1997) Stérilité masculine par agénésie bilatérale des canaux déférents: une nouvelle forme clinique de mucoviscidose?. La Revue de Médecine Interne 18:2, 114-118
CrossRef237
Kenneth J. Friedman, Ruth A. Heim, Michael R. Knowles, Lawrence M. Silverman. (1997) Rapid characterization of the variable length polythymidine tract in the cystic fibrosis (CFTR) gene: Association of the 5T allele with selected CFTR mutations and its incidence in atypical sinopulmonary disease. Human Mutation 10:2, 108-115
CrossRef238
T Casals, P Pacheco, C Barreto, J Giménez, MD Ramos, S Pereira, JA Pinheiro, N Cobos, A Curvelo, C Vázquez, H Rocha, JL Séculi, E Pérez, J Dapena, E Carrilho, A Duarte, AM Palacio, V Nunes, J Lavinha, X Estivill. (1997) Missense mutation R1066C in the second transmembrane domain of CFTR causes a severe cystic fibrosis phenotype: Study of 19 heterozygous and 2 homozygous patients. Human Mutation 10:5, 387-392
CrossRef239
Eitan Kerem, Batsheva Kerem. (1996) Genotype-phenotype correlations in cystic fibrosis. Pediatric Pulmonology 22:6, 387-395
CrossRef240
Victor Mak, Keith A. Jarvi. (1996) The Genetics of Male Infertility. The Journal of Urology 156:4, 1245-1257
CrossRef241
Victor Mak, Keith A. Jarvi. (1996) The Genetics of Male Infertility. The Journal of Urology1245-1256
CrossRef242
Thilo Dörk, Manfred Stuhrmann. (1996) Molekularbiologie der Mukoviszidose. Biologie in unserer Zeit 26:5, 282-291
CrossRef243
Jae H. Kim, William J. Cromie. (1996) Congenital Bilateral Absence of the Vas Deferens and Cryptorchidism Without Cystic Fibrosis. The Journal of Urology2060
CrossRef244
Jae H. Kim, William J. Cromie. (1996) Congenital Bilateral Absence of the Vas Deferens and Cryptorchidism Without Cystic Fibrosis. The Journal of Urology 155:6, 2060
CrossRef245
Lee Anne Matthews, Carl F. Doershuk, Robert C. Stern, Martin I. Resnick. (1996) Urolithiasis and Cystic Fibrosis. The Journal of Urology 155:5, 1563-1564
CrossRef246
Lee Anne Matthews, Carl F. Doershuk, Robert C. Stern, Martin I. Resnick. (1996) Urolithiasis and Cystic Fibrosis. The Journal of Urology1563-1564
CrossRef247
Peter N. Schlegel, David Shin, Marc Goldstein. (1996) Urogenital Anomalies in Men with Congenital Absence of the Vas Deferens. The Journal of Urology 155:5, 1644-1648
CrossRef248
Peter N. Schlegel, David Shin, Marc Goldstein. (1996) Urogenital Anomalies in Men with Congenital Absence of the Vas Deferens. The Journal of Urology1644-1648
CrossRef249
Xavier Estivill. (1996) Complexity in a monogenic disease. Nature Genetics 12:4, 348-350
CrossRef250
J.A. Dodge. (1995) Male fertility in cystic fibrosis. The Lancet 346:8975, 587-588
CrossRef
